Polynucleotide and method used for controlling insect invasion

11613749 · 2023-03-28

Assignee

Inventors

Cpc classification

International classification

Abstract

An isolated polynucleotide includes: (a) a polynucleotide sequence as shown in SEQ ID NO: 1; or (b) a polynucleotide sequence having at least 15, 17, 19 or 21 contiguous nucleotides of SEQ ID NO: 1, wherein the growth of a pest of the order Coleoptera is inhibited when the pest of the order Coleoptera ingests double-stranded RNA comprising at least one strand that is complementary to the described polynucleotide sequence; or (c) any polynucleotide sequence as shown in SEQ ID NO: 3 to SEQ ID NO: 6; or (d) a polynucleotide sequence which hybridizes under stringent conditions with the polynucleotide sequence as defined in (a), (b) or (c). A plurality of target sequences are used for controlling a target gene c4506 of Monolepta hieroglyphica, which is a pest of the order Coleoptera.

Claims

1. An isolated polynucleotide comprising a heterologous promoter operably linked to a polynucleotide, wherein the polynucleotide comprises a polynucleotide sequence that is at least 99% identical to a fragment of SEQ ID NO:1 that is at least 121 nucleotides in length, wherein when a Coleopteran insect pest ingests a double-stranded RNA comprising at least one strand complementary to the polynucleotide sequence, the growth of the Coleopteran insect pest is inhibited, and wherein the Coleopteran insect pest is Monolepta hieroglyphica.

2. The polynucleotide according to claim 1, wherein the polynucleotide also comprises a spacer sequence.

3. The polynucleotide according to claim 2, wherein the spacer sequence is SEQ ID NO: 9.

4. An expression cassette or a recombinant vector, comprising the polynucleotide according to claim 1.

5. An interfering ribonucleic acid, wherein the interfering ribonucleic acid acts to down-regulate expression of at least one target gene in an insect pest of Monolepta hieroglyphica after being ingested by the insect pest, wherein the interfering ribonucleic acid comprises at least one silencing element, wherein the silencing element is a double-stranded RNA region comprising complementary strands which have been annealed, and one strand of which comprises a nucleotide sequence at least partially complementary to a target sequence within the target gene, and the target sequence comprises a polynucleotide sequence that is at least 99% identical to a fragment of SEQ ID No:1 that is at least 121 nucleotides in length.

6. The interfering ribonucleic acid according to claim 5, wherein the silencing element comprises a sequence of at least 15, 17, 19 or 21 consecutive nucleotides complementary to or at least partially complementary to a target sequence within the target gene.

7. The interfering ribonucleic acid according to claim 5, wherein the interfering ribonucleic acid comprises at least two silencing elements, each of which comprises a nucleotide sequence at least partially complementary to a target sequence within the target gene.

8. The interfering ribonucleic acid according to claim 7, wherein each of the silencing elements comprises a different nucleotide sequence complementary to a different target sequence.

9. The interfering ribonucleic acid according to claim 8, wherein the different target sequence is derived from a single target gene or from a target gene different from the target gene.

10. The interfering ribonucleic acid according to claim 9, wherein the target gene different from the target gene is derived from a same insect pest of Monolepta hieroglyphica or a different insect pest of Coleoptera.

11. The interfering ribonucleic acid according to claim 5, wherein the interfering ribonucleic acid also comprises a spacer sequence.

12. The interfering ribonucleic acid according to claim 11, wherein the spacer sequence is SEQ ID NO: 9.

13. A composition for controlling invasion of an insect pest of Monolepta hieroglyphica, comprising at least one of the interfering ribonucleic acids according to claim 5 or a host cell expressing or capable of expressing the interfering ribonucleic acid sequence, and at least one suitable carrier, excipient or diluent.

14. The composition according to claim 13, wherein the host cell is a bacterial cell.

15. The composition according to claim 13, wherein the composition is a solid, a liquid or a gel.

16. The composition according to claim 15, wherein the composition is an insecticidal spray.

17. The composition according to claim 13, wherein the composition also comprises at least one pesticide, wherein the pesticide is a chemical pesticide, a potato tuber-specific protein, a Bacillus thuringiensis insecticidal protein, a Xenorhabdus ehlersii insecticidal protein, a Photorhabdus insecticidal protein, a Bacillus laterosporus insecticidal protein or a Bacillus sphaericus insecticidal protein.

18. A method for producing a plant capable of controlling an insect pest of Monolepta hieroglyphica, comprising introducing one of the following into the plant: a polynucleotide, wherein the polynucleotide comprises a polynucleotide sequence that is at least 99% identical to a fragment of SEQ ID NO:1 that is at least 121 nucleotides in length; the expression cassette comprising the polynucleotide; the recombinant vector comprising the polynucleotide, or an interfering ribonucleic acid; wherein the interfering ribonucleic acid comprises at least one silencing element, wherein the silencing element is a double-stranded RNA region comprising complementary strands which have been annealed, and one strand of which comprises a nucleotide sequence at least partially complementary to a target sequence within the target gene, and the target sequence comprises a polynucleotide sequence that is at least 99% identical to a fragment of SEQ ID NO:1 that is at least 121 nucleotides in length.

19. A method for controlling invasion of an insect pest of Monolepta hieroglyphica or protecting a plant from damage caused by an insect pest of Monolepta hieroglyphica, comprising introducing one of the following into the plant: the polynucleotide, wherein the polynucleotide comprises a polynucleotide sequence that is at least 99% identical to a fragment of SEQ ID NO:1 that is at least 121 nucleotides in length; the expression cassette comprising the polynucleotide; the recombinant vector comprising the polynucleotide; or an interfering ribonucleic acid; wherein when ingested by the insect pest of Monolepta hieroglyphica, the plant being introduced acts to inhibit growth of the insect pest of Monolepta hieroglyphica; wherein the interfering ribonucleic acid comprises at least one silencing element, wherein the silencing element is a double-stranded RNA region comprising complementary strands which have been annealed, and one strand of which comprises a nucleotide sequence at least partially complementary to a target sequence within the target gene, and the target sequence comprises a polynucleotide sequence that is at least 99% identical to a fragment of SEQ ID NO:1 that is at least 121 nucleotides in length.

20. The isolated polynucleotide according to claim 1, wherein the polynucleotide sequence is as shown in SEQ ID NO: 1.

21. The isolated polynucleotide according to claim 1, wherein the polynucleotide sequence is selected from any one of polynucleotide sequences as shown in SEQ ID NO: 3 to 6.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is an electrophoretogram showing the expression level of the target gene c4506 used in the polynucleotide and method for controlling insect invasions according to the present invention.

(2) FIG. 2 is a schematic diagram of recombinant expression vector DBNR4506C1 used in the polynucleotide and method for controlling insect invasions according to the present invention.

DETAILED DESCRIPTION

(3) The technical solution of the polynucleotide and method for controlling insect invasions in the present invention is further illustrated by the specific examples below.

Example 1. Determination of Target Sequences of Monolepta hieroglyphica (Motschulsky)

(4) 1. Total RNA Extraction of Monolepta hieroglyphica (Motschulsky)

(5) Newly-incubated instar larvae of Monolepta hieroglyphica (Motschulsky) were taken as materials, and RNA was extracted by using the conventional Trizol method, purified by a conventional method, and treated with a DNase, thereby obtaining a total RNA sample at a concentration of ≥300 ng/μL a total amount of ≥6 μg, and OD.sub.260/280 of 1.8-2.2.

(6) 2. Separation of mRNA and Synthesis of cDNA

(7) mRNA with polyA was separated from the total RNA sample prepared as above using magnetic beads with oligo-dT, and the first strand of cDNA was then synthesized using a random hexamer and a Superscript II reverse transcriptase kit of Invitrogen.

(8) 3. Screening of Target Genes

(9) One target gene c4506 of Monolepta hieroglyphica (Motschulsky) was screened out from the genes that are in the larvae library with medium analytical expression value and may be involved in important metabolic pathways, and its full-length nucleotide sequence was shown in SEQ ID NO: 1, the amino acid sequence was shown in SEQ ID NO: 2.

(10) 4. Selection of Target Sequences within the Target Genes

(11) Four target sequences with different ORF positions and/or different lengths of the target gene c4506 were selected, as shown in Table 1.

(12) TABLE-US-00001 TABLE 1 sequence information of four target sequences Target sequence Sequence number c4506_g1-01 SEQ ID NO: 3 c4506_g1-02 SEQ ID NO: 4 c4506_g1-03 SEQ ID NO: 5 c4506_g1-04 SEQ ID NO: 6

Example 2. Acquisition of dsRNA

(13) The dsRNA of the above-mentioned four target sequences were synthesized respectively according to the instructions of MEGAscript RNAi Kit from ThermoFisher company, namely, c4506_g1-01 to c4506_g1-04; the size of the products were detected by agarose electrophoresis with a mass concentration of 1%, and the concentrations of c4506_g1-01 to c4506_g1-04 were determined respectively by NanoDrop 2000 (Thermo Scientific).

Example 3. Identification of the Ability of Controlling Monolepta hieroglyphica (Motschulsky) by Feeding dsRNA

(14) The isolated and purified c4506_g1-01 to c4506_g1-04 were mixed respectively and added evenly into feed at the ratios of 50 μg/g feed and 5 μg/g feed (Feed formula references Development of an artificial diet for the western corn rootworm, Entomologia Experimentalis et Applicata 105: 1-11, 2002.), to obtain c4506_g1-01-50 to c4506_g1-04-50 feed and c4506_g1-01-5 to c4506_g1-04-5 feed, respectively. In the control group, irrelevant dsRNA (SEQ ID NO: 15) was added to the feed CK, and other conditions were completely consistent. The newly-incubated larvae of Monolepta hieroglyphica (Motschulsky) were fed with the feed prepared as above. 30 newly-incubated larvae with an incubation time of not more than 24 hours were placed in each dish, in which the feed mixed with dsRNA was replaced every two days and fed until day 14. The insect mortality rate was counted every two days from the beginning of feeding, and the expression value of the target gene was determined on days 0, 4, 8, 10, 12 and 14 from the beginning of feeding, by using the specific methods as follows:

(15) Step 301. The larvae, fed with c4506_g1-01-50 to c4506_g1-04-50 feed and c4506_g1-01-5 to c4506_g1-04-5 feed respectively, were collected on days 0, 4, 8, 10, 12 and 14, respectively, and frozen with liquid nitrogen;

(16) Step 302. The total RNA of the above-mentioned larvae was extracted using the Trizol method, respectively;

(17) Step 303. The cDNA was obtained by reverse transcription of the total RNA of the above-mentioned larvae using the whole gold kit (TransGen Biotech ER301-01), respectively.

(18) Step 304. Ubiquitin-C was used as an internal reference gene for PCR amplification, and after amplification, 10 μL of the amplification product was taken for agarose gel electrophoresis with a mass concentration of 1%.

(19) Five repeats were set for each treatment in the above-mentioned experiment, and the statistical results were shown in FIG. 1 and Table 2. In Table 2, “−50” in the material number represents 50 μg of the corresponding dsRNA per g of feed, i.e., “50 μg/g feed” as previously stated; “−5” represents 5 μg of the corresponding dsRNA per gram of feed, i.e., “5 μg/g feed” as previously stated. For example, “r1-dsRNA-50” represents 50 μg r1-dsRNA per gram of feed. “DAI” represents the number of days after incubating and feeding the insects.

(20) The measured results of expression amount of the target gene in FIG. 1 showed that dsRNA (50 μg/g feed) of the target sequence c4506_g1-01 had significant inhibition effect on the expression of the target gene c4506 in the Monolepta hieroglyphica (Motschulsky), and the expression amount of the target gene c4506 was significantly down-regulated on day 10 of feeding, the expression of the target gene c4506 were almost not detected on day 14.

(21) The results of feeding with dsRNA in Table 2 showed that the dsRNA of target sequences c4506_g1-01 to c4506_g1-04 of the target gene c4506 had significant lethal effect on the Monolepta hieroglyphica (Motschulsky), and there were no surviving larvae in most repeats on day 14 of feeding.

(22) TABLE-US-00002 TABLE 2 Experimental results of survival rate of Monolepta hieroglyphica (Motschulsky) fed with dsRNA Material Number DAI0 DAI2 DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 CK-dsRNA 100% ± 0% 100% ± 0% 98% ± 3% 95% ± 4% 91% ± 8% 88% ± 9% 85% ± 11% 83% ± 11% c4506_g1-01-50 100% ± 0% 100% ± 0% 98% ± 3% 96% ± 4% 86% ± 9% 46% ± 8% 31% ± 10% 12% ± 12% c4506_g1-01-5 100% ± 0% 100% ± 0% 98% ± 1% 95% ± 3%  88% ± 10%  65% ± 10% 45% ± 8%  32% ± 15% c4506_g1-02-50 100% ± 0% 100% ± 0% 99% ± 2% 98% ± 3% 91% ± 7%  70% ± 12% 53% ± 10% 39% ± 12% c4506_g1-02-5 100% ± 0% 100% ± 0% 100% ± 0%  98% ± 2% 92% ± 8% 87% ± 9% 73% ± 7%  59% ± 12% c4506_g1-03-50 100% ± 0% 100% ± 0% 99% ± 2% 96% ± 3% 88% ± 6% 50% ± 8% 42% ± 12% 21% ± 11% c4506_g1-03-5 100% ± 0% 100% ± 0% 99% ± 1% 95% ± 4% 91% ± 6% 68% ± 8% 48% ± 11% 29% ± 12% c4506_g1-04-50 100% ± 0% 100% ± 0% 98% ± 3% 97% ± 4% 90% ± 7% 66% ± 9% 44% ± 10% 18% ± 12% c4506_g1-04-5 100% ± 0% 100% ± 0% 98% ± 2% 95% ± 5% 92% ± 5% 73% ± 8% 49% ± 9%  36% ± 10%

Example 4. Unexpected Technical Effect of Interfering with the Same Gene Expression in Different Insects

(23) Signal recognition particle 54 kDa protein, which belongs to one of the peptide chains in the signal recognition particle complex, and its main function is that when the pre-secreted protein is exposed from the ribosome, signal recognition particle 54 kDa protein rapidly binds to the signal sequence of the pre-secreted protein and transfers it to the translocation chain related membrane protein. The related literature showed that interfering with coding gene expression of signal recognition particle 54 kDa protein can have lethal effects on a variety of Coleoptera insects, as reported by Julia Ulrich et al. (2015), RNAi interference was performed on the coding gene of the protein in the Tribolium castaneum by an injection manner (injection sequence code of iB_00404), and it was found that almost all Tribolium castaneum were killed at about four days after injection. As also reported by Avet-Rochex et al. (2010), RNAi interference was performed on the coding gene of the protein in Drosophila by an injection manner (Table 1), and the results showed that almost all Drosophila were killed after injection.

(24) On the basis of the reports in the above-mentioned literatures and the high homology of the sequences, the coding gene of this protein in Monolepta hieroglyphica (Motschulsky) was screened out. As for sequences for injection into Tribolium castaneum and Drosophila, the sequence M1 at corresponding position was selected, as shown in SEQ ID NO: 16, and the sequence M2 at non-corresponding position was selected, as shown in SEQ ID NO: 17. The control ability for Monolepta hieroglyphica (Motschulsky) was determined by using a method of feeding dsRNA (at a ratio of 50 μg/g of feed) in the Example 3 of the present invention. As shown in Table 3, the experimental results showed that neither the sequence M1 at the corresponding position, nor the sequence M2 at the non-corresponding position can produce a significant lethal effect on Monolepta hieroglyphica (Motschulsky), which was basically no different from the control group. Similar experimental results were confirmed in PCT international public patent WO 2018/026770, which was verified with RNAi lethal genes of nematodes, Drosophila and so on after transcriptome was obtained, that is, according to the known several lethal genes of nematodes and Drosophila, RNAi interference was performed on the corresponding gene in maize rootworm, and there was basically no significant lethal effect. In summary, the technical effect of interfering with the same gene expression of different insects was unpredictable, and it is not inevitably associated with the technical effect of known interference and the homology of sequences.

(25) TABLE-US-00003 TABLE 3 Experimental results of lethality rate of Monolepta hieroglyphica (Motschulsky) fed with dsRNA Material Number DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 CK-dsRNA 96% ± 6% 85% ± 9% 75% ± 16% 71% ± 16% 69% ± 13% 69% ± 14% M1-dsRNA-50 98% ± 3% 92% ± 6% 89% ± 7%  83% ± 9%  69% ± 15% 63% ± 18% M2-dsRNA-50 91% ± 8%  88% ± 10% 84% ± 11% 76% ± 13% 69% ± 15% 67% ± 17%

Example 5. Construction of Plant Expression Vectors

(26) Two expression cassettes were synthesized according to the order of p35S-RX-tNos-p35S-Hpt-tNos (X is 1-4), and connected to the plant expression vectors through EcoR V and BamH I, and named DBNR4506CX (X is 1-4, in which the vector schematic diagram of DBNR4506C1 was shown in FIG. 2 (Kan: Kanamycin gene; RB: the right boundary; pr35S: cauliflower mosaic virus 35S (SEQ ID NO: 7); R1 (SEQ ID NO: 8): the g1_01 nucleotide sequence (g1_01 is the target sequence 1 of target gene c4506, SEQ ID NO: 3)+spacer sequence (SEQ ID NO: 9)+the reverse complementary sequence of the g1_01 nucleotide sequence; tNos: the terminator of nopaline synthase gene (SEQ ID NO: 10); Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 11); and LB: the left border).

(27) Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBNR4506C1 by a heat shock method with the following heat shock conditions: water bathing 50 μL of Escherichia coli T1 competent cells and 10 μL of plasmid DNA (recombinant expression vector DBNR4506C1) at 42° C. for 30 s; shake culturing at 37° C. for 1 h (using a shaker at a rotation speed of 100 rpm for shaking); then culturing under the condition of a temperature of 37° C. for 12 h on a LB solid plate (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, adjusted to a pH of 7.5 with NaOH) containing 50 mg/L of Kanamycin, picking white colonies, and culturing under the conditions of a temperature of 37° C. overnight in a LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of Kanamycin, adjusted to a pH of 7.5 with NaOH). The plasmids in the cells were extracted through an alkaline method: centrifuging the bacteria solution at a rotation speed of 12000 rpm for 1 min, removing the supernatant, and the precipitated bacteria were suspended with 100 μL of an ice precooled solution I (25 mM of Tris-HCl, 10 mM of EDTA (ethylenediamine tetraacetic acid), 50 mM of glucose, pH 8.0); adding 200 μL of a freshly prepared solution II (0.2 M of NaOH, 1% SDS (sodium dodecyl sulfate)), reversing the tube 4 times, mixing, and placing on ice for 3-5 min; adding 150 μL of a cold solution III (3M of potassium acetate, 5M of acetic acid), mixing evenly well immediately, and placing on ice for 5-10 min; centrifuging under the conditions of a temperature of 4° C. and a rotation speed of 12000 rpm for 5 min, adding 2 times of volume of anhydrous ethanol to the supernatant, mixing evenly and placing at room temperature for 5 min; centrifuging under the conditions of a temperature of 4° C. and a rotation speed of 12000 rpm for 5 min, discarding the supernatant, and washing the precipitate with ethanol at a concentration (V/V) of 70% and drying; adding 30 μL of TE (10 mM of Tris-HCl, 1 mM of EDTA, pH 8.0) containing RNase (20 μg/mL) to dissolve the precipitate; water bathing at 37° C. for 30 min to digest RNA; storing at −20° C. for later use. The extracted plasmids were sequenced and identified through PCR, and the results demonstrated that the recombinant expression vector DBNR4506C1 was correctly constructed.

(28) According to the above-mentioned method, recombinant expression vectors DBNR4506C2-DBNR4506C4 were constructed respectively, with the following vector structures: Kan: Kanamycin gene; RB: the right boundary; pr35S: cauliflower mosaic virus 35S (SEQ ID NO: 7); RX: the g1_0X nucleotide sequence (g1_0X is the target sequence X of target gene c4506, X is 2-4)+spacer sequence (SEQ ID NO: 9)+the reverse complementary sequence of the g1_0X nucleotide sequence); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 10); Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 11); and LB: the left boundary. Escherichia coli T1 competent cells were transformed respectively with the recombinant expression vector DBNR4506C2-DBNR4506C4 by a heat shock method, and the plasmids in the cells were extracted through an alkaline method.

Example 6. Transformation of Agrobacterium with the Recombinant Expression Vectors

(29) Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed respectively with the recombinant expression vectors DBNR4506C1-DBNR4506C4 which had been correctly constructed, by using a liquid nitrogen method with the following transformation conditions: placing 100 μL of Agrobacterium LBA4404, and 3 μL of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 min, and warm water bathing at 37° C. for 10 min; inoculating the transformed Agrobacterium LBA4404 into a LB tube, culturing under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 h, and then spreading on a LB plate containing 50 mg/L of rifampicin and 100 mg/L of Kanamycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing verification by enzyme digestion on the recombinant expression vectors DBNR4506C1-DBNR4506C4 with restriction endonucleases EcoR V and BamH I, with the results demonstrating that the structures of the recombinant expression vectors DBNR4506C1-DBNR4506C4 were completely correct.

Example 7. Acquisition of Transgenic Maize Plants

(30) According to the conventionally used Agrobacterium infection method, young embryos of maize variety Zong31 (Z31) cultured under sterile conditions were co-cultured with the transformed Agrobacterium in Example 6, so as to transfer T-DNA (comprising the RX nucleotide sequence, a promoter sequence of a cauliflower mosaic virus 35S gene, a Hpt gene and a Nos terminator sequence) in the recombinant expression vectors DBNR4506C1-DBNR4506C4 constructed in Example 5 into the maize chromosome, thereby obtaining maize plants with the RX nucleotide sequence (X is 1-4) incorporated; meanwhile, wild type maize plants were used as the control.

(31) As regards the Agrobacterium-mediated maize transformation, briefly, immature young embryos were separated from maize, and contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the RX nucleotide sequence to at least one cell of one of the young embryos (step 1: the infection step). In this step, the young embryos were preferably immersed in an Agrobacterium suspension (OD.sub.660=0.4-0.6, a culture medium for infection (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of acetosyringone (AS), and 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3)) to initiate the inoculation. The young embryos were co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, the young embryos were cultured in a solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of acetosyringone (AS), 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), and 8 g/L of agar, pH 5.8) after the infection step. After this co-culturing stage, there can be an optional “recovery” step. In the “recovery” step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a culture medium for recovery (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), and 3 g/L of phytagel, pH 5.8), without the addition of a selective agent for plant transformant (step 3: the recovery step). Preferably, the young embryos were cultured in a solid culture medium with the antibiotic, but without the selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the inoculated young embryos were cultured in a culture medium containing a selective agent (hygromycin), and growing transformed calli were selected (step 4: the selection step). Preferably, the young embryos were cultured in a solid culture medium for screening (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 50 mg/L of hygromycin, 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), and 3 g/L of phytagel, pH 5.8) with the selective agent, resulting in selective growth of transformed cells. Then, plants were regenerated from the calli (step 5: the regeneration step). Preferably, the calli grown on a culture medium containing the selective agent were cultured in solid culture media (MS differentiation culture medium and MS rooting culture medium) to regenerate plants.

(32) The resistant calli obtained from screening were transferred onto the MS differentiation culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 50 mg/L of hygromycin, and 3 g/L of phytagel, pH 5.8), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred onto the MS rooting culture medium (2.15 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 3 g/L of phytagel, pH 5.8), cultured at 25° C. until reaching a height of about 10 cm, and transferred to a greenhouse for culturing until fruiting. In the greenhouse, the plants were cultured at 28° C. for 16 hours, and then cultured at 20° C. for 8 hours every day.

Example 8. Acquisition of Transgenic Soybean Plants

(33) According to the conventionally used Agrobacterium infection method, cotyledonary node tissues of soybean variety Zhonghuang13 cultured under sterile conditions were co-cultured with the transformed Agrobacterium in Example 6, so as to transfer T-DNA (comprising the RX nucleotide sequence, a promoter sequence of a cauliflower mosaic virus 35S gene, a Hpt gene and a Nos terminator sequence) in the recombinant expression vectors DBNR4506C1-DBNR4506C4 constructed in Example 5 into the soybean chromosome, thereby obtaining soybean plants with the RX nucleotide sequence (X is 1-4) incorporated; meanwhile, wild type soybean plants were used as the control.

(34) As regards the Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in a culture medium for soybean germination (3.1 g/L of B5 salt, B5 vitamin, 20 g/L of sucrose, and 8 g/L of agar, pH 5.6), and the seeds were inoculated on the culture medium for germination and cultured under the conditions of a temperature of 25±1° C.; and a photoperiod (light/dark) of 16 h/8 h. After 4-6 days of germination, soybean sterile seedlings swelling at bright green cotyledonary nodes were taken, hypocotyls were cut off 3-4 mm below the cotyledonary nodes, the cotyledons were cut longitudinally, and apical buds, lateral buds and seminal roots were removed. A wound was made at a cotyledonary node using the knife back of a scalpel, the wounded cotyledonary node tissues were contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the RX nucleotide sequence to the wounded cotyledonary node tissues (step 1: the infection step). In this step, the cotyledonary node tissues were preferably immersed in the Agrobacterium suspension (OD.sub.660=0.5-0.8, a culture medium for infection (2.15 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 40 mg/L of acetosyringone (AS), 4 g/L of 2-morpholine ethanesulfonic acid (MES), and 2 mg/L of zeatin (ZT), pH 5.3)) to initiate the inoculation. The cotyledonary node tissues were co-cultured with the Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, the cotyledonary node tissues were cultured in a solid culture medium (4.3 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 4 g/L of 2-morpholine ethanesulfonic acid (MES), 2 mg/L of zeatin, and 8 g/L of agar, pH 5.6) after the infection step. After this co-culturing stage, there can be an optional “recovery” step. In the “recovery” step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a culture medium for recovery (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 2 mg/L of zeatin (ZT), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, and 100 mg/L of aspartic acid, pH 5.6), without the addition of a selective agent for plant transformant (step 3: the recovery step). Preferably, tissue blocks regenerated from the cotyledonary nodes were cultured in a solid culture medium with the antibiotic, but without the selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the tissue blocks regenerated from the cotyledonary nodes were cultured in a culture medium containing a selective agent (hygromycin), and growing transformed calli were selected (step 4: the selection step). Preferably, the tissue blocks regenerated from the cotyledonary nodes were cultured in a solid culture medium for screening (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 1 mg/L of 6-benzyladenine (6-BAP), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, 100 mg/L of aspartic acid, and 50 mg/L of hygromycin, pH 5.6) with the selective agent, resulting in selective growth of transformed cells. Then, plants were regenerated from the transformed cells (step 5: the regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary nodes grown on a culture medium containing the selective agent were cultured in solid culture media (B5 differentiation culture medium and B5 rooting culture medium) to regenerate plants.

(35) The resistant tissue blocks obtained from screening were transferred onto the B5 differentiation culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 1 mg/L of zeatin (ZT), 8 g/L of agar, 150 mg/L of cephalosporin, 50 mg/L of glutamic acid, 50 mg/L of aspartic acid, 1 mg/L of gibberellin, 1 mg/L of auxin, and 50 mg/L of hygromycin, pH 5.6), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred onto the B5 rooting culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 8 g/L of agar, 150 mg/L of cephalosporin, and 1 mg/L of indole-3-butyric acid (IBA)), cultured on the rooting culture medium at 25° C. until reaching a height of about 10 cm, and transferred to a greenhouse for culturing until fruiting. In the greenhouse, the plants were cultured at 26° C. for 16 hours, and then cultured at 20° C. for 8 hours every day.

Example 9. Verification of the Transgenic Maize Plants and the Transgenic Soybean Plants Using TaqMan

(36) About 100 mg of leaves from the maize plants into which the RX nucleotide sequence (X is 1-4) was incorporated, were taken as samples. The genomic DNA thereof was extracted with a DNeasy Plant Maxi Kit from Qiagen respectively, and the copy number of a Hpt gene was detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy numbers of the RX nucleotide sequence. Meanwhile, wild type maize plants were used as the control, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.

(37) The particular method for detecting the copy number of the Hpt gene was as follows:

(38) Step 901. 100 mg of leaves from the maize plants into which the RX nucleotide sequence was incorporated and wild type maize plants were respectively taken, ground into a homogenate in a mortar with liquid nitrogen, and triple repeats were taken for each sample;

(39) Step 902. The genomic DNA of the above-mentioned samples was extracted using a DNeasy Plant Mini Kit from Qiagen, and the particular method can refer to the product instruction thereof;

(40) Step 903. The concentrations of the genomic DNAs of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific);

(41) Step 904. The concentrations of the genomic DNAs of the above-mentioned samples were adjusted to a consistent concentration value which ranges from 80-100 ng/μL;

(42) Step 905. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers had been identified and known were taken as standards, the samples of the wild type maize plants were taken as the control, and triple repeats were taken for each sample, and were averaged; the sequences of the primers and probe for fluorescence quantitative PCR were as follows, respectively:

(43) The following primers and probe were used for detecting the Hpt nucleotide sequence:

(44) Primer 1: cagggtgtcacgttgcaaga as shown in SEQ ID NO: 12 of the sequence listing;

(45) Primer 2: ccgctcgtctggctaagatc as shown in SEQ ID NO: 13 of the sequence listing;

(46) Probe 1: tgcctgaaaccgaactgcccgctg as shown in SEQ ID NO: 14 of the sequence listing;

(47) PCR Reaction System:

(48) TABLE-US-00004 JumpStart ™ Taq ReadyMix ™ (Sigma) 10 μL 50× primer/probe mixture  1 μL genomic DNA  3 μL water (ddH.sub.2O)  6 μL

(49) The 50×primer/probe mixture comprises 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and was stored at 4° C. in an centrifuge tube.

(50) PCR Reaction Conditions:

(51) TABLE-US-00005 Step Temperature Time 911 95° C.  5 min 912 95° C. 30 s 913 60° C.  1 min 914 back to step 912, repeated 40 times

(52) Data was analyzed using software SDS2. 3 (Applied Biosystems).

(53) By analyzing the experimental results of the copy number of the Hpt gene, it was further demonstrated whether the RX nucleotide sequence was respectively incorporated into the chromosome of the detected maize plants, and whether the maize plants into which the RX nucleotide sequence (X is 1-4) was incorporated resulted in single-copy transgenic maize plants.

(54) According to the above-mentioned method of verifying the transgenic maize plants using TaqMan, the transgenic soybean plants were detected and analyzed. It was further demonstrated, by analyzing the experimental results of the copy number of the Hpt gene, that the RX nucleotide sequence was incorporated into the chromosomes of the detected soybean plants, and the soybean plants into which the RX nucleotide sequence (X is 1-4) was incorporated resulted in single-copy transgenic soybean plants.

Example 10. Identification of Insecticidal Effect of Transgenic Maize on Monolepta hieroglyphica (Motschulsky)

(55) The insecticidal effect against Monolepta hieroglyphica (Motschulsky) of the maize plants into which the RX nucleotide sequence (X is 1-4) was incorporated was detected.

(56) Step 1001. Ten strains of DBNR4506C1-DBNR4506C4 maize transformation events (RX-M), each of which was identified as a positive single copy through taqman, and three strains of maize transformation events (NGM1) which were identified as negative through taqman were chosen; meanwhile, wild type maize plants were used as the control (CK1); and the plants were grown in a greenhouse until trefoil stage;

(57) Step 1002. The materials in step 1001 were taken, and a third young leaf was taken from each seedling, and cut to a size of 1×2 cm of leaf in which the main vein was removed, and laid and placed in a culture dish with a moist filter paper laid thereon;

(58) Step 1003. 10 newly-incubated larvae of Monolepta hieroglyphica (Motschulsky) with an incubation time of not more than 24 h were placed in each dish, the covers of the dishes covered same tightly, the culture dishes were placed in a bioassay box with a moist piece of gauze laid at the bottom thereof, and the bioassay box was placed in a bioassay chamber at a temperature of 24±2° C., D/L of 24/0, and a humidity of 70%-80%;

(59) Step 1004. Considering that the newly-incubated larvae of Monolepta hieroglyphica (Motschulsky) are small and weak, and easily suffer from mechanical injuries, it was better to keep the culture dishes unmoved on the day that the insects were incubated and 1 day after incubation;

(60) Step 1005. Starting on day 2 after the incubation of the insects, the number of surviving Monolepta hieroglyphica (Motschulsky) was counted from the exterior of the culture dishes every day until the end of day 16; insects of Monolepta hieroglyphica (Motschulsky) surviving in the culture dishes were transferred to culture dishes charged with fresh leaves every two days, and the experimental results were shown in Table 4.

(61) TABLE-US-00006 TABLE 4 Experimental results of feeding Monolepta hieroglyphica (Motschulsky) with leaves having maize transformation events Material Survival rate of Monolepta hieroglyphica (Motschulsky) at each two days after bioassay number DAI2 DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 DAI16 CK1 100% ± 0% 98% ± 4% 92% ± 4% 85% ± 8% 82% ± 9%  80% ± 8% 76% ± 9%  71% ± 8%  NGM1 100% ± 0% 95% ± 2% 93% ± 5% 87% ± 7% 84% ± 10% 80% ± 8% 75% ± 10% 72% ± 9%  R1-M 100% ± 0% 94% ± 5% 91% ± 4% 90% ± 6% 78% ± 10% 68% ± 8% 56% ± 15% 50% ± 15% R2-M 100% ± 0% 94% ± 3% 92% ± 5% 87% ± 6% 80% ± 5%  71% ± 7% 52% ± 12% 49% ± 11% R3-M 100% ± 0% 93% ± 5% 90% ± 3% 85% ± 7% 78% ± 8%  69% ± 8% 50% ± 10% 48% ± 13% R4-M 100% ± 0% 94% ± 2% 88% ± 2% 83% ± 6% 76% ± 5%  67% ± 9% 52% ± 9%  44% ± 9% 

(62) The experimental results in Table 4 demonstrated that the maize plants into which the RX nucleotide sequence (X is 1-4) was incorporated had good inhibitory effects on Monolepta hieroglyphica (Motschulsky), and the survival rate (survival rate=survival number/test number) of Monolepta hieroglyphica (Motschulsky) was about 50% on day 16.

Example 11. Identification of Insecticidal Effect of Transgenic Soybean on Monolepta hieroglyphica (Motschulsky)

(63) The insecticidal effect against Monolepta hieroglyphica of the soybean plants into which the RX nucleotide sequence (X is 1-4) was incorporated was detected.

(64) Step 1101. Ten strains of DBNR4506C1-DBNR4506C4 soybean transformation events (RX-S) each of which was identified as a positive single copy through taqman, and three strains of soybean transformation events (NGM2) which were identified as negative through taqman were chosen; meanwhile, wild type soybean plants were used as the control (CK2); and the plants were grown in a greenhouse until three pieces of euphylla were grown;

(65) Step 1102. The materials in step 1101 were taken, and a piece of euphylla with a size of about 2×2 cm was taken from each seedling, and laid and placed in a culture dish with a moist filter paper laid thereon;

(66) Step 1103. 15 newly-incubated larvae of Monolepta hieroglyphica (Motschulsky) with an incubation time of not more than 24 h were placed in each dish, the covers of the dishes covered same tightly, the culture dishes were placed in a bioassay box with a moist piece of gauze laid at the bottom thereof, and the bioassay box was placed in a bioassay chamber at a temperature of 24±2° C., D/L of 24/0, and a humidity of 70%-80%;

(67) Step 1104. Considering that the newly-incubated larvae of Monolepta hieroglyphica (Motschulsky) are small and weak, and easily suffer from mechanical injuries, it was better to keep the culture dishes unmoved on the day that the insects were incubated and 1 day after incubation;

(68) Step 1105. Starting on day 2 after the incubation of the insects, the number of surviving Monolepta hieroglyphica (Motschulsky) was counted from the exterior of the culture dishes every day until the end of day 16; insects of Monolepta hieroglyphica (Motschulsky) surviving in the culture dishes were transferred to culture dishes charged with fresh euphylla every two days, and the experimental results were shown in Table 5.

(69) TABLE-US-00007 TABLE 5 Experimental results of feeding Monolepta hieroglyphica (Motschulsky) with euphylla having soybean transformation events Material Survival rate of Monolepta hieroglyphica (Motschulsky) at each two days after bioassay number DAI2 DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 DAI16 CK2 100% ± 0% 100% ± 0% 95% ± 3% 94% ± 4%  90% ± 4%  86% ± 8%  80% ± 9%  74% ± 8%  NGM2 100% ± 0% 100% ± 0% 96% ± 2% 95% ± 4%  92% ± 5%  88% ± 10% 78% ± 11% 72% ± 11% R1-S 100% ± 0%  95% ± 1% 92% ± 6% 91% ± 10% 92% ± 8%  83% ± 15% 60% ± 9%  46% ± 9%  R2-S 100% ± 0%  98% ± 2% 93% ± 4% 92% ± 8%  83% ± 12% 72% ± 9%  65% ± 12% 54% ± 12% R3-S 100% ± 0%  90% ± 4% 94% ± 7% 90% ± 11% 90% ± 12% 84% ± 14% 71% ± 13% 54% ± 13% R4-S 100% ± 0%  99% ± 0% 91% ± 7% 91% ± 11% 86% ± 11% 79% ± 12% 62% ± 9%  58% ± 9% 

(70) The experimental results in Table 5 demonstrated that the soybean plants into which the RX nucleotide sequence (X is 1-4) was incorporated had good inhibitory effects on Monolepta hieroglyphica (Motschulsky), and the survival rate (survival rate=survival number/test number) of Monolepta hieroglyphica (Motschulsky) was up to 58% on day 16.

Example 12. Composition

(71) Formula of an agriculturally acceptable carrier for dsRNA (1 L system): 50 mM of NaHPO.sub.4 (pH7.0), 10 mM of β-mercaptoethanol, 10 mM of EDTA, sodium hexadecylsulfonate at a mass fraction of 0.1%, and polyethylene glycol octyl phenyl ether at a mass fraction of 0.1%, make up to 1 L with H.sub.2O.

(72) The above-mentioned formula was a buffer formula, provided that any purified dsRNA is directly added to the buffer so that the final concentration met requirements, such as 50 mg/L. The formula can also be prepared into a concentrated preparation as desired.

(73) In summary, the present invention discloses, for the first time, a target gene c4506 and target sequence thereof for controlling an insect pest of Coleoptera, Monolepta hieroglyphica (Motschulsky), and transgenic plants (maize and soybean) obtained by using RNAi technology. The transgenic plants control the invasion of Monolepta hieroglyphica (Motschulsky) efficiently and specifically by introducing dsRNA sequences formed from the target sequences, and Monolepta hieroglyphica (Motschulsky) can be prevented from developing a similar risk of Bt-toxin protein resistance, with the advantages of good environment compatibility, convenience and low cost.

(74) Finally, it should be stated that the above examples are merely used for illustrating, rather than limiting, the technical solution of the present invention; and although the present invention has been illustrated in detail with reference to the preferred examples, a person skilled in the art should understand that modifications or equivalent replacements may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.