Phosphinothricin dehydrogenase mutant, genetically engineered bacterium and one-pot multi-enzyme synchronous directed evolution method

12152264 ยท 2024-11-26

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed are a phosphinothricin dehydrogenase mutant, a recombinant bacterium and a one-pot multi-enzyme synchronous directed evolution method. The phosphinothricin dehydrogenase mutant, with an amino acid sequence as shown in SEQ ID No.1, is obtained by mutating alanine at position 164 to glycine, arginine at position 205 to lysine, and threonine at position 332 to alanine in a phosphinothricin dehydrogenase derived from Pseudomonas fluorescens. The recombinant bacterium is obtained by introducing a gene encoding the phosphinothricin dehydrogenase mutant into a host cell. The host cell can also incorporate a gene encoding a glucose dehydrogenase or a gene encoding a formate dehydrogenase to undergo synchronous directed evolution to achieve double gene overexpression. The one-pot multi-enzyme synchronous directed evolution method of the present invention can screen recombinant bacteria with greatly improved activity. Compared with other catalysis processes such as the transaminase method, the method for preparing L-PPT of the present invention features relatively simple process, high conversion of raw materials of up to 100%, and high stereo selectivity.

Claims

1. A phosphinothricin dehydrogenase mutant, wherein the phosphinothricin dehydrogenase mutant has the amino acid sequence of SEQ ID NO: 1.

2. A polynucleotide comprising a nucleotide sequence encoding the phosphinothricin dehydrogenase mutant according to claim 1.

3. A recombinant bacterium comprising the polynucleotide according to claim 2.

4. The recombinant bacterium according to claim 3, wherein the polynucleotide further comprises a nucleotide sequence encoding a glucose dehydrogenase or a formate dehydrogenase.

5. The recombinant bacterium according to claim 4, wherein the recombinant bacterium comprises a double gene expression vector, and wherein the nucleotide sequence encoding the phosphinothricin dehydrogenase mutant is cloned into a first polyclonal site region of the double gene expression vector, and the nucleotide sequence encoding the glucose dehydrogenase or the formate dehydrogenase is cloned into a second polyclonal site region of the double gene expression vector.

6. The recombinant bacterium according to claim 5, wherein the nucleotide sequence encoding the glucose dehydrogenase is derived from Exiguobacterium sibiricum, and the length of linking bases between an initiation codon of the nucleotide sequence encoding the glucose dehydrogenase and the corresponding ribosome binding site on a plasmid is 8-10 bp.

7. The recombinant bacterium according to claim 5, wherein the nucleotide sequence encoding the formate dehydrogenase has the nucleotide sequence as shown in SEQ ID NO: 3.

8. A method for preparing L-phosphinothricin, comprising the step of reacting 2-carbonyl-4-(hydroxymethylphosphinic) butyric acid as a substrate and glucose or ammonium formate as a co-substrate with a catalyst in the presence of an inorganic amino donor and a coenzyme regeneration system to obtain L-phosphinothricin; wherein the coenzyme regeneration system is a glucose dehydrogenase regeneration system or a formate dehydrogenase regeneration system; and the catalyst comprises the recombinant bacterium according to claim 5 or a phosphinothricin dehydrogenase mutant having the amino acid sequence of SEQ ID NO: 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a high-performance liquid chromatography (HPLC) chromatogram of a PPO sample.

(2) FIG. 2 is a high performance liquid chromatography (HPLC) chromatogram of a D,L-PPT sample.

(3) FIG. 3 is a plasmid profile of the expression vector with coupled PPTDH and EsGDH obtained in Example 1.

(4) FIG. 4 is a schematic diagram of the reaction for preparing L-PPT through asymmetric reductive amination of PPO as catalyzed by coupled PPTDH and EsGDH double enzymes in Example 1.

(5) FIG. 5 is a SDS-PAGE diagram of the PPTDH and EsGDH double enzyme coupling in Example 4, wherein Lane 1: protein ladder; Lane 2: recombinant E. coli cells prior to overexpression of EsGDH; Lane 3: recombinant E. coli cells after overexpression of EsGDH.

(6) FIG. 6 is a SDS-PAGE diagram of wild-type phosphinothricin dehydrogenase and mutant phosphinothricin dehydrogenase. Lane M: protein ladder; Lane 1: crude wild-type phosphinothricin dehydrogenase supernatant; Lane 2: purified wild-type phosphinothricin dehydrogenase; Lane 3: E. coli containing wild-type phosphinothricin dehydrogenase; Lane 4: crude phosphinothricin dehydrogenase mutant A164G_R205K_T332A supernatant; Lane 5: purified phosphinothricin dehydrogenase mutant A164G_R205K_T332A; Lane 6: E. coli containing phosphinothricin dehydrogenase mutant A164G_R205K_T332A.

(7) FIG. 7 is a reaction process diagram showing synthesis of L-PPT by asymmetric reductive amination using recombinant E. coli BL21(DE3)/pETDuet-PPTDH-EsGDH, where 0.5 mM NADP.sup.+ coenzyme is additionally added in the reaction system; reaction conditions: 40 C., pH=7.5. LE: low expression; HE: high expression.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(8) The experimental methods in the present invention are conventional methods unless otherwise specified, and the operation of gene cloning can be specifically found in the Molecular Cloning: A Laboratory Manual edited by J. Sambrook et al.

(9) Reagents used for upstream genetic engineering operations: the one-step cloning kits used in the examples of the present invention were all purchased from Vazyme Biotech Co. Ltd. (Nanjing); the plasmid extraction kits and DNA recovery and purification kits were purchased from Axygen Biotechnology (Hangzhou) Limited; the plasmids were purchased from Sangon Biotech (Shanghai); the DNA marker, Fast Pfu DNA polymerase, low molecular weight protein markers, agarose electrophoresis reagents, primer synthesis and gene sequencing, and gene synthesis were carried out by Hangzhou TSINGKE Biological Technology Co., Ltd. For the use methods of the above reagent, please refer to their respective instructions.

(10) Reagents used in the downstream catalytic process: 2-carbonyl-4-(hydroxymethylphosphono)butyric acid (PPO), D,L-PPT and L-PPT standards were purchased from Sigma-Aldrich; NADPH was purchased from Bontac Bio-engineering (Shenzhen) Co., Ltd; other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

(11) ##STR00001##

(12) The high-performance liquid chromatography detection method in the following examples is as follows:

(13) The substrate PPO concentration was detected by high performance liquid chromatography (HPLC) as follows: Column model: QS-C18 column, 5 m, 4.6250 mm. For the mobile phase: 50 mM ammonium dihydrogen phosphate was dissolved in 800 mL of ultra-pure water, 10 mL of tetrabutyl ammonium hydroxide (10%) was added thereto, diluted to 1000 mL with water, adjusted to pH 3.8 with phosphoric acid, and mixed with acetonitrile in a volume ratio of 88:12. The detection wavelength: 232 nm; flow rate: 1.0 mL/min; column temperature: 40 C.; and retention time of 2-carbonyl-4-(hydroxymethylphosphinyl)-butyric acid (PPO): 10.3 min (FIG. 1).

(14) Chiral analysis and concentration analysis of the products were conducted through pre-column derivatization high-performance liquid chromatography, which specifically comprises:

(15) (1) Chromatographic conditions: column model: QS-C18, 5 m, 4.6250 mm; mobile phase: 50 mM ammonium acetate solution : methanol=10:1; fluorescence detection wavelength: .sub.ex=340 nm, .sub.em=455 nm; flow rate: 1 mL/min; column temperature: 30 C., L-PPT retention time: 11 min, and D-PPT retention time: 13.4 min (FIG. 2).

(16) (2) Derivatization reagent: 0.1 g of o-phthalaldehyde and 0.12 g of N-acetyl-L-cysteine were weighed separately and dissolved in 10 mL of ethanol, 40 mL of 0.1 mol/L boric acid buffer (pH 9.8) was added and the mixture was shaken to fully dissolve and then stored in a refrigerator at 4 C. for later use (no more than 4 days).

(17) (3) Derivatization reaction and HPLC detection: Ultra-pure water was used to make up to 1 mL, i.e., the reaction mixture was diluted 10 times. The diluted sample was subjected to derivatization treatment. To 200 L of the diluted reaction mixture, 400 L of the derivatization reagent was added for derivatization at 30 C. for 5 min, and then 400 L of ultra-pure water was added to make up to 1 mL. The mixture was centrifuged at 12000 rpm for 1 min. The supernatant was passed through a 0.22 M microfiltration membrane as a liquid sample, and detected for PPO, L-PPT, D-PPT, and e.e. value by HPLC.

EXAMPLE 1

(18) Construction of Expression Vector and Engineered Bacterium with Coupled Phosphinothricin Dehydrogenase and Glucose Dehydrogenase or Formate Dehydrogenase

(19) Construction of expression vector: The synthesis work involving phosphinothricin dehydrogenase, glucose dehydrogenase and formate dehydrogenase genes described below was conducted by Hangzhou TSINGKE Biological Technology Co., Ltd. The phosphinothricin dehydrogenase gene (NCBI accession number: WP_150701510.1) derived from Pseudomonas fluorescens was seamlessly cloned between SacI and NotI at the first polyclonal site of the pETDuet-1 vector by PCR, and the glucose dehydrogenase gene (NCBI accession number: KM817194.1) derived from Exiguobacterium sibiricum or the formate dehydrogenase gene (NCBI accession number: WP_013726924.1) derived from Lactobacillus buchneri was seamlessly cloned between BglII and PacI at the second polyclonal site of the pETDuet-1 vector by PCR to obtain the expression vector pETDuet-PPTDH-EsGDH (FIG. 3) or pETDuet-PPTDH-LbFDH with phosphinothricin dehydrogenase. The PCR procedure was operated as follows: pre-denaturation at 95 C. for 3 minutes; denaturation at 95 C. for 15 seconds, annealing at 53-58 C. for 15 seconds and elongation at 72 C. for 1.5 minutes, 25 cycles in total; and then elongation at 72 C. for 10 minutes.

(20) Preparation of competent cells: The E.coli BL21(DE3) strain preserved in a glycerol tube was obtained from a refrigerator at 80 C., streaked on an antibiotic-free LB plate to culture at 37 C. for 10 hours to obtain single colonies. The single colonies on the LB plate were picked, inoculated into a test tube containing 5 L of LB culture medium to culture at 37 C. and 180 rpm for 9 hours. Then, 200 L of the bacterial liquid was taken from the test tube and inoculated into 50 mL of LB culture medium to culture at 37 C. and 180 rpm until OD.sub.600 reached 0.4-0.6. The bacterial liquid was pre-cooled on ice, put into a sterilized centrifuge tube, placed on ice for 10 minutes, and then centrifuged at 4 C. and 5,000 rpm for 10 minutes. The supernatant was poured out (contamination should be prevented), and the precipitated cells were re-suspended in pre-cooled 0.1 mol/L aqueous CaCl.sub.2 solution and placed on ice for 30 minutes, and then centrifuged at 4 C. and 5,000 rpm for 10 minutes. The supernatant was discarded and the precipitated cells were re-suspended in pre-cooled 0.1 mol/L aqueous CaCl.sub.2 solution containing 15% glycerol. A total of 100 L of the re-suspended cells were aliquoted into a sterilized 1.5 mL centrifuge tube and stored in a refrigerator at 80 C. for later use.

(21) Construction of engineered bacteria library: The competent cells of E. coli BL21(DE3) (Invitrogen) stored at 80 C. were placed in an ice bath at 0 C. for 10 minutes, and then 5 L of the expression vector pETDUET-1-PPTDH with phosphinothricin dehydrogenase and glucose dehydrogenase was added thereto in a super clean bench, the mixture was placed in an ice bath at 0 C. for 30 minutes, heat-shocked at 42 C. for 90 seconds, placed in an ice bath at 0 C. for 2 minutes, 600 L of LB culture medium was added thereto, and the mixture was then shaking-cultured at 37 C. and 200 rpm for 1 hour. The mixture was coated on an LB plate containing 50 g/ml ampicillin resistance to culture at 37 C. for 8-12 hours, thereby obtaining a recombinant E. coli BL21(DE3)/pETDuet-1-PPTDH-EsGDH or pETDuet-PPTDH-LbFDH engineered bacterium containing the recombinant expression plasmid.

EXAMPLE 2

(22) Construction and Screening of Coupled Phosphinothricin Dehydrogenase and Glucose Dehydrogenase/formate Dehydrogenase Double-enzyme Gene Library

(23) 1) Establishment of High-throughput Screening Method

(24) Preparation of 50 mL of working solution (derivatization reagent): 0.013 g of o-phthalaldehyde and 0.032 g of N-acetyl-L-cysteine were dissolved with a boric acid buffer with pH=9.8 to a constant volume of 50 mL, shaken to fully dissolve, and stored in a refrigerator at 4 C. for later use (no more than 4 days) as a high-throughput working solution, also known as derivatization reagent. Then, 50 L of the sample reaction mixture was added into 50 L of the working solution to react under shaking for 30 seconds, and then 100 L of ddH2O was added. The fluorescence value was measured at .sub.ex=340 nm and .sub.em=455 nm.

(25) 2) One-pot Multi-enzyme Synchronous Directed Evolution

(26) Comparative Example: PPTDH and EsGDH underwent directed evolution by using multi-enzyme stepwise directed evolution separately. After screening among 20,000 clones, no PPTDH (PfGluDH) and EsGDH with significantly increased viability were obtained. With wild-type lyophilized E. coli cells with PPTDH(PfGluDH) and EsGDH as the biocatalyst, the conversion of 100 mM PPO to L-PPT was 37.3% after 12 hours (without exogenous NADP.sup.+). When the PPO concentration was increased to 300 mM and 500 mM, the conversion decreased to 11.5% and 7.7% respectively (without exogenous NADP.sup.+), and the e.e. value reached more than 99%. Therefore, the efficiency of the multi-enzyme catalytic reaction for L-PPT synthesis needs to be improved.

(27) According to the strategy adopted by the present invention, with the recombinant expression plasmid pETDuet-1-PPTDH-EsGDH obtained in Example 1 as the initial plasmid, error-prone PCR was performed on the gene expression regulation elements of and between phosphinothricin dehydrogenase and glucose dehydrogenase simultaneously to screen strains with improved activity. For the error-prone PCR, there were two rounds of PCR. In the first round of PCR, error-prone PCR was performed on the target gene and the concentration of Mn.sup.2+ added was selected to be 0.15 mM; and in the second round of PCR, the product of the first round of error-prone PCR was cloned onto the expression vector pETDuet-1 using the megaprimer method to obtain a recombinant plasmid with the error-prone target gene (Miyazaki K, Takenouchi M. 2002.Creating Random Mutagenesis Libraries Using Megaprimer PCR of Whole Plasmid. BioTechniques 33:1033-1038.). The product of the second round of PCR digested by DpnI was transformed into E. coli BL21(DE3) for expression and screening.

(28) Preparation of reaction mixture: The reaction mixture comprised the substrate PPO (2-carbonyl-4-(hydroxymethylphosphinic)butyric acid) with a final concentration of 300 mM, ammonium sulfate with a final concentration of 750 mM, glucose with a final concentration of 360 mM, and phosphate buff at pH=7.5 as the reaction medium.

(29) After colonies came up on the plate, single colonies were picked from the plates and inoculated into a 96-well plate containing 1.0 mL of LB culture medium (containing 135 M ampicillin) in each well. After incubation at 37 C. for 8 hours, 200 L of the bacterial liquid was transferred to another 96-well plate containing 800 L of LB culture medium (containing 135 M ampicillin and 0.1 mM IPTG) and incubated at 22 C. and 200 rpm for 16 hours. The cultured bacterial liquid was centrifuged at 4,000 rpm for 10 minutes, the supernatant was discarded, and the bacterial cells were collected at the bottom of the well. Next, the catalytic reaction was verified. The reaction mixture was added into a 96-deep-well plate, 500 L per well, and repeatedly blown with a pipette to re-suspend the cells collected from the 96-well plate. Then, the 96-deep-well plate was placed on a shaker at 40 C. and 200 rpm to react for 1 hour, and the supernatant was collected by centrifugation for high-throughput screening.

(30) Primary screening: 50 L of the sample reaction supernatant was pipetted and mixed with 50 L of the working solution to react with shaking for 30 s. Then, 100 L of ddH.sub.2O was added thereto, and the mixture was measured for fluorescence value under the conditions of .sub.ex=340 nm and .sub.em=455 nm. Strains with higher fluorescence value than that of the wild-type pETDuet-1-PPTDH-EsGDH reaction mixture were screened, and the corresponding preserved strains were found and streak-cultured, and then high-concentration bacterial liquid and 30% glycerol in a ratio of 1:1 were pipetted and added into a glycerol tube, which was finally stored in a refrigerator at 80 C.

(31) Through preliminary screening by the high-throughput screening method and the liquid-phase re-screening, more than 8,000 mutants were selected, and finally four mutants with improved activity were screened, which improved the yield of L-PPT by at least three times. Among others, three of the mutants were mutants A164G, R205K, and T332A derived from phosphinothricin dehydrogenase, and the fourth mutant was from the deletion of the bases between the second cloning site RBS and glucose dehydrogenase, resulting in increased activity. As analyzed, the reason is that the deletion of the bases results in enhanced expression of glucose dehydrogenase, thus improving the coenzyme circulation efficiency.

EXAMPLE 3

(32) Site-saturation Mutagenesis of Phosphinothricin Dehydrogenase in Multi-enzyme Coupling Reaction System

(33) In order to further screen strains with potentially improved activity, the two beneficial mutation sites A164 and R205 of phosphinothricin dehydrogenase obtained in Example 2 were subjected to site-saturation mutagenesis for further screening, with the PCR primer design shown in Table 1. The PCR system (50 L) was as follows: 25 L of 2*Phanta Max buffer, 1 L of dNTPs, 1 L of each of the upper and lower primers for mutation, 1 L of template (original strain), 0.5 L of Pfu DNA polymerase, and ddH2O making up to 50 L. The PCR conditions were as follows: pre-denaturation at 95 C. for 3 minutes; denaturation at 95 C. for 15 seconds, annealing at 60 C. for 15 seconds, and elongation at 72 C. for 7 minutes and 20 seconds, 30 cycles; final elongation at 72 C. for 10 minutes. The PCR product was verified by DNA agarose gel electrophoresis. After the template was digested with DpnI, the PCR product was transformed into E. coli BL21(DE3) competent cells, the transformed product was coated on an LB plate containing 50 g/mL ampicillin resistance, and placed upside down to culture at 3 C. overnight. The dominant mutants were screened out from the obtained mutants, and were sent to Hangzhou TSINGKE Biological Technology Co., Ltd for sequencing confirmation, and stored.

(34) TABLE-US-00001 TABLE1 Phosphinothricindehydrogenasesite-saturation mutagenesisprimerdesign Primername Primersequence(5-3) PfGluDH-205-F GGCAGTTTGATTNNKCCAGAAGCTACC PfGluDH-205-R GGTAGCTTCTGGMNNAATCAAACTGCC PfGluDH-164-F GTCGATGTGCCANNKGGAGATATTGGCG PfGluDH-164-R ACGCCAATATCTCCMNNTGGCACATCGA

(35) The high-throughput screening method and the reaction system for measuring enzyme activity are the same as in Example 2.

(36) TABLE-US-00002 TABLE 2 Conversion of multi-enzyme catalytic reaction after phosphinothricin dehydrogenase site-saturation mutagenesis 164.sup.th site mutation of 205.sup.th mutation of phosphinothricin Conversion phosphinothricin Conversion dehydrogenase (%) dehydrogenase (%) WT 11.5 WT 11.5 A164R N.D. R205A N.D. A164N 1.2 R205N 1.6 A164D N.D. R205D N.D. A164C 4.3 R205C N.D. A164Q 5.7 R205Q 3.4 A164E N.D. R205E N.D. A164G 63.6 R205G N.D. A164H N.D. R205H 10.8 A164I 10.4 R205I N.D. A164L 9.9 R205L N.D. A164K N.D. R205K 21.3 A164M 7.3 R205M 2.6 A164F N.D. R205F N.D. A164P N.D. R205P N.D. A164S N.D. R205S N.D. A164T N.D. R205T 2.9 A164W 3.0 R205W N.D. A164Y N.D. R205Y N.D. A164V 10.9 R205V N.D. N.D.: not detected

(37) As can be seen from Table 2, phosphinothricin dehydrogenase mutant A164G can increase the conversion of 300 mM PPO from 11.5% to 63.6% without exogenous NADP.sup.+. However, no other strain with increased activity was screened out through A164 site-saturation mutagenesis and screening. The phosphinothricin dehydrogenase mutant R205K increased the conversion of 300 mM PPO from 11.5% to 21.3% without exogenous NADP.sup.+. However, no other strain with increased activity was screened out through R205 site-saturation mutagenesis and screening. Then, the A164G and R205K mutation sites were mutated together, and the results showed that the activity was further improved, and the conversion of 300 mM PPO reached 68.1%.

(38) In addition to the error-prone PCR technology, phosphinothricin dehydrogenase was also subjected to homology modeling and molecular docking according to semi-rational design, and some other mutation sites with potentially improved activity were selected for site-saturation mutagenesis. Homology modeling: with the protein crystal structure with the highest homology with phosphinothricin dehydrogenase found in the PDB database as a template, homology modeling was performed using Modeller 9.22, molecular docking was conducted using autock vina, appropriate mutation sites were selected, mutation primers were designed, site-saturation mutagenesis was conducted, and high-throughput screening was carried out.

(39) After many times of site-saturation mutagenesis and screening, the mutant PPTDH-T332A with improved activity was finally screened out. The activity of the three-enzyme mutant A164G_R205K_T332A was further improved compared with that of the wild type, and the conversion of 300 mM PPO reached 71.2%. Therefore, the phosphinothricin mutant A164G_R205K_T332A was finally selected.

EXAMPLE 4

(40) Overexpression of Glucose Dehydrogenase in the Multi-enzyme Coupling Reaction System

(41) On the double enzyme coupling expression vector pETDuet-1, the expression level of EsGDH protein was not high, resulting in poor coenzyme circulation efficiency. A strain with improved activity was screened out in Example 2, which was attributable to the deletion of bases between the second cloning site RBS and glucose dehydrogenase. Therefore, it is deduced that the expression level of GDH is related to the length of bases between glucose dehydrogenase and RBS sequence. Thus, the length of bases between glucose dehydrogenase and RBS sequence was further optimized. The primer design is shown in Table 3, and the experimental results are shown in Table 4.

(42) TABLE-US-00003 TABLE3 Designofprimerswithoptimizednumberof basesinmulti-enzymecatalyticreaction Primer name Primersequence 10bp-F TATAATTCATATACATCCATGGGTTATAATTC 10bp-R GAATTATAACCCATGGATGTATATGAATTATA 8bp-F TATAATTCATATACATATGGGTTATAATTC 8bp-R GAATTATAACCCATATGTATATGAATTATA 6bp-F TATAATTCATATACATGGGTTATAATTC 6bp-R GAATTATAACCCATGTATATGAATTATA 4bp-F TATAATTCATATATGGGTTATAATTC 4bp-R GAATTATAACCCATATATGAATTATA

(43) TABLE-US-00004 TABLE4 Summaryofconversionafterbasenumber optimizationinmulti-enzymecatalyticreaction Linkersequence Linkinglength Conversion Number (5-3) (bp) (%) 1 ATATACATCCAGAT 14 11.5 2 ATATACATCCAGA 13 35.1 3 ATATACATCC 10 78.8 4 ATATACAT 8 99.1 5 ATATAC 6 26.0 6 ATAT 4 4.3

(44) As shown in Table 4, when the length of bases between glucose dehydrogenase and RBS sequence was 8 bp, the expression of EsGDH gene was significantly improved. See FIG. 5 for SDS-PAGE analysis. The efficiency of double enzyme coupling catalysis was greatly improved, and the conversion of 300 mM PPO reached 99.1%.

EXAMPLE 5

(45) Measurement and Comparison of Total Turnover Number (TTN) in PPO Amination

(46) The total turnover number in PPO amination was detected to show the catalytic efficiency of wild-type and mutant phosphinothricin dehydrogenase, and coupled wild-type and mutant PPTDH-EsGDH double enzymes. In the case of wild-type and mutant phosphinothricin dehydrogenase alone, the reaction system was: 100 mM PPO, 0.5 mM NADPH, 400 mM NH4.sup.+, 0.5 g/L stem cells. In the case of coupled phosphinothricin dehydrogenase and glucose dehydrogenase, additional 120 mM glucose was required in the reaction system. After 5 minutes of reaction, samples of the reaction mixture were processed and the concentration of L-PPT was determined by HPLC.

(47) The calculation formula of TTN (mol L-PPT/mol catalyst) for single enzyme or multiple enzymes is as follows:
TTN=(L-PPT (mol/L))/(PPTDH (g/L).Math.49060 (mol/g))

(48) TABLE-US-00005 TABLE 5 TTN values for the wild-type and mutant A164G_R205K_T332A of three different enzymes TTN Number Enzyme WT.sup.NADPH A164G_R205K_T332A.sup.NADPH 1 PPTDH alone 115 7 168 12 2 PPTDH + low 281 13 5846 143 expressed EsGDH 3 PPTDH + high 547 35 33950 238 expressed EsGDH

(49) As can be seen from the data in Table 5, when PPTDH alone was used without the NAPDH regeneration system (EsGDH), the TTN remained at a low level, and the TTN values for PPTDH_WT and the variant PPTDH_A164G_R205K_T332A were less than 200. The TTN increased to 5846 when PPTDH_A164G_R205K_T332A was coupled with low expressed EsGDH to catalyze the reaction; and the TTN reached the maximum of 33950 when PPTDH_A164G_R205K_T332 was coupled with high expressed EsGDH to catalyze the reaction, indicating that preparation of L-PPT through catalytic reaction with coupled PPTDH_A164G_R205K_T332A and high expressed EsGDH reached the optimal coupling efficiency.

EXAMPLE 6

(50) Site-saturation Mutagenesis of Formate Dehydrogenase in Multi-enzyme Coupling Reaction System

(51) First, NADP.sup.+ dependent formate dehydrogenase derived from Lactobacillus buchneri was obtained by gene mining. Considering that the original enzyme activity was low, the semi-rational design of homology modeling and molecular docking was used to select the appropriate mutation sites, and site-saturation mutagenesis was used to screen mutants with enhanced activity. The determined mutation sites were 5148, Q222, R223, H224, M334, T338, K380 and T383.

(52) An NADPH high throughput screening method was established. Since the molar extinction coefficient () of NADPH is large at 340 nm and always stands at 6220 L mol.sup.1cm.sup.1, the OD.sub.340 is in direct proportion to the concentration of NADPH, and thus the enzyme activity can be determined by determining the value of OD.sub.340 in the reaction mixture. The reaction system for determining enzyme activity was 1 ml, containing 100 mM ammonium formate, 1 mM NADP.sup.+, 100 mM phosphate buff (pH=7), and an appropriate amount of bacterial cells, and the reaction temperature was 30 C.

(53) TABLE-US-00006 TABLE6 Designofprimersforsite-saturationmutagenesis offormatedehydrogenaseinmulti-enzyme couplingreactionsystem Primername Primersequence FDH-S148-F GAAGTGACCTATAGCAATNNKGTTAGTGTTGC FDH-S148-R CTGCTTCTGCAACACTAACMNNATTGCTATAG FDH-Q222-F CGTTAAACTGGTGTATAATNNKCGCCATCAGC FDH-Q222-R CCGGCAGCTGATGGCGMNNATTATACACC FDH-R223-F CTGGTGTATAATCAGNNKCATCAGCTGCCG FDH-R223-R CTTCATCCGGCAGCTGATGMNNCTGATTATAC FDH-H224-F GGTGTATAATCAGCGCNNKCAGCTGCCGG FDH-H224-R CAACTTCATCCGGCAGCTGMNNGCGCTGATTA FDH-M334-F GAAGCAATGACCCCGCATNNKAGTGGCACC FDH-M334-R CTCAGGGTGGTGCCACTMNNATGCGGGGTC FDH-T338-F CCCGCATATGAGTGGCACCNNKCTGAGTGCC FDH-T338-R GCGTGCCTGGGCACTCAGMNNGGTGCCACTC FDH-K380-F GGCCGGTACCGGTGCCNNKAGTTATACCG FDH-K380-R CCTTTTTTCACGGTATAACTMNNGGCACCGG FDH-T383-F CGGTGCCAAAAGTTATNNKGTGAAAAAAGG FDH-T383-R GGTTTCTTCGCCTTTTTTCACMNNATAACTTT

(54) The results of high-throughput screening showed that most of the mutants were nonsense mutations, only H224Q was a beneficial mutation site, and the relative enzyme activity of formate dehydrogenase was increased by 23%.

EXAMPLE 7

(55) Expression and Purification of Phosphinothricin Dehydrogenase

(56) 1. Wet cells containing phosphinothricin dehydrogenase gene and glucose dehydrogenase gene: The recombinant E. coli BL21(DE3)/PET Duet-PPT GDH-ES GDH obtained in Example 1 was inoculated into an LB liquid medium containing 50 g/mL ampicillin resistance to culture at 37 C. and 200 rpm for 12 hours, and then inoculated at an inoculum size of 1% (v/v) into a fresh LB liquid medium containing 50 g/ml ampicillin resistance to culture at 37 C. and 150 rpm until the OD.sub.600 of the cells reached 0.6-0.8. Then, IPTG with a final concentration of 0.1 mM was added to induce and culture at 22 C. for 16 hours. The mixture was then centrifuged at 4 C. and 8,000 rpm for 20 minutes, and the supernatant was discarded. The precipitate was collected, and washed with 20 mM phosphate buffer (PBS) at pH 7.5 two times to obtain wet cells of recombinant strain E.coli BL21(DE3)/pETDuet-PPTGDH-EsGDH containing phosphinothricin dehydrogenase gene and glucose dehydrogenase gene. The wet cells were re-suspended in 100 mM PBS at pH 7.5, and ultrasonically crushed on an ice-water mixture for 10 minutes (ultrasonic crushing conditions: 400 W, crushing for 1 second with an interval of 5 seconds) to obtain crude enzyme.

(57) The crude enzyme was centrifuged at 4 C. and 12,000 rpm for 20 minutes and the supernatant was collected. The mutant protein was purified using a Ni affinity column (1.610 cm, Bio-Rad, USA) by steps of: (1) equilibrating the Ni column with 5 column volumes of a binding buffer (50 mM sodium phosphate buffer containing 0.3 M NaCl, pH 8.0,) until stable baseline; (2) loading the sample at a flow rate of 1 mL/min at a loading amount of 25-40 mg/mL protein so that the target protein is adsorbed on the Ni column; (3) washing out miscellaneous proteins with six column volumes of buffer A (50 mM sodium phosphate buffer containing 0.3 M NaCl and 30 mM imidazole, pH 8.0) at a flow rate of 1 mL/min until stable baseline; and (4) eluting with buffer B (50 mM sodium phosphate buffer containing 0.3 M NaCl and 500 mM imidazole, pH 8.0) at a flow rate of 1 mL/min, and collecting the target protein. The target protein was dialyzed overnight in 20 mM phosphate buffer at pH 7.5 to obtain the purified enzyme. The electrophoresis pattern is shown in FIG. 6.

(58) LB culture medium: 10 g/L tryptone, 5 g/L yeast extract, and 10 g/L sodium chloride in distilled water as the solvent, pH 7.4.

(59) LB plate: 10 g/L tryptone, 5 g/L yeast extract, 10 g/L sodium chloride, 18 g/L agar in distilled water as the solvent, pH 7.4.

EXAMPLE 8

(60) Determination of Kinetic Parameters of Wild-type Phosphinothricin Dehydrogenase and its Mutant

(61) Reaction system: substrate PPO concentration 2-30 mM, 50 mM ammonium sulfate, 1-15 mM NADPH and a certain amount of purified enzyme; reaction medium: 100 mM phosphate buffer (pH 7.0); reaction temperature: 40 C. The obtained initial velocity data is fitted to the following equation:

(62) V = V max [ A ] [ B ] [ A ] [ B ] + [ B ] Km A + [ A ] Km B + Km B K s A

(63) where [A] and [B] are the concentrations of NADPH and PPO respectively, and Km.sup.A and Km.sup.B are the apparent substrate affinities for NADPH and PPO respectively. Vmax is the maximum reaction rate of the enzyme when the substrate reaches saturation, and Ks.sup.A represents the dissociation constant between phosphinothricin dehydrogenase and NADPH.

(64) TABLE-US-00007 TABLE 7 Dynamics parameters of wild-type phosphinothricin dehydrogenase and its mutant (A164G_R205K_T332A) k.sub.cat/K.sub.m.sup.A k.sub.cat/K.sub.m.sup.B Enzyme K.sub.m.sup.A(nM) K.sub.m.sup.B (mM) k.sub.cat (s.sup.1) (s.sup.1 mM.sup.1) (s.sup.1 mM.sup.1) WT 0.14 0.02 6.12 0.32 7.47 0.22 53.36 1.22 A164G_R205K_T332A 0.09 0.01 5.35 0.28 951.85 20.4 10576.11 177.92

(65) As can be seen from the data in Table 7, the catalytic constant (k.sub.cat) of the phosphinothricin dehydrogenase mutant A164G_R205K_T332A was significantly increased from 7.47 s.sup.1 (WT) to 951.85 s.sup.1 (A164G_R205K_T332A), and the substrate affinity of the phosphinothricin dehydrogenase mutant A164G_R205K_T332A was slightly higher than that of WT (K.sub.m: 5.35 mM versus 6.12 mM). High k.sub.cat and moderate substrate affinity resulted in very high catalytic efficiency (k.sub.cat/K.sub.m) for PPO, which was significantly increased from 1.22 s.sup.1mM.sup.1 (WT) to 177.92 s.sup.1mM.sup.1 (A164G_R205K_T332A), so that the catalytic efficiency of the phosphinothricin dehydrogenase mutant A164G_R205K_T332A was increased 145.83 times compared with that of the wild type.

EXAMPLE 9

(66) Synthesis of L-PPT by Asymmetric Reductive Amination Using Recombinant E. Coli BL21(DE3)/pETDuet-1-PPTDH_A164G_R205K_T332A-EsGDH/LbFDH_H224Q

(67) The reaction system consisted of 100 mM-1 M PPO, 120 mM-1.2 M glucose, 150 mM-1 M ammonium sulfate, 0.5 mM NADP.sup.+, recombinant E. coli BL21(DE3)/pETDuet-1-PPTDH_A164G_R205K_T332A-EsGDH (high expression) (0.5g/L stem cells). Reaction conditions: thermostatic water bath at 40 C. and rotating speed of 500 rpm. During the whole reaction process, the pH value of the reaction mixture was controlled to be 7.5 by feeding NH.sub.3.H.sub.2O. Samples (100 l ) were taken at regular intervals, the reaction was stopped by adding 5 L of 6 M concentrated hydrochloric acid, and the samples were then processed to determine conversion by measuring the concentration of L-PPT by HPLC, with the reaction progress curve shown in FIG. 7.

(68) When the concentration of PPO substrate was 100 mM, the substrate could be completely converted into L-PPT (conversion >99% and e.e.>99%) in 5 minutes with 0.5 g.Math.L.sup.1 catalyst. Under the same reaction conditions, using the original cells (phosphinothricin dehydrogenase WT and low expressed EsGDH), the conversion could only reach about 26% (25.68 mM after 3 hours). When the concentration of PPO substrate increased to 500 mM (89.04 g.Math.L.sup.1) and 1 M (178.08 g.Math.L.sup.1), using 0.5g.Math.L.sup.1 catalyst, the substrate could be completely converted after 20 minutes and 40 minutes respectively, with e.e.>99%. The space-time yield (STY) of the latter reached 7110 g.Math.L.sup.1.Math.d.sup.1, 173 times higher than that of the original strain (37 g.Math.L.sup.1.Math.d.sup.1). Phosphinothricin dehydrogenase coupled with glucose dehydrogenase still showed the highest conversion and the shortest reaction time compared with the reactions catalyzed by amidase and transaminase, as shown in Table 8.

(69) TABLE-US-00008 TABLE 8 Comparison with the preparation of L-PPT through modified enzyme as reported in other publications Substrate Catalyst Space-time concentration concentration Reaction Conversion e.e. yield Biocatalyst Substrate (g/L) (g/L) time (h) (%) (100%) g .Math. L.sup.1 .Math. d.sup.1 Amidase.sup.[a] rac-S.sup.[d] 150 0.03 6.8 49.7 >99 263.1 Transaminase.sup.[b] PPO 20 34 14 91.2 >99 31.3 GluDH_I170M.sup.[c] PPO 53.4 five 36 95 >99 33.8 LsGluDH_A175G.sup.[c] PPO 89.04 0.5 1.5 99 >99 1482.9 PPTDH_A164G_R205K_T332A PPO 178.08 0.5 0.67 99 >99 7110 coupled with over-expressed EsGDH.sup.[c] Notes: .sup.[a]purified amidase as catalyst; .sup.[b]immobilized transaminases as catalyst; .sup.[c]stem cells as catalysts; .sup.[d]racemic-4-[hydroxy(methyl)phosphoryl]-2-(2-phenylacetamido)butyric acid.

(70) Reaction system: 400 mM PPO, 800 mM ammonium formate, recombinant E. coli BL21(DE3)/pETDuet-1-PPTDH_A164G_R205K_T332A-LbFDH_H224Q, 25 g.Math.L.sup.1 catalyst. Reaction conditions: thermostatic water bath at 45 C. and rotating speed of 600 rpm. The changes in the concentration and e.e. value of the product L-PPT during the reaction were detected by HPLC.

(71) The results showed that the product concentration increased gradually with the passage of time, the reaction was completed within 3.5 hours, the substrate conversion was greater than 99%, and the e.e. value of the product remained above 99.5%.