BIOLOGICALLY STABLE XNAZYME THAT EFFICIENTLY SILENCES GENE EXPRESSION IN CELLS
20240392298 ยท 2024-11-28
Assignee
Inventors
- John C. Chaput (IRVINE, CA, US)
- Yajun Wang (IRVINE, CA, US)
- Robert Spitale (Irvine, CA, US)
- Kim T. Nguyen (IRVINE, CA, US)
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Efforts to use RNA-cleaving DIMA enzymes (DNAzymes) as gene silencing agents in therapeutic applications have stalled due to their low efficacy in clinical trials. Here the present invention reports a xeno-nucleic acid (XNA) modified version of the classic DNAzyme 10-23 that achieves multiple turnover activity under cellular conditions and resists nuclease digestion. The new reagent overcomes the problem of product inhibition limiting previous 10-23 designs using molecular chemotypes with DNA. FANA, and TNA backbone architectures that balance the effects of enhanced biological stability with RNA hybridization and divalent metal ion coordination. In cultured mammalian cells. X 10-23 facilitates persistent gene silencing by efficiently degrading exogenous and endogenous mRNA transcripts. Together, these results demonstrate that new molecular chemotypes can improve the activity and stability of DNAzymes, and may provide a new route for nucleic acid enzymes to reach the clinic.
Claims
1. A composition for gene silencing, the composition comprising: a) a 15-nucleotide catalytic domain according to SEQ ID NO: 1, wherein one or more nucleic acids of the catalytic domain is replaced by xeno-nucleic acids (XNA); b) a first substrate recognition domain 5 to the catalytic domain; c) a second substrate recognition domain 3 to the catalytic domain; d) a 5 terminal threose nucleic acid (TNA) residue; and e) a 3 terminal TNA residue; wherein one or more nucleic acids of the first substrate recognition domain or the second recognition domain is replaced by XNA; and wherein the composition has enhanced stability and enhanced catalytic activity compared to a control molecule comprising wild type SEQ ID NO: 1 as its catalytic domain.
2. The composition of claim 1, wherein the XNA is 2-fluoroarabino nucleic acid (FANA).
3. The composition of claim 1, wherein the XNA is TNA.
4. The composition of claim 1, wherein the composition is for knocking down a target RNA.
5. The composition of claim 4, wherein the target RNA is KRAS.
6. The composition of claim 1, wherein the first substrate recognition domain and second substrate recognition domain are at least 5 nucleotides long.
7. A method of treating a disease or condition or a symptom thereof, the method comprising administering an effective amount of a 10-23 analogue composition to a subject in need thereof, wherein the composition comprises: a) a 15-nucleotide catalytic domain according to SEQ ID NO: 1, wherein one or more nucleic acids of the catalytic domain is replaced by xeno-nucleic acids (XNA); b) a first substrate recognition domain 5 to the catalytic domain; c) a second substrate recognition domain 3 to the catalytic domain; and d) a 5 terminal threose nucleic acid (TNA) residue; and e) a 3 terminal TNA residue; wherein one or more nucleic acids of the first substrate recognition domain or the second recognition domain is replaced by XNA.
8. The method of claim 7, wherein the XNA is 2-fluoroarabino nucleic acid (FANA).
9. The method of claim 7, wherein the XNA is TNA.
10. The method of claim 7, wherein the composition is for knocking down a target RNA.
11. The method of claim 10, wherein the target RNA is KRAS.
12. The method of claim 7, wherein the first substrate recognition domain and second substrate recognition domain are at least 5 nucleotides long.
13. The method of claim 7, wherein the disease or condition is caused by a common or rare genetic disease, viral or bacterial pathogen, cancer, inflammation, cardiovascular disease, immune deficiency, or a neurological disorder.
14. A method of validating gene mutations associated with a disease or condition, the method comprising: a) administering a 10-23 analogue composition to a cell line or animal model, wherein the composition comprises: i) a 15-nucleotide catalytic domain according to SEQ ID NO: 1, wherein one or more nucleic acids of the catalytic domain is replaced by xeno-nucleic acids (XNA); ii) a first substrate recognition domain 5 to the catalytic domain; iii) a second substrate recognition domain 3 to the catalytic domain; iv) a 5 terminal threose nucleic acid (TNA) residue; and v) a 3 terminal TNA residue; wherein one or more nucleic acids of the first substrate recognition domain or the second recognition domain is replaced by XNA; and b) analyzing the cell line for characteristics associated with the disease or condition.
15. The method of claim 14, wherein the XNA is 2-fluoroarabino nucleic acid (FANA).
16. The method of claim 14, wherein the XNA is TNA.
17. The method of claim 14, wherein the composition mutates a target RNA.
18. The method of claim 14, wherein the target RNA is KRAS.
19. The method of claim 14, wherein the first substrate recognition domain and second substrate recognition domain are at least 5 nucleotides long.
20. The method of claim 14, wherein the disease or condition is caused by a common or rare genetic disease, viral or bacterial pathogen, cancer, inflammation, cardiovascular disease, immune deficiency, or a neurological disorder.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0015] The features and advantages of the present invention will become apparent from a consideration of the following detailed description presented in connection with the accompanying drawings in which:
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
TABLE-US-00001 ME10-23 (UCAUGAGGCTAGCUACAACGAGGUUAG;SEQIDNO:52) and LNA10-23 (TCATGAGGCTAGCTACAACGAGGTTAG;SEQIDNO:53)
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION OF THE INVENTION
[0033] Before the present compounds, compositions, and/or methods are disclosed and described, it is to be understood that this invention is not limited to specific synthetic methods or to specific compositions, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. All embodiments disclosed herein can be combined with other embodiments unless the context clearly dictates otherwise.
Terms
[0034] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed invention belongs. The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicates otherwise. The term comprising means that other elements can also be present in addition to the defined elements presented. The use of comprising indicates inclusion rather than limitation. Stated another way, the term comprising means including principally, but not necessary solely. Furthermore, variation of the word comprising, such as comprise and comprises, have correspondingly the same meanings. In one respect, the technology described herein related to the herein described compositions, methods, and respective component(s) thereof, as essential to the invention, yet open to the inclusion of unspecified elements, essential or not (comprising).
[0035] Suitable methods and materials for the practice and/or testing of embodiments of the disclosure are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which the disclosure pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.), Guide to Protein Purification in Methods in Enzymology (M. P. Deutshcer, ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion 1998 Catalog (Ambion, Austin, Tex.), the disclosures of which are incorporated in their entirety herein by reference.
[0036] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety for all purposes. In case of conflict, the present specification, including explanations of terms, will control.
[0037] Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.
[0038] The term disease or disorder or condition refers to any alteration in state of the body or of some of the organs, interrupting or disturbing the performance of their functions and/or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person. A disease or disorder or condition can also be related to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, indisposition or affliction.
[0039] As used herein, the terms treat or treatment or treating refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow the development of the disease, such as slow down the development of a disorder, or reducing at least one adverse effect or symptom of a condition, disease or disorder, e.g., any disorder characterized by insufficient or undesired organ or tissue function. Treatment is generally effective if one or more symptoms or clinical markers are reduced as that term is defined herein. Alternatively, a treatment is effective if the progression of a disease is reduced or halted. That is, treatment includes not just the improvement of symptoms or decrease of markers of the disease, but also a cessation or slowing of progress or worsening of a symptom that would be expected in absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
[0040] A subject is an individual and includes, but is not limited to, a mammal (e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig, or rodent), a fish, a bird, a reptile or an amphibian. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be included. A patient is a subject afflicted with a disease or disorder. The term patient includes human and veterinary subjects
[0041] As used herein, the term XNA or xeno-nucleic acids may refer to artificial genetic polymers with novel sugar-phosphate backbones that harbor unique physicochemical properties relative to natural deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
[0042] As used herein, the term FANA or 2-fluoroarabino nucleic acid refers to an artificial nucleic acid wherein the sugar portion of the nucleic acid is 2-fluoroarabinose.
[0043] As used herein, the term TNA or -L-threofuranosylnucleic acid or threose nucleic acid refers to an artificial nucleic acid wherein the sugar portion of the nucleic acid is threose.
[0044] As used herein, the term LNA or locked nucleic acids may refer to modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2 oxygen and 4 carbon.
[0045] As used herein, the term DNAzyme 10-23 refers to an enzyme comprising a 15-nucleotide (nt) catalytic domain (5-GGCTAGCTACAACGA-3 (SEQ ID NO: 1) that is flanked on both sides by substrate binding arms (i.e., substrate recognition domains) that can vary in length depending on the sequence of the RNA substrate, typically 6-20 nts. In some embodiments, the two substrate recognition domains are designed to achieve target specificity.
[0046] Target specificity is based on complementary Watson-Crick base pairing between the RNA target (i.e., a target selected by a user; e.g., KRAS RNA) and the substrate binding arms of the DNAzyme. In some embodiments, the DNAzyme cleaves a G-U dinucleotide junction; therefore the binding arms may be designed to be complementary to the RNA regions flanking the G-U cut site.
[0047] In some embodiments, the two substrate recognition domains recognize an RNA target through complementary Watson-Crick base pairing. Once the target RNA is bound by the substrate recognition domains, RNA cleavage ensues at a predefined purine-pyrimidine (R-Y) junction with the highest activity levels observed for G-U dinucleotides. In some embodiments, the cleavage mechanism involves metal-assisted deprotonation of a 2-hydroxyl from the purine (R) nucleotide, followed by nucleophilic attack on the neighboring phosphodiester bond to yield an upstream cleavage product with a 2,3-cyclic phosphate and a downstream cleavage product with a 5-hydroxyl group.
[0048] In some embodiments, the substrate recognition domains may range from 6-20 nucleotides long. In some embodiments, the substrate recognition domains are at least 4 nucleotides long. In some embodiments, the substrate recognition domains are at least 5 nucleotides long. In some embodiments, the substrate recognition domains are at least 6 nucleotides long. In some embodiments, the substrate recognition domains are at least 7 nucleotides long. In some embodiments, the substrate recognition domains are at least 8 nucleotides long. In some embodiments, the substrate recognition domains are at least 9 nucleotides long. In some embodiments, the substrate recognition domains are at least 10 nucleotides long. In some embodiments, the substrate recognition domains are at least 12 nucleotides long. In some embodiments, the substrate recognition domains are at least 14 nucleotides long. In some embodiments, the substrate recognition domains are at least 16 nucleotides long. In some embodiments, the substrate recognition domains are at least 18 nucleotides long. In some embodiments, the substrate recognition domains are at least 20 nucleotides long. In some embodiments, the substrate recognition domains are at least 22 nucleotides long.
[0049] As used herein X10-23 and XNAzyme may be used interchangeably.
[0050] Referring now to
[0051] The present invention features a composition for gene silencing. In some embodiments, the composition comprises a 15-nucleotide catalytic domain according to SEQ ID NO: 1, a first substrate recognition domain 5 to the catalytic domain, a second substrate recognition domain 3 to the catalytic domain, a 5 terminal threose nucleic acid (TNA) residue and a 3 terminal TNA residue. In some embodiments, the composition comprises a catalytic domain wherein one or more nucleic acids of the catalytic domain is replaced by xeno-nucleic acids (XNA). In other embodiments, one or more nucleic acids of the first substrate recognition domain or the second recognition domain is replaced by XNA. In other embodiments, the composition has enhanced stability and enhanced catalytic activity compared to a control molecule comprising wild type SEQ ID NO: 1 as its catalytic domain.
[0052] The XNAzymes herein comprise one or more alternative nucleic acid residues in the 15-residue catalytic core. Additionally, the XNAzymes comprise two substrate binding arms flanking the catalytic domain that in some embodiments are composed entirely of alternative nucleic acid residues. Examples of alternative nucleic acid residues include 2-fluoroarabino nucleic acid (FANA) and threose nucleic acid (TNA). The present invention is not limited to TNA and FANA. Other XNA examples include but are not limited to: hexose nucleic acid (HNA), cyclohexenyl nucleic acid (CeNA), glycerol nucleic acid (GNA), peptide nucleic acid (PNA), arabino nucleic acid (ANA), phosphonomethyl-threosyl nucleic acid (tPhoNA), locked nucleic acid (LNA), pyranosyl-RNA (pRNA), xylo nucleic acid (XNA), and deoxy-xylonucleic acid (dXNA).
[0053] In some embodiments, the XNA is 2-fluoroarabino nucleic acid (FANA). In other embodiments, the XNA is threose nucleic acid (TNA).
[0054] The present invention features a composition for gene silencing, the composition comprising an 10-23 analogue, wherein one or more sugars of the nucleotides in the 10-23 analogue is replaced by threose or 2-fluoroarabinose.
[0055] As a non-limiting example, the XNAzyme may comprise FANA substitutions in the substrate recognition domains (substrate binding arms). The XNAzyme may further comprise TNA residues flanking the ends of the FANA substrate recognition domains. The XNAzyme may further comprise TNA substitutions, e.g., in the catalytic core.
TABLE-US-00002 TABLE 1 Examples of XNAzymes Catalytic Domain Sequences Sequence of Catalytic Domain (5-3) SEQ. ID (residue number) NO: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 G G C T A G C T A C A A C G A 2 fG G C T A G C T A C A A C G A 3 G fG C T A G C T A C A A C G A 4 G G fC T A G C T A C A A C G A 5 G G C fT A G C T A C A A C G A 6 G G C T fA G C T A C A A C G A 7 G G C T A fG C T A C A A C G A 8 G G C T A G fC T A C A A C G A 9 G G C T A G C fT A C A A C G A 10 G G C T A G C T fA C A A C G A 11 G G C T A G C T A fC A A C G A 12 G G C T A G C T A C fA A C G A 13 G G C T A G C T A C A fA C G A 14 G G C T A G C T A C A A fC G A 15 G G C T A G C T A C A A C fG A 16 G G C T A G C T A C A A C G fA 17 G fG C T A G C fT A C A A C G A 18 G fG C fT A G C fT fA C A A C G A (f = FANA residue; t = TNA residue)
[0056] In some embodiments, the 10-23 analogue (X10-23) silences genes through knocking down a target RNA.
[0057] The present invention may also feature a method of treating a disease or condition or a symptom thereof. In some embodiments, the method comprises administering an effective amount of a 10-23 analogue composition to a subject in need thereof. In some embodiments, the composition comprises a 15-nucleotide catalytic domain according to SEQ ID NO: 1, a first substrate recognition domain 5 to the catalytic domain, a second substrate recognition domain 3 to the catalytic domain, a 5 terminal threose nucleic acid (TNA) residue and a 3 terminal TNA residue. In some embodiments, the composition comprises a catalytic domain wherein one or more nucleic acids of the catalytic domain is replaced by xeno-nucleic acids (XNA). In other embodiments, one or more nucleic acids of the first substrate recognition domain or the second recognition domain are replaced by XNA.
[0058] In some embodiments, the target RNA is KRAS. Other target RNAs may be used in accordance with compositions and methods as described herein.
[0059] In some embodiments, one X10-23 composition may target a single RNA (i.e., a single target RNA). In some embodiments, one or more X10-23 compositions may target a single RNA (i.e., a single target RNA). In some embodiments, a X10-23 composition may be designed to target any purine-pyrimidine dinucleotide junction (R-Y) of a target RNA. In some embodiments, a purine-pyrimidine dinucleotide junction (R-Y) of R-uracil (R-U) is preferred over R-cysteine (R-C). In preferred embodiments, the X10-23 composition described herein targets a purine-uracil (R-U) dinucleotide junction. In other embodiments, the X10-23 composition described herein targets a purine-cysteine (R-C) dinucleotide junction.
[0060] The present invention features a method of validating and treating a disease or condition, or a symptom thereof caused by a genetic mutation in the mRNA strand, the method comprising administering an effective amount of a 10-23 analogue to a subject in need thereof.
[0061] In some embodiments, the disease or condition is caused by a common or rare genetic disease, viral or bacterial pathogen, cancer, inflammation, cardiovascular disease, immune deficiency or a neurological disorder. In other embodiments, the disease or condition is pancreatic, and colorectal adenocarcinomas.
TABLE-US-00003 TABLE2 Tableofoligonucleotidesusedforinvitrotesting SEQ OligoName Sequence(5-3) IDNO: OligonucleotidesforF10-23(FANAsubstitutioninbindingarms) F10-23 ucaugaGGCTAGCTACAACGAgguuag 19 (6ntbindingarms) 10-23 TCATGAGGCTAGCTACAACGAGGTTAG 20 (6ntbindingarms) 10-23 GTCATGAGGCTAGCTACAACGAGGTTAGG 21 (7ntbindingarms) RNAsubstrate /5Cy5/rCrUrArArCrCrGrUrCrArUrGrA 22 (6ntbindingarms) RNAsubstrate /5Cy5/rCrCrUrArArCrCrGrUrCrArUrGr 23 (7ntbindingarms) ArC F10-23V2 gcacccaGGCTAGCTACAACGAcucucuc 24 (7ntbindingarms) 10-23V2 GCACCCAGGCTAGCTACAACGACTCTCTC 25 (7ntbindingarms) RNAsubstrateV2 /5Cy5/rGrArGrArGrArGrGrUrGrGrGrUr 26 (7ntbindingarms) GrC 103ntRNA rCrCrUrUrUrUrCrUrUrArArUrUrUrGrArUr 27 containingtargetsite UrCrCrUrGrCrCrArArCrArCrCrCrUrArArC rCrGrUrCrArUrGrArCrUrUrCrArCrCrUrUr UrUrArCrCrArUrGrGrGrUrGrGrCrUrUrArU rUrArArArArArCrArUrUrUrUrCrCrUrGrGr ArCrGrArArGrArCrArGrUrUrCrCrCrU OligonucleotidesformappingFANA substitutionsinthecatalyticcore 10-23G1 TCATGAgGCTAGCTACAACGAGGTTAG 28 10-23G2 TCATGAGgCTAGCTACAACGAGGTTAG 29 10-23C3 TCATGAGGcTAGCTACAACGAGGTTAG 30 10-23U4 TCATGAGGCuAGCTACAACGAGGTTAG 31 10-23A5 TCATGAGGCTaGCTACAACGAGGTTAG 32 10-23G6 TCATGAGGCTAgCTACAACGAGGTTAG 33 10-23C7 TCATGAGGCTAGcTACAACGAGGTTAG 34 10-23U8 TCATGAGGCTAGCuACAACGAGGTTAG 35 10-23A9 TCATGAGGCTAGCTaCAACGAGGTTAG 36 10-23C10 TCATGAGGCTAGCTACAACGAGGTTAG 37 10-23A11 TCATGAGGCTAGCTACaACGAGGTTAG 38 10-23A12 TCATGAGGCTAGCTACAaCGAGGTTAG 39 10-23C13 TCATGAGGCTAGCTACAAcGAGGTTAG 40 10-23G14 TCATGAGGCTAGCTACAACgAGGTTAG 41 10-23A15 TCATGAGGCTAGCTACAACGaGGTTAG 42 10-23G2/U8 TCATGAGgCTAGCuACAACGAGGTTAG 43 10-23G2/U4/U8/A9 TCATGAGgCuAGCuaCAACGAGGTTAG 44 Oligonucleotidesforbiostabilitytest 10-23WT TCATGAGGCTAGCTACAACGAGGTTAG 20 F10-23 ucaugaGGCTAGCTACAACGAgguuag 19 X10-23 .sup.tTucaugaGgCTAGCuACAACGAgguuag.sup.tT 45 OligonucleotidesforGFPreductions X10-23targetingGFP .sup.tTgcugcaGgCTAGCuACAACGAgcugcc.sup.tT 46 internal X10-23targetingGFP .sup.tTgugacaGgCTAGCuACAACGAuauaga.sup.tT 47 3UTR 10-23targetingGFP GCTGCAGGCTAGCTACAACGAGCTGCC/3InvdT/ 48 internal 10-23targetingGFP GTGACAGGCTAGCTACAACGATATAGA/3InvdT/ 49 3UTR X-antisensetargeting .sup.tTgcugcacgcugcc.sup.tT 50 GFPinternal X-antisensetargeting .sup.tTgugacacuauaga.sup.tT 51 GFP3UTR Letters in bold lower cases denote FANA nucleotides; RNA residues are denoted by r; TNA residues are denoted by superscript t; 3InvdTdenotes 3inverted dT; mdenotes 2-O-methyl ribonucleotides; +denotes LNA residues.
[0062] The present invention may further feature a method of validating gene mutations associated with a disease or condition. In some embodiments, the method comprises administering a 10-23 analogue composition to a cell line or animal model, and analyzing the cell line or animal model for characteristics associated with the disease or condition. In some embodiments, the composition comprises a 15-nucleotide catalytic domain according to SEQ ID NO: 1 with one or more nucleic acids of the catalytic domain are replaced by xeno-nucleic acids (XNA), a first substrate recognition domain 5 to the catalytic domain, a second substrate recognition domain 3 to the catalytic domain, a 5 terminal threose nucleic acid (TNA) residue, and a 3 terminal TNA residue. In some embodiments, one or more nucleic acids of the first substrate recognition domain or the second recognition domain are replaced by XNA.
[0063] As used herein, an appropriate cell line refers to a cell line that is biologically relevant to the disease or the condition being studied. In some embodiments, cell lines may include, but are not limited to, HEK-293, HeLa, or Chinese hamster ovary cells (CHO). As used herein, characteristics associated with a disease or condition may refer to measurable molecular changes in a cell line.
EXAMPLE
[0064] The following is a non-limiting example of the present invention. It is to be understood that said example is not intended to limit the present invention in any way. Equivalents or substitutes are within the scope of the present invention.
Optimizing the Substrate Recognition Domain.
[0065] XNA containing oligonucleotide synthesis and preparation: TNA phosphoramidites were synthesized using known methods. Standard -cyanoethyl phosphoramidite chemistry and an Applied Biosystems 3400 DNA Synthesizer were used to synthesize TNA oligonucleotides on Universal Support II CPG columns in 1 mole scale. Standard DNA coupling procedures were modified for FANA and/or TNA containing oligonucleotides such that coupling time for FANA and TNA amidites was increased to 360 s and 1200 s, respectively. Detritylation was performed in two cycles for TNA amidites, 60 s each. Oligonucleotides used for biostability studies were coupled with a 5-hexynyl phosphoramidite for later IR-680 fluorophore tagging via click chemistry. Cleavage from the solid support and final deprotection of oligonucleotides synthesized were achieved simultaneously in NH.sub.4OH (33%) for 18 h at 55 C. Oligonucleotides were purified on denaturing (8 M urea) PAGE, recovered by electro-elution, and subsequently desalted by buffer exchange using microcentrifugal concentrators, and quantified by nano-drop. All oligonucleotides synthesized in-house were subjected to Quadrupole time-of-flight mass spectrometry (Q-TOF) for identity confirmation.
[0066] Recognizing that XNAs harbor physicochemical properties that are distinct from those found in natural DNA and RNA, whether XNA residues could be used to enhance the RNA-cleavage activity of 10-23 under physiological conditions needed to first be determined. First, all of the DNA residues were replaced in the binding arms of the substrate recognition domain with 2-fluoroarabino nucleic acids (FANA,
[0067] Apart from thymidine, which was substituted for uridine, each DNA nucleotide was replaced with the corresponding FANA nucleotide. LNA was also considered as a possible XNA modification due to its high thermal stability with RNA (2-3 C. per base pair), but concerns over its cellular toxicity led to focusing the efforts on FANA. This version of 10-23, termed F10-23, functions with a pseudo first-order rate constant (k.sub.obs) of 0.57 min-1 under single-turnover conditions in the buffer containing 10 mM MgCl.sub.2 and 150 mM NaCl (pH 7.5, 24 C.), which is nearly 2-fold faster than the unmodified parent enzyme (
Cleavage of Long RNA Substrates:
[0068] Generation of RIMKLA mRNA transcript for in vitro cleavage assay by 10-23 and F10-23: Homo sapiens ribosomal modification protein rimK like family member A (RIMKLA) was reversed transcribed from HeLa total RNA using SuperScript RT III (Invitrogen-Life Technologies, CA) according to manual instruction. RIMKLA cDNA was subjected to 2-round nested PCR using KOD polymerase (Fisher Scientific, Cat #710863) to introduce T7 promoter upstream of the coding sequence of RIMKLA for subsequent in vitro transcription. mRNA was then transcribed in 1RNAPol reaction buffer, supplemented with 0.5 mM each ATP, UTP, GTP, CTP, 5 mM dithiothreitol (DTT), 1 U/L RNase inhibitor using 4 g/L of the purified DNA amplicon and 25 U/L of T7 RNA polymerase at 37 C. for 16 h. Transcription was terminated by the addition of 10 U/mL of RNase-free DNase I and incubation at 37 C. for 15 min. The transcription reaction was resolved by 10% denaturing purification PAGE (8 M urea), and the gel was visualized by UV-shadowing. The RNA transcript was excised, electroeluted, exchanged into H2O using EMD Millipore YM-3 micro centrifugal device, and UV quantified by Nanodrop before in vitro kinetic cleavage assays by 10-23 and F10-23.
[0069] To provide further evidence of RNA cleavage activity, F10-23 was challenged to cut a much longer RNA substrate that was more reminiscent of a biological RNA molecule found in nature. For this example, a 103 nt segment of the ribosomal modification protein rimK, was chosen, and an unlabeled RNA transcript was generated by in vitro transcription with T7 RNA polymerase. The catalytic activity of F10-23 was compared to standard 10-23 under single-turnover, steady-state, and multiple-turnover conditions in a physiological buffer containing 1 mM MgCl.sub.2 and 150 mM NaCl (pH 7.5, 24 C.). Here steady-state kinetic measurements are viewed as a more rigorous test of catalytic activity than the more common single-turnover reaction. Analysis of the reaction products by denaturing polyacrylamide gel electrophoresis (PAGE) (
Optimizing the Catalytic Core:
[0070] To determine if the activity of 10-23 could be further enhanced by introducing chemical modifications into the catalytic domain. Although this region of the sequence represents an evolutionary optimum in which almost any nucleotide change leads to a mutant enzyme with reduced catalytic activity, substantially less is known about the tolerance of the catalytic core toward chemical modifications that alter the sugar moiety. Each DNA residue was systematically replaced in the catalytic core with the corresponding FANA nucleotide (e.g., dA was replaced with fanaA (i.e, fA); Table 1). The complete set of 15 single-point mutant enzymes were assayed for RNA cleavage activity under single-turnover conditions in a physiological buffer containing 1 mM MgCl.sub.2 and 150 mM NaCl (pH 7.5, 24 C.). The catalytic profile (
Designing the X10-23 Enzyme:
[0071] Encouraged by the structural mutagenesis study, a new version of the enzyme was synthesized in which the catalytic core of F10-23 was modified to contain both G2 and U8 FANA substitutions (SEQ ID NO: 17) and non-complementary -L-threofuranosyl thymidine (tT) residues were added to the 5 and 3 terminal positions to protect the oligonucleotide against nuclease digestion (
[0072] Next, whether the enhanced chemical diversity of X10-23 enabled higher multiple-turnover activity in vitro was determined. First 10-23, F10-23, and X10-23 were evaluated under steady-state conditions with equimolar concentrations of substrate and enzyme. Kinetic measurements reveal that F10-23 and X10-23 (
Evaluating the Biostability of X10-23
[0073] Biostability measurements: All biostability assays were performed in DMEM containing 1 M of tested construct with the presence of 2 mg/mL of human liver microsome, or 50% human serum (v/v), or 10 mU/mL of snake venom phosphodiesterase at 37 C. Multiple time points were collected for each condition by quenching 1.5 L of reactions using 15 L (10 equivalents, v/v) of formamide containing 25 mM EDTA. Samples were denatured for 15 min at 95 C. and analyzed by 15% denaturing PAGE. Gels were visualized using a LI-COR Odyssey CLx.
[0074] Along with efficient catalytic activity, biostability is a critical parameter for achieving improved efficacy in cellular systems that contain strong DNA and RNA degrading enzymes. For this assay, the stability of the 10-23, F10-23, and X10-23 scaffolds was analyzed in concentrated human liver microsomes (HLM) and 50% human serum (HS) in Dulbecco's Modified Eagle Medium (DMEM). Both assays provide a rigorous test of oligonucleotide stability due to the abundance and diversity of nucleases present in the media. In addition, each scaffold was also evaluated against snake venom phosphodiesterase (SVPDE), an aggressive enzyme with strong 3-exonuclease activity commonly employed to evaluate the stability of oligonucleotide therapeutics. The results (
Comparing X23-10 to 2-O-Methyl RNA and LNA Version of 10-23:
[0075] Kinetic cleavage reaction of 10-23, F10-23, X10-23, OME10-23, and LNA10-23: Single-turnover kinetic cleavage reactions were conducted in 50 mM Tris buffer (pH 7.5) containing 150 mM NaCl, 1 mM MgCl.sub.2, 0.5 M of substrate, and 2.5 M of enzyme at 24 C. Purified enzymes and substrates were annealed in a 50 mM Tris buffer (pH 7.5) by heating for 5 min at 90 C. and cooling for 5 min on ice. Reactions were initiated by the addition of NaCl and MgCl.sub.2 to the reaction. For determination of pseudo first-order rate constant, multiple time points were collected by quenching 1.5 L of reaction using 15 L (10 equivalents, v/v) of formamide stop buffer (99% deionized formamide, 25 mM EDTA) and cooling on ice. Samples were denatured for 15 min at 95 C. and analyzed by 15% denaturing PAGE. Gels were visualized and quantified using a LI-COR Odyssey CLx. Values of k.sub.obs were calculated by fitting the percentage of substrate cleaved and reaction time (min) to the first-order decay equation (1) using Prism 6 (GraphPad, USA):
where P.sub.t is the percentage of cleaved substrate at time t, P.sub. is the apparent reaction plateau and k.sub.obs is the observed first-order rate constant. For kinetic cleavage reactions under stoichiometric and multiple-turnover conditions, substrate concentrations were poised at 0.5 M, and enzyme concentrations were adjusted to 0.5 M and 50 nM, respectively.
[0076] How X10-23 compared to other chemically enhanced versions of 10-23 that have been previously evaluated as gene silencing reagents was determined next. Among the various combinations, 2-O-methyl ribonucleotides and LNA have received significant attention as chemical modifications that function with enhanced activity and biostability which is consistent with their broad deployment in other classes of therapeutic oligonucleotides.
TABLE-US-00004 OME10-23 (UCAUGAGGCTAGCUACAACGAGGUUAG;SEQIDNO:52) and LNA10-23 (TCATGAGGCTAGCTACAACGAGGTTAG;SEQIDNO:53),
two 10-23 analogs with substrate binding arms that are complementary to the RNA substrate (
[0077] Kinetic measurements indicate that LNA10-23 is significantly faster than OME10-23 under all conditions tested. Under single turnover conditions, LNA10-23 functions with a rate of 0.26 min-1 in the presence of 10 mM MgCl.sub.2 and 0.03 min-1 when the concentration of Mg.sup.2+ is reduced to 1 mM (
Intracellular Reduction of GFP:
[0078] Next, the activity of X10-23 in cultured mammalian cells was determined using the green fluorescent protein (GFP) as an optical reporter for gene silencing activity. GFP expression was measured in the presence and absence of two X10-23 reagents that were designed to target G-U dinucleotides in the coding (internal) and 3 untranslated region (3UTR) of the GFP mRNA transcript (
[0079] Without wishing to limit the present invention to any theory or mechanism it was thought that given the strength of the CMV promoter, each X10-23 reagent must be engaging multiple mRNA templates in the cytoplasm in order to maintain strong gene silencing activity under constitutive GFP expression conditions.
[0080] Recognizing that constitutive gene expression from a CMV promoter produces larger quantities of RNA than endogenous gene expression, a dose-dependent treatment of actinomycin D for 4 hours was administered after 20 hours of incubation post-transfection to inhibit RNA transcription. Actinomycin D is a transcriptional inhibitor that prevents continued expression of GFP in the cell, allowing X10-23 to engage only those GFP transcripts that are present when the antibiotic is administered to the cells. qRT-PCR analysis of cellular GFP transcripts shows a 3-fold reduction in template copy number by X10-23 when the cells are treated with 40 M of actinomycin D, as compared to cells that are co-transfected with the GFP plasmid and X10-23 but not treated with the antibiotic (
Intracellular Reduction of Endogenous KRAS
[0081] Having demonstrated that X10-23 is capable of knocking down the expression of transiently transfected genes in cultured cells, whether similar effects could be achieved for endogenous mRNA transcripts was determined next. KRAS was chosen as a cellular target due to its implication in lung, pancreatic, and colorectal adenocarcinomas. KRAS has been the focus of many drug targeting campaigns and is often viewed as an undruggable target due to the inherent difficulty of altering its cellular expression profile. Two X10-23 reagents were designed, synthesized, and tested for targeting the 1st exon and 3UTR (
Mechanistic Insights into Cellular Cleavage:
[0082] In vitro RNAse H activity assay with X10-23, unmatched X10-23, and inactive X10-23: All RNase H activity assays were performed under simulated physiological buffer conditions in 50 mM Tris-HCl (pH 7.5) containing 0.5 mM MgCl.sub.2, 150 mM NaCl, and 0.1 unit/L of RNase H at 37 C. 1 M of RNA substrate was mixed with 1 M of the tested constructs of X10-23, unmatched X10-23, and inactive X10-23 in Tris-HCl (pH 7.5) buffer, respectively, to anneal by heating for 5 min at 90 C. and cooling for 5 min on ice. Reactions were initiated by the addition of MgCl.sub.2, NaCl, and RNase H to the final concentration. Reactions were sampled by quenching 1.5 L of reactions using 15 L (10 equivalents, v/v) of formamide containing 25 mM EDTA at time points of 0, 1, 5, and 20 hours. Samples were denatured for 15 min at 95 C. and analyzed by 15% denaturing PAGE. Gels were visualized using a LI-COR Odyssey CLx.
[0083] RNase H has been implicated as a contributor to RNA-based degradation by 10-23 variants due to the presence of complementary substrate binding arms that mimic antisense oligonucleotides. Recognizing the substantial difference in multiple turnover activity between 10-23 and X10-23, it was hypothesized that the newly engineered X10-23 reagent was sufficiently fast that it would be less susceptible to the effects of an RNase H induced cleavage pathway. To investigate this possibility, the catalytic activity of X10-23 was evaluated under simulated physiological conditions in buffered solutions that either contain or lack RNase H. X10-23 variants were designed to cleave segments of GFP and KRAS transcripts that were prepared as synthetic oligonucleotides. Inactive versions of X10-23 and active versions that were non-complementary to the mRNA targets were used as negative controls. The X10-23 reagents show strong site-specific RNA cleavage activity in the presence and absence of RNase H (
TABLE-US-00005 TABLE3 Sequence SEQIDNO: OME10-23 UCAUGAGGCTAGCUACAACGAGGUUAG 52 LNA10-23 TCATGAGGCTAGCTACAACGAGGTTAG 53 X10-23thattargetsGFP(FIG. .sup.tTgcugcaGgCTAGCuACAACGAgcugcc.sup.tT 46 16A) X10-23withaninactivecore TGCUGCAGGCTAGCTACAACGAGCUGCC.sup.tT 54 thattargetsGFP(FIG.16B) X10-23withnohybridization .sup.tTgugacaGgCTAGCuACAACGAuauaga.sup.tT 47 toGFP(FIG.16C) X10-23thattargetsKRAS .sup.tTCUACCAGGCTAGCUACAACGAAAGUUA.sup.tT 55 (FIG.16D) X10-23withaninactivecore .sup.tTCUACCAGGCTAGCTACAACGAAAGUUA.sup.tT 56 thattargetsKRAS(FIG.16E) X10-23withnohybridization .sup.tTAAAAGUAGGCTAGCUACAACGAAAAUUG 57 toKRAS(FIG.16F) U.sup.tT Note: Catalytic domain =underlined; FANA =bolded; TNA =.sup.t; LNA =italicized
[0084] The present invention aims to narrow the gap between DNAzymes and protein-based gene silencing tools by expanding the chemical space of nucleic acid analogs used to construct nucleic acid enzymes. Efforts were focused on xeno-nucleic acids, which are artificial genetic polymers with novel sugar-phosphate backbones that harbor unique physicochemical properties relative to natural DNA and RNA.
[0085] Without wishing to limit the present invention to any particular theory or mechanism it is thought that appropriate positioning of XNA residues in the nucleic acid backbone structure of a highly evolved DNAzyme will lead to enhanced RNA cleavage activity under physiological conditions, while simultaneously protecting the molecule from the harmful effects of nuclease digestion. This hypothesis is supported by limited structural data showing subtle yet important differences in the helical geometry of XNA duplexes.
[0086] Critical to the design of the present invention was the need to identify XNA residues that would (i) increase substrate binding kinetics without sacrificing multiple turnover activity, (ii) improve cofactor binding, and (iii) minimize the exolytic activity of biological enzymes. Using a medicinal chemistry approach that systematically probed the substrate binding arms and catalytic domain of the classic DNAzyme 10-23, a highly efficient and biologically stable variant that comprises three different classes of nucleic acid molecules (DNA, FANA, and TNA) was discovered. Relative to the parent enzyme, X10-23 achieves a 50-fold increase in multiple turnover activity under simulated physiological conditions and enhances the biological stability of the backbone structure >100-fold under stringent nuclease conditions. In cultured mammalian cells, X10-23 imbues a >60% reduction in mRNA and protein abundance under conditions of constitutive expression, which is further enhanced upon treatment with a transcriptional inhibitor. Similar activity profiles were observed for X10-23 reagents targeting endogenous KRAS expression in human cancer cell lines, implying that X10-23 has the potential to alter the expression profiles of proteins that are thought to be undruggable. Finally, compelling evidence was provided showing that X10-23 does not rely on RNase H as a mechanism for RNA degradation.
[0087] In summary, the present invention establishes X10-23 as a new tool in the ever expanding toolbox of gene silencing reagents. The ability for X10-23 to function with high activity and biological stability in vitro and in cultured mammalian cells suggests that even highly evolved nucleic acid enzymes can be optimized for improved activity. Based on these findings, the exploration of new molecular chemotypes provide a powerful approach for creating highly active nucleic acid enzymes with potential value as future therapeutic agents.
Intracellular GFP and KRAS Reduction Test:
[0088] Cell lines and mammalian cell cultures and conditions: HEK293T (HEK) and Hela cells were cultured in DMEM (Corning, Cat #: 10-017-CM) supplemented with 10% FBS, 1% (1 mg/mL) penicillin and streptomycin and grown at 37 C., 5% CO.sub.2. MDA-MB-231 cells were cultured in the same medium as HEK and HeLa cells but supplemented with additional components of 1 mM sodium pyruvate.
[0089] Transfection: For titrating amount of single or multivalent X10-23 experiments: After 48 h seeding of 2.510.sup.5 cells/well, HEK293T in 6-well plates were transfected with 1 g of pCDNA3.3-EGFP only (Negative control) or with 1 g of pCDNA3.3-EGFP and 4, 6, or 8 g of either internal or 3UTR GFP X10-23 in single experiments or 2/2 g, 3/3 g or 4/4 g of both internal/3UTR GFP X10-23 in multivalent (dual X10-23) experiments by using JetPrime Transfection reagent (Polyplus Transfection, France) according to manual instruction except adding 5 higher than the manual recommended volume of JetPrime Reagent. For negative controls, the volume of JetPrime Reagent used for each well was the same as those with X10-23 to ensure the same transfection condition in the control and experimental samples
[0090] For comparison of active, inactive core and active unpaired X10-23: After 48 h seeding at 2.510.sup.5 cells/well (6-well plate), Hela cells were transfected with 5.9 g10-23 variants targeting the 3UTR region of KRAS transcript (active vs. inactive core) or GFP transcript (active core but unpaired binding arms) using JetPrime Transfection reagent. At 96 h post transfection, cells were harvested and subjected to total RNA extraction and subsequently underwent DNAse treatment as described in the RNA isolation section. DNA-free RNA was subjected to RT-qPCR as described in the reverse transcription and SYBR Green qPCR analysis section.
[0091] For multivalent benchmark experiments: After 48 h seeding at 2.510.sup.5 cells/well, HEK293T in 6-well plates were transfected with 1 g of pCDNA3.3-EGFP only (Negative control) or with 1 g of pCDNA3.3-EGFP and 4/4 g of both internal/3UTR GFP X10-23 (dual X10-23), DNA10-23 (dual DNA10-23), antisense (dual antisense oligos), inactive X10-23 (dual Inactive X10-23) or inactive DNA10-23 (dual inactive DNA10-23). Parameters used in subsequent imaging and RNA isolation at 48 h post-transfection are the same as described in RNA isolation section.
[0092] For single or multivalent KRAS X10-23 experiments in HeLa or MDA-MB-231 cells: After 48 h, 76 h seeding of 2.510.sup.5 cells/well of HeLa or MDA-MB-231 cells in 6-well plates, respectively, the cells were transfected with transfection carrier only (Negative control) or with 4/4 g of both internal/3UTR KRAS X10-23 in multivalent (dual X10-23) or 8 g of either Internal or 3UTR KRAS X10-23 experiments using JetPrime Transfection reagent (Polyplus Transfection, France). Parameters used in RNA isolation at 48 h post-transfection are the same as described in the RNA isolation section.
[0093] Cell imaging: At 24 h or 48 h post-transfection, cells were subjected to live imaging using 200M Axiovert Zeiss fluorescent microscope with 10 objective and GFP filter. Following imaging, the cells were subjected to RNA extraction.
[0094] Reverse transcription (RT): Two micrograms (2 g) of DNA-free RNA were subjected to cDNA synthesis using SuperScript III First-strand Synthesis System (Invitrogen-Life Technologies, CA) with random hexamer primers in a 20 L reaction according to the manufacturer instructions. cDNA was subsequently purified using DNA Clean & Concentration columns from Zymo Research (Cat #D4003) according to the manufacturer instructions and eluted 2 with 100 L water/each.
[0095] SYBR Green semi-quantitative PCR (qPCR) analysis. To quantify copy number of GFP transcript in the presence or absence of GFP-X10-23, cDNA was subjected to qPCR analysis using iQ(tm) SYBR(R) Green Supermix (BioRad, Cat #1708880) on BioRad CFX real time PCR system. In each qPCR run, known concentration of DNA standards at 5 serial dilutions was used to establish standard curve and calculation of starting quantity (SQ) of target transcripts. Specific primers for interrogating EGFP, KRAS, GAPDH (loading control) transcripts as well as for qPCR Standards are listed in Table 4. For each experimental sample, three replicates were performed, and each serial diluted Standard was assayed in duplicates. Relative mRNA copy number of target transcripts was calculated by multiplying individual starting quantity (SQ) to a corresponding scaling factor derived from loading control GAPDH SQ. By dividing the median of GAPDH SQ in a qPCR run to individual GAPDH SQ, a scaling factor for that particular sample was generated. Fold reduction was calculated using 1/2.sup.Ct.
TABLE-US-00006 TABLE4 TableofPrimersusedforqRT-PCR SEQ ID Primer NO: ID Sequence Target 58 oKN60F 5-ACCATCTTCCAGGAG GAPDH CGAGATCCCTC-3 59 oKN61R 5-TGCAGGAGGCATTGC GAPDH TGATGATCTTGA-3 60 oKN111FC 5-ACCATGAGTGATAACACTGC Standard GGC-3 61 OKN112RC 5-CGGTTCCCAACGATC Standard AAGGC-3 62 oKN424F 5-CAGCCACAACGTCTA EGFP TATCATGGCCG-3 63 oKN421R 5-GCTCAGGTAGTGGTT EGFP GTCGGGCAG-3 64 oKN469F 5-GGCCTGCTGAAAATG KRAS ACTGAATATAAAC-3 65 oKN470R 5-ACAAGATTTACCTCT KRAS ATTGTTGGATCATATTCG-3
[0096] RNA Polymerase inhibitor (Actinomycin D, ActD) treatment. In titration of ActD concentration experiment, cultures of HEK293T cells in 6-well plates transfected with either 1 g of pCDNA3.3-EGFP only (Negative control) or with 1 g of pCDNA3.3-EGFP and 4 g of Internal GFP X10-23 were treated with ActD at final concentration of 0, 10, 20, 40 M at 20 h post transfection and harvested at 4 h later (at 24 h post transfection). Treated cells were harvested and subjected to total RNA isolation and subsequent analyses. In benchmark experiment, 40 M ActD was added to HEK293T cells transfected with dual 4 g Internal and 4 g 3UTR of X10-23, 10-23, Inactive X10-23 or antisense at 44 h post transfection and incubated at 37 C. for additional 4 h prior harvesting time at 48 h post transfection. Treated cells were imaged and subjected to total RNA isolation and subsequent analyses.
[0097] RNA isolation. To each well of the 6-well plate of cells (HEK293T, HeLa or MDA-MB-231), total RNA isolation was performed using 1 mL/well Trizol Reagent (Invitrogen) according to the manufacturer instructions. Total RNA was treated with Turbo DNAse (20 U/reaction) at 37 C. for 30 min on shaker, and followed by purification using equal volume of Phenol-Chloroform, pH 4.5 (Thermal Fisher, Ambion Cat #: AM9720). Aqueous layer was transferred to a new tube and precipitated with one tenth volume of 5 M NaCl and one volume of isopropanol at 20 C. overnight. Precipitated RNA was pelleted at 4 C. and 15000 rpm using bench-top centrifuge and followed by two washes with cold (20 C.) 70% ethanol
[0098] General Information: 2F-araNTPs (faATP, faCTP, faGTP, faUTP) were obtained from Metkinen Chemistry (Kuusisto, Finland). DNA, FANA, and 5-hexynyl phosphoramidites, as well as Universal Support II CPG columns were purchased from Glen Research (Sterling, Virginia). TNA phosphoramidites were synthesized in-house following procedures reported previously in the art. Oligonucleotides containing FANA and TNA were synthesized on an ABI3400 DNA synthesizer using chemical synthesis reagents purchased from Glen Research (Sterling, Virginia). DNA and RNA oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IA). All oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis and quantified by UV absorbance. YM-3 microcentrifugal concentrators were purchased from EMD Millipore (Billerica, MA). Dulbecco's Modified Eagle Medium (DMEM) was purchased from ThermoFisher Scientific (Waltham, MA). Human serum and snake venom phosphodiesterase were purchased from Sigma Aldrich (St. Louis, MO). Human liver microsome was purchased from Sekisui XenoTech, LLC.
[0099] As used herein, the term about refers to plus or minus 10% of the referenced number.
[0100] Although there has been shown and described the preferred embodiment of the present invention, it will be readily apparent to those skilled in the art that modifications may be made thereto which do not exceed the scope of the appended claims. Therefore, the scope of the invention is only to be limited by the following claims. In some embodiments, the figures presented in this patent application are drawn to scale, including the angles, ratios of dimensions, etc. In some embodiments, the figures are representative only and the claims are not limited by the dimensions of the figures. In some embodiments, descriptions of the inventions described herein using the phrase comprising includes embodiments that could be described as consisting essentially of or consisting of, and as such the written description requirement for claiming one or more embodiments of the present invention using the phrase consisting essentially of or consisting of is met.