Use of immune suppressive domains as medicaments

Abstract

The present invention concerns uses of immune suppressive domains. In particular, the present invention concerns a use of an immune suppressive domain (ISD) for immune suppression and for reduction of inflammation.

Claims

1. A method for relieving, alleviating, ameliorating, and/or reducing the susceptibility of an autoimmune disease, the method comprising the step of administering to a subject in need thereof a pharmaceutical composition comprising an immune suppressive domain from a virus fusion protein as an active substance, wherein said immune suppressive domain is from a virus of the Orthomyxoviridae family, and wherein said autoimmune disease is selected from the group consisting of acute disseminated encephalomyelitis (ADEM), Addison's disease, amyotrophic lateral sclerosis, ankylosing spondylodiscitis, antiphospholipid syndrome, autoimmune uveitis, celiac disease, chronic obstructive pulmonary disease, Churg-Strauss syndrome, Crohn's disease, Cushing's Syndrome, diabetes mellitus type 1, drug-induced lupus, discoid lupus erythematosus, glomerulonephritis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome (GBS), Hashimoto's encephalopathy, Hashimoto's thyroiditis, Henoch-Schonlein purpura, idiopathic thrombocytopenic purpura, IgA nephropathy, juvenile idiopathic arthritis, Kawasaki's disease, linear IgA disease (LAD), lupoid hepatitis, lupus erythematosus, Miller-Fisher syndrome, mixed connective tissue disease, multiple sclerosis, Myasthenia gravis, myositis, narcolepsy, neuromyelitis optica, neuromyotonia, paroxysmal nocturnal hemoglobinuria (PNH), pemphigus vulgaris, pernicious anaemia, polyarteritis nodosa, polymyalgia rheumatica, polymyositis, primary biliary cirrhosis, primary sclerosing cholangitis, psoriasis, psoriatic arthritis, pyoderma gangrenosum, pure red cell aplasia, Raynaud phenomenon, relapsing polychondritis, Reiter's syndrome, restless leg syndrome, retroperitoneal fibrosis, rheumatoid arthritis, rheumatic fever, sarcoidosis, schizophrenia, scleritis, scleroderma, serum sickness, Sjögren's syndrome, spondyloarthropathy, Still's disease, Sweet's syndrome, systemic lupus erythematosus, Takayasu's arteritis, temporal arteritis, thrombocytopenia, transverse myelitis, ulcerative colitis, vasculitis, vitiligo, and Wegener's granulomatosis.

2. The method according to claim 1, wherein said autoimmune disease is selected from the group consisting of drug-induced lupus, discoid lupus erythematosus, lupus erythematosus, rheumatoid arthritis, scleroderma, Sjögren's syndrome, and systemic lupus erythematosus.

3. The method according to claim 1, wherein said autoimmune disease is systemic lupus erythematosus.

4. The method according to claim 1, wherein said pharmaceutical composition further comprises at least one carrier.

5. The method according to claim 1, wherein said pharmaceutical composition is administered subcutaneously or parenterally.

6. The method according to claim 1, wherein said immune suppressive domain is from a virus of the Influenza virus A genus.

7. The method according to claim 1, wherein said immune suppressive domain comprises SEQ ID NO: 4.

8. The method according to claim 1, wherein said immune suppressive domain comprises SEQ ID NO: 287.

9. The method according to claim 1, wherein said immune suppressive domain is connected to at least one additional immune suppressive domain to form a dimer.

10. The method according to claim 9, wherein said dimer is homologous and comprises at least two immune suppressive domains with SEQ ID NO. 4, wherein said immune suppressive domains are cross-linked by a disulfide bond at the N-terminal or the C-terminal.

11. The method according to claim 7, wherein said autoimmune disease is selected from the group consisting of drug-induced lupus, discoid lupus erythematosus, lupus erythematosus, rheumatoid arthritis, scleroderma, Sjögren's syndrome, and systemic lupus erythematosus.

12. The method according to claim 7, wherein said autoimmune disease is systemic lupus erythematosus.

13. The method according to claim 7, wherein said pharmaceutical composition further comprises at least one carrier.

14. The method according to claim 7, wherein said pharmaceutical composition is administered subcutaneously or parenterally.

15. The method according to claim 7, wherein said immune suppressive domain is connected to at least one additional immune suppressive domain to form a dimer.

16. The method according to claim 15, wherein said dimer is homologous and comprises at least two immune suppressive domains with SEQ ID NO. 4, wherein said immune suppressive domains are cross-linked by a disulfide bond at the N-terminal or the C-terminal.

17. The method according to claim 8, wherein said autoimmune disease is selected from the group consisting of drug-induced lupus, discoid lupus erythematosus, lupus erythematosus, rheumatoid arthritis, scleroderma, Sjögren's syndrome, and systemic lupus erythematosus.

18. The method according to claim 8, wherein said autoimmune disease is systemic lupus erythematosus.

19. The method according to claim 8, wherein said pharmaceutical composition further comprises at least one carrier.

20. The method according to claim 8, wherein said pharmaceutical composition is administered subcutaneously or parenterally.

21. The method according to claim 8, wherein said immune suppressive domain is connected to at least one additional immune suppressive domain to form a dimer.

22. The method according to claim 21, wherein said dimer is homologous and comprises at least two immune suppressive domains with SEQ ID NO. 4, wherein said immune suppressive domains are cross-linked by a disulfide bond at the N-terminal or the C-terminal.

Description

FIGURES

(1) INF ISD peptide is identical to INF-F#2 and are dimeric form of the peptide with the sequence [Seq id 287] GLFGAIAGFIENGWEGCGGEKEKEK

(2) FIG. 1 shows the effect of the INF ISD peptide on TNF-alpha mRNA levels.

(3) FIG. 2 shows the effect of peptide incubation on secreted TNF-alpha levels in the supernatant of THP-1 cells.

(4) FIG. 3 shows the effect of the INF ISD peptide on IL-1 beta mRNA levels in THP-1 cells.

(5) FIG. 4 shows the effect of the INF ISD peptide on IL-6 mRNA levels in THP-1 cells.

(6) FIG. 5 shows the effect of the INF ISD peptide on IL-8 mRNA levels in THP-1 cells.

(7) FIG. 6 shows the effect of the INF ISD peptide on IL-10 mRNA levels in THP-1 cells.

(8) FIG. 7 shows the effect of the INF ISD peptide on NF-kappa B mRNA levels in THP-1 cells.

(9) FIG. 8 shows the effect of the INF ISD peptide on the house holding gene RPL13a mRNA levels in THP-1 cells.

(10) FIG. 9 shows that in the presence of INF F#2, cells treated with LPS release significantly lower amounts of cytokines.

(11) BMDCs were treated with LPS for 16 hours. Cell supernatants were then collected and analyzed for type I IFN using bioassay. Before LPS treatment cells were either pretreated with INF F#2, with the deletion mutant D16 or not pretreated with any peptide.

(12) FIG. 10 shows inflammation-related enzyme and transcription factor gene expression kinetics of THP-1 monocytes stimulated with 1 μg/ml LPS. Gene expression was expressed as relative gene expression towards RPL13a-expression and non-stimulated cells at time zero (AACt). Data shown are means+standard deviation from two independent biological replications.

(13) FIG. 11 shows effects of INF ISD peptide on expression of NF-kappaB mRNA in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM, 60 μM INF ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the medians±standard deviation from two independent biological replications.

(14) FIG. 12 shows effects of INF ISD peptide on expression of SP-1 mRNA in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM, 60 μM INF ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the medians±standard deviation from two independent biological replications.

(15) FIG. 13 shows effects of INF ISD peptide on protein secretion of IL-8 in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM or 60 μM INF ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the median±standard deviation from three independent experiments performed in duplicates.

(16) FIG. 14 shows effects of INF ISD peptide on protein secretion of IL-10 in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM or 60 μM INF ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the median±standard deviation from three independent experiments performed in duplicates.

(17) FIG. 15 shows effect of different stimulus on the secretion of IFN-gamma in PBMCs. PBMCs were incubated either with 1 μg/ml or 50 ng/ml PMA and 1 μg/ml ionomycin or 10 ng/ml SEB for indicated time periods. Data shown are the medians±standard deviation from three independent technical replicates.

(18) FIG. 16 shows expression kinetics of IFN gamma expression in response to PMA/ionomycin treatment. Gene expression was expressed as relative gene expression towards RPL13a expression and non-stimulated cells at time zero (ΔΔ Ct). Data shown are the medians±standard deviation from three independent technical replicates.

(19) FIG. 17 shows effect of INF ISD on secretion of protein of IFN-gamma in PMA/ionomycin stimulated PBMCs. PBMCs were incubated with either medium alone, 30 μM or 60 μM Flu ISU or 30 μM or 60 μM control peptide, and stimulated with 50 ng/ml PMA and 1 μg/ml ionomycin. Data shown are the medians±standard deviation from three independent experiments performed in duplicates.

(20) FIG. 18 shows effects of SARS ([Seq id 285] AEVQIDRLITGRLQSLQTYVCGGEKEKEK) or Filo ISD ([Seq id 286] GAAIGLAWIPYFGPAAECGGEKEKEK) on expression of TNF-alpha mRNA in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM, 60 μM SARS or Filo ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the medians±standard deviation from two independent biological replications.

(21) FIG. 19 shows effects of SARS or Filo ISD on expression of IL-113 mRNA in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM, 60 μM SARS or Filo ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the medians±standard deviation from two independent biological replications.

(22) FIG. 20 shows effects of SARS or Filo ISD on expression of IL-113 mRNA in LPS-stimulated THP-1 cells. THP-1 cells were incubated with either medium alone, 30 μM, 60 μM SARS or Filo ISD peptide or 30 μM, 60 μM control peptide, and stimulated with 1 μg/ml LPS. Data shown are the medians±standard deviation from two independent biological replications.

(23) FIG. 21 shows interactions between INF ISD peptide (pFlu) and STING depends on distinct STING domains. To investigate further the interaction between STING and INF ISD peptide (pFlu) the C-terminal domain of STING was expressed with a HA-tag in HEK293 cells. STING was either in a wt form or with deletions. Lysates from tansfected cells were used for pulldown using biotinylated INF ISD peptide (pFlu) and streptavidin coated beads. The bead eluate was then immunoblotted using antibodies against HA-tag. As seen in the figure wt STING and the deletion mutant DN5 (162-N) was readily pulled down using INF ISD peptide (pFLu) whereas the deletion mutants DN6 (172-N) was not. These data indicate that amino acids 162-172 are necessary for interactions between pFlu and STING.

EXAMPLES

Example 1: ELISA

(24) TNF-α ELISA Assay

(25) The supernatant from THP-1 cells treated with peptides was assayed on human TNF-α ELISA Max™ Deluxe Set (Biolegend, #430205). ELISA assay was performed according to the manufacturer's protocol, as follows. Each incubation step was followed by sealing and shaking on the rotating table at 150-200 rpm, except the overnight incubation with the Capture Antibody, where plates were not shaken. One day prior running ELISA the 96-well assay plates were covered with the Capture Antibody, diluted 1:200 in 1× Coating Buffer (5× Coating Buffer diluted in ddH.sub.2O). 100 μL of this Capture Antibody solution was added into all wells, sealed and incubated overnight (16-18 hrs) at 4° C. The next day all reagents from the set were brought to the room temperature (RT) before use. The plate was washed 4 times with minimum 300 μL Wash Buffer (1×PBS, 0.05% Tween 20) per well. The residual buffer in the following washing was removed by blotting the plates against the absorbent paper. Next 200 μL of the 1× Assay Diluent A (5× Assay Diluent A diluted in PBS pH=7.4) was added for 1 h to block non-specific binding. While the plate was being blocked, all samples and standards (mandatory for each plate) were prepared. Standards and samples were run in triplicates. 1 mL of the top standard 250 pg/mL was prepared in 1× Assay Diluent A (1× AD) from the TNF-α stock solution (55 ng/mL). The six two-fold serial dilutions of the 250 pg/mL top standard were performed, with the human TNF-α standard concentration: 250 pg/mL, 125 pg/mL, 62.5 pg/mL, 31.2 pg/mL, 15.6 pg/mL, 7.8 pg/mL and 3.9 pg/mL, respectively. 1× AD serves as the zero standard (0 pg/mL). After blocking the plate, washing was performed and 100 μL standards and samples were assayed in triplicates and incubated for 2 h in RT. Samples were not diluted, the whole supernatant from the THP-1 cells was assayed. After washing, 100 μl of the Detection Antibody was applied to each well, diluted 1:200 in 1× AD, and incubated for 1 hour. Plate was washed and followed by 30 minutes incubation with 100 μL of Avidin-HRP solution per well, diluted 1:1000 in 1× AD. The final washing was performed 5 times with at least 30 seconds interval between the washings, to decrease the background. Next 100 μL of the freshly mixed TMB Substrate Solution (10 mL per plate, 5 mL of each from 2 substrates provided in the set) was applied and left in the dark for 15 min. It needs to be observed to prevent signal saturation, positive wells turned blue. After incubation in the dark the reaction was stopped with 100 μL of 2N H.sub.2SO.sub.4 per well. Positive wells turned yellow. Absorbance was read at 450 nm and 570 nm (background) within 30 minutes. The data were analyzed in the Microsoft Excel 2010 program.

Example 2: Effect of Peptides on Cytokine and Transcription Factor mRNA Level Measurements by QPCT

(26) Cell Culture

(27) THP-1 cells were cultured in RPMI medium supplemented with 10% fetal bovine serum 2 mM glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and used before passage 10. Cells were cultured in a humidified atmosphere in 95% air, 5% CO.sub.2 at 37° C.

(28) RNA Isolation

(29) RNAs from THP-1 cells were isolated using RNeasy® Plus Mini Kit (Qiagen, DK) according to the manufacturer's protocol. Quality and integrity of isolated RNA samples was controlled by determining A.sub.260/A.sub.280, A.sub.260/A.sub.230 absorbance ratios and 28S/18S rRNA ratios followed by rigorous DNase I (Ambion® TURBO DNA-Free™) treatments.

(30) Quantitative Real-Time RT-PCR

(31) 500 ng total RNA was used for cDNA synthesis using iScript™ cDNA synthesis kit (Bio-Rad, CA USA) according to the instructions of the manufacturers. Real-time Q-PCR analysis was performed using a LightCycler 480 cycler (Roche Diagnostics, DK). 2 μl of cDNA (from a total 20 μl reaction volume) was used in a 20 μl reaction. The real-time Q-PCR reactions contained 10 μl SybrGreen 2× Master Mix (Roche Diagnostics, DK), 2 μl forward primer (5 pmol/μl), 2 μl reverse primer (5 pmol/μ1) and 4 μl water. After initial denaturation at 95° C. for 10 minutes, PCR amplifications were performed for 45 cycles. The primer sequences used in this study are shown in Table 1. The crossing point (CP) for each transcript was measured and defined at constant fluorescence level in Light Cycler 480 software. The mRNA levels for the test gene were normalized to the RPL13a or RPL37A value and relative quantification was determined using the ΔCt model presented by PE Applied Biosystems (Perkins Elmer, Foster City, Calif. USA). For quantitative real-time RT-PCR analysis, standard deviations were calculated and a T-test was employed to compare expression levels. P-values 0.05 were considered statistically significant.

(32) TABLE-US-00003 Target gene/ primer name Primer sequence 5′-3′ IL-2 β forward GTGGCAATGAGGATGACTTGTTC IL-2 β reverse TAGTGGTGGTCGGAGATTCGTA IL-6 forward AGCCACTCACCTCTTCAGAAC IL-6 reverse GCCTCTTTGCTGCTTTCACAC IL-10 forward GTGATGCCCCAAGCTGAGA IL-10 reverse CACGGCCTTGCTCTTGTTTT TNF-alpha forward CTGCTGCACTTTGGAGTGAT TNF-alpha reverse AGATGATCTGACTGCCTGGG NF-κB forward TGAGTCCTGCTCCTTCCA NF-κB reverse GCTTCGGTGTAGCCCATT RPL13a forward CATCGTGGCTAAACAGGTACTG RPL13a reverse GCACGACCTTGAGGGCAGCA RPL37A forward ATTGAAATCAGCCAGCACGC RPL37A reverse AGGAACCACAGTGCCAGATCC
Treatment of Cells/Induction of Cytokines

(33) Pro- and anti-inflammatory cytokine gene expression was analyzed in un-differentiated THP-1 cells, designed as THP-1 monocytes. LPS is widely used as a potent and prototypical inducer of cytokine production in innate immunity which begins with the orchestration of monocytes. Pathogen associated molecular patterns (PAMPs), like lipopolysaccharide (LPS), play a pivotal role in initiation of variety of host responses caused by infection with Gram-negative bacteria. Such action leads to systemic inflammatory response, for instance up-regulation of pro- and anti-inflammatory cytokines, resulting in secretion of cytokine proteins into the blood stream.

(34) THP-1 cells (1.0×10.sup.6) were cultured in a 24-well tissue culture plate (Corning). Cells were cultured with stimulant LPS at 1 μg/ml with or without indicated peptides (at the indicated concentrations) for 4 h. LPS and peptides concentrations were chosen according to our preliminary optimization studies. RPMI 1640 medium containing 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin was used as a control. To investigate gene expression and cytokine secretion cells were harvested at 4 h time point, while cell-free culture supernatants were collected and stored at −80° C. The time point of 4 h has been chosen based on the previously published gene expression and cytokine secretion kinetics of THP-1 monocytes stimulated with LPS.sup.1. The experiments were performed by two independent biological replications, started from a new batch of cells. 1. Wasaporn Chanput, Jurriaan Mes, Robert A. M. Vreeburg, Huub F. J. Savelkoul and Harry J. Wichers. Transcriptional profiles of LPS-stimulated THP-1 monocytes and macrophages: a tool to study inflammation modulating effects of food-derived compounds. Food Funct., 2010, 1, 254-261.

Example 3

(35) Inflammatory shock as a consequence of LPS release remains a serious clinical concern. In humans, inflammatory responses to LPS result in the release of cytokines and other cell mediators from monocytes and macrophages, which can cause fever, shock, organ failure and death. Here we present data that show that pretreatment of cells with INF F#2 results in a decrease in the release of cytokines including pro-inflammatory cytokines such as TNFalpha and IL-6. Therefore, treatment of patients, in the risk of developing sepsis, with INF F#2 could act beneficially to decrease production of proinflammatory cytokines and hereby lessen the risk of developing shock, organ failure and death. See FIG. 8.

(36) The content of the ASCII text file of the sequence listing named “Third-Substitute-Sequence-Listing-12397-0801-31May2022”, having a size of 76.3 kb and a creation date of 31 May 2022, and electronically submitted via EFS-Web on 31 May 2022, is incorporated herein by reference in its entirety.

REFERENCES

(37) Cianciolo 1985: Cianciolo G J, Bogerd H, Snyderman R. Human retrovirus-related synthetic peptides inhibit T lymphocyte proliferation. Immunol Lett. 1988 September; 19(1):713. Denner 1994: Denner J, Norley S, Kurth R. The immunosuppressive peptide of HIV-1: functional domains and immune response in AIDS patients. AIDS. 1994 August; 8(8):1063 72. Harrell 1986: Harrell R A, Cianciolo G J, Copeland T D, Oroszlan S, Snyderman R. Suppression of the respiratory burst of human monocytes by a synthetic peptide homologous to envelope proteins of human and animal retroviruses. J Immunol. 1986 May 15; 136(10):3517-20. Kleinerman 1987: Kleinerman E S, Lachman L B, Knowles R D, Snyderman R, Cianciolo G J. A synthetic peptide homologous to the envelope proteins of retroviruses inhibits monocyte-mediated killing by inactivating interleukin 1. J Immunol. 1987 Oct. 1; 139(7):2329-37. Mangeney 1998: Mangeney M, Heidmann T. Tumor cells expressing a retroviral envelope escape immune rejection in vivo. Proc Natl Acad Sci USA. 1998 Dec. 8; 95(25):14920-5. [Haraguchi 1995: Haraguchi S, Good R A, James-Yarish M, Cianciolo G J, Day N K. Induction of intracellular cAMP by a synthetic retroviral envelope peptide: a possible mechanism of immunopathogenesis in retroviral infections. Proc Natl Acad Sci USA. 1995 Jun. 6; 92(12):5568-71. Haraguchi 1995a: Haraguchi S, Good R A, James-Yarish M, Cianciolo G J, Day N K. Differential modulation of Th1- and Th2-related cytokine mRNA expression by a synthetic peptide homologous to a conserved domain within retroviral envelope protein. Proc Natl Acad Sci USA. 1995 Apr. 11; 92(8):3611-5. Erratum in: Proc Natl Acad Sci USA 1995 Sep. 12; 92(19):9009 Haraguchi 2008: Haraguchi S, Good R A, Day-Good N K. A potent immunosuppressive retroviral peptide: cytokine patterns and signaling pathways. Immunol Res. 2008; 41(1):46-55. Review. Mangeney 2007: Mangeney M, Renard M, Schlecht-Louf G, Bouallaga I, Heidmann O, Letzelter C, Richaud A, Ducos B, Heidmann T. Placental syncytins: Genetic disjunction between the fusogenic and immunosuppressive activity of retroviral envelope proteins. Proc Natl Acad Sci USA. 2007 Dec. 18; 104(51):20534-9. Sander 1993: Sander H M, Morris L F, and Menter A. J Am Acad Dermatol. The annual cost of psoriasis. 1993. vol 28 (3) p 422-5 Funding et al., J Invest. Dermatol. 2008; in press: Funding A T, Johansen C, Gaestel M, Bibby B M, Lilleholt L L, Kragballe K, Iversen L. Reduced oxazolone-induced skin inflammation in MAPKAP kinase 2 knockout mice. J Invest Dermatol. 2009 April; 129(4):891-8. Kim S D, Kim Y K, Lee H Y, Kim Y S, Jeon S G, Baek S H, Song D K, Ryu S H, Bae Y S. The agonists of formyl peptide receptors prevent development of severe sepsis after microbial infection. J Immunol. 2010 Oct. 1; 185(7):4302-10. Epub 2010 Sep. 3. PubMed PMID: 20817875 Hillenbrand A, Knippschild U, Weiss M, Schrezenmeier H, Henne-Bruns D, Huber-Lang M, Wolf A M. Sepsis induced changes of adipokines and cytokines—septic patients compared to morbidly obese patients. BMC Surg. 2010 Sep. 9; 10:26. PubMed PMID: 20825686; PubMed Central PMCID: PMC2944119 Hamishehkar H, Beigmohammadi M T, Abdollahi M, Ahmadi A, Mahmoodpour A, Mirjalili M R, Abrishami R, Khoshayand M R, Eslami K, Kanani M, Baeeri M, Mojtahedzadeh M. Identification of enhanced cytokine generation following sepsis. Dream of magic bullet for mortality prediction and therapeutic evaluation. Daru. 2010; 18(3):155-62. PubMed PMID: 22615611; PubMed Central PMCID: PMC3304360. Delavallée L, Duvallet E, Semerano L, Assier E, Boissier M C. Anti-cytokine vaccination in autoimmune diseases. Swiss Med Wkly. 2010 Nov. 1; 140:w13108. doi: 10.4414/smw.2010.13108. Review. PubMed PMID: 21043003. Finkelman F D, Hogan S P, Hershey G K, Rothenberg M E, Wills-Karp M. Importance of cytokines in murine allergic airway disease and human asthma. J Immunol. 2010 Feb. 15; 184(4):1663-74. Review. PubMed PMID: 20130218. Corren J. Cytokine inhibition in severe asthma: current knowledge and future directions. Curr Opin Pulm Med. 2011 January; 17(1):29-33. Review. PubMed PMID: 21330823. de Paz B, Alperi-López M, Ballina-García F J, Prado C, Gutiérrez C, Suárez A. Cytokines and regulatory T cells in rheumatoid arthritis and their relationship with response to corticosteroids. J Rheumatol. 2010 December; 37(12):2502-10. Epub 010 Oct. 15. PubMed PMID: 20952465. Malaviya A M. Cytokine network and its manipulation in rheumatoid arthritis. J Assoc Physicians India. 2006 June; 54 Suppl:15-8. Review. PubMed PMID: 16909710. Broos S, Lundberg K, Akagi T, Kadowaki K, Akashi M, Greiff L, Borrebaeck C A, Lindstedt M. Immunomodulatory nanoparticles as adjuvants and allergen-delivery system to human dendritic cells: Implications for specific immunotherapy. Vaccine. 2010 Jul. 12; 28(31):5075-85. Epub 2010 May 15. PubMed PMID: 20478343. Morimoto Y, Ogami A, Todoroki M, Yamamoto M, Murakami M, Hirohashi M, Oyabu T, Myojo T, Nishi K, Kadoya C, Yamasaki S, Nagatomo H, Fujita K, Endoh S, Uchida K, Yamamoto K, Kobayashi N, Nakanishi J, Tanaka I. Expression of inflammation-related cytokines following intratracheal instillation of nickel oxide nanoparticles. Nanotoxicology. 2010 June; 4(2):161-76. PubMed PMID: 20795893 Summer B, Paul C, Mazoochian F, Rau C, Thomsen M, Banke I, Gollwitzer H, Dietrich K A, Mayer-Wagner S, Ruzicka T, Thomas P. Nickel (Ni) allergic patients with complications to Ni containing joint replacement show preferential IL-17 type reactivity to Ni. Contact Dermatitis. 2010 July; 63(1):15-22. PubMed PMID: 20597929. Schutte R J, Xie L, Klitzman B, Reichert W M. In vivo cytokine-associated responses to biomaterials. Biomaterials. 2009 January; 30(2):160-8. Epub 2008 Oct. 11. PubMed PMID: 18849070; PubMed Central PMCID: PMC2621303. Rodriguez A, Meyerson H, Anderson J M. Quantitative in vivo cytokine analysis at synthetic biomaterial implant sites. J Biomed Mater Res A. 2009 April; 89(1):152-9. PubMed PMID: 18431759. Roberts-Thomson I C, Fon J, Uylaki W, Cummins A G, Barry S. Cells, cytokines and inflammatory bowel disease: a clinical perspective. Expert Rev Gastroenterol Hepatol. 2011 December; 5(6):703-16. Review. PubMed PMID: 22017698. Rogler G, Andus T. Cytokines in inflammatory bowel disease. World J Surg. 1998 April; 22(4):382-9. Review. PubMed PMID: 9523521.