ENGINEERED VECTORS AND ORGANISMS CONTAINING THE SAME FOR ISOFLAVONE CONVERSION IN THE GUT
20240390432 ยท 2024-11-28
Inventors
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
Generally, the present disclosure contemplates engineered vectors, organisms (e.g., bacteria or bacteriophage) containing the same, and methods for treating the gut of mammalian species by providing the organism containing the engineered vector to the gut of a mammal. Example engineered organisms can include one or more genes isolated from microbial populations for promoting isoflavone metabolism.
Claims
1-24. (canceled)
25. A method for modifying the phenotype of a mammalian gut comprising: introducing to the mammalian gut a probiotic for the treatment of cardiovascular disease (CVD) comprising: a bacterium from the genus Escherichia containing therein at least two stable plasmids for isoflavone metabolism, said plasmids providing one or more components of isoflavone metabolism for converting Daidzein to Equol, Genistein to 5-Hydroxy-Equol, or both.
26. The method of claim 25, further comprising co-administering a transduction agent.
27. The method of claim 26, wherein the transduction agent comprises an antibiotic, a polycation, a bacteriophage, or a combination of two or more of the foregoing.
28. The method of claim 25, wherein introducing the probiotic to the mammalian gut is performed according to a dosage regimen.
29. The method of claim 28, wherein the dosage regimen comprises: introducing the probiotic having a concentration of the bacterium to the mammalian gut at a dosing schedule over the course of a time period.
30. The method of claim 29, wherein the concentration is between 110.sup.6 to 110.sup.10 CFU/mL.
31. The method of claim 29, wherein the time period is selected from: every 4 hours, every 6 hours, every 12 hours, every 24 hours, or every 48 hours.
32. The method of claim 29, wherein the time period is 1 day, 1 week, 1 month, or one year.
33. The method of claim 25, wherein the probiotic comprises: a first bacterium having a first plasmid comprising the nucleotide sequence or sequences encoding DZNR, DDRC, or both; and a second bacterium having a second plasmid comprising the nucleotide sequence or sequences encoding DHDR, THDR, or both.
34. The method of claim 33, wherein the ratio of the first bacterium to the second bacterium is no less than 9:1 and no greater than 1:9.
35-37. (canceled)
38. The method of claim 33, wherein the nucleotide sequence encoding Daidzein reductase (DZNR) comprises the sequence of SEQ ID 1.
39. The method of claim 33, wherein the nucleotide sequence encoding Dihydrodaidzein racemase (DDRC) comprises the sequence of SEQ ID 2.
40. The method of claim 33, wherein the nucleotide sequence encoding Dihydrodaidzein reductase (DHDR) comprises the sequence of SEQ ID 3.
41. The method of claim 33, wherein nucleotide sequence encoding Tetrahydrodaidzein reductase (THDR) comprises the sequence of SEQ ID 4.
42. The method of claim 25, wherein the first plasmid further comprises an antibiotic resistance gene, and wherein the second plasmid further comprises an antibiotic resistance gene.
43. The method of claim 42, wherein the antibiotic resistance gene of the first plasmid or the antibiotic resistance gene of the second plasmid is an ampicillin or a kanamycin resistance gene.
44. The method of claim 25, wherein the probiotic comprises a dosage form that can be taken orally.
45. The method of claim 44, wherein the dosage form comprises a liquid, a foodstuff, or a capsule.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION
[0028] Embodiments described herein can be understood more readily by reference to the following detailed description and examples. Elements, apparatus and methods described herein, however, are not limited to the specific embodiments presented in the detailed description and examples. It should be recognized that these embodiments are merely illustrative of the principles of the present disclosure. Numerous modifications and adaptations will be readily apparent to those of skill in the art without departing from the spirit and scope of the disclosure.
[0029] In addition, all ranges disclosed herein are to be understood to encompass any and all subranges subsumed therein. For example, a stated range of 1.0 to 10.0 should be considered to include any and all subranges beginning with a minimum value of 1.0 or more and ending with a maximum value of 10.0 or less, e.g., 1.0 to 5.3, 1 to 4, 3 to 7, 4.7 to 10.0, 3.6 to 7.9, or 5 to 8.
[0030] All ranges disclosed herein are also to be considered to include the end points of the range, unless expressly stated otherwise. For example, a range of between 5 and 10, from 5 to 10, or 5-10 should generally be considered to include the end points 5 and 10.
[0031] It is also to be understood that the article a or an refers to at least one, unless the context of a particular use requires otherwise.
[0032] In general, the present disclosure is directed to man-made vectors which include nucleic acid sequences encoding one or more proteins, carriers including one or more of the vectors described herein, methods for producing said vectors, and methods for improving gut health in a mammal which include introducing said vector to the mammal.
[0033] One example aspect of the present disclosure includes vectors which include one or more genes, the one or more genes having a nucleotide sequence encoding a protein selected from: Daidzein reductase (DZNR); Dihydrodaidzein racemase (DDRC); Dihydrodaidzein reductase (DHDR); or Tetrahydrodaidzein reductase (THDR).
[0034] As used herein, a vector is a transmissible genetic construct (e.g., a plasmid).
[0035] According to certain aspects of the present disclosure, a vector can be carried by a bacteria or bacteriophage to encapsulate and/or deliver the vector or vectors.
[0036] In some implementations, the nucleotide sequence encoding the protein can be derived from an organism such as L. garvieae, Coriobacteriaceae, or S. isoflavoniconvertens. For example, SEQ ID NOs 1-4 are nucleotide sequences derived from Lactococcus garvieae. However, for implementations of the present disclosure, genes encoding proteins for DZNR, DDRC, DHDR, or THDR may be derived from one or multiple organisms other than or in addition to Lactococcus garvieae.
[0037] For certain implementations, the nucleotide sequence derived from the organism can be modified (e.g., using codon optimization) to facilitate expression of the protein in a heterologous organism. For instance, codon optimization can be performed using one of the sequence ID listings herein (e.g., SEQ ID NO. 1) to generate an optimized SEQ ID NO. 1 for expression by Escherichia bacteria species.
[0038] In one example implementation, a vector can include two genes from Lactococcus garvieae. For instance, a vector can include the two genes from Lactococcus garvieae which encode the proteins DZNR and DHDR.
[0039] In some implementations, the vector can further include an antibiotic resistance gene. Alternatively, in certain implementations that vector can include no antibiotic resistance gene. One example advantage of a vector that does not include an antibiotic resistance gene is that this vector will not intentionally transmit antibiotic resistance to potentially pathogenic bacteria within the gut of mammalian populations.
[0040] Several non-limiting examples of antibiotic resistances genes can include a gene for resistance to ampicillin, kanamycin, streptomycin, penicillin, neomycin, gentamicin, chloramphenicol, erythromycin, zeocin, bleomycin, or tetracycline.
[0041] In some implementations, the vector can include a bacteriophage genome. An example vector in accordance with the present disclosure can include the nucleotide sequence encoding Daidzein reductase (DZNR) having the sequence of SEQ ID 1 or a codon optimized sequence thereof.
[0042] Another example vector in accordance with the present disclosure can include the nucleotide sequence encoding Dihydrodaidzein racemase (DDRC) having the sequence of SEQ ID 2 or a codon optimized sequence thereof.
[0043] A further example vector in accordance with the present disclosure can include the nucleotide sequence encoding Dihydrodaidzein reductase (DHDR) having the sequence of SEQ ID 3 or a codon optimized version thereof.
[0044] A still further example vector in accordance with the present disclosure can include the nucleotide sequence encoding Tetrahydrodaidzein reductase (THDR) having the sequence of SEQ ID 4 or a codon optimized version thereof.
[0045] One example implementation of the present disclosure can include a bacterium comprising one or more vectors according to the present disclosure, wherein one of the one or more vectors comprises the nucleotide sequences encoding DZNR and DDRC.
[0046] In certain example implementations, the bacterium including the one or more vectors can have a first plasmid and a second plasmid. According to an example aspect of the disclosure, the second plasmid can have a different nucleotide sequence from the first plasmid. For instance, the first plasmid may include the nucleotide sequences encoding DDRC and DZNR, and the second plasmid may include the nucleotide sequences encoding DHDR and THDR.
[0047] Additionally or alternatively, in some implementations a two bacterium system can be used where each bacterium includes a different plasmid (e.g., a first bacterium having the first plasmid and a second bacterium including the second plasmid).
[0048] In one example implementations, the one or more vectors can consist of one plasmid, and the one plasmid further includes the nucleotide sequences encoding DHDR, and THDR. Thus, the disclosure contemplates a bacterium having one plasmid that includes the nucleotide sequences encoding DZNR, DDRC, DDHDR, and THDR.
[0049] Several non-limiting examples of bacteria that can be used to contain the vector(s) described herein can include bacteria of Escherichia genus, Bacteroides genus, Bifidobacterium genus, Streptococcus genus, Bacillus, Enterococcus, or Lactobacillus genus.
[0050] For example, in some implementations, the bacteria of the Escherichia genus can be E. coli, in some implementations the bacteria of the Bacteroides genus can be B. intestinalis, the bacteria of the Bifidobacterium genus can in some implementations be B. longum, the bacteria of the Streptococcus genus can be S. thermophilus, the bacteria of the Bacillus genus can be B. subtilis, the bacteria of the Enterococcus genus can be E. faecium, and/or the bacteria of the Lactobacillus genus can be L. plantarum.
[0051] Another example implementation of the disclosure can include a bacterium from the genus Escherichia containing therein at least two stable plasmids for isoflavone metabolism, wherein said plasmids provide components (e.g., separate or unique components) for converting Daidzein to Equol, Genistein to 5-Hydroxy-Equol, or both. Isoflavone metabolism can be exemplified using several reaction pathways. For instance,
[0052] To further illustrate, in some embodiments, the separate isoflavone metabolism pathways that can be included in bacteria are provided in one or more genes described herein, such as the genes encoding a protein selected from: Daidzein reductase (DZNR), Dihydrodaidzein racemase (DDRC), Dihydrodaidzein reductase (DHDR), or Tetrahydrodaidzein reductase (THDR). In certain implementations, the genes can include a codon optimized nucleic acid sequence. In some such cases, the codon optimized nucleic acid sequence is generated to produce the same amino acid sequence. Any available techniques (e.g., online tool kits) may be used to generate the codon optimized nucleic acid sequence. For example, in some embodiments, the Integrated DNA Technologies (IDT) Codon Optimization Tool can be applied to design an optimal DNA sequence for expression of DZNR, DDRC, DHDR, and/or THDR in a host organism based on its codon usage.
[0053] In one example implementation, one of the at least two stable plasmids for metabolizing isoflavone includes the genes encoding DDRC and DZNR, wherein a second of the at least two stable plasmids for metabolizing isoflavone includes the genes encoding DHDR and THDR.
[0054] Another embodiment of the present disclosure can include a probiotic for the treatment of cardiovascular disease (CVD), the example probiotic including a bacterium according to the disclosure.
[0055] One example aspect of the probiotic is a dosage form, such as a dosage form that can be taken orally. Several example dosage forms of a probiotic described herein can include a liquid, a foodstuff, a capsule, or other acceptable form for ingestion.
[0056] A further example embodiment of the present disclosure can include a method for modifying the phenotype of a mammalian gut. The example method can comprise introducing to the mammalian gut a probiotic according to the present disclosure.
[0057] In some implementations, the method of modifying the phenotype of the mammalian gut can also include co-administering a transduction agent which can affect the transmission of vectors and/or uptake of vectors described herein.
[0058] Several non-limiting examples of transduction agents can include an antibiotic, a polycationic polymer (e.g., lipofectamine), a bacteriophage, a polycationic liposome, a polycationic nanoparticle, etc.
[0059] In some implementations, a method for modifying the phenotype of the mammalian gut described herein can be implemented so that introducing the probiotic to the mammalian gut is performed according to a dosage regimen.
[0060] For instance, in some methods the dosage regimen can include introducing the probiotic having a concentration of the bacterium to the mammalian gut at a dosing schedule over the course of a time period.
[0061] In an example implementation, the concentration of the bacterium is between 110.sup.6 to 110.sup.10 CFU/mL.
[0062] According to an aspect of the disclosure, the time period can be selected from: every 4 hours, every 6 hours, every 12 hours, every 24 hours, or every 48 hours.
[0063] Additionally or alternatively, the time period can be 1 day, 1 week, 1 month, or one year.
[0064] In one example embodiment, the probiotic provided to the mammalian gut can include: a first bacterium having a first plasmid comprising the nucleotide sequence or sequences encoding DZNR, DDRC, or both; and a second bacterium having a second plasmid comprising the nucleotide sequence or sequences encoding DHDR, THDR, or both. According to some example aspects of the disclosure, a ratio of the first bacterium to the second bacterium is no less than 9:1 and no greater than 1:9 such as 9:1 to 1:1, 1:1 to 1:9, or 1:1 to 1:5.
[0065] Another embodiment of the disclosure can include a method of producing a vector described herein. An example method can include: obtaining a cloning vector (e.g., a bacteriophage genome, phagemid, or plasmid); and inserting into the cloning vector the nucleotide sequence for Daidzein reductase (DZNR), Dihydrodaidzein racemase (DDRC), Dihydrodaidzein reductase (DHDR), or Tetrahydrodaidzein reductase (THDR). Moreover, in some such instances, the cloning vector does not include an antibacterial resistance gene.
[0066] According to certain aspects of the present disclosure, the cloning vector used to produce the man-made vector can include one or more restriction sites.
[0067] Further, inserting into the cloning vector the nucleotide sequence may include introducing a restriction enzyme to the cloning vector; providing a cloning sequence comprising the nucleotide sequence for Daidzein reductase (DZNR); Dihydrodaidzein racemase (DDRC); Dihydrodaidzein reductase (DHDR); or Tetrahydrodaidzein reductase (THDR); and ligating the cloning sequence to the cloning vector.
[0068] Another example aspect of producing the vector can include isolating the vector containing the nucleotide sequence.
[0069] In one aspect, the present invention will be better understood with reference to the following non-limiting examples and the drawings.
EXAMPLES
[0070] The present examples provide aspects of embodiments of the present disclosure. These examples are not meant to limit embodiments solely to such examples herein, but rather to illustrate some possible implementations.
Example 1
Plasmid Dosage and Persistence in Murine Gut
SUMMARY
[0071] Here we describe dosing strategies for introducing a plasmid to the bacterial community of the murine gut as evaluated on the ability of plasmid carriers to persist within the mouse gastrointestinal tract. Mice were provided carrier bacteria (E. coli) possessing a plasmid harboring a reporter gene and antibiotic resistance gene. Variations in dosage strategies included amount of donor bacteria, pretreatment of the gut with broad-spectrum antibiotics, and the extent of time in which the mice were provided the donor bacteria. Bacteria were collected from fecal pellets for analysis by plate assay to determine the proportion of bacteria carrying the introduced plasmid. As described further below, longer dosing regimens with plasmid donor bacteria can lead to a significantly increased duration for persistence of the plasmid within the gut. The amount of donor bacteria and use of antibiotic pretreatment marginally influenced the duration of plasmid persistence but did influence short-term abundance. Herein we describe a temporal assessment of plasmid introduced to the murine gut.
[0072] Mice were provided bacteria containing a genetic construct, known as a plasmid, and were examined for the persistence of the plasmid in the gut. Long-term persistence of the plasmid within the gut was identified when using extended schedules of dosing with donor bacteria carrying the plasmid. The use of higher amounts of dosing influenced short term abundance of the plasmid carrying bacteria in the gut.
INTRODUCTION
[0073] In the mammalian gut, dynamics of the environment, including continuous secretion of mucin, limit direct colonization of the underlying epithelium but permit high density microbial communities to reside. The diversity of species within and across hosts is believed to be spatially structured, as it is well known that the high bacterial densities presented in the mammalian gut, up to 10.sup.3 CFU/ml for the stomach and duodenum, 10.sup.8 CFU/ml for the jejunum and ileum, and 10.sup.12 CFU/g for the colon, are conducive to gene transfer. Gene transfer can occur among bacteria, and the importance of understanding these dynamics becomes clear when considering the possible impact such gene transfer events can have on the ability to break down food and drugs, the emergence of antibiotic resistance, and the communication with the host immune system. To explore the possibility of introducing new genetic elements to existing gut bacteria for modifying their metabolic capabilities, it is important to understand the transmission and persistence of mobile genetic constructs within the gut.
[0074] In this Example, we describe the introduction of plasmid to the murine gut to evaluate its availability to persist within the microbial community of the gastrointestinal tract in relation to dosage duration of donor bacteria and usage of antibiotic pre-treatment. See, e.g.,
[0075] In this Example, we specifically describe the persistence of a plasmid carrying a set of antibiotic selectable and fluorescently screen-able genetic markers introduced to the murine gut within E. coli as the donor. To test the hypothesis that the persistence of the plasmid would be dependent upon the residence time of the donor and the existing recipient population, plate-based culture assays of fecal samples were carried out to quantify the amount of plasmid carrier bacteria with respect to variations in antibiotic pretreatment duration and dosage schedule as well as amount for the E. coli donor. As described, we have identified that the persistence of an introduced plasmid can be extended significantly by regulating the dosage schedule, and antibiotic pre-treatment and amount produced short-term effects. The present disclosure can be extended beyond the described single form of donor bacteria and plasmid.
Methods
[0076] To begin examining gene transfer throughout the gut microbiota, we selected a plasmid pWR011 harboring a Kanamycin resistance cassette, ColE1 high copy origin of replication, and a red fluorescent mCherry gene under control of a PL(tetO) promoter. This was transformed into chemically competent E. coli that then served as the carrier bacteria for the subsequent murine studies. The presence of the reporter gene and selectable resistance allowed the bacteria which received and expressed the plasmid to be easily discerned. 16 Swiss-Webster mice (4 weeks of age from Charles River Labs, Wilmington, MA) were used in the studies involving examination of the effect of antibiotic pre-treatment and length of dosing. The mice were separated into 4 groups as follows: no antibiotic pre-treatment+1 week of carrier bacteria; no antibiotic pre-treatment+1 month of carrier bacteria; antibiotic pre-treatment+1 week of carrier bacteria; antibiotic pre-treatment+1 month of carrier bacteria. Antibiotic treatment was provided by replacing the water bottles with the following aqueous solution (1 g/L ampicillin, 1 g/L neomycin sulphate, 1 g/L metronidazole, 0.5 g/L vancomycin, and 5% sucrose). Carrier bacteria treatment was provided by replacing the water bottles with an aqueous solution containing 106 CFU/mL of carrier bacteria containing pWR011. An additional 24 Swiss-Webster mice were separated into 3 groups of 8 (4 male and 4 female) without addition of antibiotic and provided a single day dose of either 210.sup.9, 510.sup.8, or 310.sup.7 CFU of pWR011 carrier bacteria. Fecal pellet samples were collected regularly and plate-based cultures were used to determine the proportion of bacteria possessing the introduced plasmid within samples. The antibiotic and reporter genes allowed for simple quantification of the proportion of pWR011 carrier vs non-carrier bacteria without the plasmid.
Results
[0077] In order to examine the persistence of plasmid carriers in the murine gut, we analyzed the number of colony forming units (CFUs) from fecal pellets selected on Kanamycin containing media. To ensure accuracy in colony counting experiments, sample plating was conducted in sets of 5. The results of our analysis of the fecal pellets bacterial content reveals the number of bacteria possessing the pWR011 plasmid for mice having received 1 week of plasmid donor E. coli (
[0078] To determine if a longer dosage period for the donor bacteria would result in a change in the observed persistence of plasmid, we examined the presence of carrier bacteria in fecal pellets of mice that received 1 month of plasmid donor E. coli. The results in
DISCUSSION
[0079] We found that mice provided a 1-week dosage of donor E. coli are able to provide plasmid carrier persistence for almost a week. Interestingly, we note that the higher the single day dosage amounts of donor bacteria produced increases in carrier persistence but did noticeably provide increased abundance on plasmid carrier. In looking at the longer dosing regimens, we do see a very significant increase in the duration of the persistence of the plasmid within the gut. Not intending to be bound by theory, we believe this to be attributable to the longer duration course of donor bacteria providing more opportunities for transfer of plasmid to the existing commensal gut bacteria. There also exists the possibility that donor E. coli themselves are residing longer within the gut. Our comparison between broad-spectrum antibiotic pre-treated mice and untreated mice did not reveal any long-term differences in persistence; therefore, again not intending to be bound by theory, we believe these results may rule out long-term effects of donor E. coli residence as being the main contributor to the extended duration of persistence observed when using 1 month dosages. A higher carrier bacteria abundance observed for antibiotic pre-treated mice during the donor E. coli dosage period could also be observed and maybe reasonably attributed to increased survival of the input E. coli. Based on observations of decrease in the total commensal gut bacteria density during antibiotic use we may expect corresponding increases in donor survival. It is expected that these observed plasmid carriers counted in the fecal pellets of the 1-week dosage study were from the pWR011 plasmid donor E. coli that had survived the transit through the gut rather than the carriers being only transconjugants.
CONCLUSION
[0080] As disclosed in this Example, we provide an assessment of the plasmid carrier persistence in the murine gut. We revealed the effect of duration in plasmid donor dosing as well as antibiotic pre-treatment on persistence (
Example 2
Controlling the Persistence of an Engineered Bacterial Metabolite Pathway for Isoflavone Conversion in the Gut
SUMMARY
[0081] Metabolic pathways provided by bacteria in the gut can change the structure of dietary compounds that are ultimately absorbed by the host and in turn influence health. A natural isoflavone known as Equol is one such case of a microbially synthesized metabolite formed from dietary Daidzein. Equol has been found to be a selective agonist for estrogen receptor beta signaling indicated in reducing large artery stiffness. Unfortunately, only a fraction of the population possesses the intestinal bacteria capable of converting Daidzein from dietary soy into Equol such as via the pathway illustrated in
Methods
[0082] A set of plasmids was first constructed to facilitate expression of the enzymes DR, DHDR, and THDR from Slackia isoflavoniconvertens which is a recently isolated bacteria from a healthy human gut described in literature to have high activity for Daidzein conversion to Equol. The gene products were expressed in E. coli and the cultures were provided varying concentrations of Daidzein in order monitor its conversion. Production of dihydrodaidzein, tetrahydrodaidzein, and Equol (the desired end product) were assessed qualitatively by thin layer chromatography of the extracted isoflavones and monitored quantitatively by liquid chromatographymass spectrometry as a function of time. We first administered to Swiss-Webster mice distinct amounts of E. coli carrying a plasmid to express a red fluorescent mCherry reporter. Conditions were varied with respect to the concentration and length of E. coli dosage, and additional experiments using either antibiotic pre-treatment or concurrent treatment were also conducted. Fecal pellets were assessed longitudinally to serve as a representation of the proportion of reporter plasmid carrying bacteria that remained in the gut, and 16s metagenomics analysis was carried out to assess bacterial diversity.
Results
[0083] We found that using the P1 plasmid gene products we can convert Daidzein to dihydrodaidzein. Further, p2 plasmid gene products can be used to convert dihydrodaidzein to Equol. Qualitative TLC (
DISCUSSION
[0084] Examining the enzymes DR, DHDR, and THDR, we found that these enzymes demonstrated conversion of Daidzein to Equol. In assessing plasmid persistence in the murine gut, we herein describe that the amount of donor bacteria and use of antibiotic pre-treatment marginally influenced the duration of plasmid persistence but did influence short-term abundance. In contrast, providing a concurrent low dosage of antibiotic for which the plasmid carried the corresponding resistance, showed a significant increase in the plasmid persistence which may be attributable to the selective advantage for the carrier bacteria and potentially the resident bacteria as well to retain the plasmid. By altering the dosage duration, we found that we could also effectively modulate the persistence but not to the same degree as that using concurrent antibiotic treatment. We also describe how these dosage strategies may alter compositional diversity of the gut microbiome.
CONCLUSIONS
[0085] In summary, this Example provides a temporal assessment of plasmid introduced to the murine gut, which provides a strategy for controlling plasmid persistence as a function of provided dosage. We also demonstrate the activity of an engineered vector including DR, DHDR, and THDR. The vector once introduced to E. coli can convert Daidzein to the estrogen receptor beta agonist known as Equol. We describe new methods for the introduction and persistence of this metabolic pathway to the gut as one possible approach to engineering the intestinal microbiota toward an Equol producing phenotype in a more socially acceptable alternative to fecal transplant therapy.
Example 3
Engineering the Gut Virome for Equol Conversion as a Countermeasure for Arterial Aging
[0086] As an extension of Example 2 above and other disclosure herein, we describe herein the engineering of the gut virome for Equol conversion as a countermeasure for arterial aging. Cardiovascular disease (CVD) is the leading cause of death in the industrialized world and advanced age is the major risk factor for CVD. It is projected that by 2030, >40% of the population will have some form of CVD. Vascular aging manifests itself primarily through increases in large artery stiffness and impairments in endothelium dependent dilation (EDD) due to decreased nitric oxide (NO)-bioavailability and increases in reactive oxygen species (ROS). Both large elastic artery stiffness and endothelial dysfunction are predictive of future cardiovascular events and are present in patients with clinical CVD. A recent report has shown that broad spectrum antibiotic treatment to deplete the microbiota improves large artery stiffness and endothelial function in old mice, this was also associated with improvements in ROS. Although this report demonstrates a role for the microbiome, complete depletion of the microbiota as a prevention strategy for CVD is likely unfeasible and other strategies are needed. Equol is a selective agonist for ERbeta unlike other products that can activate ERalpha, androgen receptors, glucocorticoid receptors, progesterone receptor, and mineralocorticoid receptors. Only a minority fraction of the population possesses the proper intestinal bacteria capable of converting Daidzein, an abundant isoflavone in soy based products, into the natural product Equol. Individuals who have gut bacterial strains capable of producing Equol from dietary soy (referred to as Equol producers) experience a range of health benefits with soy intake. For example, Equol-producing postmenopausal women have demonstrated reduced levels of serum LDL-C of 6-8% as well as reduction in C-reactive protein after supplement with dietary soy but this effect is not seen for purified Daidzein supplement. Fecal transplant therapy can be provided to convert non-producers into Equol-producers where the new microbiota provides the ability to metabolize Daidzein to Equol. Thus, the ability to metabolize the Daidzein in dietary soy into Equol may be dependent on each individual's microbiota. Repeated testing of Equol-producers over prolonged periods indicate the status of the microbiota are remarkably stable once becoming an Equol-producer; however, the stigma of fecal transplant therapy along with ethical and social concerns prompt for a more widely acceptable alternative to engineer the intestinal microbiota.
Example 4
Engineering E. coli for Conversion of Dietary Isoflavones in the Gut
INTRODUCTION
[0087] Introducing metabolic pathways to the gut is important to tailor the biochemical components ultimately absorbed by the host. Given identical diets, hosts possessing different consortia of gut bacteria can exhibit distinct health outcomes regulated by metabolic capabilities of the gut microbiota. The disparate competency of the population to metabolize isoflavones, such as dietary Daidzein, has shown health benefits for those individuals possessing gut bacteria capable of producing Equol from Daidzein-rich diets. To begin addressing health inequalities due to gut metabolic pathway deficiencies, we developed a probiotic that allows metabolism of isoflavones as to provide a gut phenotype paralleling that of natural Equol producers. Further, we engineered E. coli to produce the enzymes necessary for conversion of Daidzein to Equol, and as demonstrated in a murine model these bacteria enabled elevated serum Equol levels to dietary Daidzein.
[0088] Isoflavones and isoflavone-derived compounds with structural similarity to steroid hormones can bind to estrogen or androgen receptors within different tissues serving as agonist or antagonists. Because dietary isoflavones can undergo different forms of biotransformation by gut bacteria, the metabolic pathways present within the gut can influence host health by modulating the biochemical profile of absorbed compounds. It has been reported that a minor fraction of the population possess gut bacteria capable of metabolizing dietary Daidzein into the estrogen receptor beta agonist known as Equol. Individuals displaying an Equol producing gut phenotype however have demonstrated health benefits, including reduced risk of cardiovascular disease when consuming Daidzein-rich foods such as soy. Accounts of microbial cultures derived from human fecal samples have shown Equol-producing capability can be imparted upon mixing of those bacteria with fecal culture from individuals that were not Equol producers. Providing a host with exogenous gut bacteria that express the enzymes needed for conversion of Daidzein into Equol has been shown in fecal transplant therapy to achieve an Equol producing phenotype in the host gut. In this Example, we describe development of a probiotic strain of E. coli that can provide conversion of dietary Daidzein into Equol to serve as a means for introducing the metabolic pathways necessary for the host gut to attain an Equol producing phenotype. The significance of providing the host with the ability to convert Daidzein to Equol follows from intestinal absorption of the Equol product, since increased serum Equol has reported positive endocrine-related health effects as a selective estrogen receptor modulator.
[0089] We describe the use of two separate engineered probiotic strains of E. coli Nissle 1917 for compartmentalizing the DZNR and DHDR enzymes in separate cells (
Results and Discussion
[0090] In this Example, the probiotic E. coli Nissle 1917 strain was engineered to express these recombinant proteins of L. garvieae strain 20-92, wherein two separate E. coli Nissle strains were produced. Specifically, transformation of E. coli Nissle with plasmid P1-DZNR-DDRC was carried out to produce the DZNR and DDRC expressing strain Nissle P1 and similarly transformation with P2-DHDR-THDR was used to produce Nissle P2 which expresses the DHDR and THDR genes. The separation of these genes across two strains is notable and is related to the NADPH cofactor requirements for catalysis by both the DZNR gene product and the DHDR gene product, to alleviate competition for NADPH and reduce the burden of overexpression of multiple recombinant enzymes in a single host cell. Using this approach, the formation of dihydrodaidzein product by Nissle P1 and Equol product by Nissle P2 was confirmed by thin layer chromatography (TLC) (
[0091] As shown in the TLC images, Daidzein control (lane 1), dihydrodaidzein control (lane 2), extracted sample of cell pellet from Nissle P1 culture provided Daidzein (lane 3), and extracted sample of supernatant from Nissle P1 culture provided Daidzein (lane 4) showing that the enzymes expressed in Nissle P1 remained within the cells and were not released into the supernatant as only the cell pellet sample showed conversion of Daidzein to dihydrodaidzein. B) TLC of dihydrodaidzein control (lane 1), Equol control (lane 2), extracted sample of cell pellet from Nissle P2 culture provided dihydrodaidzein (lane 3), and extracted sample of supernatant from Nissle P1 culture provided dihydrodaidzein (lane 4) showing that the enzymes expressed in Nissle P2 remained within the cells and were not released into the supernatant as only the cell pellet sample showed conversion of dihydrodaidzein to Equol
[0092] The activity of each strain was initially confirmed by TLC of the extracted product of Nissle P1 and Nissle P2 cell culture in the presence of Daidzein and dihydrodaidzein substrate, respectively. As seen in
[0093] To identify which, if either, of the strains in the two-strain conversion system was rate limiting, we investigated the amount of dihydrodaidzein and Equol production for whole-cell reactions of Nissle P1 and Nissle P2, respectively. As shown in
[0094] From these whole-cell kinetics experiments, we could identify the projected maximum rate for Nissle P1 formation of dihydrodaidzein (1.8 nM/s) as compared to the projected maximum rate for Nissle P2 formation of Equol (0.1 nM/s) revealing an order of magnitude faster rate for product formation by P1 wherein the projected maximum rate of product formation was determined based on a Michaelis-Menten model of kinetics. The enzyme was not found to be vulnerable to oxygen with little to no activity under aeration (shaking) conditions. Our reactions which were all conducted under aerobic conditions with orbital shaking at 180 rpm
[0095] Examining a mixed cell biotransformation system in which Nissle P1 and Nissle P2 were cultured separate and then mixed to provide a two-strain whole-cell reaction showed the final Equol product was formed upon addition of Daidzein substrate to the culture. Mixed cell populations of Nissle P1 and Nissle P2 at different proportions of Nissle P1 to Nissle P2 and holding the total amount of cells in the culture constant revealed that the ratio of the strains impacted Equol production as shown in
[0096] Interestingly, we see that the substrate flexibility of the L. garvieae 20-92 enzymatic pathway allowed for conversion of genistein to 5-hydroxy-Equol wherein we also observed an analogous faster rate in processing genistein to dihydrogenistein by Nissle P1 as compared to Nissle P2 showing slower formation of 5-hydroxy-Equol. This shows that the second half of the enzymatic pathway (that being dihydrogenistein to 5-hydroxy-Equol) proceeds slower than dihydrogenistein formation from genistein.
[0097] In order to demonstrate the ability of the Nissle strains P1 and P2 to be utilized as a cooperative mixture of probiotics to enhance the metabolic gut pathways for conversion of dietary Daidzein into Equol, we carried out a study in mice examining the serum Equol levels as a function of dietary Daidzein in the form of soy powder and supplementation of probiotic Nissle P1 and Nissle P2 via drinking water. Serum Equol levels of the mice were measured after 1 week of consumption of a low or high soy content supplement (1 or 8 soy loaded hydrogel). As seen in
[0098] To summarize, the examination of the co-administered Nissle P1 and Nissle P2 as probiotic for mice consuming Daidzein-rich soy revealed an impressive increase in the serum level of Equol present as compared to mice receiving no probiotic. The effect was more pronounced for mice provided supplement containing higher concentrations of soy. These levels provide one possible means for imparting a host gut with an Equol producing phenotype under a Daidzein-rich diet. In conclusion, we have demonstrated the successful use of recombinant genes from L. garvieae strain 20-92 expressed in E. coli Nissle for the conversion of the isoflavones Daidzein and Genistein. Finally, this two strain compartmentalized system demonstrated effective conversion of dietary Daidzein within a host murine gut after consumption of soy to form the product Equol resulting in elevated serum Equol levels.
TABLE-US-00001 SEQUENCES Sequencedefinitions DZNRsequence(daidzeinreductase[Lactococcusgarvieae]): ATGAAGAATAAATTTTATCCCAAAACCTTTGAACGTGGTTAC ATCGGGAATTTGGAAGTAGAAAACCGCGCGATCCGCATGCCTATGGGAAC AGAACTTGGCAACCCCGACGGTTCGCCCTCATGGGCTTCCCTTAAGGCGTA TGCTGAGGCTGCGGATGGTGGGACAGGTATTGTCTTTATGGATAACGCAG GTGTTACTCAGTTCCACCATGTCGGTTTGTCGCTGGCGTCAGATAATTATAT CGGTCCTATGAGTGTCTTGGCGAAAACTATTAAGCAGCATGGGGCAATTCC AGGTCTTCAAATTGTGCACCCTGGACGTGATGCTGCATTTGTGCGTGGCGA CGATCTTATCAGTTCTAGCCGCATTCAGTGGGAGCCTTGGTATGAAAATGG AGGGGCTGTTCCTCGCGAGCTGACAATCGAGGAAATTCATGATTTTGTGGG GTACTTCGGTGATTGTGCTTTACGTGCGCAAACAGCGGGGTTCGAAATCGT TGATGTCCACGCGGCGTGCGGGGTCCTGTTGTCCAACTTCTTGTCACCTCG CAACAATACTCGTAACGATATGTATGGCGGCTCGTTGCACAATCGTGCACG CTTTTTGTTAGAGGTAATCCGCGATATCAAAAAGAAGTGCCCGAACCTTCC ATTAGCTATTCGTCTTAGTGGAATCGACTTCGAGCCCGATGGAATCACTAT CGAAGAGACATGTGAGGTCGCGAAAATGTGTGAAGCAGCTGGGGCTGACG CCATCAACATTACCTGGGGCTCTCATGCTGAGGTAATCAATGCAGCAGGTT TGCTTTCTAAACATGGAGCGAACCACGTCGAGGCCGCGAAAATGATCAAA GACGCGGTAAGCATCCCGACTATGTTATGTGGGGGTATCTACAGCCCAGA AATTGGCGAAAAGTTACTTGAGGATGGTGTCTGCGACTTCATCGGGATTGG TAAGCCAGCTCTGGCTGACCCCATGTGGGCTAAAAAGGCGGCTGAGGGAC GCCCCGAGGACATTCGTCCGTGCATCGGTTGTGGAGTTGGATGCCACGATC GCGGGATGCTTTCCGGTGGAGTGGTACAATGCGCAGTCAACGCTGCCCTGT ACAAGTTTGATGAACCTGTCTACCCTCAAGCGGAAGTTCCCAAGAAAGTTA TTATTATTGGAGCGGGACCGGCAGGTTGTGAAGCAGCCATTACAGCGAAA AAATGCGGGCACGACGTCACAATTTACGAGAAGCGTAAAATCGGTGGCGT GCTGAAGGAGGCCACTGTGAGCGACTCCAAGGAGGATCTGGGTCGCTTAA TCACATATTACGAGACCCAGTTGAAAAAGGAGGGAATCGAGGTAATCTAT GAAGAAGCGACCGCGGATACCGTAGTGGCGGGCGGTTTCGACGTTGCGAT TGTTGCGTGTGGAGCCACAGTTCGCAATCTTAACATTGACGGCCAAGACGA CCCAAGCGTTGTGTACGCTATGGACTTCCTGGATAACGATTGCAAGTCAGA CGCCGACCGTGTAGTAGTTGTCGGGGGCGGAATTGTTGGCGCGGAAACTG CGCTTATTCTTGCGGAGGAGCGTGGGAAGGACGTAACCATTACAACTCGCT CACCAGAGTTCTTTGTATCTGGAGTGATGGGGATTGCCTATATGGTACGTT TAGGCATGGCCGGTGTAACCATTAAGCCCAGTACTCAATTGGTCGCCGTTA AGGATGGAAAGCCGATGTTCGCCGGGCCCCGTGGTTTGGAAACTCTTGAT GTGGACCAGACTATCATCTCTAGTGGCTTCGTGCCCACGTTTAACCAATTC CGTGCACAGATTGAAGAAAAGTGCGAAGACGTGCGTGTGATCGGGATCGG CGATTGCAAAGCATCTCGTATGGTAATGGATGCCGTTCATGAGGGGTACAT CGCAGGCTGTAACCTGTAATAG.(SEQIDNO.1). DDRCsequence(dihydrodaidzeinracemase[Lactococcusgarvieae]): ATGATTAAAGCACAATTAAATCGCATTGCGTTACGCGCTGCC GATGCTGATAAAGCCGTCGAAGACCTTAACAAATTGTTAGGTGTAACCTTC TACGGGCCGTACGATGACGAACACATGGGCCTGCGCGTTGCGTTACCGAA ATCGGGGGGCATTGAAGTCATGGCCCCGATGCACGATCACGACGCCATCG GCGCATATAAGGCATTACAGACGGTCGGAGAGGGTATCAGTGGTATCGCA ATGCGCGTGGACGACTTTGATGCCGCCAAGGAACACTTCGCAAGTCTTGG CTTAACGCCGGTTGTAGAGTTCAATCACGGAAAGTTTCGTGAGATGATCTT TCCCCCTCAGCCGGCAACGCACAACCTGGAAATCGCTGTGAACGAATTTCC AGATGCTAACGGCGCGGCCATTCAGGTGGCATTAGATATGGGTGTAGACT GGACTGATGTTTGTGACTGGGATGCGAAGTAGTAA.(SEQIDNO.2). DHDRsequence(dihydrodaidzeinreductase[Lactococcusgarvieae]): ATGGCTCAGGAAGTGAAAGTACCAAAAATGCCCGGTGCACC TGTTTTTGGTAAATGGATCTCACCGGAGGAGTCCGTGGGTCAGCGCCTGAA GGGTAAGAAGATTTTGTTGACCGGGACTACTAAGGGGGTGGGCCGTGTAA CGCAAGAGTTACTGTGTGCACATGGAGCGTTCGTGTGTGGGAGTGGCCGC ACGCCAGGGGTGGCTGCATCAGTTGCCGACGAATTGAAAGCAAAGGGTTA TCAGGCCGCAGGAATGGATGTAGACCTTTCTGACTACGATGCTGTAAAAA AGTGGGTCGAGGAGTGCGCCGAACTGATGGGTGGAATTGATGTTGTGATC AACAATGCCTCACACCCTGGCATGGCACCCTTCGGTGAGATGACACCGGA AATCTGGAATTACGGAATCAAGAACGAGCTGGATTTAGTGTACAACGTAT GCAATTGTGCATGGCCGTATTTACAAAAAGCCGATGGGGCATCAATCATTA TTACGTCAAGCACCGTAGCGTTACAAGGGAGCAACTCACCTCAGGCATGT CACGCAGCTTGTAAAGGGGCCTGTCTTTCACTGGCACGTCAGCTTGCCGCG GAAGGTGGGCCATTCGGAATCCGCTGTAACTCGGTTACGCCCGGCCTTGTT TGGACTGAGGCAATGAGTAACATCCCGAAGGAAATGGCCTCTGGTTTGGT TGCCGCTCAAACAACTCAGCAGGCCGTTGACCCGATGGACATTGCTTACGC CTATCTGTTCTTAGCCTCTGACGAAAGTCGCCAAATTACTGCCGCGAATAT CCCTGTGGATGGAGGTTGTGCAGGTGCCGTAACCGGTGGAATGCAGGGCG AAATCGAAGTATAATAG.(SEQIDNO.3). THDRsequence(tetrahydrodaidzeinreductase[Lactococcusgarvieae]): ATGGCGGAGTTTGACGTAGAGTATGATTTGGTAGTCGTCGGC GGGGGGGCTTCCGGCAAATCAGCTGCCTTGATTGCTGCCCGCGAAGGGAA ACGTGTTGTCGTTTTGGAGAAGATGCCGGAGACGGGGGGTTTGTCGATGTA CGCCGAGGGCACAGCAGCCTTTGAGTCTAGCATTCAGAACGAATTGGGAA CTCCCCGCCTTAGTAAATATCACTTTCCCACGAAACAGGAAGGCATCGAA AAGTTTATGGGGTATTCGCATCAACGTGCTAATTACGACGTAGTTCGTGCC TTCGTCGAAAATAGCGCCGAAACCATCGACATCTACCGTGACCTGGGTGT AGTATATAAAGCATGCGACATCGCCGCTGAAGACGATCCAAACGAGGTCT GGACGTTTCACTTGCCTGAGGGTCTTGGAGCACATTGTCAGGAAGTTCTGC TTGACGCGATTCAAAAACTGGATGTTGATATTTTCACATCCACTCCGGCGA AGGAACTTATCATTGAAGACGGGGCTGTCGTAGGAGTCGTCGCTGAATCC GACGGCGAGCCTCTGCGTGTGGGTGGCAAAGCTGTCATCCTTGCGACCGG AGGTATGGGATCAAGTCCAGAACGTATCTTCAAATATTCTTGGTTTGCGCC CGCGGCATATAATATGAACACTTTAACACCGCTTCAGAACGTAGGGGATG GCTTAGACCTTGCACTGTCAGCCGGGGCCGACCCGACCTACATCACTACTT GTCCAATCCTGGCAGCAGGAGGCCGCGACATGACTATGGACAGCCAGGTG GGAGGTGCCGGTGTTAATCCGGGGGTGTGGATTAACAAAACGGGACGCCG TTTTGCGGCCGAATCAGTAGCGGAGAATATCGGGGACATTGGAACATATT ATGGGAAACAGCCGGGTGGAGTTGTGTGGAGCATTTTGTCTCAGGCGGAC ATCGATCGCTTGGTCGCCGAAGGCTCTGAGATTGCCATTGGAGAGTTTGTT GTTTACCATAAGCCTATGGAACGCCTGCCCATCGAGCTGGAGGCCCACCTG GAGAGCGGGTTAGTTAAAAAGGCGGGAAGTTTTGAAGAACTTGCCGCTTT AATTGACGTACCCGTCGACACTTTCGTTGCAACAATGGCAGATTATAACGA GGCGTGTGAGAAAGGGTATGATGATGCTTTTATGAAGAAACCCCAGTACT TGCGCCCCATGGTTGAAGGTCCGTTCTATGCTATCCCACTTGCAACCGGAA CCATGGGATCGGCCGGAGGTATTCGCATCAACGGAAATATGCAAGTCGTA GACGCAGATTATAATGCGATTCCAGGTCTTTATGCCGTAGGGTTGGACGCG ACCGGTTTGTACGGTGACAGTTACAATATGGAAGTTCCGGGGGCCGCCAA TGGGTTCGCTCATACGTCAGGACGTATTGCAGCTCGTCACGCTATCTCCAC GATGTAGTAA.(SEQIDNO.4). Promoter: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC.(SEQID NO.5). BioBrickScar: TACTAGAG.(SEQIDNO.6). RibosomeBindingSite: AAGAAGGAGATATACC.(SEQIDNO.7). TranscriptionalTerminator: CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGT TTTTTG.(SEQIDNO.8). OriginalvectorsequenceincludingatetAregionthatwasremoved duringcloning: aaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtga accatcacccaaatcaagtttttggaggtcgaggtgccgtaaagcactaaatcggaaccctaaagggatctcgggaaaagc gttggtgaccaaaggtgccttttatcatcactttaaaaataaaaaacaattactcagtgcctgttataagcagcaattaattatgat tgatgcctacatcacaacaaaaactgatttaacaaatggttggtctgccttagaaagtatatttgaacattatcttgattatattatt gataataataaaaaccttatccctatccaagaagtgatgcctatcattggttggaatgaacttgaaaaaattagccttgaatacat tactggtaaggtaaacgccattgtcagcaaattgatccaagagaaccaacttaaagcttatgatagtgatgtgcttaaaaactta ctcaatggctggtttatgcatatcgcaatacatgcgaaaaacctaaaagagcttgccgataaaaaaggccaatttattgctattt accgcggctttttattgagcttgaaagataaataaaatagataggttttatttgaagctaaatcttctttatcgtaaaaaatgccctc ttgggttatcaagagggtcattatatttcgcggaataacatcatttggtgacgaaataactaagcacttgtctcctgtttactcccc tgagcttgaggggttaacatgaaggtcatcgatagcaggataataatacagtaaaacgctaaaccaataatccaaatccagc catcccaaattggtagtgaatgattataaataacagtaaacagtaatgggccaataacaccggttgcattggtaaggctcacc aataatccctgtaaagcaccttgctcatgactctttgtttggatagacatcactccctgtaatgcaggtaaagcgatcccaccac cagccaataaaattaaaacagggaaatctaaccaaccttcagatataaacgctaaaaaggcaaatgcactactatctgcaata aattcgagcagtactgccgttttttcgccccatttagtggctattcttcctgccacaaaggcttggaatactgagtgtaaaagac caagacccgctaatgaaaagccaaccatcatgctattccatccaaaacgattttcggtaaatagcacccacaccgttgcggg aatttggcctatcaattgcgctgaaaaataaataatcaacaaaatgggcatcgttttaaataaagtgatgtataccgaatt cgattgcgtctcaacccctacttcggtatctgtattatcacgtgtatttttggtttcacggaaccaaaacataaccacaaggaaa gtgacaatatttagcaacgcagcgataaaaaagggactatgcggtgaaatctctcctgcaaaaccaccaataataggcccc gctattaaaccaagcccaaaacttgcccctaaccaaccgaaccacttcacgcgttgagaagctgaggtggtatcggcaatg accgatgccgcgacagccccagtagctcctgtgatccctgaaagcaaacggcctaaatacagcatccaaagcgcacttga aaaagccagcaataagtaatccagcgatgcgcctattaatgacaacaacagcactgggcgccgaccaaatcggtcagaca tttttccaagccaaggagcaaagataacctgcattaacgcataaagtgcaagcaatacgccaaagtggttagcgatatcttcc gaagcaataaattcacgtaataacgttggcaagactggcatgataaggccaatccccatggcatcgagtaacgtaattacca atgcgatctttgtcgaactattcatttcacttttctctatcactgatagggagtggtaaaataactctatcaatgatagagtgtcaac aaaaattaggaattaatgatgtctagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatc gaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcggg ctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattt tttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctaca gaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcag cgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctacta ctgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttga attgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtcttaaaagcagcataacctttttccgtgatggtaacttc acggtaaccaagatgtcgagttaaccaccctttagattcataaagcgaaaataatgcggctccaacgtacccacctaaatgg aaacggcgttcactccaatctaaacacgcacaacagattttacgtgaatgtttggaaggaacgtcaattcccatttcatgaaaa tattgaataccacttaatgtgatcattgaaccattttcagtgatccattgctgttgacaaagggaatcatagatcccccgatttaga gcttgacggggaaagccggagaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctg gcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtactatggttg ctttgacgagcacgtacaacgtgctttcctcgttagaatcagaacgggagctaaacaggaggccgattaaagggattttaga caggaacggcacaccagaatcttgagaagtgtttttgtaatcagtgaggccaccgagcaaaagagtctgaccatcacgcaa attaaccgttgtcgcaatacttctttgattagtaataacatcacttgcctgagtagaagaactcaaactatcggccttactggttat atctaaaacaatattaccgccagccattgcaacgggaaaaacactcatagaaataccaacattttgacgctcaaccgtctgaa atggattatttacattggcagattcaccagttacacgaccagtaataaaagggacattctggccaacagaaatagaacccttct gacctgaaagcgtaagaatacgaggcacagacaatatttttgaatggctattagtctttaatgcgcgaactgatagccctaaaa catcgccgttaaaaataccgaacgaaccacccgcagaagataaaacagaggttagacggtcagtattaacaccaccagca acagtgccgcgctgagagccagcagcaaaggaaaaatctaaagcatcaccttgctgaacctcgaaaattaatccttcaatca atatctggtcagttggcaaatcaacagtagaaagaaattgcggaaggttatctaaaatatctttaggggcgctaactactaata agttagaaccatcaacagataatacatttgaggatttagatgtattagatttaacaaacaattctacaacccttattaaatcctttgc gcgaacgttattaattttaaatgtttgagtaacattatcattttgcggaacaaagaaaccaccagaaggagcggaattatcatca tattcctgaatatcagatgatggcaattcatcaatataatcctgactatttgggttatatttctgaattatggaaggaattgagccaa ccatatcaaaattattagcacgtaaaacagagataaagaaattgcgtaaattttcaggcttaacgtcagaggaatatacagtca ctgtacctttaacatcaggtgagacaataacagattcacctgtttgctttgaataccaagtcacgaaatcgcgcagaggcgaat tattcatttcaattacttgagcaaaagaagatgatgaaacaaacatcaagaaaacaaaattaattacatttaacaatttcatttgaa ttaccttttttaattgaaacagtacataaatcaatatatgtgatggaataaccttgcttctgtaaatcgtcgctattaattaattttc ccttagaatccttgaaaacatagcgatagcttagattaagacgctgagaagagtcaatagtgaatttatcaaaatcataggtctgag agactacctttttaacctccggcttaggttgggttatataactatatgtaaatgctgatgcaaatcctatcgcaagacaaagaac gcgagaaaactttttcaaatatattttagttaatttcatcttctgacctaaatttaatggtttgaaataccgaccgtgtgataaataag gggttaaatatgaataaacacctgaatcataattactggaaaaagcctgtttagtgtcatatgcgttatataaattcttaccagtat aaagccaacgctcaacagtagggcttaattgagaatcaccatatttaacaacaccaacatgtaatttaggcagaggcatttttg agccagtaacaagagaatataaagtgccgacaaagggtaaagtaattctgtccagacggcgacaataaacaacgtgttcag ctaatgcagaacgcgcctgtttatcaacaatagataaatcctgaacaagaaaaataatatcccatcccaatttacgagcatgaa gaaaccaatcaataatcggctgtctttccttgtcattccatgaacgggtattaaaccaagtaccgcattcatcaagaacaagca aaccgtttttattttcgtcgtaggaatcattaccacgaccaatagcaagcaaatcagaaatagaaggcttatccggtattctaag aacgcgaggcgttttagcgaacctcccgacttgcgggaggttttgaagccttaaatcaagattagttgctattttgcacccagc tacaattttatcctgaatcttaccaacgctaacgagcgtctttccagagcctaatttgccagttacaaaataaacagccatatttat ttatcccaatccaaataagaaacgattttttgtttaacgtcaaaaatgaaaatagcagcctttacagagagaataacataaaaac agggaagcgcattagacgggagaattaactgaacgccctgaacaaaatcagagggtaattgtgcgctaatatcagagagat aacccacaagaattgagttaagcccaataataagagcaagaaacaatgaaatagcaatagctatcttaccgaagcccttttta aggaaagtaagcagatagccgaacaaagttaccagaaggaaaccgaggaaacgcaataataacggaatacccaaaaga actggcatgattaagactccttattacgcagtatgttagcaaacgtcgaaaatacatacataaaggtggcaacatataaaagaa acgcaaagacaccacggaataagtttattttgtcacaatcaatagaaaattcatatggtttaccagcgccaaagacataaggg cgacattcaaccgactgaggcaaagaaggtaaatattgacggaaattattcattaaaggtgaattatcaccgtcaccgacttg agccatttgggaattagagccagcaaaatcaccagtagcaccattaccattagcaaggccggaaacgtcaccaatgaaacc atcgatagcagcaccgtaatcagtagcgacagaatcaagtttgcctttagcgtcagactgtagcgcgttttcatcggcattttc ggtcatagcccccttattagcgtttgccattttttcataatcaaaatcaccggaaccggagccgccaccggaaccgccaccct cagagccgccaccctcagaaccgccaccctcagagccgccaccctcagagccgccaccagaaccaccaccagagccg ccgccagcattgacaggaggttgaggcaggtcagacgattggccttgatattcacaaacgaatggatcctcattaaagccag aatggaaagcgcagtctctgaatttaccgttccagtaagcgtcatacatggcttttgatgatacaggagtgtactggtaataagt tttaacggggtcagtgccttgagtaacagtgcccgtataaacagttaatgcaccctgcctatttcggaacctattattctgaaac atgaaagtattaagaggctgagactcctcaagagaaggattaggattagcggggttttgctcagtaccaggcggataagtgc cgtcgagagggttgatataagtatagcccggaataggtgtatcaccgtactcaggaggtttagtaccgccaccctcagaacc gccaccctcagaaccgccaccctcagagccaccaccctcattttcagggatagcaagcccaataggaacccatgtaccgta acactgagtttcgtcaccagtacaaaccacaacgcctgtagcattccacagacagccctcatagttagcgtaacgatctaaag ttttgtcgtctttccagacgttagtaaatgaattttctgtatgaggttttgctaaacaactttcaacagtttcagcggagtgagaata gaaaggaacaactaaaggaattgcgaataataattttttcacgttgaaaatctccaaaaaaaaaggctccaaaaggagccttt aattgtatcggtttatcagcttgctttcgaggtgaatttcttaaacagcttgataccgatagttgcgccgacaatgacaacaacca tcgcccacgcataaccgatatattcggtcgctgaggcttgcagggagtcaaaggccgcttttgcgggatcgtcaccctcagc agcgaaagacagcatcggaacgagggtagcaacggctacggaggctttgaggactaaagactttttcatgaggaagtttcc attaaacgggtaaaatacgtaatgccactacgaaggcaccaacctaaaacgaaagaggcgaaagaatacactaaaacact catctttgacccccagcgattataccaagcgcgaaacaaagtacaacggagatttgtatcatcgcctgataaattgtgtcgaa atccgcgacctgctccatgttacttagccggaacgaggcgcagacggtcaatcataagagaaccgaactgaccaactttga acgaggacagatgcacggtgtacagaccaggcgcatacgctggctgaccttcgtcgagagtaatcttgacaagcaccgga tattcattacccaaatcaacgtaacaaagctgctcattcagtgaataaggcttgccctgacgagaaacaccagaacgggtagt aaattgcgcttgagacggtttaatttcaactttaatcattttgaattaccttatgcgattttaagaactggctcattataccagtcag gacgttgggaggaaaaatctacgttaataaaacgaactaacggaacaacattattacaggtggaaagattcatcaattgagat ttaggaataccacactcaactaatgcagatacataacgccaaaaggaattacgaggcatggtaagagcaacactatcataac cctcattaaccagacgacgatagaaaccaaaatagcgagaggcttttgcaaaggaagttttgccagagggggtaattgtaaa atgtttagactggatagcgtccaatactgcggaatcgtcataaatattcattgaatccccctcaaatgctttaaacagttcagaaa acgagaatgaccataaatcaaaaatcaggtctttaccctgtctattatagtcagaagcaaagcgaattgcatcaaaaagattaa gaggaagcccgaaagacttcaaatatcgcgtttcaattcgagcctcaaagcgaaccagaccggaagcaaattccaacaggt caggattagacagtacctttaattgctccttttgataagaggtcatttttgcggatggcttagagcttaattgctgaatctggtgct gtagttcaacatgttttaaatatgcaactaaagtacggtgtctggaagtttcattccatgtaacagttgattcccaattctgcgaac gagtagatttagtttgaccattagatacatttcgcaaatggtcaataacctgtttagctatattttcatttggggcgcgagctgaaa aggtggcatcaattctactaatggtagtagcgttaacatccaataaatcgtacaagcaaggcagagagttagcaaaattaagc aataaagcctcagagcataaagctaaatcggttgtaccaaaaacattatgaccctgtaatacttttgctggtgaagccttaatttc aacgcagggataaaaatttttagaaccctcatatattttaaatgcaatgccggagtaatgagtaggcaaagattcaaacgggt gagaaaggccggagacagtcaaatcaccgtcaatatgatattcaaccgttctagctgataaattcatgccggagagggtagc tatttttgagaggtctacaaaggctatcaggtcattacctgaaagtctggagcaaacaagagaatcgatgaacggtaatcgta aaactagcatgtcaatcatatgtaccccggttgataatcagaaaagccccaaaaacaggatgattgtataagcaaatatttaaa ttgtaaacgttaatgttttgttaaatttcgcgttaaatatttgttaaatcagcttattttttaaccagtaagcagaaaatgacaaaa atccttataaatcaaaagaataggccgagttagttgtgagtgttgttccagtttggaacaagagtccactatt.(SEQIDNO. 9). TetApromoterregionwithinSEQIDNO.9removedduring cloning: Cgattgcgtctcaacccctacttcggtatctgtattatcacgtgtatttttggtttcacggaaccaaaacat aaccacaaggaaagtgacaatatttagcaacgcagcgataaaaaagggactatgcggtgaaatctctcctgcaaaaccacc aataataggccccgctattaaaccaagcccaaaacttgcccctaaccaaccgaaccacttcacgcgttgagaagctgaggt ggtatcggcaatgaccgatgccgcgacagccccagtagctcctgtgatccctgaaagcaaacggcctaaatacagcatcc aaagcgcacttgaaaaagccagcaataagtaatccagcgatgcgcctattaatgacaacaacagcactgggcgccgacca aatcggtcagacatttttccaagccaaggagcaaagataacctgcattaacgcataaagtgcaagcaatacgccaaagtggt tagcgatatcttccgaagcaataaattcacgtaataacgttggcaagactggcatgataaggccaatccccatggcatcgagt aacgtaattaccaatgcgatctttgtcgaactattcatttcacttttctctatcactgatagggagtggtaaaataactctatcaa tgatagagtgtcaacaaaaattaggaattaatgatgtctaga.(SEQIDNO.10) Examplemodifiedvector:fd-DZNR-DDRC,thecapitalizedportion wasinsertedtoreplacetheTetAregionoftheoriginalvectorsequenceand havingthelayoutof:BioBrickPrefix-Promoter-BioBrickScar-Ribosome bindingsite-DZNRsequence-Ribosomebindingsite-DDRCsequence- Transcriptionalterminator-BioBrickSuffix aaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtga accatcacccaaatcaagtttttggaggtcgaggtgccgtaaagcactaaatcggaaccctaaagggatctcgggaaaagc gttggtgaccaaaggtgccttttatcatcactttaaaaaaaaaaacaattactcagtgcctgttataagcagcaattaattatgat tgatgcctacatcacaacaaaaactgatttaacaaatggttggtctgccttagaaagtatatttgaacattatcttgattatatta ttgataataataaaaaccttatccctatccaagaagtgatgcctatcattggttggaatgaacttgaaaaaattagccttgaatac attactggtaaggtaaacgccattgtcagcaaattgatccaagagaaccaacttaaagcttatgatagtgatgtgcttaaaaactta ctcaatggctggtttatgcatatcgcaatacatgcgaaaaacctaaaagagcttgccgataaaaaaggccaatttattgctattt accgcggctttttattgagcttgaaagataaataaaatagataggttttatttgaagctaaatcttctttatcgtaaaaaatgccct cttgggttatcaagagggtcattatatttcgcggaataacatcatttggtgacgaaataactaagcacttgtctcctgtttactccc ctgagcttgaggggttaacatgaaggtcatcgatagcaggataataatacagtaaaacgctaaaccaataatccaaatccagc catcccaaattggtagtgaatgattataaataacagtaaacagtaatgggccaataacaccggttgcattggtaaggctcacc aataatccctgtaaagcaccttgctcatgactctttgtttggatagacatcactccctgtaatgcaggtaaagcgatcccaccac cagccaataaaattaaaacagggaaatctaaccaaccttcagatataaacgctaaaaaggcaaatgcactactatctgcaata aattcgagcagtactgccgttttttcgccccatttagtggctattcttcctgccacaaaggcttggaatactgagtgtaaaagac caagacccgctaatgaaaagccaaccatcatgctattccatccaaaacgattttcggtaaatagcacccacaccgttgcggg aatttggcctatcaattgcgctgaaaaataaataatcaacaaaatgggcatcgttttaaataaagtgatgtataccgaattcGC GGCCGCTTCTAGAGTTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTA CTAGAGAAGAAGGAGATATACCATGAAGAATAAATTTTATCCCAAAACCT TTGAACGTGGTTACATCGGGAATTTGGAAGTAGAAAACCGCGCGATCCGC ATGCCTATGGGAACAGAACTTGGCAACCCCGACGGTTCGCCCTCATGGGC TTCCCTTAAGGCGTATGCTGAGGCTGCGGATGGTGGGACAGGTATTGTCTT TATGGATAACGCAGGTGTTACTCAGTTCCACCATGTCGGTTTGTCGCTGGC GTCAGATAATTATATCGGTCCTATGAGTGTCTTGGCGAAAACTATTAAGCA GCATGGGGCAATTCCAGGTCTTCAAATTGTGCACCCTGGACGTGATGCTGC ATTTGTGCGTGGCGACGATCTTATCAGTTCTAGCCGCATTCAGTGGGAGCC TTGGTATGAAAATGGAGGGGCTGTTCCTCGCGAGCTGACAATCGAGGAAA TTCATGATTTTGTGGGGTACTTCGGTGATTGTGCTTTACGTGCGCAAACAG CGGGGTTCGAAATCGTTGATGTCCACGCGGCGTGCGGGGTCCTGTTGTCCA ACTTCTTGTCACCTCGCAACAATACTCGTAACGATATGTATGGCGGCTCGT TGCACAATCGTGCACGCTTTTTGTTAGAGGTAATCCGCGATATCAAAAAGA AGTGCCCGAACCTTCCATTAGCTATTCGTCTTAGTGGAATCGACTTCGAGC CCGATGGAATCACTATCGAAGAGACATGTGAGGTCGCGAAAATGTGTGAA GCAGCTGGGGCTGACGCCATCAACATTACCTGGGGCTCTCATGCTGAGGT AATCAATGCAGCAGGTTTGCTTTCTAAACATGGAGCGAACCACGTCGAGG CCGCGAAAATGATCAAAGACGCGGTAAGCATCCCGACTATGTTATGTGGG GGTATCTACAGCCCAGAAATTGGCGAAAAGTTACTTGAGGATGGTGTCTG CGACTTCATCGGGATTGGTAAGCCAGCTCTGGCTGACCCCATGTGGGCTAA AAAGGCGGCTGAGGGACGCCCCGAGGACATTCGTCCGTGCATCGGTTGTG GAGTTGGATGCCACGATCGCGGGATGCTTTCCGGTGGAGTGGTACAATGC GCAGTCAACGCTGCCCTGTACAAGTTTGATGAACCTGTCTACCCTCAAGCG GAAGTTCCCAAGAAAGTTATTATTATTGGAGCGGGACCGGCAGGTTGTGA AGCAGCCATTACAGCGAAAAAATGCGGGCACGACGTCACAATTTACGAGA AGCGTAAAATCGGTGGCGTGCTGAAGGAGGCCACTGTGAGCGACTCCAAG GAGGATCTGGGTCGCTTAATCACATATTACGAGACCCAGTTGAAAAAGGA GGGAATCGAGGTAATCTATGAAGAAGCGACCGCGGATACCGTAGTGGCGG GCGGTTTCGACGTTGCGATTGTTGCGTGTGGAGCCACAGTTCGCAATCTTA ACATTGACGGCCAAGACGACCCAAGCGTTGTGTACGCTATGGACTTCCTG GATAACGATTGCAAGTCAGACGCCGACCGTGTAGTAGTTGTCGGGGGCGG AATTGTTGGCGCGGAAACTGCGCTTATTCTTGCGGAGGAGCGTGGGAAGG ACGTAACCATTACAACTCGCTCACCAGAGTTCTTTGTATCTGGAGTGATGG GGATTGCCTATATGGTACGTTTAGGCATGGCCGGTGTAACCATTAAGCCCA GTACTCAATTGGTCGCCGTTAAGGATGGAAAGCCGATGTTCGCCGGGCCC CGTGGTTTGGAAACTCTTGATGTGGACCAGACTATCATCTCTAGTGGCTTC GTGCCCACGTTTAACCAATTCCGTGCACAGATTGAAGAAAAGTGCGAAGA CGTGCGTGTGATCGGGATCGGCGATTGCAAAGCATCTCGTATGGTAATGG ATGCCGTTCATGAGGGGTACATCGCAGGCTGTAACCTGTAATAGAAGAAG GAGATATACCATGATTAAAGCACAATTAAATCGCATTGCGTTACGCGCTGC CGATGCTGATAAAGCCGTCGAAGACCTTAACAAATTGTTAGGTGTAACCTT CTACGGGCCGTACGATGACGAACACATGGGCCTGCGCGTTGCGTTACCGA AATCGGGGGGCATTGAAGTCATGGCCCCGATGCACGATCACGACGCCATC GGCGCATATAAGGCATTACAGACGGTCGGAGAGGGTATCAGTGGTATCGC AATGCGCGTGGACGACTTTGATGCCGCCAAGGAACACTTCGCAAGTCTTG GCTTAACGCCGGTTGTAGAGTTCAATCACGGAAAGTTTCGTGAGATGATCT TTCCCCCTCAGCCGGCAACGCACAACCTGGAAATCGCTGTGAACGAATTTC CAGATGCTAACGGCGCGGCCATTCAGGTGGCATTAGATATGGGTGTAGAC TGGACTGATGTTTGTGACTGGGATGCGAAGTAGTAACTAGCATAACCCCTT GGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTACTAGattagataaaagtaaagtga ttaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtaga gcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatac tcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcg cgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgcca acaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagag catcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgat caccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgg gtcttaaaagcagcataacctttttccgtgatggtaacttcacggtaaccaagatgtcgagttaaccaccctttagattcataaa gcgaaaataatgcggctccaacgtacccacctaaatggaaacggcgttcactccaatctaaacacgcacaacagattttacg tgaatgtttggaaggaacgtcaattcccatttcatgaaaatattgaataccacttaatgtgatcattgaaccattttcagtgatcca ttgctgttgacaaagggaatcatagatcccccgatttagagcttgacggggaaagccggagaacgtggcgagaaaggaag ggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgcc gcgcttaatgcgccgctacagggcgcgtactatggttgctttgacgagcacgtacaacgtgctttcctcgttagaatcagaac gggagctaaacaggaggccgattaaagggattttagacaggaacggcacaccagaatcttgagaagtgtttttgtaatcagt gaggccaccgagcaaaagagtctgaccatcacgcaaattaaccgttgtcgcaatacttctttgattagtaataacatcacttgc ctgagtagaagaactcaaactatcggccttactggttatatctaaaacaatattaccgccagccattgcaacgggaaaaacac tcatagaaataccaacattttgacgctcaaccgtctgaaatggattatttacattggcagattcaccagttacacgaccagtaat aaaagggacattctggccaacagaaatagaacccttctgacctgaaagcgtaagaatacgaggcacagacaatatttttgaa tggctattagtctttaatgcgcgaactgatagccctaaaacatcgccgttaaaaataccgaacgaaccacccgcagaagata aaacagaggttagacggtcagtattaacaccaccagcaacagtgccgcgctgagagccagcagcaaaggaaaaatctaa agcatcaccttgctgaacctcgaaaattaatccttcaatcaatatctggtcagttggcaaatcaacagtagaaagaaattgcgg aaggttatctaaaatatctttaggggcgctaactactaataagttagaaccatcaacagataatacatttgaggatttagatgtatt agatttaacaaacaattctacaacccttattaaatcctttgcgcgaacgttattaattttaaatgtttgagtaacattatcattttg cggaacaaagaaaccaccagaaggagcggaattatcatcatattcctgaatatcagatgatggcaattcatcaatataatcctga ctatttgggttatatttctgaattatggaaggaattgagccaaccatatcaaaattattagcacgtaaaacagagataaagaaatt gcgtaaattttcaggcttaacgtcagaggaatatacagtcactgtacctttaacatcaggtgagacaataacagattcacctgtt tgctttgaataccaagtcacgaaatcgcgcagaggcgaattattcatttcaattacttgagcaaaagaagatgatgaaacaaa catcaagaaaacaaaattaattacatttaacaatttcatttgaattaccttttttaattgaaacagtacataaatcaatatatgtga tggaataaccttgcttctgtaaatcgtcgctattaattaattttcccttagaatccttgaaaacatagcgatagcttagattaagacgc tgagaagagtcaatagtgaatttatcaaaatcataggtctgagagactacctttttaacctccggcttaggttgggttatataacta tatgtaaatgctgatgcaaatcctatcgcaagacaaagaacgcgagaaaactttttcaaatatattttagttaatttcatcttctga cctaaatttaatggtttgaaataccgaccgtgtgataaataaggggttaaatatgaataaacacctgaatcataattactggaaa aagcctgtttagtgtcatatgcgttatataaattcttaccagtataaagccaacgctcaacagtagggcttaattgagaatcacc atatttaacaacaccaacatgtaatttaggcagaggcatttttgagccagtaacaagagaatataaagtgccgacaaagggta aagtaattctgtccagacggcgacaataaacaacgtgttcagctaatgcagaacgcgcctgtttatcaacaatagataaatcct gaacaagaaaaataatatcccatcccaatttacgagcatgaagaaaccaatcaataatcggctgtctttccttgtcattccatga acgggtattaaaccaagtaccgcattcatcaagaacaagcaaaccgtttttattttcgtcgtaggaatcattaccacgaccaata gcaagcaaatcagaaatagaaggcttatccggtattctaagaacgcgaggcgttttagcgaacctcccgacttgcgggagg ttttgaagccttaaatcaagattagttgctattttgcacccagctacaattttatcctgaatcttaccaacgctaacgagcgtctttc cagagcctaatttgccagttacaaaataaacagccatatttatttatcccaatccaaataagaaacgattttttgtttaacgtcaaa aatgaaaatagcagcctttacagagagaataacataaaaacagggaagcgcattagacgggagaattaactgaacgccct gaacaaaatcagagggtaattgtgcgctaatatcagagagataacccacaagaattgagttaagcccaataataagagcaa gaaacaatgaaatagcaatagctatcttaccgaagccctttttaaggaaagtaagcagatagccgaacaaagttaccagaag gaaaccgaggaaacgcaataataacggaatacccaaaagaactggcatgattaagactccttattacgcagtatgttagcaa acgtcgaaaatacatacataaaggtggcaacatataaaagaaacgcaaagacaccacggaataagtttattttgtcacaatca atagaaaattcatatggtttaccagcgccaaagacataagggcgacattcaaccgactgaggcaaagaaggtaaatattgac ggaaattattcattaaaggtgaattatcaccgtcaccgacttgagccatttgggaattagagccagcaaaatcaccagtagca ccattaccattagcaaggccggaaacgtcaccaatgaaaccatcgatagcagcaccgtaatcagtagcgacagaatcaagt ttgcctttagcgtcagactgtagcgcgttttcatcggcattttcggtcatagcccccttattagcgtttgccattttttcataatcaaa atcaccggaaccggagccgccaccggaaccgccaccctcagagccgccaccctcagaaccgccaccctcagagccgc caccctcagagccgccaccagaaccaccaccagagccgccgccagcattgacaggaggttgaggcaggtcagacgatt ggccttgatattcacaaacgaatggatcctcattaaagccagaatggaaagcgcagtctctgaatttaccgttccagtaagcgt catacatggcttttgatgatacaggagtgtactggtaataagttttaacggggtcagtgccttgagtaacagtgcccgtataaac agttaatgcaccctgcctatttcggaacctattattctgaaacatgaaagtattaagaggctgagactcctcaagagaaggatt aggattagcggggttttgctcagtaccaggcggataagtgccgtcgagagggttgatataagtatagcccggaataggtgta tcaccgtactcaggaggtttagtaccgccaccctcagaaccgccaccctcagaaccgccaccctcagagccaccaccctc attttcagggatagcaagcccaataggaacccatgtaccgtaacactgagtttcgtcaccagtacaaaccacaacgcctgta gcattccacagacagccctcatagttagcgtaacgatctaaagttttgtcgtctttccagacgttagtaaatgaattttctgtatga ggttttgctaaacaactttcaacagtttcagcggagtgagaatagaaaggaacaactaaaggaattgcgaataataattttttca cgttgaaaatctccaaaaaaaaaggctccaaaaggagcctttaattgtatcggtttatcagcttgctttcgaggtgaatttcttaa acagcttgataccgatagttgcgccgacaatgacaacaaccatcgcccacgcataaccgatatattcggtcgctgaggcttg cagggagtcaaaggccgcttttgcgggatcgtcaccctcagcagcgaaagacagcatcggaacgagggtagcaacggct acggaggctttgaggactaaagactttttcatgaggaagtttccattaaacgggtaaaatacgtaatgccactacgaaggcac caacctaaaacgaaagaggcgaaagaatacactaaaacactcatctttgacccccagcgattataccaagcgcgaaacaaa gtacaacggagatttgtatcatcgcctgataaattgtgtcgaaatccgcgacctgctccatgttacttagccggaacgaggcg cagacggtcaatcataagagaaccgaactgaccaactttgaacgaggacagatgcacggtgtacagaccaggcgcatac gctggctgaccttcgtcgagagtaatcttgacaagcaccggatattcattacccaaatcaacgtaacaaagctgctcattcagt gaataaggcttgccctgacgagaaacaccagaacgggtagtaaattgcgcttgagacggtttaatttcaactttaatcattttga attaccttatgcgattttaagaactggctcattataccagtcaggacgttgggaggaaaaatctacgttaataaaacgaactaac ggaacaacattattacaggtggaaagattcatcaattgagatttaggaataccacactcaactaatgcagatacataacgcca aaaggaattacgaggcatggtaagagcaacactatcataaccctcattaaccagacgacgatagaaaccaaaatagcgag aggcttttgcaaaggaagttttgccagagggggtaattgtaaaatgtttagactggatagcgtccaatactgcggaatcgtcat aaatattcattgaatccccctcaaatgctttaaacagttcagaaaacgagaatgaccataaatcaaaaatcaggtctttaccctg tctattatagtcagaagcaaagcgaattgcatcaaaaagattaagaggaagcccgaaagacttcaaatatcgcgtttcaattc gagcctcaaagcgaaccagaccggaagcaaattccaacaggtcaggattagacagtacctttaattgctccttttgataaga ggtcatttttgcggatggcttagagcttaattgctgaatctggtgctgtagttcaacatgttttaaatatgcaactaaagtacggtg tctggaagtttcattccatgtaacagttgattcccaattctgcgaacgagtagatttagtttgaccattagatacatttcgcaaatg gtcaataacctgtttagctatattttcatttggggcgcgagctgaaaaggtggcatcaattctactaatggtagtagcgttaacat ccaataaatcgtacaagcaaggcagagagttagcaaaattaagcaataaagcctcagagcataaagctaaatcggttgtacc aaaaacattatgaccctgtaatacttttgctggtgaagccttaatttcaacgcagggataaaaatttttagaaccctcatatatttta aatgcaatgccggagtaatgagtaggcaaagattcaaacgggtgagaaaggccggagacagtcaaatcaccgtcaatatg atattcaaccgttctagctgataaattcatgccggagagggtagctatttttgagaggtctacaaaggctatcaggtcattacct gaaagtctggagcaaacaagagaatcgatgaacggtaatcgtaaaactagcatgtcaatcatatgtaccccggttgataatc agaaaagccccaaaaacaggatgattgtataagcaaatatttaaattgtaaacgttaatgttttgttaaatttcgcgttaaatattt gttaaatcagcttattttttaaccagtaagcagaaaatgacaaaaatccttataaatcaaaagaataggccgagttagttgtgag tgttgttccagtttggaacaagagtccactatt.(SEQIDNO.11).