A COMPOSITION FOR IMPROVING GUT MICROBIOTA, BEHAVIOURAL PATTERN, ALPHA-SYNUCLEIN LEVELS, SLEEP PATTERN AND/OR SERUM MELATONIN

20240374631 ยท 2024-11-14

    Inventors

    Cpc classification

    International classification

    Abstract

    Compositions for improving gut microbiota, improving behavioural pattern and alpha-synuclein levels, and improving sleep pattern and serum melatonin, especially in children with autism, are provided. Methods are also included for control of gut enterobacteria in children with autism, reconstitution of gut microbiota, and control of enterobacteria in autism and neurodegenerative diseases.

    Claims

    1. A composition for improving gut microbiota, comprising a beta-glucan produced by Aureobasidium pullulans APO-202 (FERM BP-I9327).

    2. The composition according to claim 1, wherein the improvement of gut microbiota comprises a decrease of Akkermansia muciniphila with an increase of beneficial bacteria including Roseburia in a gut.

    3. The composition according to claim 1, wherein the composition is for prophylactic, ameliorating and/or curative treatment of autism spectrum disorders (ASD), multiple sclerosis (MS), Alzheimer's disease (AD), Parkinson's disease (PD) and/or epilepsy.

    4. The composition according to claim 1, wherein the composition is for improving behavioural pattern and alpha-synuclein levels.

    5. The composition according to claim 1, wherein the composition is for improving sleep pattern and serum melatonin.

    6. The composition according to claim 5, wherein the improvement is in a child with autism spectrum disorder.

    7. The composition according to claim 1, wherein the composition is a pharmaceutical composition.

    8. The composition according to claim 1, wherein the composition is a food composition.

    9. A method of improving gut microbiota in a subject, comprising administering a beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327) to the subject in need thereof.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0036] FIG. 1. Index of the most abundant taxa across species levels.

    [0037] FIGS. 2A and 2B. Differences pre and post-intervention in the read count of selected bacteria between A. Enterobacteria; and, B. Firmicutes.

    [0038] FIGS. 3A-3C. Most abundant taxa at the phyla (A), genus (B), and species (C) levels in the different groups of the study.

    [0039] FIGS. 4A-4D. Principal component analysis (PCA) of: A, B. all the ten samples (five groupspre- and post-intervention)A, C. Score plot; B, D. Loading plot; Study groups (1) Control/Vehicle, 2Baseline, 12post-intervention, (2) AFO-202, 4Baseline, 14post-intervention, and (3) Telmisartan, 10Baseline, 20post-intervention.

    [0040] FIGS. 5A-5C. Differential abundance analysis, log 2 fold change results for each group before and after intervention: A. Control, B. AFO-202, and C. Telmisartan.

    [0041] FIGS. 6A-6F. Score plots of principal component analysis (PCA) and compounds with a VIP value of 1 or higher in the OPLS-DA of the different groups: A. Control; B. AFO-202; C. Telmisartan.

    [0042] FIGS. 7A-7E. Peak height of the detected compounds after normalization. A. Succinic acid, B. Phosphoric acid, C. Fructose, D. Isoleucine, and E. Leucine (**significant;*not significant; p-value significance <0.05).

    [0043] FIG. 8. Euclidean distance hierarchical clustering analysis demonstrating the different intensity levels of characteristic metabolites in AFO-202.

    [0044] FIGS. 9A and 9B. Euclidean distance hierarchical clustering analysis demonstrating the different intensity levels of characteristic metabolites in A. Control; and, B. Telmisartan.

    [0045] FIG. 10 shows decrease in abundance of Enterobacteria in AFO-202 compared to Control, post-intervention.

    [0046] FIG. 11 shows decrease in abundance of Bacteroides in AFO-202 compared to Control, post-intervention.

    [0047] FIG. 12 shows increase in abundance of Prevotella in AFO-202 compared to Control, post-intervention.

    [0048] FIG. 13 shows decrease in Lactobacillus in AFO-202 and Control.

    [0049] FIG. 14 shows CONSORT flow diagram of the trial.

    [0050] FIG. 15. Data before and after adapter trimming.

    [0051] FIG. 16. Average Read quality before and after adapter trimming.

    [0052] FIG. 17. Average GC % before and after adapter trimming.

    [0053] FIG. 18. Percentage of alignment to Bacteria, Fungi, Virus, Archae Bacteria and Human genomes.

    [0054] FIG. 19. Post intervention control vs post intervention treatment SEED Average values.

    [0055] FIG. 20. Distribution of Phyla: Phylum Proteobacteria was the most abundant followed by Phylum Firmicutes.

    [0056] FIGS. 21A and 21B. Genus Abundance of major genera identified (A) Group (Gr.) 1 at baseline versus post-intervention and (B) Group (Gr.) 2 at baseline versus post-intervention.

    [0057] FIGS. 22A-22D. FIG. 22A shows decrease in abundance of Enterobacteria in Group 2 compared to Group (Gr.) 1, post-intervention. FIG. 22B shows decrease in abundance of Bacteroides in Group (Gr.) 2, which had increased in Group 1 post-intervention. FIG. 22C shows increase in Prevotella in Group 1 and Group 2 post-intervention. FIG. 22D shows decrease in Lactobacillus in Group 1 and Group 2 post-intervention.

    [0058] FIGS. 23A and 23B. Species Abundance of major species analysed; (A) Group (Gr.) 1 at baseline versus post-intervention and (B) Group (Gr.) 2 at baseline versus post-intervention.

    [0059] FIGS. 24A and 24B. Distribution of Genera and Distribution of Species.

    [0060] FIGS. 25A-25D. (A) Decrease in abundance of E. coli was significant in Group (Gr.) 2 compared to Group (Gr.) 1, post-intervention; (B) Significant increase in abundance of Faecalibacterium prausnitzii in Group 2 compared to Group 1 post-intervention; (C) Increase in Akkermansia muciniphila in Group 1 but decrease in Group 2 post-intervention; and, (D) Increase in Clostridium bolteae CAG:59 in Group 1 but decrease in Group 2 post-intervention.

    [0061] FIGS. 26A-26C. A. The score on the childhood autism rating scale (CARS) in Gr. 1 (control), which was very mild and showed no improvement after the study, whereas the score decreased in all children by an average of 3 points for B. Gr. 2 (Nichi Glucan); and, C. Comparison between Gr. 1 and Gr. 2 showed a significant decrease in the CARS score, indicating improvement in autism's signs and symptoms in Gr. 2 (Nichi Glucan) compared to Gr. 1 (control) post-intervention (p-value=0.034517).

    [0062] FIGS. 27A-27C. A. Plasma alpha-synuclein levels in Gr. 1 (control) pre- and post-intervention; B. Plasma alpha-synuclein in Gr. 2 (Nichi Glucan) pre- and post-intervention; and, C. Plasma alpha-synuclein levels in Nichi Glucan group Gr. 2 showed a significant increase compared to Gr. 1 (p-value=0.091701).

    [0063] FIG. 28. The total sleep pattern score of the Children's Sleep Habits Questionnaire-Abbreviated (CSHQ-A) showing significant improvement by decrease in score in Nichi Glucan (Gr.2) compared to Gr.1 (Control) after the intervention.

    [0064] FIGS. 29A-29C. Serum melatonin levels in Gr. 1 (Control group) pre- and post-intervention; serum melatonin levels in Gr. 2 (Nichi Glucan group) pre- and post-intervention; and fold increase in Nichi Glucan group Gr. 2 greater than in Gr.1

    [0065] FIG. 30 explains, stepwise, the pathogenesis as well as the way beta glucan tackles each stage of the disease process: (A) & (B) Enterobacteria secretion of curli that causes misfolding of -synuclein (Syn); its aggregation in enteric neuronal cells is tackled by (1) control of enterobacteria, (2) scavenging of the accumulated amyloids by activated natural killer cells, and (3) reconstitution of beneficial microbiome; (C) The prion like propagation may not occur because the accumulation of curli proteins and amyloids is controlled at the level of production and aggregation (1) as well as clearing of already accumulated deposits (3); and, (D) Deposition of Lewy bodies, amyloid fibrils, and misfolded Syn are tackled by (4) microglial-based scavenging.

    [0066] FIG. 31. Increase in abundance of Roseburia hominis after AFO-202, whose increase may be attributed to the increase in melatonin.

    [0067] FIG. 32. Increase in abundance of Roseburia inulinivorans after AFO-202, whose increase may be attributed to the increase in melatonin.

    [0068] FIG. 33. Increase in abundance of Roseburia intestinalis after AFO-202, whose increase may be attributed to the increase in melatonin.

    [0069] FIG. 34. Increase in abundance of Roseburia faecis after AFO-202, whose increase may be attributed to the increase in melatonin.

    [0070] FIG. 35. Post Intervention Control vs Post Intervention Treatment Seed Average of the different functional properties and metabolic pathways beneficially modulated in AFO-202 (Treatment group).

    [0071] FIGS. 36A and 36B. Expression of -synuclein on the neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) -synuclein polyclonal antibody (Proteintech Co. 10842-1-AP), and expression of -synuclein on the neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) -synuclein polyclonal antibody in a wider field of magnification (Proteintech Co. 10842-1-AP).

    [0072] FIG. 37. Illustration of how AFO-202 prevents and treats neurological diseases by controlling production and propagation of Abnormal Alpha-Synuclein.

    [0073] FIG. 38. Illustration of how AFO-202 prevents and treats neurological diseases by controlling production and propagation of Abnormal Alpha-Synuclein at the gut level by controlling the production of Alpha-Synuclein and scavenging of aggregates by Natural Killer (NK) cells and in the brain by microglia.

    DETAILED DESCRIPTION OF INVENTION

    [0074] The present invention relates to a composition for improving gut microbiota. The present invention also relates to an effective control of gut enterobacteria producing Alpha synuclein and Curli amyloids after consumption of Aureobasidium pullulans derived beta 1,3-1,6 glucans in children with autism spectrum disorder in a clinical pilot study. The present invention also relates to a beneficial reconstitution of gut microbiota and control of alpha-synuclein and curli-amyloids-producing enterobacteria, by beta 1,3-1,6 glucans in a clinical pilot study of autism and potentials in neurodegenerative diseases. The present invention also relates to a gut microbiota reconstitution by Beta Glucans in autism.

    [0075] Further, the present invention relates to a composition for improving behavioural pattern and alpha-synuclein levels, especially in autism spectrum disorder. The present invention also relates to an improvement of behavioural pattern and alpha-synuclein levels in autism spectrum disorder after consumption of a beta-glucan food supplement in a randomized, parallel-group pilot clinical study.

    [0076] Moreover, the present invention relates to a composition for improving sleep pattern and serum melatonin, especially in children with autism spectrum disorder. The present invention also relates to an improvement of sleep pattern and serum melatonin in children with autism spectrum disorder after consumption of Beta 1,3-1,6 Glucan in a pilot clinical study.

    [0077] The glucan contained in the composition of the present invention can be a glucan derived from Aureobasidium pullulans strain FO-68 (Also referred to herein as strain AFO 202), and preferably -1,3-1,6 glucan derived from FO-68 (Also referred to herein simply as glucan, AFO 202 glucan or AF 202 beta glucan). Aureobasidium pullulans strain FO-68 has been deposited at the Patent Biological Depository Center, National Institute of Advanced Industrial Science and Technology, under the deposit number FERMP-19327.

    [0078] While the domestic deposition was made on Apr. 23, 2003, Aureobasidium pullulans strain FO-68 has then been transferred to international deposition at the International Patent Organism Depositary, National Institute of Technology and Evaluation (Room. 120, 2-5-8, Kazusa Kamatari, Kisarazu-shi, Chiba, 292-0818 Japan) on Apr. 21, 2021 with the accession number: FERM BP-19327.

    [0079] Aureobasidium pullulans strain FO-68 is also called as Aureobasidium strain FERM P-18099.

    Scientific Properties of FO-68

    [0080] This fungus produces high-molecular polysaccharide with high viscosity. This substance agglutinates easily with ethanol, making it possible to collect simply. This polysaccharide is of [beta] type, and is acidic polysaccharide having a main chain of 1,3 bond and branches from 3- and 6-positions. It contains carboxylic acids such as malic acid as organic acids and phosphoric acid. Moreover, it agglutinates easily with aluminum ions etc. This substance is also effective for the promotion of growth as a feed and the effluent treatment. It is effective as a food additive and functional food.

    [0081] FO-68 forms blackish brown colonies on potato-dextrose-agar slant culturing for 7 days at 25 C. The fringe of colonies shows filamentous growth and becomes gradually light blackish brown. The cells are filamentous, and sometimes arthrospores, yeast-like budding conidiospores, oval yeast-like single cells, and, in some time, thick-walled spore cells are formed. The growth temperature is 25 C., and it decomposes hexoses such as glucose, fructose and galactose, sucrose, and starch. The medium becomes conspicuously viscous. Based on FO-68's mycological properties, it is a kind of Aureobasidium pullulans in the black fungus family of deuteromycetes.

    Mycological Features of the Isolated Fungus

    [0082] A colony of FO-68 has a smooth surface at first and grows into a grayish white, mucous and glossy oil drop-like (fat-like), yeast-like material. The filamentous fungus body grows radially from the fringe thereof, leading to crinkled, filamentous and just dendritic growth. This filamentous fungus body grows well not only on the surface of medium, but also in the medium. In a short time, light dark brown specks appear here and there on the surface of colony, which become black specks gradually, and overall surface becomes dark black eventually. On this filamentous fungus body, a lot of light brown, elliptic or oval conidiospores are produced laterally. This conidiospore falls easily in pieces. While the surface of oil drop-like colony puts on the conidiospores here and there.

    [0083] As a method for culturing FO-68 and a method for producing -1,3-1,6 glucan using FO-68, known methods can be used, for example, see JP 2004-329077A.

    [0084] In some embodiment, the present invention relates to a composition comprising a beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327) for improving gut microbiota, behavioural pattern, alpha-synuclein levels, sleep pattern and/or serum melatonin. In another aspect, the present invention also relates to use of Aureobasidium pullulans AFO-202 (FERM BP-19327) for improving gut microbiota, behavioural pattern, alpha-synuclein levels, sleep pattern and/or serum melatonin, and particularly relates to a method of improving gut microbiota, behavioural pattern, alpha-synuclein levels, sleep pattern and/or serum melatonin by administering Aureobasidium pullulans AFO-202 (FERM BP-19327) to a subject.

    [0085] In the composition used in the present invention, a culture of FO-68 may be used as it is without purification, or glucan isolated from the culture or further purified as necessary may be used. In addition, for example, the culture product of the present invention was crushed into a concentrate, a paste, a spray-dried product, a freeze-dried product, a vacuum-dried product, a drum-dried product, a liquid product dispersed in a medium, a diluted product, and a dried product.

    [0086] The composition of the present invention exerts its function when ingested by mammals including humans. The term ingestion as used herein is not limited to any administration route as long as it can enter the human body, and is realized by all known administration methods such as oral administration, tube administration, and enteral administration. Typically, oral ingestion and enteral ingestion via the digestive tract are preferable.

    [0087] The dose of the present invention can be appropriately set in consideration of various factors such as administration route, age, body weight, and symptoms. The dose of the composition of the present invention is not particularly limited, but the amount of glucan is preferably 0.05 mg/kg/day or more, more preferably 0.5 mg/kg/day or more, particularly preferably 1.0 mg/kg/day. However, when ingested over a long period of time, the amount may be smaller than the preferable amount described above. In addition, the glucan used in the present invention has a sufficient dietary experience, and there is no problem in terms of safety. Therefore, an amount far exceeding the above amount (for example, 10 mg/kg/day or more) is possible.

    [0088] The composition of the present invention can be used as a food or drink. The composition of the present invention, as a special-purpose food such as a food for specified health use and a nutritionally functional food, by administering to animals such as humans, can improve gut microbiota, behavioural pattern, alpha-synuclein levels, sleep pattern and/or serum melatonin.

    [0089] When the composition of the present invention is used as food or drink, the type of food or drink is not particularly limited. Further, the shape of the food or drink is not particularly limited, and may be any shape of food or drink that is usually used. For example, it may be in any form such as solid form (including powder and granule form), paste form, liquid form and suspension form, and is not limited to these forms.

    [0090] When used as a pharmaceutical, a dosage form that can be orally administered is preferable because the composition of the present invention reaches the intestine. Examples of preferable dosage forms of the drug according to the present invention include tablets, coated tablets, capsules, granules, powders, solutions, syrups, troches and the like. These various preparations are prepared according to a conventional method by using glucan, which is the active ingredient, an excipient, a binder, a disintegrating agent, a lubricant, a coloring agent, a flavoring agent, a solubilizing agent, a suspending agent, a coating agent, etc. It can be formulated by admixing the auxiliaries usually used in the technical field of pharmaceutical formulation.

    [0091] In some embodiment, the present invention can be used in combination with other food, drink, drugs and any other substances in order to enhance the efficacy of the present invention.

    Beneficial Regulation of Gut Microbiota Yielding an Advantageous Fecal Metabolome Profile by Administration of AFO-202 Biological Response Modifier Glucan in an Stam Animal Model of Non-Alcoholic Steatohepatitis, Paving Way for Effective Utilization in Human Health and Disease.

    Introduction:

    [0092] With approximately 100 trillion micro-organisms existing in the human gastrointestinal tract, the microbiome is now considered as a virtual organ of the body. The microbiome encodes over three million genes producing thousands of metabolites compared to 23,000 genes of the human genome and hence replaces many of the functions of the host influencing the host's fitness, phenotype, and health. Gut microbiota influences several aspects of human health including immune, metabolic and neurobehavioural traits [D1]. In regard to functions, the gut microbiota ferments non-digestible substrates like dietary fibres and endogenous intestinal mucus. The fermentation supports the growth of specialist microbes that produce short chain fatty acids (SCFAs) and gases. Major SCFAs produced are acetate, propionate, and butyrate.

    [0093] Butryate is needed to maintain colon's cells, it helps in apoptosis of colon cancer cells, activation of intestinal gluconeogenesis, having beneficial effects on glucose and energy homeostasis and maintenance of oxygen balance in the gut, preventing gut microbiota dysbiosis. Propionate is transported to the liver, where it regulates gluconeogenesis and acetate is an essential metabolite for the growth of other bacteria, as well as playing a role in central appetite regulation [D1].

    [0094] Gut dysbiosis or the altered state of the microbiota community has been associated with several diseases including but not limited to diabetes, metabolic disorders, obesity, cancers, rheumatoid arthritis, neurological disorders such as Parkinson's disease, Alzheimer's, multiple sclerosis and autism spectrum disorders (ASD) [D2,3]. The fecal metabolome represents the functional readout of the gut microbial activity and can be considered to be an intermediate phenotype mediating host-microbiome interaction. An average 67.7% (18.8%) of the fecal metabolome's variance represents the gut microbial composition.

    [0095] Fecal metabolic profiling thus is a novel tool to explore links among microbiome composition, host phenotypes and disease states [D4]. Probiotics and pre-biotic nutritional supplements represent the major strategy other than fecal microbiota transplantation to restore the dsybiotic gut to a healthy state. Beta glucans are one of the most promising nutritional supplements with established efficacy in metabolic diseases, diabetes, cancer, cardiovascular diseases and neurological diseases. Beta glucans produced from two strains AFO-202 and N-163 of a black yeast Aureobasidium pullulans derived beta glucan has been reported with beneficial effects in diabetes [D5], dyslipidemia [D6], ASD [D7,8], Duchenne muscular dystrophy (DMD) [D9], Non-alcoholic steatohepatitis (NASH) [D10] and infectious diseases including COVID-19 [D11,12].

    [0096] In a previous study, the AFO-202 beta 1,3-1,6 glucan was able to balance the gut microbiome in children with ASD [D13]. In the study on STAM murine model of NASH, the AFO-202 beta glucan significantly decreased inflammation-associated hepatic cell ballooning and steatosis while the N-163 beta glucan decreased fibrosis and inflammation. The combination of AFO-202 with N-163 significantly decreased the Non-alcoholic fatty liver disease (NAFLD) Activity Score (NAS) [D10]. The present study was undertaken as an extension of this NASH study to study the fecal microbiome and metabolome profile before and after administration of AFO-202 beta glucan.

    Methods:

    Mice

    [0097] The study is reported in accordance with Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. C57BL/6J mice were obtained from Japan SLC, Inc. (Japan). All animals used in this study were cared for under the following guidelines: Act on Welfare and Management of Animals (Ministry of the Environment, Japan, Act No. 105 of Oct. 1, 1973), standards relating to the care and management of laboratory animals and relief of pain (Notice No. 88 of the Ministry of the Environment, Japan, Apr. 28, 2006) and the guidelines for proper conduct of animal experiments (Science Council of Japan, Jun. 1, 2006). Protocol approvals were obtained from SMC Laboratories, Japan's IACUC (Study reference no: SP_SLMN128-2107-6_1). Mice were maintained in a specific pathogen-free (SPF) facility under controlled conditions of temperature (233 C.), humidity (5020%), lighting (12-hour artificial light and dark cycles; light from 8:00 to 20:00) and air exchange.

    [0098] The STAM model of NASH was induced as previously described [D10]. Mice were given a single subcutaneous injection of 200 g streptozotocin (STZ, Sigma-Aldrich, USA) solution 2 days after birth and fed with a high-fat diet (HFD, 57 kcal % fat, Cat #HFD32, CLEA Japan, Inc., Japan) from 4-9 weeks of age. All mice develop liver steatosis and diabetes and at 3 weeks mice had established steatohepatitis, histologically.

    [0099] Studygroups: There were five study groups, described below. Eight mice were included in each study group.

    Group 1: Vehicle

    [0100] Eight NASH mice were orally administered vehicle [RO water] in a volume of 5 mL/kg once daily from 6 to 9 weeks of age.

    Group 2: AFO-202 Beta Glucan

    [0101] Eight NASH mice were orally administered vehicle supplemented with AFO-202 Beta Glucan at a dose of 1 mg/kg in a volume of 5 mL/kg once daily from 6 to 9 weeks of age.

    Group 3: Telmisartan

    [0102] Eight NASH mice were orally administered vehicle supplemented with Telmisartan at a dose of 10 mg/kg once daily from 6 to 9 weeks of age.

    TABLE-US-00001 TABLE 1 Study design and treatment schedule No. Test Dose Volume Group mice substance (mg/kg) (mL/kg) Regimen Sacrifice 1 8 Vehicle 5 PO, QD, 9 wks 6-9 wks 2 8 AFO-202 1 5 PO, QD, 9 wks Beta 6-9 wks Glucan 3 8 Telmisartan 10 5 PO, QD, 9 wks 6-9 wks

    Test Substances

    [0103] AFO-202 Beta Glucan was provided by GN Corporation Co Ltd., Japan. Telmisartan (Micardis(R)) was purchased from Boehringer Ingelheim GmbH (Germany).

    Randomization

    [0104] NASH model mice were randomized into 3 groups of 8 mice at 6 weeks of age based on their body weight the day before the start of treatment. The randomization was performed by body weight-stratified random sampling using Excel software. NASH model mice were stratified by their body weight to get SD and the difference in the mean weights among groups as small as possible.

    Animal Monitoring and Sacrifice

    [0105] The viability, clinical signs (lethargy, twitching, labored breathing) and behavior were monitored daily. Body weight was recorded daily before the treatment. Mice were observed for significant clinical signs of toxicity, moribundity and mortality before administration and after administration. The animals were sacrificed at 9 weeks of age by exsanguination through direct cardiac puncture under isoflurane anesthesia (Pfizer Inc.).

    Collection of Fecal Pellets Samples:

    [0106] Frequency: Fecal samples were collected at the 6 weeks of age (before administration) and 9 weeks of age (before sacrifice).

    [0107] Procedure: At 6 weeks of age, fecal samples were collected from each mouse by clean catch method. Handle animals with clean gloves sterilized with 70% ethanol. A sterile petri dish was placed on the bench. Gently massage the abdomen, position the bottom of mouse over a fresh petri dish, and collect 1-2 fecal pellets. At sacrifice, fecal samples were aseptically collected from cecum. The tubes with feces were placed on ice immediately. These tubes were snap frozen in liquid nitrogen and stored at 80 C. for shipping.

    Microbiome Analysis:

    [0108] In this analysis, the 16S rRNA sequence data acquired by the next-generation sequencer from the fecal RNA was used to perform community analysis using the QIIME2 program for microbial community analysis. The raw read data in FASTQ format output from the next-generation sequencer was trimmed to remove adapter sequences and low QV regions that may be included in the data. Cutadapt was used to remove adapter sequences from DNA sequencing reads. Trimmomatic was used as read trimming tool for Illumina NGS data. The adapter sequence was trimmed using the adapter trimming program cutadapt if the Trimming of the region at the end of the read sequence overlapped the corresponding sequence by at least one base (mismatch tolerance: 20%). When reads containing N were present in at least one of Read1 and Read2, both Read1 and Read2 were removed.

    Illumina Adapter Sequence Information

    Read1 3 End Side

    [0109] CTGTCTTCTATACACATCTCCGAGCCCACGAGAC

    Read2 3 End Side

    [0110] CTGTCTTCTATACACATCTGACGCTGCCGACGA

    [0111] Trimming of low QV regions was performed on the read data after processing using the QV trimming program Trimmomatic under the following conditions.

    <QV Trimming Conditions>

    [0112] The window of 20 bases is slid from the 5 side, and the area where the average QV is less than 20 is trimmed.

    [0113] After trimming, only the reads with more than 50 bases remaining in both Read1 and Read2 were taken as output.

    Population Analysis

    [0114] The microbial community analysis based on 16S rRNA sequence was performed on the sequence data trimmed in the previous section using the microbial community analysis program QIIME2. The annotation program sklearn included in QIIME2 is used to annotate the ASV (OTU) sequences.

    [0115] Using sklearn, an annotation program included in QIIME2, the ASV (OTU) sequences obtained were annotated with taxonomy information [Kingdom (kingdom)/Phylum (phylum)/Class (class)/Order (order)/Family (family)/Genus/Species] based on the 16S rDNA database.

    [0116] The data set of 16S rDNA database greengenes provided on the QIIME2 Resources site was used for the analysis. The ASVs (OTUs) obtained above were aggregated and graphed based on the taxonomy information a and the read counts of each specimen. Based on the composition of bacterial flora for each specimen compiled above, various index values for -diversity were calculated.

    Metabolome Analysis:

    [0117] After lyophilization of the fecal sample, about 10 mg of the sample was separated, extracted by the Bligh-Dyer method, and the resulting aqueous layer1 was collected and lyophilized. The residue was derivatized using 2-methoxyamine hydrochloride and MSTFA, and submitted to gas chromatography-mass spectrometry (GC-MS) as an analytical sample. 2-Isopropylmalic acid was used as an internal standard. In addition, an operational blank test was also conducted.

    [0118] Analytical equipment used was GCMS-TQ8030 (Shimadzu Corporation); Column BPX-5 (film thickness 0.25 m, length 30 m, inner diameter 0.25 mm, Shimadzu GC).

    Peak Detection and Analysis:

    [0119] MS-DIAL ver.4.7 (http://prime.psc.riken.jp/compms/index.html) was used to analyze and prepare the peak list (peak height) under the conditions given in Table 2. In doing so, peaks that were detected in the QC samples and whose C.V. was less than 20% and whose intensity was more than twice that of the operating blank were treated as detected peaks.

    TABLE-US-00002 TABLE 2 Abundance of all the bacteria analysed at baseline and post-intervention F18S_3 F18S_13- F18S_1 AFO- F18S_9- F18S_11- AFO- F18S_19- Control- 202 - Telmisartan- Control- 202- Telmisartan- Family Genus Species pre pre pre post post post text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Allobaculum text missing or illegible when filed 12083 15713 6375 8007 6542 622 text missing or illegible when filed Turicibacteraceae text missing or illegible when filed Turicibacter text missing or illegible when filed 12538 6159 9408 3346 2749 786 text missing or illegible when filed Desulfovibrionaceae text missing or illegible when filed text missing or illegible when filed 306 1398 3882 8016 10096 6012 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Other text missing or illegible when filed Other 7455 3689 7143 3479 2806 723 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobacillus text missing or illegible when filed 8text missing or illegible when filed 3433 416 11554 5804 254 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Lactococeus text missing or illegible when filed 5038 2755 2239 1081 2146 1948 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed 1091 1text missing or illegible when filed 07 1596 1562 2831 8412 text missing or illegible when filed [Paraprevotellaceae] text missing or illegible when filed [Prevotella] text missing or illegible when filed 962 1777 1674 540 1865 7582 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 17 680 1552 526text missing or illegible when filed 5964 6029 text missing or illegible when filed Deferribacteraceae text missing or illegible when filed Mucispirillum text missing or illegible when filed schaedleri 36 1486 4795 2087 1644 1921 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed acidifaciens 322 781 983 2633 2161 2571 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 497 760 853 1386 1478 2764 text missing or illegible when filed Verrucomicrobiaceae text missing or illegible when filed Akkermansia text missing or illegible when filed muciniphila 21text missing or illegible when filed 1 1963 2305 0 746 320 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 475 849 696 616 769 117text missing or illegible when filed text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 5 17 100 0 40 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobacillus text missing or illegible when filed 1729 1119 883 594 459 513 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 592 953 623 494 796 411 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 149 914 752 826 1194 1545 text missing or illegible when filed Peptostreptocpccaceae text missing or illegible when filed text missing or illegible when filed 1705 7 1121 1344 6text missing or illegible when filed 1 181 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 1015 1118 2041 582 398 898 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococeus text missing or illegible when filed 90 955 444 708 1191 1468 text missing or illegible when filed Bifidobacteriaceae text missing or illegible when filed Bifidobacterium text missing or illegible when filed pseudolongum 711 1236 1317 180 324 111 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Proteus text missing or illegible when filed 14 42 0 1432 520 1153 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobacillus text missing or illegible when filed Other 1456 362 64 2494 844 111 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 442 804 740 819 555 329 text missing or illegible when filed Porphyromonadaceae text missing or illegible when filed Parabacteroides text missing or illegible when filed distasonis 111 194 320 699 700 1437 text missing or illegible when filed Clostridiaceae text missing or illegible when filed text missing or illegible when filed 389 384 1242 387 572 79 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 41 289 420 998 1118 536 text missing or illegible when filed Desulfovibrionaceae text missing or illegible when filed Desulfovibrio text missing or illegible when filed 0 8 65 734 739 503 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 331 629 708 155 495 271 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 1261 411 625 399 280 135 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 216 457 480 471 163 527 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Clostridium text missing or illegible when filed cocleatum 0 95 319 519 1185 696 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 532 1331 1164 50 257 266 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 250 302 319 522 564 995 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 35 267 481 611 832 436 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 238 1211 311 0 25 87 text missing or illegible when filed Turicibacteraceae text missing or illegible when filed Turicibacter text missing or illegible when filed 822 472 586 269 206 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 119 46 611 119 119 253 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed 18 73 460 180 283 2042 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 82 400 293 267 804 621 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Other text missing or illegible when filed Other 923 362 text missing or illegible when filed 17 314 132 70 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Roseburia text missing or illegible when filed 88 466 488 408 878 927 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 66 386 338 461 658 698 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 389 291 305 98 129 104 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 44 522 123 466 0 126 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 224 692 418 104 49 236 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 82 358 357 323 299 267 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 38 349 126 297 454 562 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 146 230 322 199 549 144 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 153 3text missing or illegible when filed 8 237 340 131 410 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 7 199 116 283 2text missing or illegible when filed 5 590 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 263 65 562 169 100 245 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 386 162 375 62 433 686 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Allobaculum text missing or illegible when filed 512 415 286 501 301 0 text missing or illegible when filed Desulfovibrionaceae text missing or illegible when filed Desulfovibrio text missing or illegible when filed C21_c20 47 333 604 98 294 43 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 212 366 383 120 271 152 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 53 228 524 177 178 345 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Lactococcus text missing or illegible when filed garvieae 167 0 11 0 0 8 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 227 0 0 0 0 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Proteus text missing or illegible when filed 0 0 0 507 184 386 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 76 760 44 103 0 786 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 162 376 399 120 103 74 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 38 471 278 31 179 331 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 273 690 371 0 38 44 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Clostridium text missing or illegible when filed Other 145 179 707 196 284 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 37 867 0 179 356 15 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Other text missing or illegible when filed Other 542 252 215 233 97 49 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 403 25 313 21 0 54 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Other text missing or illegible when filed Other 7text missing or illegible when filed 6 307 255 281 127 5text missing or illegible when filed text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 163 408 196 20text missing or illegible when filed 199 101 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 301 295 601 151 118 260 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed 11 74 170 20 66 1596 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 165 318 327 67 220 125 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 264 754 323 0 39 3text missing or illegible when filed text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 310 363 120 177 58 281 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 69 329 284 164 288 393 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Anaerotruncus text missing or illegible when filed 38 189 638 112 113 12text missing or illegible when filed text missing or illegible when filed Alcaligenaceae text missing or illegible when filed Sutterella text missing or illegible when filed 257 217 191 399 107 63 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 169 368 394 83 85 54 text missing or illegible when filed F16 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 10 0 329 117 0 22text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 305 37 320 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 456 0 276 360 170 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 146 175 168 173 91 325 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 206 230 476 0 0 153 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 0 162 259 135 264 134 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 656 0 62 492 0 30 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 118 250 126 244 359 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 164 693 119 235 39 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 46 111 78 160 205 239 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 117 97 160 249 220 138 text missing or illegible when filed Enterococcaceae text missing or illegible when filed Enterococcus text missing or illegible when filed 45 42 32 822 61 0 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 39 147 239 119 230 96 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 188 153 208 40 59 79 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobacillus text missing or illegible when filed reuteri 517 157 0 428 340 0 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed acidifaciens 0 90 161 124 202 127 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 75 162 202 51 2text missing or illegible when filed 4 451 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Escherichia text missing or illegible when filed coli 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 16 262 152 135 137 280 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 117 2text missing or illegible when filed 6 228 29 17 254 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 84 173 157 2text missing or illegible when filed 0 62 92 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 1text missing or illegible when filed 9 0 988 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 11 149 463 230 27 251 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 51 67 46 287 224 163 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 88 185 148 190 272 63 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 28 54 390 17 62 117 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Klebsiella text missing or illegible when filed Other 0 0 0 225 0 33 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 11 105 76 51 99 187 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Klebsiella text missing or illegible when filed 0 0 0 210 0 text missing or illegible when filed 7 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 11 491 0 32 61 261 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobacillus text missing or illegible when filed 167 26 4 857 183 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 27 23text missing or illegible when filed 57 102 117 248 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 114 209 176 243 0 text missing or illegible when filed Erysipclotrichaceae text missing or illegible when filed Allobaculum text missing or illegible when filed 0 0 203 0 0 59 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 72 267 131 0 0 84 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 34 188 207 15 165 271 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 4 text missing or illegible when filed 4 362 263 8 173 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 18 70 58 149 183 269 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobacillus text missing or illegible when filed reuteri 339 55 0 470 93 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 40 88 158 77 244 273 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 27 93 50 122 193 139 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 90 0 1text missing or illegible when filed 8 0 103 125 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 91 97 64 55 8text missing or illegible when filed 111 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 22 69 315 31 45 119 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 40 75 104 60 198 text missing or illegible when filed 8 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 123 161 60 36 39 74 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 22 16text missing or illegible when filed 19 229 192 98 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 22 18 28 40 109 376 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 121 196 110 63 33 30 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 43 83 200 53 95 118 text missing or illegible when filed Clostidiaceae text missing or illegible when filed Other text missing or illegible when filed Other 100 0 0 0 0 0 text missing or illegible when filed Turicibacteraceae text missing or illegible when filed Turicibacter text missing or illegible when filed 521 0 125 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 49 105 193 0 81 143 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 13 10text missing or illegible when filed 215 36 75 119 text missing or illegible when filed Dehalobacteriaceae text missing or illegible when filed Dehalobacterium text missing or illegible when filed 20 38 43 100 256 268 text missing or illegible when filed Staphylococcaceae text missing or illegible when filed Staphylococcus text missing or illegible when filed Other 177 72 110 88 81 34 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 13 62 61 139 140 97 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 155 109 87 63 114 98 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 53 188 60 0 0 68 text missing or illegible when filed Staphylococcaceae text missing or illegible when filed Staphylococcus text missing or illegible when filed sciuri 184 66 34 139 63 41 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 356 0 103 25 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 72 98 157 16 119 124 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 176 96 101 34 46 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 34 67 61 103 101 120 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Clostridium text missing or illegible when filed Other 0 32 85 15 15 40 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 56 92 151 69 61 85 text missing or illegible when filed Desulfovibrionaceae text missing or illegible when filed text missing or illegible when filed 4 41 50 90 18text missing or illegible when filed 148 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 32 162 94 28 23 103 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 22 2text missing or illegible when filed 5 0 53 0 272 text missing or illegible when filed Dehalobacteriaceae text missing or illegible when filed Dehalobacterium text missing or illegible when filed 0 34 41 9text missing or illegible when filed 203 239 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 108 127 90 52 63 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 14 39 37 text missing or illegible when filed 3 108 119 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 87 193 168 48 17 14 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 101 4text missing or illegible when filed 3 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 56 158 text missing or illegible when filed 5 33 47 51 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Streptococcus text missing or illegible when filed 0 0 0 112 106 44 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 0 107 83 126 165 37 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 144 102 0 102 173 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 50 158 231 11 17 10 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 142 text missing or illegible when filed 9 74 26 19 8 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 220 7 2text missing or illegible when filed 55 52 57 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Clostridium text missing or illegible when filed cocleatum 0 0 0 106 222 119 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 15 36 53 93 160 text missing or illegible when filed 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 7 40 27 64 61 81 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed 0 0 55 0 0 468 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 46 59 87 97 53 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed text missing or illegible when filed 21 41 41 81 139 72 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 42 11 52 53 86 90 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Dorea text missing or illegible when filed 23 46 28 50 63 154 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 70 78 94 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 34 130 168 0 29 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 87 92 0 96 138 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobaccilus text missing or illegible when filed Other 107 148 0 83 189 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 39 34 29 73 48 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 24 95 99 0 52 101 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 43 55 64 52 text missing or illegible when filed 9 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 55 52 67 0 53 71 text missing or illegible when filed [Mogibacteriaceae] text missing or illegible when filed text missing or illegible when filed 55 76 36 44 53 28 text missing or illegible when filed Peptococcaceae text missing or illegible when filed text missing or illegible when filed 18 80 43 36 152 42 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 42 42 13 0 0 40 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 36 0 83 0 213 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 31 99 76 33 36 19 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 17 25 text missing or illegible when filed 5 26 88 135 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 15 110 97 4 14 53 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 43 135 33 0 0 87 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 15 35 57 33 100 42 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobaccilus text missing or illegible when filed reuteri 80 103 0 76 178 0 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 112 73 58 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 12 0 0 36 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 64 48 113 49 text missing or illegible when filed Turicibacteraceae text missing or illegible when filed Turicibacter text missing or illegible when filed 0 0 0 134 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 45 128 53 41 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 11 14 25 84 84 86 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 99 0 0 text missing or illegible when filed Rikenellaceae text missing or illegible when filed Other text missing or illegible when filed Other 5 40 47 37 43 53 text missing or illegible when filed Porphytext missing or illegible when filed ceae text missing or illegible when filed Parabacteroides text missing or illegible when filed 0 2text missing or illegible when filed 16 63 72 79 text missing or illegible when filed Lactobacillaceae text missing or illegible when filed Lactobaccilus text missing or illegible when filed Other 87 86 0 81 146 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 47 60 0 38 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 13 53 27 22 73 45 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 15 30 35 0 83 109 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 8 50 85 43 14 19 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Klebsiella text missing or illegible when filed Other 0 0 0 82 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 32 73 63 0 5 3 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 8 6text missing or illegible when filed 48 24 67 137 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 102 134 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 67 71 0 30 65 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed acidifaciens 0 0 27 31 35 35 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 85 29 51 7 14 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Dorea text missing or illegible when filed 18 0 98 6 15 74 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Enterobacter text missing or illegible when filed Other 125 0 0 30 text missing or illegible when filed 41 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 42 0 82 45 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Other text missing or illegible when filed Other 1text missing or illegible when filed text missing or illegible when filed 3 61 text missing or illegible when filed 0 44 12 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 68 184 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 0 0 31 61 55 43 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 63 text missing or illegible when filed 9 12 45 79 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 98 0 0 273 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 18 39 65 87 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 47 79 0 37 72 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 23 38 28 78 85 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 6 15 3 111 127 0 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Staphylococcus text missing or illegible when filed 53 0 0 168 30 27 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 77 96 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 87 60 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 219 101 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 text missing or illegible when filed 0 10 15 29 71 text missing or illegible when filed Aerococcaceae text missing or illegible when filed Aerococcus text missing or illegible when filed 7 0 0 22 85 187 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 61 0 111 108 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Staphylococcus text missing or illegible when filed 40 18 0 120 0 3text missing or illegible when filed text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 19 31 0 14 71 26 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 11 36 0 7 11 51 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 6 15 0 13 110 43 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 6 0 0 266 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 19 0 0 64 48 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 12 86 30 0 63 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed [Ruminococcus] text missing or illegible when filed gnavus 51 0 27 18 26 95 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 65 48 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 81 45 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 11 25 37 23 16 23 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 69 0 99 90 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 38 0 0 46 67 11 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 56 53 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 40 68 0 0 57 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Clostridium text missing or illegible when filed Other 0 0 0 18 0 101 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 16 0 23 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 42 13 18 62 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 9 0 23 40 0 51 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 20 25 0 62 38 text missing or illegible when filed Desulfovibrionaceae text missing or illegible when filed text missing or illegible when filed 0 0 23 0 54 42 text missing or illegible when filed Dehalobacteriaceae text missing or illegible when filed Dehalobacterium text missing or illegible when filed 11 31 24 0 0 0 text missing or illegible when filed Porphytext missing or illegible when filed text missing or illegible when filed Parabacteroides text missing or illegible when filed 0 9 3 29 19 115 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 21 44 15 38 22 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 10 39 23 6 12 46 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 8 0 0 0 77 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 70 38 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 0 16 34 25 0 49 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 87 0 67 0 text missing or illegible when filed Christensenellaceae text missing or illegible when filed text missing or illegible when filed 49 0 37 8 15 9 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 11 44 8 19 8 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 95 0 54 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 0 0 11 19 54 29 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 0 text missing or illegible when filed Enterococcaceae text missing or illegible when filed Vatext missing or illegible when filed coccus text missing or illegible when filed 11 0 0 0 14 20 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Clostridium text missing or illegible when filed cocleatum 0 0 16 28 61 34 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 9 25 92 0 0 0 text missing or illegible when filed Desulfovibrionaceae text missing or illegible when filed Bilophila text missing or illegible when filed 0 8 11 13 46 17 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 22 107 0 0 0 text missing or illegible when filed Corynebacteriaceae text missing or illegible when filed Corynebacterium text missing or illegible when filed stationis 72 0 0 18 23 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 43 0 41 0 34 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 27 26 82 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 22 9 14 7 0 10 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 6 31 26 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 22 108 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 67 84 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 30 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed text missing or illegible when filed 5 52 27 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 24 96 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 54 90 0 0 0 text missing or illegible when filed Dehalobacteriaceae text missing or illegible when filed Dehalobacterium text missing or illegible when filed 3 8 3 19 23 43 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 71 0 0 0 68 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Streptococcus text missing or illegible when filed luteciae 25 19 12 0 15 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 55 0 0 82 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 9 0 0 38 0 36 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Atext missing or illegible when filed otruncus text missing or illegible when filed 0 7 6 13 23 11 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 63 10 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Clostridium text missing or illegible when filed Other 0 0 26 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 31 10 0 0 10 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 13 11 6 18 22 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 0 13 20 19 25 30 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 20 39 12 12 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 0 113 0 text missing or illegible when filed Atext missing or illegible when filed ceae text missing or illegible when filed text missing or illegible when filed 21 25 16 0 2 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 60 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 54 0 0 30 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 47 0 6 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 107 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 35 0 27 9 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed acidifaciens 0 0 0 105 0 0 text missing or illegible when filed Bacteroidaceae text missing or illegible when filed Bacteroides text missing or illegible when filed acidifaciens 0 6 0 3 32 11 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Dorea text missing or illegible when filed 11 21 25 3 0 8 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Other text missing or illegible when filed Other 4 14 10 0 8 11 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 80 7 0 0 13 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 11 0 20 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 20 0 1 0 0 1 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 19 14 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 4 42 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 13 0 9 15 9 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 42 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 14 13 20 19 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 38 0 0 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 6text missing or illegible when filed 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 11 13 0 17 9 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 15 76 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 21 22 0 0 14 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 49 0 0 0 text missing or illegible when filed F16 text missing or illegible when filed text missing or illegible when filed 0 66 0 0 18 0 text missing or illegible when filed Christensenellaceae text missing or illegible when filed text missing or illegible when filed 6 17 19 0 5 5 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 9 12 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 80 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Other text missing or illegible when filed Other 8 12 14 4 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 19 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 15 0 0 0 18 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 0 text missing or illegible when filed Enterococcaceae text missing or illegible when filed Vagococcus text missing or illegible when filed 29 0 0 0 0 26 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 14 9 23 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Coprabacillus text missing or illegible when filed 11 2text missing or illegible when filed 11 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 22 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 9 11 0 0 9 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 38 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 14 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 text missing or illegible when filed 0 15 14 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 0 31 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 8 10 9 5 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 9 6 0 14 2 text missing or illegible when filed Rikenellaceae text missing or illegible when filed text missing or illegible when filed 0 7 0 8 4 11 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 40 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 15 11 8 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 10 15 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Clostridium text missing or illegible when filed Other 0 0 0 0 0 28 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 7 18 9 0 9 0 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Streptococcus text missing or illegible when filed minor 0 9 9 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 27 0 8 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 13 7 7 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 36 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 14 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 13 8 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 7 11 0 12 text missing or illegible when filed Streptococcaceae text missing or illegible when filed Streptococcus text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 42 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 42 text missing or illegible when filed [Mogibacteriaceae] text missing or illegible when filed text missing or illegible when filed 7 4 0 0 12 0 text missing or illegible when filed Enterobacteriaceae text missing or illegible when filed Enterobacter text missing or illegible when filed Other 13 0 0 0 0 0 text missing or illegible when filed Eubacteriaceae text missing or illegible when filed Atext missing or illegible when filed tis text missing or illegible when filed 0 13 5 2 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 19 text missing or illegible when filed Aerococcaceae text missing or illegible when filed Aerococcus text missing or illegible when filed 0 0 0 0 0 39 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 21 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 10 12 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 16 5 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 5 9 10 8 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 0 17 0 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 35 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 33 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 12 11 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 8 0 0 14 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 32 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 15 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 31 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 30 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 14 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 16 0 8 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 0 0 12 8 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 6 7 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 14 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 14 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 20 0 0 0 text missing or illegible when filed Corynebacteriaceae text missing or illegible when filed Corynebacterium text missing or illegible when filed stationis 26 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 4 5 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 13 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 0 26 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 13 11 0 0 0 0 text missing or illegible when filed [Mogibacteriaceae] text missing or illegible when filed text missing or illegible when filed 11 0 0 0 4 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Coprobacillus text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Clostridium text missing or illegible when filed cocleatum 0 0 0 2 0 1 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed text missing or illegible when filed 0 7 0 0 0 0 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 4 0 0 0 0 0 text missing or illegible when filed Leucontext missing or illegible when filed ceae text missing or illegible when filed Weissella text missing or illegible when filed parametext missing or illegible when filed enteroides 2 0 0 0 3 12 text missing or illegible when filed Enterococcaceae text missing or illegible when filed Vagococcus text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Butytext missing or illegible when filed coccus text missing or illegible when filed pullictext missing or illegible when filed um 0 0 6 0 0 0 text missing or illegible when filed [Mogibacteriaceae] text missing or illegible when filed text missing or illegible when filed 0 0 0 0 12 6 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 8 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 20 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 20 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 0 9 11 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 9 0 0 0 0 text missing or illegible when filed Planococcaceae text missing or illegible when filed Sporosarcina text missing or illegible when filed 0 0 0 8 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Bltext missing or illegible when filed text missing or illegible when filed producta 0 7 0 0 6 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 7 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 15 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 15 0 0 text missing or illegible when filed Coriobacteriaceae text missing or illegible when filed Adlercreutzia text missing or illegible when filed 10 0 0 4 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 text missing or illegible when filed 9 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 14 0 text missing or illegible when filed Deferribacteraceae text missing or illegible when filed Mucispirillum text missing or illegible when filed schaedleri 0 0 0 0 0 0 text missing or illegible when filed Methylobacteriaceae text missing or illegible when filed Methylobacterium text missing or illegible when filed Other 0 0 0 0 0 0 text missing or illegible when filed Methanobacteriaceae text missing or illegible when filed Methanobrevibacter text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 text missing or illegible when filed 0 2 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 0 12 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Dorea text missing or illegible when filed 11 0 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Dorea text missing or illegible when filed 0 4 7 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 11 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 11 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 11 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 0 0 0 0 11 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Other text missing or illegible when filed Other 0 10 0 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed Clostridum text missing or illegible when filed cocleatum 0 0 0 0 0 0 text missing or illegible when filed Clostridiaceae text missing or illegible when filed text missing or illegible when filed 0 0 10 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 0 0 0 6 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 0 0 0 0 10 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 9 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 9 text missing or illegible when filed Streptococcaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Turicibacteraceae text missing or illegible when filed Turicibacter text missing or illegible when filed 7 0 0 0 0 0 text missing or illegible when filed S24-7 text missing or illegible when filed text missing or illegible when filed 0 7 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 7 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 7 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 3 0 4 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Ruminococcus text missing or illegible when filed 0 0 0 0 0 7 text missing or illegible when filed Moraxellaceae text missing or illegible when filed Psychrobacter text missing or illegible when filed Other 3 0 0 0 0 0 text missing or illegible when filed Paenibacillaceae text missing or illegible when filed Other text missing or illegible when filed Other 0 6 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Coprococcus text missing or illegible when filed 0 6 0 0 0 0 text missing or illegible when filed Bacillaceae text missing or illegible when filed Bacillus text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Enterococcaceae text missing or illegible when filed Vagococcus text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 6 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 5 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 5 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Oscillospira text missing or illegible when filed 0 4 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Erysipelotrichaceae text missing or illegible when filed text missing or illegible when filed 0 0 4 0 0 0 text missing or illegible when filed Other text missing or illegible when filed Other text missing or illegible when filed Other 0 0 0 0 0 4 text missing or illegible when filed Clostridiaceae text missing or illegible when filed Clostridium text missing or illegible when filed Other 3 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed Butytext missing or illegible when filed coccus text missing or illegible when filed pullitext missing or illegible when filed um 0 0 0 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed text missing or illegible when filed 0 0 3 0 0 0 text missing or illegible when filed Deferribacteraceae text missing or illegible when filed Mucispirillum text missing or illegible when filed schaedleri 0 0 0 0 3 0 text missing or illegible when filed Turicibacteraceae text missing or illegible when filed Turicibacter text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 3 text missing or illegible when filed Verrucomicrobiaceae text missing or illegible when filed Akkermansia text missing or illegible when filed phil 2 0 0 0 0 0 text missing or illegible when filed [Mogibacteriaceae] text missing or illegible when filed text missing or illegible when filed 0 2 0 0 0 0 text missing or illegible when filed Alcaligenaceae text missing or illegible when filed Stext missing or illegible when filed ella text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed Dorea text missing or illegible when filed longicateria 0 0 2 0 0 0 text missing or illegible when filed Ruminococcaceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 2 0 text missing or illegible when filed Lachnospiraceae text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 0 text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed 0 0 0 0 0 2 text missing or illegible when filed indicates data missing or illegible when filed

    Differential Abundance Analysis, PCA and PCA, OPLS-DA and Clustering Analysis:

    [0120] Principal component analysis (PCA) and orthogonal partial least squares-discriminant analysis (OPLS-DA) were performed to visualize the metabolic differences among the experimental groups. For principal component analysis, SIMCA-P+ ver.17 (Umetrics) was used. The normalized peak heights of the sample-derived peaks were used to perform principal component analysis using all samples and five points (F18S-12, F18S-14, F18S-16, F18S-18, and F18S-20). Transform was set to none, and Scaling was set to Pareto scaling. Differential metabolites were selected according to the statistically significant variable importance in the projection (VIP) values obtained from the OPLS-DA model. Hierarchical Cluster Analysis (HCA) and heat maps were performed using R (https://www.r-project.org/).

    Statistical Analysis:

    [0121] Statistical data were analysed using Microsoft Excel statistics package analysis software. Graphs were prepared using Origin Lab's Originb 2021 software. For normally distributed variables, t-test or ANOVA with Tukey HSD was used and P values<0.05 were considered significant. For OPLS-DA, values from two-tailed Student's t-tests were applied on the normalized peak areas; metabolites with VIP values>1 and P values<0.05 were included. The Euclidean distance and Ward's method were used to analyze the heat map. The mean and variance were normalized so that the mean is 0 and the variance is 1.

    Results:

    [0122] There were no significant differences in mean body weights at any day during the treatment period between the control group and the other treatment groups. There were no significant differences in mean body weights on the day of sacrifice between the treatment groups.

    Gut Microbiome Analysis:

    [0123] With regard to the taxonomic profiling, firmicutes represented the most abundant phyla followed by Bacteroidetes (FIG. 1)

    [0124] When individual taxa were analysed in each of the beta glucan groups comparing it to Telmisartan (standard), decrease in enterobacteria was highest in AFO-202 group (FIG. 2A). Decrease in Decrease in Firmicutes was highest in AFO-202 group (FIG. 2B).

    Fecal Metabolome Analysis:

    [0125] The resulting score plot of the principal component analysis using the normalized peak heights of the 10 samples (Pre- and post intervention of five groups), is shown in FIG. 3. The contribution of the first principal component was 55%, and that of the second principal component was 20%. Principal component analysis of post-intervention samples using the peak heights after normalization and the obtained score plot is shown in FIGS. 4A and 4C and the loading plot in FIGS. 4B and 4D. The contribution of the first principal component was 49% and that of the second principal component was 34%.

    [0126] Peak height of all the detected metabolite compounds after normalization is available in Table 3. The values which showed decrease post-intervention are highlighted in bold in the different groups. The number of peaks detected in the QC samples was 108, of which 53 peaks were qualitatively determined and 55 peaks were unknown.

    [0127] Differential abundance analysis, log 2 fold change results are shown in FIG. 5.

    TABLE-US-00003 TABLE 3 Peak height of all the detected metabolite compounds after normalization Name Gr. 1 Control Gr. 2-AFO-202 Telmisartan S. of the Differ- Differ- Differ- No Compound Pre Post ence Pre Post ence Pre Post ence 1 2-Aminobutyric 16544.74 40209.97 23665.23 23704.19 27627.27 3text missing or illegible when filed 23.08 2text missing or illegible when filed 46.06 43700.57 17954.52 acid-2TMS 2 2-Hydroxyisobutyric 36888.72 145407.17 108518.45 38444.81 146808.33 108363.52 text missing or illegible when filed 2.36 170732.7text missing or illegible when filed 133880.36 acid-2TMS 3 3-Aminoglutaric 2064.63 11599.10 9534.47 2674.96 8297.81 5622.84 3808.51 12436.04 8627.53 acid-3TMS 4 3-Hydroxybutyric 78693.42 32663.28 46030.14 49425.90 15869.18 33556.73 15499.52 10891.34 4608.17 acid-2TMS 5 3-Methyl- 2494.33 15765.26 13270.93 5771.05 12154.53 6383.48 7152.49 12393.37 5240.87 2-oxotext missing or illegible when filed leric acid-text missing or illegible when filed -TMS 6 4-Hydroxyphenyltext missing or illegible when filed 71212.24 90389.17 1text missing or illegible when filed 176.93 38406.22 61406.93 23000.73 36067.25 text missing or illegible when filed 4 3815.29 acid-2TMS 7 5-Aminovaleric 359981.32 177455.86 182525.46 28606.18 220398.9text missing or illegible when filed 191792text missing or illegible when filed 28517.91 2text missing or illegible when filed 2458.93 26394.02 acid-3TMS 8 5-Oxoproline- 86202.33 183221.07 97018.7text missing or illegible when filed 101052.25 142117.70 41065.45 113169.35 text missing or illegible when filed .94 text missing or illegible when filed .59 2TMS 9 Acetylglycine- 622text missing or illegible when filed .84 text missing or illegible when filed .14 16600.30 62217.0text missing or illegible when filed 75225.0text missing or illegible when filed 13007.93 text missing or illegible when filed .14 text missing or illegible when filed .2 2text missing or illegible when filed TMS 10 Alanine-2TMS 462486.71 9text missing or illegible when filed 2281.83 469795.13 575514.07 709299.17 133785.10 544032.text missing or illegible when filed 1268525.27 724492.text missing or illegible when filed 0 11 Asparagtext missing or illegible when filed - 50264.14 47387.02 2877.12 52065.54 39742.05 12323.49 text missing or illegible when filed .79 68357.text missing or illegible when filed 10864.48 3TMS 12 Aspartic 122316.67 309390.39 187073.73 168305.85 250489.61 82183.75 183416.60 4text missing or illegible when filed .75 2text missing or illegible when filed 17.15 acid-3TMS 13 Fructose-text missing or illegible when filed - custom-character 999935.86 726073.07 323320.36 936708.26 613387.90 325202.45 111093text missing or illegible when filed .22 7857text missing or illegible when filed .77 5TMS 14 text missing or illegible when filed 36824.30 44185.98 7361.68 57488.33 33927.51 23560.text missing or illegible when filed 3 text missing or illegible when filed .59 24027.13 65text missing or illegible when filed 28.4text missing or illegible when filed 4TMS 15 Galactose-text missing or illegible when filed - 92513.44 457335.67 text missing or illegible when filed 822.23 177745.54 661315.76 48text missing or illegible when filed .22 359608.12 text missing or illegible when filed .00 170827.12 5TMS 16 Glucose-text missing or illegible when filed - 299911.54 17403text missing or illegible when filed .37 1440487.83 842456.89 996893.55 154436.66 400546.16 text missing or illegible when filed 55701.34 text missing or illegible when filed 5TMS 17 Glutamic 197256.75 658386.79 461130.05 264245.78 515323.80 251078.03 text missing or illegible when filed 61041.65 74375text missing or illegible when filed .06 382709.41 acid-3TMS 18 Glutamine- 60900.94 73851.25 12950.31 45289.87 46071.10 781.23 4text missing or illegible when filed 99.14 7text missing or illegible when filed 644.26 30745.13 3TMS 19 Glycerol- 100045.16 5text missing or illegible when filed 2115.32 412070.17 193048.44 332266.23 139217.82 283873.86 324467.91 405text missing or illegible when filed 3TMS 20 Glycine- 17text missing or illegible when filed 941.04 19text missing or illegible when filed 667.24 14726.20 182268.66 182802.22 533.56 179124.text missing or illegible when filed 5 288456.14 109331.29 3TMS 21 Hypoxanthine- 1820text missing or illegible when filed .77 73610.39 554text missing or illegible when filed 0.63 25970.42 54650.62 28680.21 33144.25 5text missing or illegible when filed .97 23680.72 2TMS 22 Itext missing or illegible when filed - 20341.44 29963.22 9621.79 27134.0text missing or illegible when filed 52940.46 25806.38 24548.88 37226.82 12677.9text missing or illegible when filed 4TMS 23 Isoleucine- 240751.6text missing or illegible when filed 255text missing or illegible when filed .87 14928.19 213617.13 18text missing or illegible when filed .81 28538.33 175687.57 381173.16 205text missing or illegible when filed 2TMS 24 Lactic acid- 126966.77 174366.10 43399.33 161320.99 112769.78 48551.21 71969.33 36363.66 35605.88 2TMS 25 Leucine- 405177.22 48496text missing or illegible when filed 79792.64 381285.89 366743.37 14542.52 364222.text missing or illegible when filed 0 631954.96 267732.46 2TMS 26 Lysine- 453167.29 1042910.27 589742.text missing or illegible when filed 578069.33 771280.17 193210.94 592034.86 952876.14 360841.28 4TMS 27 Malic acid- 15431.92 50833.82 35401.90 18557.13 136072.04 117514.91 54899.38 38544.73 16354.66 3TMS 28 Mannose-text missing or illegible when filed - 46604.74 101647.05 55042.30 58090.57 125118.62 67028.06 79951.11 65364.10 14587.00 3TMS 29 Methionine- 72809.85 128516.text missing or illegible when filed 4 55706.text missing or illegible when filed 84612.94 90620.text missing or illegible when filed 6007.93 103825.98 168797.44 6text missing or illegible when filed 1.46 2TMS 30 N-Acetyltext missing or illegible when filed - 51349.02 194543.7text missing or illegible when filed 143194.68 95958.86 210636.96 114678.10 207515.87 90678.54 116837.33 4TMS 31 Nicottext missing or illegible when filed 8270.text missing or illegible when filed 31967.10 23696.54 12163.20 23936.48 11773.28 1835text missing or illegible when filed .32 23826.50 5467.18 acid-TMS 32 Norvaline- text missing or illegible when filed 4923.32 100191.34 5268.03 82912.31 73583.61 9328.70 72621.50 110365.67 37744.18 TMS 33 text missing or illegible when filed thine- 45698.47 101711.56 56013.10 40654.29 52324.86 11670.57 44496.80 62226.84 17730.04 4TMS 34 Phenylalamine- 173673.02 290028.18 116355.17 186230.03 228284.46 42048.43 208441.78 342996.16 134text missing or illegible when filed 4.38 2TMS 35 Phosphoric 13703.35 692470.05 678766.text missing or illegible when filed text missing or illegible when filed 467.68 765279.47 709811.79 107073.44 122301.92 15228.48 acid-3TMS 36 Proline- 57195.44 92021.21 34825.77 77037.72 103324.97 26287.25 text missing or illegible when filed 6.02 151136.53 52750.51 2TMS 37 Ptext missing or illegible when filed - 90940.03 4806.17 86133.86 30410.15 5030.93 25379.22 21749.text missing or illegible when filed 6122.text missing or illegible when filed 15626.91 4TMS 38 Pyruvic 31557.87 108630.32 77072.65 40255.26 105996.98 65741.72 41703.69 116493.60 74789.91 acid-text missing or illegible when filed -TMS 39 Ribotext missing or illegible when filed 90115.51 64726.74 25388.76 85151.16 66560.71 18390.46 95701.95 64707.65 30994.30 acid-5TMS 40 Ribtext missing or illegible when filed - 199285.35 806414.91 607129.56 321848.24 706173.47 384325.23 510635.39 6996text missing or illegible when filed 0.70 189015.32 4TMS 41 #Sz,899;- 134100.10 150072.29 15972.text missing or illegible when filed 9 134521.62 135009.56 487.94 124526.34 206603.text missing or illegible when filed 4 820text missing or illegible when filed .40 3TMS 42 Spetext missing or illegible when filed - 11571.text missing or illegible when filed 9 14335.92 2text missing or illegible when filed 64.13 8257.93 7462.86 795.07 9612.text missing or illegible when filed 4 8122.10 1490.65 3TMS 43 Succinic 200720.47 75253.68 125466.79 32921.32 139text missing or illegible when filed 291.07 1365369.7text missing or illegible when filed 263097.91 text missing or illegible when filed 13904.61 50806.69 acid-2TMS 44 Taurine- 15049.13 66033.11 50983.98 14685.18 46705.91 32020.73 14857.44 24726.77 9869.33 3TMS 45 Ttext missing or illegible when filed nine- 137361.71 175385.78 38024.08 137475.15 135608.93 1866.22 122185.79 240869.77 118683.98 3TMS 46 Thytext missing or illegible when filed - 5319.57 16561.64 11242.07 6636.79 13272.69 6635.90 12893.64 7133.20 5760.44 2TMS 47 Tryptophan- 21044.89 2089text missing or illegible when filed .79 149.10 17365.35 18254.73 889.38 16169.30 28678.00 12text missing or illegible when filed 08.70 3TMS 48 Tyrosine- 273469.68 438287.99 164818.32 293828.48 text missing or illegible when filed 51487.07 576text missing or illegible when filed 8.59 309190.46 42582text missing or illegible when filed .94 116635.49 3TMS 49 Uracil- 25078.62 92837.69 67759.07 44546.07 84845.85 40299.79 74843.38 71567.16 3276.22 2TMS 50 Valine- 353165.15 405846.51 52681.36 290698.34 255449.25 35249.text missing or illegible when filed 8 254032.97 521841.20 267808.23 2TMS 51 Xanthine- 53777.98 130586.54 76808.56 79540.73 113793.80 34253.08 101684.60 103194.40 1text missing or illegible when filed 09.80 3TMS 52 Xylose-text missing or illegible when filed - 174559.36 290187.08 115627.72 186404.46 228374.90 41970.44 208text missing or illegible when filed 74.29 343176.94 134602.65 4TMS text missing or illegible when filed indicates data missing or illegible when filed

    [0128] Score plots of PCA and compounds with a VIP value of 1 or higher in the OPLS-DA are shown in FIG. 6 and Table 4 shows the compounds with a VIP value of 1 or higher and their Coefficients in OPLS-DA. The results of the principal component analysis of the control group showed that the contribution of the first principal component axis (PC1) was 96.7% and that of the second principal component axis (PC2) was 1.5%. In AFO-202 group, PCA showed that PC1 and PC2 contributed 90.4% and 4.9%, respectively. In the Telmisartan group, PC1 and PC2 contributed 95.1% and 1.9%, respectively.

    TABLE-US-00004 TABLE 4 Coefficients of Metabolite compounds with a VIP value of 1 or higher in OPLS-DA in the different groups Coefficients No. Metabolites Control AFO-202 Telmisartan 1 Glucose-meto-5TMS 0.000108 0.000091 0.000139 2 Fructose-meto-5TMS 0.000133 0.000173 0.000209 3 Phosphoric acid-3TMS 0.000125 4 Ribose-meto-4TMS 0.000116 0.000132 0.000083 5 Lysine-4TMS 0.000116 0.000083 0.000120 6 Alamine-2TMS 0.000109 0.000003 0.000171 7 Glutamic acid-3TMS 0.000100 0.000101 0.000149 8 Glycero-3TMS 0.000102 0.000080 9 Galactose-meto-5TMS 0.000092 0.000144 0.000094 10 Aspartic acid-3TMS 0.000063 0.000061 0.000113 11 5-Aminovaleric acid-3TMS 0.000069 0.000103 0.000123 12 Tyrosine-3TMS 0.000064 0.000043 13 N-Acetylmannosamine-meto-4TMS 0.000055 0.000068 14 Succinic acid-2TMS 0.000059 0.000259 15 Phenylalanine-2TMS 0.000049 0.000087 16 Xylose-meto-4TMS 0.000048 0.000087 17 2-Hydroxyisobutyric acid-2TMS 0.000054 0.000072 0.000072 18 5-Oxoproline-2TMS 0.000043 19 Phosphoric acid-3TMS 0.000197 20 Malic acid-3TMS 0.000077 21 Mannose-meto-5TMS 0.000057 22 Pyruvic acid-meto-TMS 0.000065 0.000046 23 Lactic acid-2TMS 24 Valine-2TMS 0.000075 25 Leucine-2TMS 0.000087 26 Isoleucine-2TMS 0.000083 27 Threonine-3TMS 0.000080 28 Glycine-3TMS 0.000058 29 5-Oxoproline-2TMS 0.000064 30 Serine-3TMS 0.000065

    [0129] In all the groups except telmisartan, phosphoric acid shoed the highest log 2 fold change in terms of increase. Putrescine showed the highest decrease. In regard to specific compounds, increase in succinic acid was highest in AFO-202 (P-value=0.06) with statistical significance (FIG. 7A). Increase in phosphoric acid was also high in AFO-202 (FIG. 7B), though not significant (p-value=0.21). Decrease in fructose was highest in AFO-202 (FIG. 7C) (p-value=0.0007). Euclidean distance hierarchical clustering analysis demonstrating the different intensity levels of characteristic metabolites also matched the above observations (FIG. 8 and FIG. 9)

    Discussion:

    [0130] This is the first study to investigate profiles of fecal gut microbiome and metabolome in a NASH model of mice with relevance to beta glucans specially so for two different beta glucans produced by different strains of same species of black yeast A. pullulans. Beta glucans are obtained from different sources and the functionality depends on the source and extraction/purification processes [D14]. The beta glucans described in the study from AFO-202 strain of the A. pullulans black yeast are unique as they are produced as an exopolysaccharide without the need for extraction/purification and hence the biological actions are superior [D15].

    [0131] The AFO-202 beta glucan has been reported to have superior metabolic benefits by regularization of blood glucose levels [D5] apart from immune enhancement in immune-infectious illnesses such as COVID-19 [D11,12] and has been reported to produce positive effects on melatonin and alpha-synuclein neurotransmitters apart from improving sleep and behaviour in neurodevelopmental disorders such as ASD [D7,8]. In the NASH animal study, AFO-202 beta glucan has been able to significantly decrease inflammation-associated hepatic cell ballooning and steatosis [D10].

    [0132] The N-163 beta glucan has been able to produce immune-modulatory benefits in terms of regulating dyslipidaemia evident from balance of the levels of non-esterified fatty acids [D16] and decrease in fibrosis and inflammation in NASH [D10]. The combination of AFO-202 and N-163 beta glucans has been able to decrease in pro-inflammatory markers and increase in anti-inflammatory markers in an advantageous manner in healthy human volunteers [D17], decrease the NAFLD Activity Score (NAS) in the NASH model [D10] and significantly control of immune-mediated dysregulated levels of IL-6, CRP and Ferritin in Covid-19 patients [D11,12]. In the study done on gut microbiome analysis in ASD subjects, there was efficient control of enterobacteria apart from beneficial reconstitution of the gut microbiome favourable for producing benefits in ASD by AFO-202 beta glucan [D13]. In the current study, we sought to evaluate the benefits of AFO-202 and N-163 individually and in combination in the NASH animal model.

    [0133] The STAM model of NASH used in the study is a disease model, the Stelic Animal model [D10,18,19], in which mice are allowed to develop liver steatosis by injection streptozotocin solution 2 days after birth and fed with a high-fat diet. This model recapitulates most of the features of metabolic syndrome which occurs in humans wherein obesity and a high fat diet gives rise to diabetes, dyslipidaemia and liver steatosis.

    [0134] Therefore, the gut microbiome profiles and fecal metabolite profiles that are present at baseline can be considered to recapitulate that which is present in metabolic syndrome [D20,21] which over time will produce pathophysiological problems in different organ systems of the body including the heart, liver, kidney apart from immune-metabolic interactions leading to a declined immune system with aging and its associated complications.

    [0135] Therefore, the present study will serve as a forerunner to study the effects of the beta glucans on different aspects of metabolic syndrome associated pathologies as well as conditions associated with immune-metabolic interactions including neurological disorders in which such immune-metabolic interactions have profound implications [D20].

    Relevance of Metabolome and Microbiome to NASH:

    [0136] An abundance of bacterial species, such as Proteobacteria, Enterobacteria, and Escherichia coli has been reported in humans with NAFLD[D21, 22]. In the current study, a decrease in Enterobacteria with AFO-202 was reported.

    Potentials in Neurological Illnesses:

    Neurodevelopmental and Neurodegenerative:

    [0137] We have earlier reported the decrease in Enterobacteria, Escherichia coli, Akkermansia muciniphila CAG:154, Blautia spp., Coprobacillus sp., and Clostridium bolteae CAG:59, with an increase of Faecalibacterium prausnitzii and Prevotella copri after AFO-202 consumption in children with ASD [D13]. In the present study as well, the decrease in enterobacteria was highest in AFO-202 group (FIG. 5A). Succinic acid which has been reported to be lower in ASD individuals [D23] was found to increase the highest in AFO-202 group (FIGS. 7A-C). In regard to neurodegenerative diseases such as Parkinson's disease, amino acids such as isoleucine, and leucine have been found to be higher in the fecal metabolome [D24]. In the present study, decrease in these amino acids were highest in the AFO-202 group (FIGS. 7D-E).

    Other Implications:

    [0138] Use of Steroids has been reported to cause increase in E-Coli, enterococcus while decrease in Bacteroides [D25]. In the current study, the control of enterobacteria with increase in Bacteroides by AFO-202 make it worthy adjuncts for medications such as steroids as well.

    Conclusion:

    [0139] In summary, black yeast A. pullulans' strain AFO-202 produced beta glucans increase the gut microbial diversity, control the harmful bacteria, promote healthy ones apart from producing beneficial differences in fecal metabolites, all indicative of a healthy profile both individually and in combination in this NASH animal model. AFO-202 will serve as a worthy treatment adjunct for neurodevelopmental conditions such as ASD and neurodegenerative conditions such as PD. With further validation on the correlation between gut microbiome and fecal metabolites in specific conditions, these safety proven prebiotics have potential applications in promoting a healthy life.

    Increasing Gut Microbiota

    [0140] There is increasing evidence that gut dysbiosis plays a critical role in the development and progression of several neurodevelopmental conditions such as autism spectrum disorders (ASD), neuroinflammatory conditions such as multiple sclerosis (MS) and neurodegenerative diseases such as Alzheimers (AD) and Parkinson's disease (PD). The biofilms and byproducts of the bacteria especially the Gram-negative enteric bacteria mediate the effects of the altered gut microbiome in these disease conditions. Amyloid proteins constitute the major part of the biofilms especially the Curli amyloid whose characteristics have been reported to be similar to pathological and immunomodulatory human amyloids such as Alzheimer's disease associated amyloid-, ASD and PD associated -synuclein [A1].

    [0141] Though these reports discuss on the correlation of the levels of these amyloids, enteric bacteria and the neural diseases, there has been no simple and safe intervention with subjective and objective correlation to a clinical benefit associated by altering the gut microbiota to a beneficial advantage. We herein report the outcome of beneficial reconstitution of gut microbiota especially those of the bacteria which are associated with Alpha synuclein and Curli amyloids after consumption of Beta 1,3-1,6 Glucans in children with autism spectrum disorder in a clinical pilot study.

    [0142] The emerging evidence of constant communication and interaction between the gut and the brain through the gut-brain axis has begun to unravel its significance associated with the health of the central nervous system. Any dysbiosis of the gut microbiota has been shown to influence the development and progression of neurological pathologies of developmental (autism spectrum disorder [ASD]), inflammatory (multiple sclerosis [MS]), and degenerative (Alzheimer's disease [AD] and Parkinson's disease [PD]) disorders (Kang et al., 2019). The mechanisms involve activation of the immune system; production of inflammatory cytokines and chemokines (e.g., IL-6 and TNF-); and alteration of the gut barrier permeability, which in turn is due to the increased levels of circulating lipopolysaccharide in these neurological disorders. These mechanisms modulate the neurotrophic factors, activity of the central and peripheral nervous system, and the endocrine pathways, all of which contribute to the onset or the phenotypic expression of neuropsychiatric and neurodevelopmental disorders (Santocchi et al., 2020).

    [0143] Another important player is the amyloid protein, which has self-aggregation properties. Even non-identical amyloid proteins can accelerate reciprocal amyloid aggregation in a prion-like fashion. Nearly 30 amyloidogenic proteins are encoded by humans, whereas some functional amyloids are produced by the gut microbiome (Werner et al., 2020). Of importance are cell-surface amyloid proteins called curli, which are produced by certain enterobacteria that in turn accelerate formation of -synuclein (Syn), which is a presynaptic neurotransmitter that is crucial in the initiation and pathogenesis of neurological disorders such as ASD, PD, AD, and MS (Sampson et al., 2020). Though these reports (Sampson et al., 2020; Werner et al., 2020; Santocchi et al., 2020) discuss the correlation of the levels of these amyloids, enteric bacteria, and neural diseases, there has been no simple and safe intervention with subjective and objective correlation to a clinical benefit that can be derived based on an associated balancing of the gut microbiota.

    [0144] We herein report the outcome of beneficial reconstitution of gut microbiota, especially those of the bacteria associated with Syn and curli amyloids after consumption of beta 1,3-1,6 glucans in children with ASD in a clinical pilot study. The beta-glucan studied (Nichi Glucan) was obtained from the AFO-202 strain of a black yeast called Aureobasidium pullulans that has beneficial advantages in metabolic disorders by alleviating glucotoxicity (Dedeepiya et al., 2012), lipotoxicity (Ganesh et al., 2014; Ikewaki et al., 2021.sup.a), lipidemia-induced hepatic fibrosis (Ikewaki et al., 2021.sup.b), inflammation (Ikewaki et al., 2021.sup.b) apart from immune-enhancement (Ikewaki et al., 2021.sup.c), and modulation in COVID-19 (Raghavan et al., 2022), which have been reported in translational and clinical studies.

    [0145] The effects of this AFO-202 beta glucan in terms of behavioural (Raghavan et al., 2021a) and sleep pattern improvement (Raghavan et al., 2021.sup.b), increase in levels of plasma Syn (Raghavan et al., 2021.sup.a), and serum melatonin (Raghavan et al., 2021.sup.b) levels in children with ASD has been reported. We report the effects of AFO-202 beta glucan on the gut microbiome in children with ASD who participated in our pilot study.

    [0146] The beta-glucan studied (Nichi Glucan) was obtained from the AFO-202 strain of a black yeast called Aureobasidium pullulans that has beneficial advantages in metabolic disorders by alleviating glucotoxicity [B5], lipotoxicity [B6, B7], lipidemia-induced hepatic fibrosis [B8], inflammation [B8] apart from immune-enhancement [B9], and modulation in COVID-19 [B10], which have been reported in translational and clinical studies. The effects of this AFO-202 beta glucan in terms of behavioural [E11] and sleep pattern improvement [B12], increase in levels of plasma Syn [E11], and serum melatonin [B12] levels in children with ASD has been reported. We report the effects of AFO-202 beta glucan on the gut microbiome in children with ASD who participated in our pilot study.

    [0147] In this randomized pilot clinical study, we have evaluated the gut microbiota of subjects with autism spectrum disorder (ASD) after consumption of Aureobasidium pullulans (black yeast) AFO-202 strain-produced beta glucan, Nichi Glucan.

    Example 1

    Methods:

    [0148] The study was conducted in 18 subjects who were randomly allocated; six subjects (n=6) to the control group (Gr.1) who underwent conventional treatment comprising remedial behavioural therapies and L-carnosine 500 mg per day, and twelve subjects (n=12) Gr. 2 underwent supplementation with an Aureobasidium black yeast AFO-202 (Aureobasidium pullulans strain AFO-202 (also referred to as FO-68 [accession number: FERM BP-19327])) derived beta glucan, Nichi Glucan 0.5 g twice daily along with the conventional treatment. Stool samples from the subjects was collected at baseline and after the intervention. The samples were sequenced using Novaseq 6000 with a read length of 151 bp and taken for whole genome metagenome analysis.

    [0149] Thirteen subjects (four in control (Gr.1) and nine in Nichi Glucan (Gr.2) completed the study. The sample reads were filtered for human DNA contamination. The alignment to the human genome was around 18.98%. The filtered reads were then aligned to bacterial, fungal, viral and archea genomes. The overall alignment to the bacterial genome was around 40%. However, the alignment to the viral, fungi and archea genomes was around 0.05-0.2%. De novo assembly was carried out using the pre-processed reads to obtain the scaffolds. These scaffolds were then used for gene prediction. Bacterial abundance was analysed.

    Results:

    [0150] The abundance of Enterobacter was decreased almost to nil in the Nichi Glucan (Gr.2) group after intervention while it increased from 0.36% to 0.85% in the control group (FIG. 10). The abundance of Bacteroides increased from 16.84 to 19.09% in the control while it decreased from 11.60 to 11.43% in the Gr. 2 (FIG. 11) after intervention. The abundance of Prevotella increased in both Gr.1 and Gr.2 (FIG. 12). The decrease in abundance of Lactobacillus was significant in Gr.2 compared to Gr. 1 (FIG. 13).

    Conclusion:

    [0151] Earlier reports have indicated a lower abundance of Prevotella, higher abundance of Lactobacillus and Bacteroides in children with autism spectrum disorders [A2]. MS patients also have been reported to have a lower abundance of Prevotella [A4]. Enterobacter produce functional amyloid proteins termed curli which promotes human amyloid -synuclein (Syn) pathology and the aggregation of curli and Syn stimulates pathological and immunological processes that lead to the neurodevelopmental and neurodegenerative diseases such as ASD, MS, PD and AD [A1]. The results of this study which have produced favorable results after Nichi Glucan consumption in the gut microbiota by alleviate the pathological processes behind such neurodevelopmental and neurodegenerative diseases involving amyloid accumulations warrant larger clinical studies to recommend this as a routine food supplement in patients with neurodegenerative and neuroinflammatory conditions apart from research to explore their mechanisms and further potentials.

    Example 2

    Methods:

    [0152] Eighteen subjects with ASD were randomly allocated: six subjects in the control group (Group 1): conventional treatment comprising remedial behavioural therapies and L-carnosine 500 mg per day, and 12 subjects (Group 2) underwent supplementation with Nichi Glucan 0.5 g twice daily along with the conventional treatment for 90 days.

    Results:

    [0153] Whole genome metagenome (WGM) sequencing of the stool samples at baseline and after intervention, showed that among genera of relevance, the abundance of Enterobacteria was decreased almost to zero in Group 2 after intervention, whereas it increased from 0.36% to 0.85% in Group 1. The abundance of Bacteroides increased in Group 1, whereas it decreased % in Group 2. The abundance of Prevotella increased in both Group 1 and Group 2. The decrease in abundance of Lactobacillus was significant in Group 2 compared to Group 1. Among species, a decrease was seen in Escherichia coli, Akkermansia muciniphila CAG:154, Blautia spp., Coprobacillus sp., and Clostridium bolteae CAG:59, with an increase of Faecalibacterium prausnitzii and Prevotella copri, which are both beneficial.

    Conclusion:

    [0154] AFO-202 beta 1,3-1,6 glucan apart from balancing the gut microbiome in children with ASD, its role in effective control of curli-producing enterobacteria that leads to -synuclein (Syn) misfolding and accumulation, may have a prophylactic role in Parkinson's and Alzheimer's diseases as well.

    Trial Registration:

    [0155] The study was registered in India's clinical trial registry CTRI, Ref no: [0156] CTRI/2020/10/028322. URL: [0157] http://ctri.nic.in/Clinicaltrials/showallp.php?mid1=47623&EncHid=&userName=ken max.

    Example 3

    Methods:

    [0158] This study was approved by the institutional ethics committee of the hospital in which the study took place and was registered as a clinical trial in the national clinical trial registry. The caregivers of each subject gave their informed consent for inclusion before participation in the study. The study was conducted in accordance with the Declaration of Helsinki.

    Patient Involvement:

    [0159] Patients were involved in the design and conduct of this research. During the feasibility stage, priority of the research question, choice of outcome measures, and methods of recruitment were informed by discussions with patients through a focus group session and structured interviews. Once the trial has been published, participants will be informed of the results through a study newsletter suitable for a non-specialist audience.

    Study Design

    [0160] The subjects enrolled in the study had received a diagnosis of ASD from a developmental pediatrician, which was verified by a psychologist using a clinical interview for a behavioural pattern that incorporated the Childhood Autism Rating Scale score.

    [0161] Eighteen subjects with ASD were enrolled in this prospective, open-label, pilot clinical trial comprised of two arms. The CONSORT flow diagram is presented in FIG. 14.

    Study Groups

    [0162] Arm 1 or Group 1 (control group): Six subjects with ASD underwent conventional treatment comprising remedial behavioural therapies and L-carnosine 500 mg per day.

    [0163] Arm 2 or Group 2 (Nichi Glucan group): 12 subjects underwent supplementation with Nichi Glucan food supplement along with conventional treatment (remedial behavioural therapies and L-carnosine 500 mg per day). Each subject consumed two sachets (0.5 g each) of Nichi Glucan dailyone sachet with a meal twice dailyfor 90 days.

    [0164] The inclusion and exclusion criteria along with the assessment of behavioural and sleep pattern apart from evaluation of levels of Syn and melatonin are available in the results of the clinical trial reported earlier (Raghavan et al., 2021.sup.a,b)

    Faecal Sample Collection and Preparation

    [0165] Faecal samples were collected at baseline and 90 days after the intervention using a sterile faecal collection kit and the samples were kept at 20 C. until they were transferred to the laboratory and processed. Samples for DNA extraction were stored at 80 C. until needed for analysis.

    DNA Extraction

    [0166] Total microbial DNA was extracted from faeces of each specimen using the QIAAmp DNA Mini Kit (Qiagen) according to manufacturer's instructions. Each batch of specimens were extracted with negative buffer control (extraction control).

    Library Preparation

    [0167] Whole-genome metagenome sequencing libraries were prepared. In brief, the DNA was sheared using a Covaris ultrasonicator. Sheared DNA was subjected to a sequence of enzymatic steps for repairing the ends and tailing with dA by ligation of indexed adapter sequences. These adapter-ligated fragments were then cleaned up using SPRI beads. Next, the clean fragments are indexed using limited cycle PCR to enrich the adapter-ligated molecules. Finally, the amplified products were purified and checked before sequencing.

    Metagenome Sequencing

    [0168] Prepared libraries were sequenced using Novaseq 6000 with a read length of 151 bp. The samples were taken for whole genome metagenome analysis. Initially, the reads were filtered for human DNA contamination (FIGS. 15-17). The alignment to the human genome was around 18.98%. The filtered reads were then aligned to bacterial, fungal, viral, and archea genomes (FIG. 18). The overall alignment to the bacterial genome was around 40%. However, the alignment to the viral, fungi, and archaea genomes was around 0.05-0.2%. De novo assembly was carried out using the preprocessed reads to obtain the scaffolds, which were then used for gene prediction. The abundances at the phylum, genus, and species level were evaluated.

    Microbiome Bioinformatics

    [0169] The following bioinformatics pipeline was used to perform whole-genome-sequencing metagenomic analysis. The quality of the raw data was analysed and the adapters were trimmed. The low-processed reads were first aligned to human genome to remove unaligned reads that were then assembled using METASPADES de novo assembler for metagenomics. After assembly, the gene prediction was performed using PRODIGAL. The predicted genes were then searched against existing genes in the NCBI database using the DIAMOND MEGAN5 program. The occurrence of dominant microbial population was studied at various levels (phylum, class, order, family, and genus) based on the taxonomic abundance in the given samples. The dominance was calculated based on the amount of sequence obtained from samples, community composition, and the contig size distribution. Chimeric sequences were identified and filtered from the analysis.

    Statistical Analysis

    [0170] Statistical data were analysed using Microsoft Excel statistics package analysis software. Paired t tests were also calculated using this package, and P values<0.05 were considered significant.

    Results

    [0171] Eighteen patients who fulfilled all the selection criteria and none of the exclusion criteria were selected to begin the study. During enrolment, one participant in the treatment group (Group 2) dropped out before the study began. During the study, four subjects were lost to follow-up: two in Group 1 (one dropped out due to social problems in the family, and the other relocated to another city) and two in Group 2 (one dropped out due to social problems in the family, and the other relocated to another city). After excluding these four subjects, 13 subjects were included in the analysis.

    [0172] The pre-processed reads were first aligned with the human genome (hg19) using BWA-MEM aligner to remove human genome contamination from the samples. The uncontaminated sequences were then taken for further alignment with known bacteria, fungi, virus, and archaea bacteria genomes using BWA MEM aligner. Around 7-12% of the reads mapped to the human genome, and the bacterial genome with 30-60% mapped reads.

    [0173] Regarding the SEED average, there was several fold decrease in all the gene annotations (metabolites and metabolic functions) in the AFO-202 Nichi Glucan treatment group including Carbohydrates, Fatty acids, lipids, virulence, metabolite damage and nitrogen metabolism (FIG. 19 and Table 5).

    [0174] Bacterial kingdom was the most abundant organism type one. In both Group 1 (control) and Group 2 (Nichi Glucan), both before and after intervention, phylum Firmicutes was the most abundant followed by Bacteroidetes (FIG. 20). Although in Group 1 Proteobacteria was the next most abundant followed by Actinobacteria, this relationship was reversed in Group 2 (FIG. 21).

    [0175] Among the genera of relevance, the abundance of Enterobacter was decreased to almost zero in Group 2 after intervention, while it increased from 0.36% to 0.85% in Group 1 (FIG. 22A). The abundance of Bacteroides increased from 16.84% to 19.09% (p-value=0.42) in Group 1, while it showed little significant difference (11.60% and 11.43%) (p value=0.46) (FIG. 22B) after intervention. The abundance of Prevotella increased in both Group 1 and Group 2 (FIG. 22C). The decrease in abundance of Lactobacillus was significant in Group 2 compared to Group 1 (FIG. 22D). Desulfovibrio decreased from 0.40% to 0.28% in Gr.2. Species abundance increased in Group 2 after intervention. Faecalibacterium prausnitzii, Bifidobacterium longum, and Firmicutes bacterium CAG:124 represented the most abundant species (FIG. 23 and FIG. 24). Escherichia coli decreased in both Group 1 and Group 2 but the difference was significant in Group 2 (p-value=0.02) (FIG. 25A). Faecalibacterium prausnitzii increased in both Group 1 and Group 2 but the difference was significant in Group 2 (p-value=0.041) (FIG. 25B). Akkermansia muciniphila CAG:154 (FIG. 25C) and Clostridium bolteae CAG:59 increased in the Group 1, whereas it decreased in Group 2 (FIG. 25D). Prevotella copri increased in both the groups. Blautia spp., Coprobacillus sp., and several Clostridium spp. decreased in both the groups.

    [0176] The data of the genus and species level abundance in Gr. 1 and Gr. 2 are presented in Tables 5-9.

    TABLE-US-00005 TABLE 5 Genus level: Mean and percentage abundance as baseline and post-intervention in Gr. 1 (Control) Percentage Mean abundance of abundance Post- Post- S. Inter- Inter- No Genus Baseline vention Baseline vention 1 Bacteroides 16395 16956 16.84 19.09 2 Prevotella 2019 7252 2.07 8.16 3 Clostridium 6277 5792 6.45 6.52 4 Faecalibacterium 4646 5398 4.77 6.08 5 Bifidobacterium 7375 4809 7.58 5.41 6 Blautia 6123 4175 6.29 4.70 7 Roseburia 3257 3564 3.35 4.01 8 Eubacterium 2268 3016 2.33 3.40 9 Ruminococcus 3484 2066 3.58 2.33 10 Lachnoclostridium 1289 1682 1.32 1.89 11 Hungatella 66 1381 0.07 1.55 12 Dialister 983 1380 1.01 1.55 13 Klebsiella 1121 1357 1.15 1.53 14 Alistipes 3487 1352 2.55 1.52 15 Enterococcus 4721 1270 4.85 1.43 16 Veillonella 0 1244 0.00 1.40 17 Akkermansia 827 1126 0.85 1.27 18 Streptococcus 384 1093 0.39 1.23 19 Megasphaera 64 1084 0.07 1.22 20 Anaerostipes 393 1020 0.40 1.15 21 Parabacteroides 1686 971 1.73 1.09 22 Lactobacillus 1857 956 1.91 1.08 23 Coprococcus 897 915 0.92 1.03 24 Dorea 1352 862 1.39 0.97 25 Butyricicoccus 1339 815 1.38 0.94 26 Flavonifractor 669 823 0.69 0.93 27 Escherichia 1062 822 1.09 0.92 28 Odoribacter 1036 803 1.06 0.90 29 Enterobacter 355 757 0.36 0.85 30 Subdoligranulum 802 597 0.82 0.67 31 Oscillibacter 699 569 0.72 0.64 32 Bilophila 0 552 0.00 0.62 33 Eggerthella 829 548 0.85 0.62 34 Collinsella 1617 541 1.66 0.61 35 Turicibacter 0 415 0.00 0.47 36 Mitsuokella 0 409 0.00 0.46 37 Catenibacterium 540 403 0.55 0.45 38 Fusicatenibacter 434 392 0.45 0.44 39 Romboutsia 206 357 0.21 0.40 40 Haemophilus 88 346 0.09 0.39 41 Gemmiger 524 343 0.54 0.39 42 Sutterella 139 301 0.14 0.34 43 Lachnospira 0 294 0.00 0.33 44 Mycoplasma 292 251 0.30 0.28 45 Holdemanella 585 199 0.60 0.22 46 Parasutterella 0 197 0.00 0.22 47 Weissella 173 177 0.18 0.20 48 Ruminiclostridium 174 148 0.18 0.17 49 Chlamydia 133 147 0.14 0.16 50 Dakarella 97 147 0.10 0.16 51 Lactococcus 144 144 0.15 0.16 52 Clostridioides 107 126 0.11 0.14 53 Terrisporobacter 0 123 0.00 0.14 54 Coprobacillus 224 114 0.23 0.13 55 Adlercreutzia 405 101 0.42 0.11 56 Butyrivibrio 121 90 0.12 0.10 57 Anaerotruncus 135 81 0.14 0.09 58 Bacillus 262 69 0.27 0.08 59 Agathobaculum 54 67 0.05 0.08 60 Shigella 53 60 0.05 0.07 61 Tyzzerella 13 59 0.01 0.07 62 Oribacterium 145 52 0.15 0.06 63 Intestinimonas 91 50 0.09 0.06 64 Citrobacter 0 49 0.00 0.06 65 Fusobacterium 0 46 0.00 0.05 66 Acholeplasma 0 41 0.00 0.05 67 Pseudoflavonifractor 68 40 0.07 0.05 68 Raoultella 0 32 0.00 0.04 69 Muribaculum 0 31 0.00 0.03 70 Acidiphilium 27 29 0.03 0.03 71 Paenibacillus 110 28 0.11 0.03 72 Acidaminococcus 0 25 0.00 0.03 73 Salmonella 0 22 0.00 0.03 74 Anaeromassilibacillus 179 22 0.18 0.02 75 Pantoea 0 21 0.00 0.02 76 Intestinibacter 0 21 0.00 0.02 77 Eisenbergiella 85 20 0.09 0.02 78 Prevotellamassilia 0 20 0.00 0.02 79 Anaerotignum 0 17 0.00 0.02 80 Selenomonas 0 16 0.00 0.02 81 Actinomyces 0 16 0.00 0.02 82 Paraprevotella 26 10 0.03 0.01 83 Porphyromonas 0 9 0.00 0.01 84 Barnesiella 129 0 0.13 0.00 85 Anaerococcus 141 0 0.14 0.00 86 Stenotrophomonas 13 0 0.01 0.00 87 Finegoldia 82 0 0.08 0.00 88 Pediococcus 10 0 0.01 0.00 89 Solobacterium 27 0 0.03 0.00 90 Peptoniphilus 929 0 0.95 0.00 91 Urinacoccus 144 0 0.15 0.00 92 Enterorhabdus 46 0 0.05 0.00 93 Slackia 69 0 0.07 0.00 94 Achromobacter 59 0 0.06 0.00 95 Lysinibacillus 1130 0 1.16 0.00 96 Olsenella 192 0 0.20 0.00 97 Comamonas 131 0 0.13 0.00 98 Ruthenibacterium 63 0 0.06 0.00 99 Viridibacillus 40 0 0.04 0.00 100 Rummeliibacillus 603 0 0.62 0.00 101 Gordonibacter 735 0 0.75 0.00 102 Drancourtella 19 0 0.02 0.00 103 Monoglobus 24 0 0.02 0.00 104 Lagierella 39 0 0.04 0.00 105 Peptococcus 27 0 0.03 0.00 106 Senegalimassilia 122 0 0.13 0.00 107 Libanicoccus 25 0 0.03 0.00 108 Urmitella 24 0 0.02 0.00 109 Paraclostridium 19 0 0.02 0.00 110 Acinetobacter 1273 0 1.31 0.00 111 Anaerocolumna 9 0 0.01 0.00 112 Marvinbryantia 22 0 0.02 0.00 113 Robinsoniella 50 0 0.05 0.00 114 Neglecta 33 0 0.03 0.00 115 Butyricimonas 180 0 0.19 0.00 116 unknown 6947 5101 7.14 5.74

    TABLE-US-00006 TABLE 6 Genus level: Mean and percentage abundance as baseline and post-intervention in Gr. 2 (Nichi Glucan) Mean abundance Percentage of abundance S. Post- Post- No Genus Baseline Intervention Baseline Intervention 1 Bacteroides 13463 14088 11.60 11.43 2 Clostridium 8728 12105 7.52 9.83 3 Bifidobacterium 6771 5625 5.84 4.57 4 Faecalibacterium 5291 9278 4.56 7.53 5 Enterococcus 4583 40 3.95 0.03 6 Eubacterium 4380 5007 3.78 4.06 7 Ruminococcus 4265 6143 3.68 4.99 8 Blautia 4196 3973 3.62 3.22 9 Alistipes 3187 2268 2.75 1.84 10 Collinsella 2542 1590 2.19 1.29 11 Parabacteroides 2419 1307 2.08 1.06 12 Oscillibacter 1956 2542 1.69 2.06 13 Prevotella 1887 5979 1.63 4.85 14 Lactobacillus 1860 1093 1.60 0.89 15 Roseburia 1756 7932 1.51 6.44 16 Trichosporon 1683 0 1.45 0.00 17 Dorea 1592 1585 1.37 1.29 18 Lachnoclostridium 1360 1056 1.17 0.86 19 Olsenella 1354 246 1.17 0.20 20 Escherichia 1346 505 1.16 0.41 21 Klebsiella 1067 80 0.92 0.06 22 Gemmiger 970 1161 0.84 0.94 23 Streptococcus 925 521 0.80 0.42 24 Coprococcus 910 1228 0.78 1.00 25 Subdoligranulum 904 1112 0.78 0.90 26 Eggerthella 871 190 0.75 0.15 27 Dialister 765 1062 0.66 0.86 28 Hungatella 732 175 0.63 0.14 29 Lysinibacillus 709 0 0.61 0.00 30 Acinetobacter 677 0 0.58 0.00 31 Pediococcus 662 0 0.57 0.00 32 Holdemanella 649 546 0.56 0.44 33 Butyricicoccus 623 1257 0.54 1.02 34 Catenibacterium 620 470 0.53 0.38 35 Cloacibacillus 602 265 0.52 0.21 36 Pichia 588 0 0.51 0.00 37 Odoribacter 577 271 0.50 0.22 38 Rummeliibacillus 555 0 0.48 0.00 39 Weissella 555 24 0.48 0.02 40 Flavonifractor 545 729 0.47 0.59 41 Senegalimassilia 505 56 0.43 0.05 42 Megasphaera 464 1203 0.40 0.98 43 Romboutsia 463 130 0.40 0.11 44 Desulfovibrio 461 344 0.40 0.28 45 Fusicatenibacter 452 641 0.39 0.52 46 Sutterella 436 780 0.38 0.63 47 Mycoplasma 424 265 0.37 0.21 48 Peptoniphilus 413 0 0.36 0.00 49 Ruminiclostridium 411 387 0.35 0.31 50 Anaerotruncus 410 485 0.35 0.39 51 Butyrivibrio 404 315 0.35 0.26 52 Methanobrevibacter 395 368 0.34 0.30 53 Megamonas 392 501 0.34 0.41 54 Bacillus 326 150 0.28 0.12 55 Butyricimonas 319 39 0.28 0.03 56 Anaerostipes 318 485 0.27 0.39 57 Phascolarctobacterium 317 464 0.27 0.38 58 Akkermansia 305 498 0.26 0.40 59 Gordonibacter 304 0 0.26 0.00 60 Coprobacillus 295 438 0.25 0.36 61 Coraliomargarita 294 339 0.25 0.28 62 Methanosphaera 282 0 0.24 0.00 63 Enterobacter 257 17 0.22 0.01 64 Pyramidobacter 231 15 0.20 0.01 65 Acidaminococcus 230 269 0.20 0.22 66 Paenibacillus 229 184 0.20 0.15 67 Acidiphilium 219 555 0.19 0.45 68 Adlercreutzia 210 334 0.18 0.27 69 Actinomyces 191 4 0.16 0.00 70 Succinatimonas 190 383 0.16 0.31 71 Libanicoccus 188 119 0.16 0.10 72 Angelakisella 184 79 0.16 0.06 73 Pseudoflavonifractor 183 173 0.16 0.14 74 Chlamydia 176 130 0.15 0.11 75 Anaeromassilibacillus 175 135 0.15 0.11 76 Intestinimonas 157 174 0.14 0.14 77 Duodenibacillus 150 181 0.13 0.15 78 Oribacterium 145 103 0.33 0.08 79 Clostridioides 129 64 0.11 0.05 80 Barnesiella 118 84 0.10 0.07 81 Slackia 109 0 0.09 0.00 82 Eisenbergiella 95 112 0.08 0.09 83 Acidovorax 93 0 0.08 0.00 84 Lactococcus 92 0 0.08 0.00 85 Paraprevotella 91 16 0.08 0.01 86 Shigella 90 90 0.08 0.07 87 Oxalobacter 87 0 0.08 0.00 88 Selenomonas 84 231 0.07 0.19 89 Turicibacter 74 36 0.06 0.03 90 Haemophilus 74 196 0.06 0.16 91 Pygmaiobacter 69 0 0.06 0.00 92 Urinacoccus 64 0 0.06 0.00 93 Bilophila 63 613 0.05 0.50 94 Allisonella 62 54 0.05 0.04 95 Ruthenibacterium 51 69 0.04 0.06 96 Raoultibacter 50 0 0.04 0.00 97 Comamonas 44 0 0.04 0.00 98 Neglecta 42 37 0.04 0.03 99 Atopabium 40 11 0.03 0.01 100 Christensenella 38 41 0.03 0.03 101 Massilimaliae 37 32 0.03 0.03 102 Finegoldia 36 0 0.03 0.00 103 Treponema 36 48 0.03 0.04 104 Robinsoniella 36 0 0.03 0.00 105 Enterorhabdus 36 40 0.03 0.03 106 Viridibacillus 36 0 0.03 0.00 107 Peptococcus 35 0 0.03 0.00 108 Fusobacterium 34 30 0.03 0.02 109 Terrisporobacter 34 7 0.03 0.01 110 Tyzzerella 33 171 0.03 0.14 111 Erysipelatoclostridium 32 0 0.03 0.00 112 Sporobacter 32 36 0.03 0.03 113 Mitsuokella 31 432 0.03 0.35 114 Cutaneotrichosporon 31 0 0.03 0.00 115 Marvinbryantia 31 28 0.03 0.02 116 Corallococcus 30 143 0.03 0.12 117 Anaerotignum 28 18 0.02 0.01 118 Prevotellamassilia 24 158 0.02 0.13 119 Anaerofilum 24 35 0.02 0.03 120 Synergistes 22 0 0.02 0.00 121 Alloprevotella 22 22 0.02 0.02 122 Isoptericola 22 0 0.02 0.00 123 Anaerococcus 21 0 0.02 0.00 124 Propionibacterium 20 0 0.02 0.00 125 Leuconostoc 20 0 0.02 0.00 126 Brachyspira 19 95 0.02 0.08 127 Lachnospira 18 386 0.02 0.31 128 Lagierella 17 0 0.02 0.00 129 Mogibacterium 16 0 0.01 0.00 130 Agathobaculum 15 61 0.01 0.05 131 Pseudobutyrivibrio 15 35 0.01 0.03 132 Hydrogenoanaerobacterium 14 14 0.01 0.01 133 Holdemania 14 0 0.01 0.00 134 Desulfotomaculum 14 0 0.01 0.00 135 Veillonella 14 324 0.01 0.26 136 Succinivibrio 14 32 0.01 0.03 137 Anaerocolumna 14 14 0.01 0.01 138 Mobilibacterium 12 0 0.01 0.00 139 Arabia 12 0 0.01 0.00 140 Enorma 11 0 0.01 0.00 141 Candida <Debaryomycetaceae> 11 0 0.01 0.00 142 Intestinibacter 11 13 0.01 0.01 143 Kurthia 10 0 0.01 0.00 144 Paeniclostridium 9 0 0.01 0.00 145 Paraclostridium 8 0 0.01 0.00 146 Listeria 8 0 0.01 0.00 147 Kwoniella 8 0 0.01 0.00 148 Cryptococcus 7 0 0.01 0.00 149 Fournierella 0 23 0.00 0.02 150 Sellimonas 0 23 0.00 0.02 151 Blastocystis 0 34 0.00 0.03 152 Acholeplasma 0 126 0.00 0.10 153 Azospirillum 0 162 0.00 0.13 154 Porphyromonas 0 7 0.00 0.01 155 Emergencia 0 14 0.00 0.01 156 Acetobacter 0 13 0.00 0.01 157 Dakarella 0 64 0.00 0.05 158 Parasutterella 0 133 0.00 0.11 159 Elusimicrobium 0 128 0.00 0.10 160 Drancourtella 0 32 0.00 0.03 161 Anaerovorax 0 15 0.00 0.01 162 Caldicoprobacter 0 15 0.00 0.01 163 unknown 12707 16408 10.93 13.32

    TABLE-US-00007 TABLE 7 Species level: Mean abundance at baseline and post-intervention in Gr. 1 (Control) Mean abundance Post- S. Base- Inter- No Species line vention 1 Prevotella copri 530 2058 2 uncultured Clostridium sp. 2459 1860 3 Bifidobacterium longum 2150 1433 4 Hungatella hathewayi 65 1287 5 Bacteroides fragilis 2052 1189 6 Bacteroides thetaiotaomicron 1432 1172 7 Blautia producta 25 985 8 Bifidobacterium bifidum 941 946 9 Roseboria intestinalis 144 930 10 Bacteroides vulgatus 364 866 11 Bacteroides ovatus 1186 846 12 Clostridium neonatale 0 770 13 Escherichia coli 998 267 14 Akkermansia muciniphila 464 760 15 uncultured Butyricicoccus Sp. 948 751 16 Prevotella copri CAG: 164 362 700 17 Flavonifractor plautii 445 640 18 [Eubacterium] rectale 380 594 19 Anaerostipes sp. BG01 0 584 20 Dialister sp. CAG: 357 0 540 21 Lactobacillus ruminis 628 536 22 Bacteroides uniformis 265 519 23 Roseburia faecis 625 507 24 Prevotella sp. CAG: 386 61 481 25 Eubacterium sp. CAG: 252 0 472 26 [Clostridium] bolteae 0 471 27 [Eubacterium] eligens 0 470 28 Bifidobacterium adolescentis 574 466 29 Klebsiella pneumoniae 397 461 30 Prevotella sp. CAG: 1092 0 457 31 Dialister succinatiphilus 412 454 32 Clostridium sp. AT4 12 450 33 Prevotella sp. CAG: 604 154 445 34 Firmicutes bacterium CAG: 124 806 439 35 uncultured Blautia sp. 1136 435 36 Bacteroides xylanisolvens 402 414 37 Bilophila wadsworthia 0 412 38 Blautia obeum 1024 410 39 Prevotella sp. 885 48 406 40 Fusicatenibacter saccharivorans 432 391 41 [Clostridium] clostridioforme 76 379 42 Megasphaera elsdenii 0 376 43 Bacteroides nordii 56 369 44 Faecalibacterium sp. CAG: 82 296 362 45 [Ruminocossus] gnavus 367 361 46 Ruminococcus sp. CAG: 177 427 359 47 Dorea longicatena 402 358 48 Mitsuokella multacida 0 356 49 Blautia wexlerae 738 355 50 Eubacterium sp. CAG: 251 0 351 51 [Ruminococcus] torques 790 342 52 Prevotella multisaccharivorax 72 334 53 Odoribacter splanchnicus 417 330 54 Firmicutes bacterium CAG: 176 653 329 55 Dialister sp. CAG: 486 143 328 56 Gemmiger formicilis 481 320 57 Firmicutes bacterium CAG: 41 334 311 58 Streptococcus thermophilus 0 305 59 Romboutsia timonensis 171 299 60 Subdoligranulum sp. 60_17 438 296 61 Bacteroides oleiciplenus 0 286 62 Subdoligranulum variabile 275 281 63 Bacteroides plebeius 0 280 64 uncultured Faccalibacterium sp. 168 280 65 Roseburia hominis 94 273 66 Anaerostipes hadrus 350 266 67 Alistipes putredinis 568 266 68 butyrate-producing bacterium SS3/4 0 259 69 Firmicutes bacterium CAG: 103 872 255 70 Eggerthella lenta 392 254 71 Catenibacterium sp. CAG: 290 324 240 72 Mycoplasma sp. CAG: 956 229 238 73 Veillonella dispar 0 238 74 Oscillibacter sp. ER4 283 238 75 Clostridium sp. CAG: 81 0 236 76 Collinsella aerofaciens 715 236 77 Bacteroides timonenasis 0 235 78 Turicibacter sanguinis 0 233 79 Bifidobacterium sp. N5G01 530 230 80 Bacteroides caccae 548 224 81 Clostridiales bacterium KLE1615 0 216 82 uncultured Ruminococcus sp. 760 213 83 Bacteroides cellulosilyticus 0 213 84 Clostridium sp. CAG: 7 55 213 85 Parabacteroides merdae 40 211 86 Clostridium sp. CAG: 389 291 208 87 Blautia sp. CAG: 37 162 208 88 Coprococcus eutactus 158 200 89 Veillonella atypica 0 200 90 Ruminococcus callidus 32 200 91 Holdemanella biformis 585 199 92 Lachnospiraceae bacterium TF01-11 0 199 93 uncultured Lachnospira sp. 0 190 94 Bacteroides stercoris 0 187 95 Bifidobacterium catenulatum 142 183 96 [Eubacterium] hallii 346 174 97 Prevotella sp. CAG: 520 0 173 98 Roseburia sp. CAG: 18 283 173 99 Alistipes sp. HGB5 27 172 100 Haemophilus parainfluenzae 52 172 101 Streptococcus salvarius 71 169 102 Coprococcus catus 49 167 103 Firmicutes bacterium CAG: 65 89 164 104 Bacteroides plebeius CAG: 211 0 163 105 Ruminococcus bromii 158 163 106 Megasphaera massiliensis 12 161 107 Enterobacter hormaechei 47 158 108 Roseburia intestinalis CAG: 13 0 153 109 Catenibacterium mitsuokai 198 149 110 Dakarella massiliensis 97 147 111 Chlamydia trachomatis 132 146 112 Enterobacter cloacae 70 145 113 Bifidobacterium pseudocatenulatum 251 145 114 Clostridiales bacterium VE202-06 0 144 115 Firmicutes bacterium CAG: 65_45_313 0 142 116 [Clostridium] symbiosum 0 140 117 Veillenella parvula 0 139 118 Clostridiales bacterium 1_7_47FAA 0 336 119 Burkholderiales bacterium 1_1_47 0 135 120 Roseburia sp. CAG: 18_43_25 158 134 121 Bacteroides sp. HPS0048 64 132 122 Weissella confusa 124 132 123 Clostridium sp. CAG: 122 0 131 124 Firmicutes bacterium CAG: 424 146 131 125 Prevotella stercorea 0 127 126 Ruminococcus sp. CAG: 254 445 127 127 Bacteroides sp. 2_2_4 64 127 128 Enterococcus asini 0 126 129 Blautia sp. KLE 1732 185 126 130 Clostridioides difficile 107 125 131 Firmicutes bacterium CAG: 129_59_24 164 124 132 [Eubacterium] siraeum 50 124 133 Clostridiales bacterium 42_27 184 120 134 Bifidobacteriam kashiwanohense 125 117 135 Roseburia inulinivorans 482 117 136 Prevotella sp. CAG: 732 28 114 137 Firmicutes bacterium CAG: 170 235 113 138 Clostridium sp. CAG: 12237_41 0 113 139 Clostridium bolteae CAG: 59 0 113 140 Clostridium sp. ATCC BAA-442 67 113 141 Laetobacillus ruminis CAG: 367 87 113 142 Firmicutes bacterium CAG: 102 0 111 143 Ruminococcus sp.5_1_39BFAA 166 105 144 Firmicutes bacterium CAG: 114 480 103 145 Alistipes senegalensis 628 102 146 Alistipes finegoldii 41 101 147 Adlercreutzia equolifaciens 405 101 148 Sutterella sp. CAG: 351 132 100 149 Parabacteroides distasonis 67 100 150 Parasutterella excrementihominis 0 98 151 uncultured Eubacterium sp. 294 98 152 Enterococcus avium 292 97 153 Bacteroides dorei 235 97 154 Bacteroides stercorirosoris 0 97 155 Collinsella sp. CAG: 66 156 96 156 uncultured bacterium 89 95 157 Lactococcus garvieae 0 95 158 Prevotella sp. CAG: 474 21 95 159 Terrisporobacter glycolicus 0 94 160 Osdillibacter sp. 57_20 66 94 161 Veillonella sp. DORA_A_3_16_22 0 94 162 Ruminococcus sp. CAG: 90 118 92 163 Prevotella sp. CAG: 592 0 92 164 Lachnospira pactinoschiza 0 92 165 Bacteroides intestinalis 0 89 166 Bacteroides caccae CAG: 21 231 88 167 Bacteroides sp. 3_1_23 12 87 168 Clostridiales bacterium 41_21_two_genomes 21 87 169 Faecalibacterium sp. CAG: 82-related_59_9 24 85 170 Klebsiella michiganensis 0 85 171 Bifidobacterium sp. N4G05 217 83 172 Proteobacteria bacterium CAG: 139 0 81 173 Clostridiales bacterium 41_12_two_minus 83 81 174 Eubacterium sp. CAG: 248 0 80 175 Dorea formicigenerans 292 80 176 Megasphaera sp. D1SK 18 0 79 177 Coprobacillus sp. CAG: 235 197 79 178 Prevotella stercorea CAG: 629 0 79 179 Clostridiales bacterium 52_15 218 79 180 Clostridiales bacterium 59_14 133 77 181 Blautia sp. CAG: 37 163 77 182 uncultured Bacteroides sp. 0 76 183 Alistipes finegoldii CAG: 68 0 75 184 Dorea sp. CAG: 105 39 74 185 Ruminococcus obeum CAG: 39 163 73 186 Bacteroides cellulosilyticus CAG: 158 0 70 187 Ruminococcus sp. CAG: 17 170 69 188 Eubacterium sp. CAG: 38 0 69 189 Clostridium sp. CAG: 91 0 69 190 Klebsiella oxytoca 0 68 191 Bacteroides sp. 43_46 134 68 192 Prevotella sp. P3-122 0 68 193 Roseburia sp. CAG: 471 101 68 194 Agathobaculum desmolans 54 67 195 Sutterella parvirubra 0 66 196 Eubacterium rectale CAG: 36 35 66 197 Collinsella sp. 4_8_47FAA 144 65 198 Blantia sp. Marseille-P3201T 68 65 199 Bacteroide sp. 4_1_36 75 63 200 Odoribacter sp. 43_10 61 62 201 Parasutterella excrementihominis CAG: 233 0 60 202 Bilophila sp. 4_1_30 0 60 203 Eubacterium elugens CAG: 72 0 60 204 Parabacteroides merdae CAG: 48 0 59 205 Blautia sp. CAG: 37_48_57 87 59 206 Bifidobacterium breve 485 58 207 Ruminococcus sp. CAG: 108 45 58 208 Firmicutes bacterium CAG: 83 430 57 200 Bacteroides sp. 41_26 0 57 210 Anaerostipes caccae 0 56 211 uncultured Flavonifractor sp. 65 56 212 Enterococcus sp. HMSC05C03 31 56 213 Butyricicoccus sp. BB10 347 56 214 Alistipes putredinis CAG: 67 57 55 215 Bacteroides sp. D20 18 54 216 Lachnoclostridium sp. An196 34 54 217 Dorea longicatena CAG: 42 29 53 218 Klebsiella variicola 0 53 219 Akkermansia muciniphila CAG: 154 21 48 220 Streptococcus pneumoniae 36 48 221 Firmicutes bacterium CAG: 129 73 48 222 Eubacterium sp. 45_250 0 48 223 Bacteroides sp. D22 51 47 224 Eubacterium sp. CAG: 76 0 47 225 Clostridiales bacterium VE202-28 0 47 226 Oscillibacter sp. CAG: 241 69 46 227 Blautia massiliensis 69 46 228 Blautia sp. SF-50 77 46 229 Parabacteroides sp. D13 39 45 230 Enterococcus faecium 844 45 231 Mitsuokella jalaludinii 0 45 232 Sutterella wadsworthensis 0 44 233 Clostridiales baterium 36_14 48 44 234 Coprococcus sp. CAG: 131 66 44 235 Lachnoclostridium sp. An14 0 43 236 Lachnospiracaea bacterium 7_1_58FAA 18 43 237 Blautia sp. Marseille-P2398 86 43 238 Eubacterium ballii CAG: 12 85 42 239 Bacteroides sp. 1_1_30 49 42 240 Clostridiales bacterium VE202-03 25 41 241 Acholeplasma sp. CAG: 878 0 40 242 Blautia sp. CAG: 52 175 40 243 Veillonella sp. HPA0037 0 40 244 Alistipes indistinctus 91 39 245 Ruminococcus sp. SR1/5 57 39 246 Roseburia sp. CAG: 50 0 38 247 Erwinia phage vB_EamM_V3 0 38 248 Bacteroides sp. D2 0 38 249 Eubacterium ramulus 34 37 250 Veillonella sp. oral taxon 158 0 37 251 Clostridia bacterium UC5, 1-2H11 22 36 252 Turicibacter sp. H121 0 36 253 Fusobacterium sp. CAG: 815 0 36 254 Alistipes sp. 58_9_plus 0 35 255 Prevotella sp. CAG: 873 0 34 256 Clostridium sp. CAG: 448 0 34 257 Clostridium sp. CAG: 492 0 34 258 Firmicutes bacterium CAG: 822 0 34 259 Veillonella sp. ACP1 0 34 260 Bacteroides sp. 14(A) 0 33 261 Clostridiales bacterium NK3B98 0 33 262 Ruminococcus sp. CAG: 108_related_41_35 25 33 263 Bacteroides intestinalis CAG: 315 0 32 264 Lactobacillus rogosae 0 32 265 Alistipes timonensis 27 32 266 Anaerotruncus sp. CAG: 390 26 31 267 Prevotella sp. P4-65 0 31 268 Blautia sp. An81 27 31 269 Bacteroides fragilis CAG: 558 57 31 270 Tyzzerella nexilis 0 30 271 Romboutsia ilealis 0 30 272 [Clostridium] citroniae 0 29 273 Prevotella sp. P5-108 0 29 274 Prevotella sp. P4-76 0 29 275 Acidiphilium sp. CAG: 727 27 29 276 Muribaculum intestinale 0 29 277 Eubacterium sp. 41_20 27 29 278 Shigella sonnei 0 28 279 Terrisporobacter othiniensis 0 28 280 Bifidobacterium adolescentis CAG: 119 0 28 281 Veillonella sp. ICM51a 0 28 282 Prevotella sp. AGR2160 0 27 283 Bacteroides sp. 3_1_13 11 27 284 Prevotella sp. CAG: 279 320 27 285 Intestinimonas butyriciproducens 72 27 286 Prevotella bryantii 0 27 287 Streptococcus parasanguinis 12 27 288 Clostridium sp. CAG: 43 0 27 289 Klebsiella aerogenes 503 27 290 Ruminococcus sp. CAG: 330 37 26 291 Clostridium sp. SS2/1 43 26 292 uncultured Oscillibacter sp. 53 26 293 Prevotella sp. P5-64 0 26 294 Firmicutes bacterium CAG: 341 281 25 295 Oscillibacter sp. CAG: 241_62_21 32 25 296 Megashaera sp. MJR8396C 0 25 297 Coprococcus sp. CAG: 131-related_45_246 0 25 298 Ruminococcus sp. CAG: 9 61 25 299 Prevotella sp. P5-60 0 25 300 Bacteroides sp. CAG: 927 0 24 301 Megashaera sp. BL7 0 24 302 Bacteroidales bacterium 52_46 0 24 303 Odoribacter splanchnicus CAG: 14 50 24 304 Bacteroides sp. 43_108 0 24 305 Citrobacter koseri 0 24 306 Clostridium sp. CAG: 221 0 23 307 Veillonella tobetsuensis 0 23 308 Collinsella sp. TF06-26 144 23 309 Prevotella sp. P2-180 0 23 310 Bacteroides intestinalis CAG: 564 0 23 311 Lachnoclostridium edouardi 0 23 312 Eggerthella sp. 1_3_56FAA 25 22 313 Klebsiella sp. MS 92-3 24 22 314 Ruminococcus faecis 39 22 315 Bacteroides sp. 3_1_19 0 22 316 Bacteroides stercoris CAG: 120 0 22 317 Bacteroides sp. 1_1_14 170 21 318 Parabacteroides johnsonii 0 21 319 Weissella cibaria 0 21 320 Prevotella sp. P4-67 0 21 321 Intestinibacter bartlettii 0 21 322 Lachnospiraeceae bacterium 6_1_63FAA 21 21 323 Eubacterium siraeum CAG: 80 0 21 324 Salmonella enterica 0 21 325 Prevotella sp. P4-51 0 21 326 Clostridium botulinum 0 20 327 Clostridium nexile CAG: 348 0 20 328 Prevotellamassilia timonensis 0 20 329 Prevotella sp. P5-125 0 20 330 Clostridiales bacterium VE202-09 0 20 331 Shigella flexneri 0 20 332 Eubacterium sp. CAG76_36_125 0 20 333 Prevotella sp. P5-119 0 20 334 Prevotella ruminicola 0 19 335 Prevotella lascolanii 0 19 336 Prevotella buccae 0 19 337 Clostridium butyricum 0 19 338 Blautia sp. An46 20 19 339 Eggerthella sp. HGA1 19 19 340 Coprococcus comes 85 18 341 Prevotella sp. CAG: 1185 0 18 342 Lachnospiraeceae bacterium 5_1_63FAA 35 18 343 Bifidobacterium ruminantium 263 18 344 Bacteroides finegoldii 0 18 345 Bacteroides sp. 4_3_47FAA 0 17 346 Bacteroides sp. 3_1_40A 0 17 347 Bacteroides sp. CAG: 530 0 17 348 Lachnospiraeceae bacterium CAG: 364 15 16 349 Prevotella sp. CAG: 1124 0 16 350 Bacteroides vulgatus CAG: 6 0 16 351 Prevotella baroniae 0 16 352 Anaerotignum lactatifermentans 0 16 353 Blautia hansenii 14 15 354 Prevotella sp. CAG: 487 0 15 355 Prevotella timonensis 0 15 356 Ruminococcus gnavus CAG: 126 17 15 357 Megasphaera sp. NM10 0 15 358 Prevotella buccalis 0 14 359 Prevotella sp. P5-92 0 14 360 Streptococcus infantarius 0 14 361 Bacteroides sp. AR20 0 14 362 Enterobacter sp. BIDMC 29 0 14 363 Lachnospiraceae bacterium 2_1_58FAA 13 14 364 Bacteroides uniformis CAG: 3 18 14 365 Prevotella sp. CAG: 5226 0 14 366 Bacteroides sartorii 0 14 367 Blautia schinkii 0 14 368 [Clostridium] lavalense 0 13 369 Prevotella intermedia 0 13 370 Bacteroides mediterraneensis 0 13 371 Veillonella sp. 6_1_27 0 13 372 Lactoccoccus lactis 140 13 373 Bacteroides faecis 0 12 374 Lachnospiraceae bacterium JC7 37 12 375 Prevotella histicola 0 11 376 Sutterella sp. KLE1602 0 11 377 Prevotella oralis 0 11 378 Bifidobacterium bifidum CAG: 234 0 10 379 Prevotella sp. P4-119 0 10 380 Prevotella paludivivens 0 10 381 Prevotella sp. tc2-28 0 10 382 Prevotella sp. P5-126 0 10 383 Prevotella sp. 109 0 10 384 Prevotella brevis 0 10 385 Prevotella oris 0 9 386 Prevotella sp. DNF00663 0 9 387 Prevotella oryzae 0 9 388 Prevotella sp. CAG: 255 0 9 389 Prevotella sp. S7-1-8 0 9 390 Prevotella dentalis 0 9 391 Prevotella sp. KH2C16 0 9 392 Prevotella sp. CAG: 1058 0 9 393 Prevotella maculosa 0 9 394 Prevotella bergensic 0 9 395 Ruminococcaceae bacterium D16 14 8 396 Dorea formicigenerans CAG:28 31 0 397 Rummeliibacillus stabekisii 41 0 398 Bifidobacterium pseudolongum 30 0 399 Clostridium sp. CAG: 138 415 0 400 Blautia sp. CAG: 257 39 0 401 Enterococcus sp. HMSC072H05 14 0 402 Bacteroides dorei CAG: 222 22 0 403 Bacteroides sp. CAG: 189 67 0 404 [Desulfotomaculum] guttoideum 17 0 405 Tissierellia bacterium S5-A11 21 0 406 Ruminococcus sp. CAG: 382 21 0 407 Peptococcus niger 27 0 408 Oribacterium sp. C9 24 0 409 Olsenella provencensis 22 0 410 Collinsella sp. CAG: 289 85 0 411 Ruthenibacterium lactatiformans 63 0 412 Acinetobacter sp. NIPH 899 71 0 413 Oribacterium sp. WCC10 33 0 414 Clostridium sp. CAG: 609 259 0 415 Clostridium sp. CAG: 571 33 0 416 Butyricimonas virosa 146 0 417 Slackia piriformis 52 0 418 Firmicutes bacterium CAG: 110 278 0 419 Achromobacter xylosoxidans 12 0 420 Lactobacillus mucosae 321 0 421 Clostridium sp. CAG: 433 54 0 422 Clostridium sp. CAG: 226 155 0 423 Solobacterium moorei 27 0 424 bacterium LF-3 22 0 425 Anaerococcus prevotii 17 0 426 Olsenella sp. An188 24 0 427 Clostridium minihomine 16 0 428 Acinetobacter sp. NIPH 2171 133 0 429 Anaeromassilibacillus senegalensis 19 0 430 Dialister invisus 60 0 431 Firmicutes bacterium CAG: 646 12 0 432 bacterium MS4 32 0 433 Gordonibacter pamelaeae 82 0 434 Parabacteroides sp. HGS0025 18 0 435 Anaeromassilibacillus sp. Marseille-P3371 12 0 436 Peptoniphilus senegalensis 37 0 437 Clostridium sp. 7_2_43FAA 17 0 438 Peptoniphilus duerdenii 16 0 439 Comamonas testosteroni 90 0 440 Anaeromassilibacillus sp. An200 9 0 441 Lysinibacillus sp. ZYM-1 44 0 442 Mycoplasma sp. CAG: 472 53 0 443 Clostridium sp. L2-50 37 0 444 Collinsella sp. MS5 44 0 445 Firmicutes bacterium CAG: 555 26 0 446 Bacillus kochii 12 0 447 Faecalibacterium sp. CAG: 74_58_120 295 0 448 Clostridium sp. CAG: 793 270 0 449 Neglecta timonensis 26 0 450 [Clostridium] celerecrescens 750 0 451 Clostridium sp. ASB-410 20 0 452 Enterococcus cassaliflavus 251 0 453 Eggerthella timonensis 23 0 454 Faecalibacterium sp. CAG: 74 439 0 455 Clostridiales bacterium Marseille-P2846 187 0 456 Anaerocococcus vaginalis 30 0 457 Anaeromassilibacillus sp. An250 39 0 458 Acinetobacter sp. CIP 101934 13 0 459 Firmicutes bacterium CAG: 24 145 0 460 Firmicutes bacterium HGW-Firmicutes-16 22 0 461 Barnesiella intestinihominis 121 0 462 Enterococcus gallinarum 214 0 463 Lysinibacillus sp. FJAT-14222 245 0 464 Alistipes shahii 40 0 465 Peptoniphilus timonensis 41 0 466 Akkermansia sp. CAG: 344 85 0 467 Lagierella massiliensis 39 0 468 Acinetobacter sp. LCT-H3 26 0 469 Drancourtella massiliensis 12 0 470 Subdoligranulum sp. 4_3_54A2FAA 88 0 471 Peptoniphilus harei 30 0 472 Ruminococcus sp. CAG:9-related_41_34 11 0 473 Ruminococcus lactaris 22 0 474 Firmicutes bacterium CAG: 24053_14 48 0 475 Enterorhabdus caecimuris 28 0 476 Alistipes sp. Marseille-P2431 21 0 477 Bacteroides thetaiotaomicron CAG: 40 42 0 478 Ruminococcus flavefaciens 30 0 479 Blantis sp. Marseille-P3087 46 0 480 Oribacterium sp. P6A1 25 0 481 Clostridium sp. C105KSO15 124 0 482 Achromobacter sp. Root170 21 0 483 Clostridium sp. CAG: 264 101 0 484 Lysinibacillus sphaerieus 108 0 485 Clostridium sp. CAG: 1024 39 0 486 Urinacoccus sp. Marseille-P3926 136 0 487 Enterococcus sp. FDAARGOS_375 30 0 488 Clostridiales bacterium 81 0 489 Lysinibacillus boronitolerans 27 0 490 Collinsella bouchesdurhonensis 32 0 491 Rummeliibacillus pyenus 562 0 492 Erysipelotrichaceae bacterium NK3D112 33 0 493 Collinsella sp. 60_9 26 0 494 Alistipes obesi 352 0 495 Dialister invisus CAG: 218 290 0 496 Eubacterium sp. CAG: 161 21 0 497 Bacteroides sp. 3_1_33FAA 22 0 498 Firmicutes bacterium CAG: 110_56_8 45 0 499 uncultured Coprococcus sp. 83 0 500 Paraclostridium bifermentans 17 0 501 Monoglobus pectinilyticus 24 0 502 Oribacterium sp. NK2B42 20 0 503 Lactobacillus brevis 32 0 504 Senegalimassilia anaerobia 122 0 505 Acinetobacter baumannii 228 0 506 Clostidium sp. CAG: 567 236 0 507 Coprococcus sp. ART55/1 22 0 508 Peptoniphilus sp. HMSC075B08 105 0 509 Enterococcus pallens 17 0 510 Finegoldia magna 82 0 511 Lysinibacillus sp. FJAT-14745 97 0 512 Coprobacillus sp. 8_1_38FAA 10 0 513 Peptoniphilus sp. oral taxon 375 118 0 514 uncultured crAssphage 31 0 515 Gordonibacter massiliensis 20 0 516 Olsenella sp. An290 19 0 517 Peptoniphilus grossensis 71 0 518 Bacteroides sp. 9_1_42FAA 31 0 519 Firmicutes bacterium CAG: 176_63_11 30 0 520 Enterococcus faecalis 238 0 521 Lactobacillus plantarum 259 0 522 Lysinibacillus fusiformis 42 0 523 Eubacterium sp. 38_16 21 0 524 Peptoniphilus sp. HMSC062D09 42 0 525 Alistipes sp. AG:53 39 0 526 Bacteroidales bacterium 43_8 22 0 527 Peptoniphilus phoceensis 55 0 528 Peptoniphilus sp. BV3AC2 12 0 529 Clostridium sp. CAG: 302 267 0 530 Gordonibacter urolithinfaciens 567 0 531 Acinetobacter sp. YZS-X1-1 115 0 532 Lysinibacillus xylanilyticus 242 0 533 Acinetobacter schindleri 91 0 534 Bacteroides sp. CAG: 20 60 0 535 Clostridium sp. CAG: 269 67 0 536 Alistipes sp. cv1 20 0 537 Roseburia inulinivorans CAG: 15 111 0 538 Urmitella timonensis 24 0 539 Olsenella sp. An293 20 0 540 Eisenbergiella tayi 73 0 541 Enterococcus saccharolyticus 16 0 542 Parabacteroides goldsteinii 602 0 543 Marvinbryantia formatexigens 22 0 544 Lysinibacillus macroides 49 0 545 Bacteroides salyersiae 248 0 546 Eubacterium sp. CAG: 146 52 0 547 Peptoniphilus coxii 318 0 548 Libanicoccus massiliensis 25 0 549 Roseburia sp. CAG: 182 36 0 550 Clostridium sp. CAG: 413 26 0 555 Dorea sp. AGR2135 24 0 552 Acinetobacter lwoffii 12 0

    TABLE-US-00008 TABLE 8 Species level: Mean abundance at baseline and post-intervention in Gr. 2 (Nichi Glucan) Mean abundance Post- S. No Species Baseline Intervention 1 Faecalibacterium prausnitzii 3613 6596 2 Bifidobacterium longum 2012 1446 3 Firmicutes bacterium CAG: 124 1684 1308 4 Trichosporon asahii 1683 0 5 Bifidobacterium adolescentis 1376 931 6 Escherichia coli 1264 471 7 uncultured Clostridium sp. 1062 2726 8 Collinsella aerofaciens 1048 729 9 uncultured Blautia sp. 981 879 10 Ruminococcus sp. CAG: 177 977 565 11 Firmicutes bacterium CAG: 103 972 925 12 Bacteroides fragilis 960 1186 13 Blautia obeum 877 777 14 Gemmiger formicilis 865 1022 15 Firmicutes bacterium CAG: 170 847 989 16 Dorea longicatena 819 785 17 Firmicutes bacterium CAG: 110 787 604 18 Clostridium sp. CAG: 226 779 321 19 Clostridium sp. CAG: 138 743 528 20 uncultured Ruminococcus sp. 726 913 21 Bacteroides uniformis 707 512 22 Alistipes sp. CAG: 435 690 721 23 Hungatella hathewayi 681 171 24 Holdemanella biformis 649 546 25 Oscillibacter sp. CAG: 241 634 419 26 Firmicutes bacterium CAG: 176 617 945 27 Firmicutes bacterium CAG: 83 612 400 28 Subdoligranulum sp. 60_17 588 734 29 Pichia kudriavzevii 582 0 30 Bacteroides thetaiotaomicron 581 562 31 Prevotella copri 568 1458 32 Eubacterium sp. CAG: 202 536 0 33 Enterococcus faecium 528 0 34 Klebsiella pneumoniae 524 44 35 Rummeliibacillus pycnus 516 0 36 Senegalimassilia anaerobia 505 56 37 [Eubacterium] rectale 499 1165 38 Firmicutes bacterium CAG: 114 489 386 39 Bifidobacterium bifidum 476 418 40 Bacteroides ovatus 472 448 41 Bacteroides vulgatus 467 375 42 Blautia wexlerae 464 486 43 Lactobacillus ruminis 464 634 44 [Ruminococcus] torques 452 347 45 Fusicatenibacter saccharivorans 450 624 46 [Eubacterium] hallii 442 218 47 Olsenella umbonata 441 37 48 Desulfovibrio piger 434 303 49 Dialister sp. CAG: 486 433 447 50 uncultured Eubacterium sp. 429 294 51 Enterococcus avium 425 0 52 Faecalibacterium sp. CAG: 74 415 485 53 Bacteroides caccae 398 152 54 Oscillibacter sp. CAG: 241_62_21 392 469 55 Romboutsia timonensis 388 112 56 Eubacterium sp. CAG: 180 379 338 57 Parabacteroides merdae 377 101 58 Pediococcus pentosaceus 371 0 59 Enterococcus faecalis 362 0 60 Clostridiales bacterium Marseille-P2846 358 355 61 Clostridium sp. CAG: 221 355 326 62 Butyricicoccus sp. BB10 334 177 63 [Clostridium] celerecrescens 333 0 64 Lentisphaerae bacterium GWF2_44_16 332 307 65 [Clostridium] bolteae 331 43 66 Clostridiales bacterium 42_27 329 463 67 Prevotella sp. CAG: 279 326 754 68 Bifidobacterium sp. N5G01 325 383 69 Firmicutes bacterium CAG: 129 324 380 70 Cloacibacillus porcorum 322 248 71 Clostridium sp. CAG: 1024 319 488 72 Prevotella copri CAG: 164 318 771 73 Catenibacterium mitsuokai 312 274 74 Eggerthella lenta 309 60 75 Mycoplasma sp. CAG: 956 306 117 76 Oscillibacter sp. ER4 302 587 77 Roseburia faecis 301 662 78 Coraliomargarita sp. CAG: 312 292 338 79 Clostridiales bacterium 52_15 290 332 80 Catenibacterium sp. CAG: 290 287 180 81 Pediococcus acidilactici 282 0 82 Bacteroides dorei 281 357 83 Clostridiales bacterium 59_14 280 386 84 Firmicutes bacterium CAG: 176_63_11 280 400 85 Alistipes putredinis 278 201 86 Odoribacter splanchnicus 277 129 87 bacterium OL-1 275 15 88 Parabacteroides sp. SN4 274 249 89 [Eubacterium] eligens 273 552 90 Alistipes indistinctus 272 13 91 Alistipes obesi 272 0 92 Clostridium sp. CAG: 510 270 449 93 Dialister sp. CAG: 357 270 360 94 Faecalibacterium sp. CAG: 74_58_120 264 368 95 Lactobacillus brevis 262 0 96 Bifidobacterium ruminantium 261 257 97 Anaerostipes hadrus 260 422 98 Enterococcus casseliflavus 259 0 99 Cloacibacillus sp. An23 257 0 100 Bacteroides plebeius 250 250 101 Weissella confusa 249 12 102 Lactobacillus plantarum 249 0 103 Bacteroides sp. CAG: 545 246 379 104 Clostridium sp. CAG: 452 245 120 105 uncultured Faecalibacterium sp. 243 437 106 Collinsella sp. 4_8_47FAA 239 166 107 Firmicutes bacterium CAG: 555 237 281 108 Ruminococcus sp. CAG: 724 236 367 109 Roseburia inulinivorans 233 1197 110 Lentisphaerae bacterium GWF2_45_14 232 228 111 Bacteroides xylanisolvens 232 285 112 uncultured Butyricicoccus sp. 230 995 113 Butyricimonas virosa 230 0 114 Bacteroides intestinalis 230 135 115 Collinsella sp. CAG: 166 228 187 116 Ruminococcus sp. CAG: 488 225 211 117 Coprococcus catus 225 412 118 Klebsiella aerogenes 224 0 119 Phascolarctobacterium sp. CAG: 207 220 21 120 Acidiphilium sp. CAG: 727 219 555 121 Parabacteroides gordonii 217 0 122 [Eubacterium] siraeum 212 189 123 Adlercreutzia equolifaciens 210 334 124 Butyrivibrio sp. CAG: 318 208 0 125 Blautia sp. CAG: 37 207 203 126 Clostridium sp. CAG: 448 203 192 127 Bacteroides salyersiae 203 193 128 Coprobacillus sp. CAG: 235 197 145 129 Clostridiales bacterium 194 147 130 Bifidobacterium pseudocatenulatum 194 174 131 Collinsella sp. TF06-26 189 155 132 Alistipes sp. CAG: 53 189 180 133 Clostridium sp. CAG: 571 189 14 134 Sutterella sp. CAG: 397 188 193 135 Libanicoccus massiliensis 188 119 136 Succinatimonas sp. CAG: 777 187 376 137 Subdoligranulum variabile 187 244 138 Anaerotruncus sp. CAG: 390 185 275 139 Bifidobacterium angulatum 185 332 140 Angelakisella massiliensis 184 79 141 Alistipes senegalensis 183 57 142 Megamonas funiformis 182 175 143 Ruminococcus obeum CAG: 39 180 137 144 Acidaminococcus fermentans 180 199 145 Lactobacillus mucosae 178 0 146 Firmicutes bacterium CAG: 129_59_24 174 400 147 Chlamydia trachomatis 174 127 148 Lentisphaerae bacterium GWF2_52_8 172 173 149 Ruminococcus bromii 172 301 150 Eubacterium sp. CAG: 581 171 148 151 Clostridium sp. CAG: 433 170 8 152 Weissella cibaria 170 0 153 Methanobrevibacter smithii 161 159 154 Enterococcus gallinarum 161 0 155 Firmicutes bacterium CAG: 240 159 135 156 Clostridium sp. CAG: 302 159 20 157 Bacteroides plebeius CAG: 211 158 160 158 Firmicutes bacterium CAG: 24053_14 158 158 159 Eubacterium limosum 157 0 160 Clostridium sp. CAG: 349 157 143 161 Clostridium sp. CAG: 43 156 162 162 Parabacteroides sp. HGS0025 155 0 163 Akkermansia muciniphila 153 218 164 Clostridium sp. CAG: 245 152 15 165 Enterococcus hirae 151 0 166 Duodenibacillus massiliensis 150 181 167 Firmicutes bacterium CAG: 272 149 254 168 Coprococcus eutactus 148 100 169 Verrucomicrobia bacterium CAG: 312_58_20 148 273 170 Faecalibacterium sp. CAG: 82 147 398 171 Lysinibacillus xylanilyticus 147 0 172 Firmicutes bacterium CAG: 460 144 166 173 Peptoniphilus coxii 141 0 174 uncultured bacterium 141 176 175 Lysinibacillus sp. FJAT-14222 141 0 176 Bifidobacterium breve 139 132 177 Clostridium sp. CAG: 245_30_32 138 9 178 Clostridium sp. CAG: 451 136 30 179 Sutterella wadsworthensis 136 279 180 Parabacteroides goldsteinii 135 13 181 Streptococcus mutans 133 0 182 Roseburia hominis 132 630 183 Streptococcus salivarius 131 110 184 Alistipes sp. CAG: 514 131 147 185 Firmicutes bacterium CAG: 137 131 72 186 Roseburia sp. CAG: 18 130 229 187 Ruminococcus sp. 5_1_39BFAA 129 152 188 Clostridioides difficile 127 64 189 Flavonifractor plautii 125 221 190 Gordonibacter urolithinfaciens 125 0 191 Firmicutes bacterium CAG: 110_56_8 123 87 192 Pyramidobacter sp. C12-8 122 0 193 Ruminococcus sp. CAG: 17 122 151 194 Bifidobacterium sp. N4G05 119 125 195 Streptococcus thermophilus 118 0 196 Clostridium sp. CAG: 568 117 204 197 Blautia sp. KLE 1732 115 51 198 Parabacteroides merdae CAG: 48 114 30 199 Dorea formicigenerans 114 119 200 Barnesiella intestinihominis 112 77 201 [Clostridium] clostridioforme 111 124 202 Intestinimonas butyriciproducens 110 124 203 Olsenella scatoligenes 107 13 204 Clostridium sp. CAG: 413 107 472 205 uncultured Flavonifractor sp. 105 138 206 Clostridium sp. CAG: 343 104 0 207 Alistipes shahii 104 102 208 Pyramidobacter piscolens 103 0 209 Firmicutes bacterium CAG: 238 103 75 210 Collinsella sp. CAG: 289 102 0 211 Bacteroides caccae CAG: 21 102 107 212 Acinetobacter baumannii 101 0 213 Lentisphaerae bacterium GWF2_50_93 100 109 214 Bacteroides sp. 2_2 4 97 83 215 Eubacterium sp. CAG: 841 93 105 216 Ruminococcus sp. CAG: 382 93 170 217 Firmicutes bacterium CAG: 270 92 45 218 Olsenella sp. kh2p3 90 13 219 Phascolarctobacterium succinatutens 90 420 220 Lactobacillus fermentum 90 0 221 Mycoplasma sp. CAG: 877 89 41 222 Bacteroides intestinalis CAG: 564 87 60 223 Oxalobacter formigenes 87 0 224 Eisenbergiella tayi 86 99 225 Parabacteroides distasonis 86 157 226 Lentisphaerae bacterium GWF2_49_21 84 96 227 Dorea longicatena CAG: 42 84 83 228 Ruminococcus sp. CAG: 563 83 191 229 Olsenella sp. KH3B4 83 16 230 Lactobacillus ruminis CAG: 367 82 106 231 Blautia sp. CAG: 37_48_57 82 140 232 Alistipes sp. 56_sp_Nov_56_25 82 62 233 Enterococcus thailandicus 80 0 234 Alistipes sp. HGB5 80 0 235 Blautia sp. CAG: 237 78 207 236 Bacteroides stercoris 77 19 237 Firmicutes bacterium HGW-Firmicutes-9 75 94 238 Clostridium sp. CAG: 1193 75 125 239 Roseburia sp. CAG: 18_43_25 75 173 240 Firmicutes bacterium HGW-Firmicutes-16 74 73 241 Oscillibacter sp. 57_20 74 403 242 Olsenella provencensis 74 7 243 Olsenella sp. An188 74 0 244 Anaerotruncus colihominis 73 71 245 Clostridium sp. CAG: 524 73 71 246 Bacteroides coprocola CAG: 162 72 79 247 Firmicutes bacterium CAG: 41 72 310 248 Coprococcus comes 71 125 249 Ruminococcus sp. CAG: 90 71 9 250 Clostridium sp. CAG: 492 70 0 251 Pygmaiobacter massiliensis 69 0 252 Lysinibacillus sphaericus 69 0 253 Roseburia intestinalis 69 1218 254 Ruminococcus flavefaciens 69 267 255 uncultured Coprococcus sp. 68 22 256 Lactococcus lactis 68 0 257 uncultured Oscillibacter sp. 66 87 258 Gordonibacter pamelaeae 65 0 259 Bacteroides eggerthii 64 0 260 Bifidobacterium kashiwanohense 64 82 261 Clostridiales bacterium 41_12_two_minus 63 195 262 Collinsella sp. 60_9 63 17 263 Allisonella histaminiformans 62 54 264 Megasphaera elsdenii 61 262 265 Lysinibacillus sp. FJAT-14745 61 0 266 Ruminococcus sp. CAG: 9 60 59 267 Urinacoccus sp. Marseille-P3926 60 0 268 Bacteroides coprocola 60 99 269 Olsenella sp. An285 59 0 270 Acinetobacter sp. NIPH 2171 59 0 271 Clostridium sp. CAG: 7 59 396 272 Bifidobacterium catenulatum 58 75 273 Olsenella sp. An290 58 0 274 Eubacterium hallii CAG: 12 57 41 275 Streptococcus pneumoniae 57 8 276 Collinsella sp. MSS 56 0 277 Eggerthella sp. CAG: 209 56 0 278 Bacteroides sp. CAG: 20 56 37 279 Clostridium sp. C105KSO15 55 0 280 Bacteroides sp. CAG: 189 55 36 281 Clostridium sp. CAG: 594 55 0 282 Bacteroides sp. AR29 55 0 283 Subdoligranulum sp. 4_3_54A2FAA 54 65 284 Ruminococcus bicirculans 54 172 285 Oscillibacter sp. 1-3 53 70 286 Blautia sp. Marseille-P3087 53 39 287 Turicibacter sanguinis 52 26 288 Peptoniphilus sp. oral taxon 375 52 0 289 Olsenella sp. An293 52 0 290 Bacteroides intestinalis CAG: 315 51 32 291 Acinetobacter sp. YZS-X1-1 51 0 292 Ruthenibacterium lactatiformans 51 69 293 Coprococcus eutactus CAG: 665 51 0 294 Firmicutes bacterium CAG: 321 51 69 295 Bacteroides sp. D20 50 32 296 Clostridium sp. CAG: 264 50 38 297 Blautia producta 49 0 298 Firmicutes bacterium CAG: 176_59_8 49 90 299 Bacteroides sp. 1_1_14 48 18 300 Erysipelotrichaceae bacterium 6_1_45 48 0 301 Peptoniphilus sp. HMSC075B08 47 0 302 Selenomonas bovis 47 168 303 Bacteroides sp. 4_1_36 45 27 304 Slackia piriformis 44 0 305 Enterobacter cloacae 44 0 306 [Clostridium] citroniae 43 0 307 Ruminococcus sp. CAG: 254 43 486 308 Alistipes finegoldii 43 143 309 Haemophilus parainfluenzae 43 87 310 Alistipes onderdonkii 42 14 311 Actinomyces sp. HPA0247 42 0 312 Roseburia sp. CAG: 182 42 317 313 Parabacteroides sp. merdae-related_45_40 41 10 314 butyrate-producing bacterium SS3/4 41 248 315 Collinsella vaginalis 41 8 316 Faecalibacterium sp. CAG: 82-related_59_9 41 99 317 Acinetobacter schindleri 40 0 318 Bacteroides oleiciplenus 40 55 319 Megamonas rupellensis 40 35 320 Blautia sp. Marseille-P2398 40 44 321 Clostridium sp. CAG: 81 40 238 322 Comamonas kerstersii 40 0 323 Eggerthella sp. 1_3_56FAA 39 0 324 Enterobacter hormaechei 39 0 325 Rummeliibacillus stabekisii 39 0 326 Acinetobacter bereziniae 39 0 327 Lactobacillus pentosus 39 0 328 Eubacterium eligens CAG: 72 39 102 329 Oscillibacter valericigenes 38 58 330 Bacteroides nordii 38 0 331 Clostridium sp. CAG: 127 37 628 332 Eggerthella sp. HGA1 37 0 333 [Ruminococcus] gnavus 37 96 334 Ruminococcus sp. CAG: 108 37 100 335 Olsenella mediterranea 37 0 336 Oscillibacter sp. PC13 37 56 337 Subdoligranulum sp. CAG: 314 37 36 338 Oscillibacter ruminantium 37 68 339 Roseburia inulinivorans CAG: 15 37 161 340 Finegoldia magna 36 0 341 Bacteroides sp. 3_1_23 36 42 342 Peptococcus niger 35 0 343 Bacteroides sp. HPS0048 35 0 344 Oribacterium sp. WCC10 35 15 345 Firmicutes bacterium CAG: 552_39_19 34 68 346 Paraprevotella clara CAG: 116 34 0 347 Clostridiales bacterium 41_21_two_genomes 34 338 348 Prevotella sp. CAG: 604 34 247 349 Intestinimonas massiliensis 34 34 350 Clostridium sp. L2-50 34 123 351 Clostridium sp. CAG: 1000 34 0 352 Firmicutes bacterium CAG: 24 33 9 353 Enterococcus sp. FDAARGOS_375 33 0 354 Prevotella sp. CAG: 891 33 34 355 Parabacteroides sp. D13 33 60 356 Enterococcus sp. HMSC05C03 33 0 357 Eubacterium siraeum CAG: 80 33 39 358 Megasphaera sp. BL7 33 74 359 Bacteroides sp. D22 33 41 360 Lysinibacillus macroides 32 0 361 Klebsiella sp. MS 92-3 32 0 362 Sporobacter termitidis 32 36 363 Acinetobacter sp. NIPH 899 32 0 364 Pseudoflavonifractor capillosus 31 31 365 Lysinibacillus fusiformis 31 0 366 Peptoniphilus grossensis 31 0 367 Firmicutes bacterium CAG: 102 31 206 368 Ruminococcus albus 31 33 369 Cutaneotrichosporon oleaginosum 31 0 370 Firmicutes bacterium HGW-Firmicutes-21 31 0 371 Marvinbryantia formatexigens 31 28 372 Collinsella bouchesdurhonensis 31 0 373 Acidovorax sp. 12322-1 31 0 374 Firmicutes bacterium CAG: 321_26_22 31 51 375 Corallococcus sp. CAG: 1435 30 143 376 Bacteroides sp. 3_1_40A 30 17 377 Ruminococcaceae bacterium D5 30 31 378 Bacteroidales bacterium 43_8 30 0 379 Anaerotruncus rubiinfantis 30 14 380 Ruminococcus champanellensis 30 57 381 Clostridium sp. CAG: 349_48_7 30 25 382 Eubacterium rectale CAG: 36 29 95 383 Clostridium sp. CAG: 91 29 107 384 Butyricimonas sp. An62 29 0 385 Clostridiales bacterium GWF2_36_10 29 0 386 Alistipes finegoldii CAG: 68 29 0 387 Flavonifractor sp. An10 28 30 388 Lactobacillus salivarius 28 0 389 Butyricimonas synergistica 28 0 390 Firmicutes bacterium CAG: 65 28 160 391 Prevotella sp. CAG: 5226 28 188 392 Romboutsia ilealis 27 8 393 Eubacterium sp. CAG: 146 27 27 394 Clostridium sp. CAG: 609 27 19 395 Blautia schinkii 27 0 396 Methanosphaera stadtmanae 27 0 397 Alistipes timonensis 26 0 398 Lysinibacillus sp. ZYM-1 26 0 399 Lachnospiraceae bacterium JC7 26 17 400 Bacteroides sp. CAG: 709 26 140 401 Terrisporobacter glycolicus 26 0 402 Bacteroides sp. 3_1_19 25 22 403 bacterium LF-3 25 20 404 Bacteroides stercorirosoris 24 31 405 Peptoniphilus phoceensis 24 0 406 Oribacterium sp. P6A1 24 0 407 Prevotellamassilia timonensis 24 158 408 Ruminococcus faecis 24 10 409 Anaerofilum sp. An201 24 35 410 Dorea sp. 42_8 24 17 411 Eubacterium sp. CAG: 251 24 290 412 Clostridium sp. CAG: 389 23 45 413 Blautia sp. SF-50 23 9 414 Eubacterium sp. CAG: 76 23 76 415 Clostridiales bacterium NK3B98 23 33 416 Firmicutes bacterium ASF500 23 46 417 Bacteroides bouchesdurhonensis 23 0 418 Eubacterium sp. 38_16 22 22 419 Clostridium sp. HGF2 22 0 420 Bacteroides sp. 9_1_42FAA 22 16 421 Mitsuokella jalaludinii 22 280 422 Paraprevotella clara 22 0 423 Blautia massiliensis 22 7 424 Coriobacteriaceae bacterium 68-1-3 22 0 425 Bacteroides sp. 43_108 22 22 426 Olsenella sp. An270 22 0 427 Isoptericola variabilis 22 0 428 Clostridium sp. KNHs209 21 13 429 Streptococcus parasanguinis 21 61 430 Gordonibacter massiliensis 21 0 431 Bilophila wadsworthia 21 436 432 uncultured Bacteroides sp. 21 46 433 Firmicutes bacterium CAG: 552 21 31 434 Clostridium sp. SS2/1 21 60 435 Parabacteroides johnsonii 21 8 436 Flavonifractor sp. An100 20 50 437 Propionibacterium acidifaciens 20 0 438 Clostridium sp. CAG: 914 20 29 439 Clostridium sp. 26_22 20 0 440 Bacteroides cellulosilyticus 20 82 441 Ruminococcaceae bacterium D16 20 163 442 Butyricicoccus pullicaecorum 20 30 443 Actinomyces sp. ICM47 20 0 444 Olsenella sp. Marseille-P2300 20 0 445 Collinsella tanakaei 20 15 446 Gemmiger sp. An120 19 39 447 Pseudoflavonifractor sp. An184 19 35 448 Peptoniphilus sp. HMSC062D09 19 0 449 Bacteroides sp. 3_1_13 19 36 450 Flavonifractor sp. An306 19 32 451 Firmicutes bacterium CAG: 145 19 15 452 Peptoniphilus timonensis 18 0 453 Eubacterium ventriosum 18 70 454 Clostridiales bacterium 43-6 18 0 455 Cloacibacillus evryensis 18 0 456 Akkermansia muciniphila CAG: 154 18 13 457 Oribacterium sp. C9 18 0 458 Olsenella uli 18 11 459 Prevotella sp. CAG: 1092 17 299 460 Slackia heliotrinireducens 17 0 461 Lagierella massiliensis 17 0 462 Firmicutes bacterium CAG: 194 17 14 463 Lachnospiraceae bacterium 28-4 17 0 464 Oribacterium sp. NK2B42 17 0 465 Bacteroides eggerthii CAG: 109 17 0 466 Eggerthella timonensis 17 0 467 Clostridium sp. CAG: 762 17 79 468 Brachyspira sp. CAG: 484 17 91 469 methanogenic archaeon mixed culture ISO4-G1 17 38 470 Eggerthella sp. 51_9 17 0 471 Ruminococcus sp. CAG: 379 17 27 472 Bacteroides timonensis 17 98 473 Oscillibacter sp. CAG: 155 17 36 474 Peptoniphilus senegalensis 17 0 475 Lachnospira pectinoschiza 16 117 476 Firmicutes bacterium CAG: 95 16 197 477 Megamonas sp. Calf98-2 16 10 478 Massilimaliae massiliensis 16 14 479 Anaeromassilibacillus sp. An200 16 17 480 Odoribacter sp. 43_10 16 0 481 Bacteroides mediterraneensis 16 11 482 Bacteroides dorei CAG: 222 16 7 483 Bacteroides sp. 4_3_47FAA 16 13 484 Firmicutes bacterium CAG: 534 16 314 485 Ruminococcaceae bacterium FB2012 16 0 486 Clostridium disporicum 16 0 487 Neglecta timonensis 16 13 488 Bacteroides uniformis CAG: 3 15 9 489 Clostridium bolteae CAG: 59 15 0 490 Agathobaculum desmolans 15 61 491 Bacteroides sartorii 15 5 492 Bacteroides sp. D2 15 63 493 Lachnoclostridium sp. An196 15 151 494 Acidaminococcus massiliensis 15 0 495 Raoultibacter massiliensis 15 0 496 Clostridium sp. SN20 15 0 497 Eggerthella sp. YY7918 15 0 498 Bacteroides sp. 43_46 15 0 499 Lachnospiraceae bacterium 7_1_58FAA 15 25 500 Eggerthellaceae bacterium AT8 15 0 501 Alistipes sp. AL-1 15 10 502 Ruminococcus sp. SR1/5 15 0 503 Bacteroides fragilis CAG: 558 15 0 504 [Clostridium] thermosuccinogenes 14 0 505 Hydrogenoanaerobacterium saccharovorans 14 14 506 Alistipes sp. 58_9_plus 14 0 507 Eubacterium sp. CAG: 86 14 92 508 Faecalibacterium sp. CAG: 1138 14 29 509 Actinomyces oris 14 0 510 Dorea sp. CAG: 105 14 0 511 Eubacteriaceae bacterium CHKC1005 14 17 512 Succinivibrio dextrinosolvens 14 32 513 Lactococcus garvieae 14 0 514 Bacteroides sp. 1_1_30 14 33 515 [Clostridium] asparagiforme 14 9 516 Ruminococcus sp. CAG: 9-related 41_34 14 13 517 Enterococcus sp. HMSC072H05 14 0 518 Firmicutes bacterium CAG: 475 14 39 519 Clostridium sp. CAG: 440 14 0 520 Coprobacillus sp. 8_1_38FAA 14 35 521 Alloprevotella rava 14 14 522 Collinsella ihuae 13 0 523 Coprobacillus sp. CAG: 235_29_27 13 0 524 Megasphaera sp. NM10 13 39 525 Enterorhabdus caecimuris 13 21 526 Peptoniphilus harei 13 0 527 Prevotella sp. CAG: 755 13 13 528 Ruminococcus sp. CAG: 579 13 0 529 Paraprevotella xylaniphila 13 0 530 Enterococcus sp. 5B7_DIV0075 12 0 531 Tyzzerella nexilis 12 81 532 Ruminococcus sp. CAG: 57 12 36 533 Parabacteroides sp. Marseille-P3763 12 0 534 Raoultibacter timonensis 12 0 535 Bacteroides thetaiotaomicron CAG: 40 12 0 536 Clostridiales bacterium SK-Y3 12 0 537 Eubacterium sp. 41_20 12 62 538 Mobilibacterium timonense 12 0 539 Arabia massiliensis 12 0 540 Bacteroides vulgatus CAG: 6 12 7 541 Lysinibacillus boronitolerans 12 0 542 Ruminococcus sp. CAG: 108-related_41_35 11 50 543 Acinetobacter sp. LCT-H3 11 0 544 Odoribacter splanchnicus CAG: 14 11 0 545 Synergistes jonesii 11 0 546 Olsenella profusa 11 6 547 Synergistes sp. 3_1_syn1 11 0 548 Bilophila sp. 4_1_30 11 78 549 Clostridium sp. CAG: 798 11 61 550 Bacteroides sp. 2_1_33B 11 0 551 Prevotella sp. 885 11 146 552 Intestinibacter bartlettii 11 13 553 Enterorhabdus mucosicola 10 11 554 Bacteroides cellulosilyticus CAG: 158 10 30 555 Enterococcus sp. 3H8_DIV0648 10 0 556 Clostridium sp. CAG: 269 10 115 557 Candida parapsilosis 10 0 558 Clostridium nexile CAG: 348 10 74 559 Weissella sp. DD23 10 0 560 Actinomyces dentalis 9 0 561 uncultured crAssphage 9 9 562 Tissierellia bacterium SS-A11 9 0 563 Clostridium sp. ASBs410 9 0 564 Roseburia sp. CAG: 471 9 119 565 Paeniclostridium sordellii 9 0 566 Collinsella stercoris 9 0 567 Bacteroides coprophilus 9 8 568 Bacteroides sp. 3_1_33FAA 9 17 569 Enterococcus gilvus 9 0 570 Acidaminococcus sp. CAG: 542 8 0 571 Alistipes sp. CAG: 29 8 30 572 Prevotella sp. CAG: 617 8 8 573 Leuconostoc lactis 8 0 574 Collinsella sp. An2 8 0 575 Actinomyces sp. oral taxon 175 8 0 576 Clostridiales bacterium VE202-21 8 0 577 Listeria monocytogenes 8 0 578 Clostridium sp. 7_2_43FAA 8 0 579 Paraclostridium bifermentans 8 0 580 Enterococcus pallens 8 0 581 [Desulfotomaculum] guttoideum 7 0 582 Anaerococcus prevotii 7 0 583 Actinomyces viscosus 7 0 584 Bacteroides finegoldii 7 33 585 Clostridium celatum 7 0 586 Bacteroides stercoris CAG: 120 7 0 587 Enterococcus saccharolyticus 7 0 588 Enterococcus malodoratus 7 0 589 Clostridium sp. CAG: 470 7 10 590 Actinomyces odontolyticus 7 0 591 Peptoniphilus duerdenii 7 0 592 Actinomyces sp. ICM58 7 0 593 Ruminococcus sp. 37_24 7 0 594 Alistipes putredinis CAG: 67 7 9 595 Fusobacterium mortiferum 7 0 596 Collinsella phocaeensis 7 0 597 Dialister succinatiphilus 7 196 598 Enterococcus sp. kppr-6 6 0 599 Eubacterium callanderi 6 0 600 Sutterella wadsworthensis CAG: 135 6 18 601 Clostridiales bacterium 36_14 6 52 602 Prevotella lascolaii 6 11 603 Collinsella intestinalis 6 0 604 Lachnospiraceae bacterium 5_1_63FAA 6 33 605 Actinomyces sp. ICM39 6 0 606 Acinetobacter sp. CIP 101934 6 0 607 Acinetobacter lwoffii 5 0 608 Peptoniphilus sp. BV3AC2 5 0 609 Bifidobacterium bifidum CAG: 234 5 0 610 Bifidobacterium pseudocatenulatum CAG: 263 5 0 611 Lactobacillus rhamnosus 5 0 612 Prevotella sp. CAG: 732 5 65 613 Megamonas funiformis CAG: 377 5 0 614 Megamonas hypermegale 4 124 615 Eubacterium sp. CAG76_36_ 125 4 30 616 Bifidobacterium adolescentis CAG: 119 4 18 617 Roseburia sp. CAG: 197 0 47 618 Bacteroides sp. CAG: 98 0 41 619 Parasutterella excrementihominis CAG: 233 0 48 620 Clostridium sp. CAG: 122 0 98 621 Firmicutes bacterium CAG: 313 0 124 622 Clostridiales bacterium KLE1615 0 301 623 Elusimicrobium sp. An273 0 124 624 Bifidobacterium dentium 0 5 625 Clostridia bacterium UC5.1-1D1 0 8 626 Tyzzerella sp. Marseille-P3062 0 35 627 Acidaminococcus intestini 0 7 628 Prevotella sp. CAG: 386 0 64 629 uncultured Lachnospira sp. 0 248 630 Clostridium sp. M62/1 0 10 631 Sellimonas intestinalis 0 23 632 Clostridium sp. CAG: 780 0 114 633 Clostridium sp. AT4 0 26 634 Roseburia sp. CAG: 380 0 16 635 Ruminococcus sp. CAG: 330 0 23 636 Clostridium sp. CAG: 575 0 4 637 Clostridium sp. CAG: 62 0 74 638 Lachnospiraceae bacterium 8_1_57FAA 0 11 639 Eubacterium sp. CAG: 603 0 22 640 Ruminococcaceae bacterium cv2 0 15 641 Akkermansia sp. CAG: 344 0 58 642 Clostridium sp. 44_14 0 54 643 Clostridium sp. CAG: 628 0 107 644 Ruminococcus sp. CAG: 624 0 32 645 Roseburia sp. CAG: 303 0 451 646 Lactobacillus rogosae 0 33 647 Roseburia sp. CAG: 309 0 25 648 Acholeplasma sp. CAG: 878 0 115 649 Shigella sonnei 0 35 650 Megasphaera elsdenii CAG: 570 0 7 651 Fusobacterium sp. CAG: 439 0 8 652 Bifidobacterium pseudolongum 0 9 653 Bacteroides sp. CAG: 770 0 38 654 Bacteroides sp. 14(A) 0 11 655 Anaerovorax odorimutans 0 15 656 Bifidobacterium merycicum 0 7 657 Ruminococcus callidus 0 268 658 Eubacterium sp. CAG: 252 0 27 659 Clostridium sp. CAG: 253 0 42 660 Clostridium sp. ATCC BAA-442 0 20 661 Coprobacillus sp. 28_7 0 21 662 Clostridium sp. SCN 57-10 0 40 663 Ruminococcus sp. CAG: 403 0 7 664 Clostridium sp. 42_12 0 14 665 Firmicutes bacterium CAG: 65_45_313 0 108 666 Lachnospiraceae bacterium CAG: 25 0 8 667 Sutterella parvirubra 0 15 668 Eubacterium sp. 45_250 0 17 669 Firmicutes bacterium CAG: 272_52_7 0 26 670 Clostridium sp. 29_15 0 18 671 Veillonella dispar 0 94 672 Bacteroides sp. CAG: 530 0 145 673 Flavonifractor sp. An82 0 15 674 Firmicutes bacterium CAG: 449 0 81 675 Eubacterium ramulus 0 27 676 Clostridium sp. CAG: 75 0 26 677 Shigella flexneri 0 10 678 Coprococcus comes CAG: 19 0 9 679 Firmicutes bacterium CAG: 341 0 52 680 Candidatus Gastranaerophilales bacterium HUM_1 0 102 681 Clostridium sp. CAG: 813 0 49 682 Proteobacteria bacterium CAG: 495 0 31 683 Coprobacillus sp. CAG: 698 0 130 684 Prevotella stercorea 0 117 685 Gemmiger sp. An50 0 16 686 Clostridium sp. 26_21 0 12 687 Clostridium sp. CAG: 217 0 20 688 Butyrivibrio crossotus 0 11 689 Coprococcus sp. CAG: 782 0 11 690 Prevotella sp. P3-122 0 18 691 Blautia sp. CAG: 52 0 31 692 uncultured organism 0 7 693 Roseburia sp. 499 0 46 694 Clostridium sp. CAG: 277 0 170 695 Mitsuokella multacida 0 126 696 Azospirillum sp. 51_20 0 8 697 Ruminococcus sp. DSM 100440 0 37 698 Clostridium sp. CAG: 62_40_43 0 30 699 Butyrivibrio crossotus CAG: 259 0 10 700 Azospirillum sp. CAG: 239 0 82 701 Prevotella sp. CAG: 520 0 540 702 Lachnospiraceae bacterium TF01-11 0 111 703 Burkholderiales bacterium 1_1_47 0 118 704 Bacteroides massiliensis 0 134 705 Eubacterium sp. CAG: 248 0 294 706 Clostridiales bacterium VE202-14 0 17 707 Eubacterium sp. 36_13 0 36 708 Veillonella atypica 0 41 709 Sutterella sp. 54_7 0 5 710 Dakarella massiliensis 0 64 711 Clostridium ventriculi 0 119 712 Sutterella sp. CAG: 351 0 44 713 Bacteroides acidifaciens 0 9 714 Lachnospiraceae bacterium KHCPX20 0 7 715 Roseburia sp. CAG: 10041_57 0 38 716 Veillonella sp. DORA_A_3_16_22 0 33 717 Selenomonas ruminantium 0 6 718 Emergencia timonensis 0 14 719 Roseburia sp. CAG: 45 0 62 720 Azospirillum sp. 47_25 0 8 721 Fournierella massiliensis 0 23 722 Tenericutes bacterium HGW-Tenericutes-4 0 16 723 Blastocystis sp. subtype 1 0 33 724 Prevotella bryantii 0 8 725 Roseburia sp. 831b 0 46 726 Bacteroides sp. CAG: 754 0 25 727 Roseburia sp. 40_7 0 11 728 Roseburia sp. CAG: 100 0 70 729 Bacteroides congonensis 0 14 730 Clostridium sp. CAG: 12237_41 0 36 731 Lachnospiraceae bacterium 10-1 0 20 732 Eubacterium sp. CAG: 38 0 452 733 Azospirillum sp. CAG: 260 0 16 734 Bacteroides ovatus CAG: 22 0 36 735 Firmicutes bacterium CAG 194_44_15 0 7 736 Veillonella parvula 0 14 737 Clostridium sp. CAG: 265 0 41 738 Coprococcus sp. ART55/1 0 9 739 Parasutterella excrementihominis 0 63 740 Roseburia intestinalis CAG: 13 0 190 741 Roseburia sp. CAG: 50 0 13 742 uncultured Roseburia sp. 0 36 743 Akkermansia glycaniphila 0 18 744 Mycoplasma sp. CAG: 611 0 61 745 Eggerthella sp. CAG: 298 0 43 746 Clostridium sp. CAG: 632 0 226 747 Prevotella ruminicola 0 7 748 Drancourtella massiliensis 0 18 749 Lachnoclostridium sp. An14 0 19 750 Eubacterium sp. CAG: 115 0 14 751 Bacteroides sp. CAG: 1076 0 4 752 Coprococcus sp. CAG: 131 0 26 753 Veillonella sp. oral taxon 158 0 12 754 Phascolarctobacterium sp. CAG: 266 0 14 755 Lachnoclostridium edouardi 0 11 756 Prevotella stercorea CAG: 629 0 24 757 Alloprevotella tannerae 0 7 758 Olsenella sp. oral taxon 807 0 8

    TABLE-US-00009 TABLE 9 PostIntervention Control vs PostIntervention Treatment Seed Average Values Post Post Baseline Intervention Baseline Intervention Control Control Increase/ Treatment Treatment Increase/ IDs Average Average Difference Decrease Average Average Difference Decrease Carbohydrates text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Ctext missing or illegible when filed , Vitamins, text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Increase text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Prosthetic Groups, Pigments Amino Acids and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Derivatives Protein Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Increase text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Cell Wall and Capsule text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Fatty Acids, Lipids, text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease and text missing or illegible when filed text missing or illegible when filed and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Respiration text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Stress Response text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Metabotext missing or illegible when filed damage and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed repair or mitigation text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Phosphorus Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Regulation and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Cell Signaling Cell Division and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Cell Cycle text missing or illegible when filed acquisition and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Increase text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease metabolism Potassium metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Sulfur Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Virulence, Disease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease and Defense Phages, Prophages, text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Transposable elements, Plasmids Metabolism of Aromatic text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Compounds Mtext missing or illegible when filed and Chetext missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Increase text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Thiamin text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Increase text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Nitrogen Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Predictions based on text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease plant-prokaryote comparative analysis Mitotext missing or illegible when filed electron text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease transport system in plants text missing or illegible when filed and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed lation text missing or illegible when filed sugars text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Secondary Metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Plant Gluctext missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Transcriptional text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease regulation Phages, Prophages, text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Transposable elements Plant cell walls and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed surfaces Central metabolism text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Increase text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Autotrophy text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease Atext missing or illegible when filed Sensor and text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease transport module Polyamines text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed Stress Response text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease and Stationary Phase Response text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed text missing or illegible when filed text missing or illegible when filed Decrease text missing or illegible when filed electron transport system text missing or illegible when filed indicates data missing or illegible when filed

    Discussion:

    [0177] In this study, following earlier reports of clinical improvement in terms of sleep (Raghavan et al., 2021.sup.a), behavioural pattern (Raghavan et al., 2021.sup.b), plasma Syn (Raghavan et al., 2021a) and serum melatonin increase (Raghavan et al., 2021.sup.b), gut dysbiosis has been shown to have a strong correlation with the severity of symptoms in ASD (Grimaldi et al., 2018). We evaluated and compared the gut microbiota of the subjects who were supplemented with AFO-202-derived 1,3-1,6 beta glucan with those who did not take the supplement.

    [0178] Several studies have reported the differences in the gut microbiota between children with ASD and neurotypical children. Reduced number of bifidobacterial and increased Clostridium spp., Desulfovibrio spp., Sutterella spp., and/or Veillonellacea was reported by Souza et al (2012). Tomova et al (2015) reported a change in Bacteroidetes/Firmicutes ratio and an increase in bifidobacterial numbers after probiotic administration.

    [0179] An exclusion diet and a 6-week prebiotic intervention demonstrated lower abundance of Bifidobacterium spp. and Veillonellaceae family and higher abundance of Faecalibacterium prausnitzii and Bacteroides spp. (Grimaldi et al., 2018). Faecalibacterium, Ruminococcus, and Bifidobacterium were relatively less abundant, whereas Caloramator, Sarcina, Sutterella ceae, and Enterobacteriaceae were more abundant in children with ASD (De Angelis et al., 2013). In addition, lower abundances of the genera Prevotella, Coprococcus, and unclassified Veillonellaceae have been reported (Kang et al., 2013). Among these bacteria, increased Bacteroidaceae, Prevotellaceae, and Ruminococcaceae and decreased Prevotella copri, Faecalibacterium prausnitzii, and Haemophilus parainfluenzae have been reported (Kang et al., 2018; Oh et al., 2020).

    [0180] In the present study, in line with these reports, the shift of the gut microbiome was towards a beneficial spectrum in Group 2 (Nichi Glucan) because there was a decrease in Enterobacter, Lactobacillus, Escherichia coli, Akkermansia muciniphila CAG:154, Blautia spp., Coprobacillus sp., several clostridium spp., and Clostridium bolteae CAG:59, with an increase in the abundance of Bacteroides, Prevotella, Faecalibacterium prausnitzii, and Prevotella copri. Desulfovibrio Bacteria which have been reported to be associated with PD (Murros et al., 2021) decreased in the Gr. 2.

    [0181] In particular, Enterobacteria and E. coli significantly decreased in Group 2 compared to Group 1 after the intervention. Gram-negative enteric bacteria such as the Enterobacter and E. coli secrete the amyloid curli that constitutes 85% of the extracellular matrix of enteric biofilms. The curli has similarities and associations with pathological and immunomodulatory human amyloids such as amyloid-3 implicated in AD, Syn involved in ASD and PD, and serum amyloid A associated with neuroinflammation (Miller et al., 2021). Curli causes misfolding (Al-Mazidi et al., 2021) and accumulation of the neuronal protein Syn in the form of insoluble amyloid aggregations, leading to inflammation and neuronal dysfunction that is central to pathogenesis of Lewy-body-associated synucleinopathies, including PD and AD.

    [0182] Curli-producing bacteria also increase the production and aggregation of the amyloid protein Syn, which has been shown to propagate in a prion-like fashion from the gut to the brain via the vagus nerve and/or spinal cord, thus culminating in the neurological disorders such as ASD (Al-Mazidi et al., 2021). In this study, the significant decrease in Enterobacter and E-coli will thus be of benefit in these synculeopathies. Before the start of this study, the objective to study Syn was to understand the effects of the beta glucan supplementation on Synaptic imbalance in presynaptic terminals, observed in ASD.

    [0183] The study results showed that plasma levels of Syn increased in Group 2 compared with Group 1 along with improvement in Childhood Autism Rating Scale score and sleep pattern which to our knowledge is the first of its kind intervention producing an observable change in the plasma synuclein levels (Al-Mazidi et al., 2021).

    [0184] In a study by Ding et al., it was reported that 14 functional properties displayed differences between the ASD and healthy control groups. Four functions, including galactose metabolism, glycosyltransferase activity, glutathione metabolism, and antifolate resistance, were enriched in the ASD group. In another study by Lindefeldt et al, the relative abundance of 26 metabolic pathways was diminished after 3 months on a ketogenic diet in children with epilepsy and 3 became more relative abundant.

    [0185] The group with most pathways changed was carbohydrate metabolism, showing reduction of fructooligosaccharides (FOS) and raffinose utilization, sucrose utilization, glycogen metabolism, lacto-N-biose I and galacto-N-biose metabolic pathway. The SEED average findings of the present study also reflect this beneficial outcome (FIG. 21 and Table 9)

    [0186] The study of the gut microbiome has offered further new insights wherein Enterobacter increasing curli protein and Syn deposition in the enteric nervous system having been controlled by the beta glucan food supplement, the increase in plasma Syn levels point out to the disintegration of the amyloid deposits leading to these Syn entering the blood stream. Indeed, natural killer (NK) cells have been shown to act as efficient scavengers of abnormal -Syn aggregates (Earls et al., 2020), and the AFO-202 beta glucan has a proven capability to increase and activate NK cells (Ikewaki et al., 2007), which could be another probable mechanism contributing to the increased Syn levels in the plasma, apart from positive clinical outcomes in these children with ASD.

    [0187] This result highlights NK cell's potential as a promising therapeutic strategy for prophylaxis and prevention of brain disorders, and they are likely to be used for such Syn accumulation and propagation, after relevant research on their specific pathways and variations in their capability. The NK cells have been proven to clear the amyloid deposits peripherally though not macrophages (Raghavan et al., 2021.sup.c). In the central nervous system, such a role is played by the microglia (Bartels et al., 2020). eta-glucans also rejuvenate microglia (Luna et al., 2015) that have been shown to scavenge amyloid deposits in the brain and CNS (Morato Torres et al., 2020), thus proving to be a wholesome therapeutic strategy for neurodevelopmental and neurodegenerative diseases.

    [0188] Altered -Syn protein misfolding spreading to anatomically connected regions in a prion-like manner and mediating neurodegenerative diseases such as PD (Terajima et al., 2020) and the increased risk of children with ASD in developing PD at a later stage (Swirski et al., 2014) suggests further research into these converging pathogenic pathways of neurodevelopmental and neurodegenerative diseases is needed as well as suggests that this safety-proven food supplement is a preventive strategy in subjects with ASD against PD.

    [0189] Other than research into normal and abnormal -syn being warranted, studying the implications of soluble and insoluble -syn (Boziki et al., 2020) is important because the proportion of insoluble -syn that was phosphorylated at Ser129 was reported to be significantly higher in brain tissue from PD patients. In addition, cell lines such as the SH-SYHY neuroblastoma (Boziki et al., 2020) will reveal the correlation of the various -syn with the severity of symptoms and pathogenesis in these neurodegenerative diseases, apart from helping to develop novel disease-modifying strategies employing such simple nutritional supplementation.

    [0190] The microbiota reconstituted in a beneficial manner in the present study with AFO-202 beta glucan must be further progressed into research to study the effects of other variants of A. pullulans beta glucan that have been shown to be anti-inflammatory. Such research could lead to mechanistic insight into the molecular pathways from the local immune responses in the gut leading to systemic inflammation and, eventually, to organ-specific autoimmunity of the CS in neuroinflammatory conditions such as MS.

    Conclusion:

    [0191] Favourable reconstitution of the gut microbiota after consumption of AFO-202 beta glucan in children with ASD has been demonstrated in this study, apart from the clinical improvement already reported. The decrease in Enterobacteria demonstrates the potential of this beta-glucan supplementation for neurodevelopmental conditions such as ASD as well as neurodegenerative disorders such as PD and AD, with converging pathways of amyloid accumulations and propagation, warranting larger clinical studies and research to recommend this as a routine food supplement or an adjunct to existing therapies for prevention and management of both neurodevelopmental and neurodegenerative diseases.

    List of Abbreviations

    [0192] ASDautism spectrum disorder [0193] WGMWhole genome metagenome [0194] Syn-synuclein [0195] MSmultiple sclerosis [0196] ADAlzheimer's disease [0197] PDParkinson's disease

    Improving Behavioural Pattern and Alpha-Synuclein Levels

    Abstract:

    [0198] Autism spectrum disorders (ASDs) are a wide range of disabilities in which the neurosynaptic biomarkers and mechanisms remain elusive. As there are no definite interventional modalities available to improve the behavioural pattern, remedial therapies are the only option and have varying outcomes. Based on our earlier study on the improvement of melatonin in ASD children when supplemented with a biological response modifier beta-glucan food supplement, we have evaluated the childhood autism rating scale (CARS) and alpha-synuclein levels in this randomized, parallel-group, multiple-arm clinical trial. Six subjects with ASD (n=6) Gr. 1 underwent conventional treatment comprising remedial behavioural therapies and L-Carnosine 500 mg per day, and 12 subjects (n=12) Gr. 2 underwent supplementation with the Nichi Glucan food supplement 0.5 g twice daily along with the conventional treatment.

    [0199] There was a significant decrease in the CARS score in all of the children of the Nichi Glucan Gr.2 compared to the control (p-value=0.034517), by an average of 3 points in the improvement of autism's signs and symptoms, whereas the improvement was very mild or nil in Gr.1. Plasma levels of alpha-synuclein were significantly higher in Gr. 2 (Nichi Glucan) than in the control group Gr. 1 (p-value=0.091701). Improvement of the behavioural pattern CARS score and a correlating alpha-synuclein level, followed by a safe beta-glucan food supplement, warrants further research on other parameters, such as gut-microbiota evaluation, and relevant neuronal biomarkers which is likely to cast light on novel solutions.

    Trial Registration Number:

    [0200] Clinical Trials Registry of India (CTRI/2020/10/028322)

    Lay Summary:

    [0201] Behavioural pattern in children with Autism Spectrum Disorder has been observed to improve following consumption of Beta 1,3-1,6 Glucan food supplement. The CARS score has also shown improved, compared to the control group in this pilot clinical study along with increase of a neuronal marker Alpha-Synuclein which is usually lower in affected children compared to normal age matched controls.

    Methods:

    [0202] This study was approved by the institutional ethics committee of Kenmax Medical Service Private Limited, Madurai, India and was registered as a randomized, parallel-group, and multiple-arm clinical trial in the Clinical Trials Registry of India (CTRI/2020/10/028322). The caregiver of all the subjects gave their informed consent for inclusion before participation in the study. The study was conducted in accordance with the Declaration of Helsinki.

    Study Design:

    [0203] The subjects enrolled in the study had received a diagnosis of ASD by a developmental paediatrician and were verified by a psychologist using a clinical interview for a behavioural pattern that incorporated CARS.

    [0204] Eighteen subjects (n=18) with ASD in total were enrolled in this prospective, open-label, pilot clinical trial comprising of two arms. The CONSORT flow diagram is presented as FIG. 14.

    [0205] Arm 1 or Gr. 1: Control: Six subjects with ASD (n=6) underwent conventional treatment comprising remedial behavioural therapies and L-Carnosine 500 mg per day.

    [0206] Arm 2 or Gr. 2: Treatment arm: 12 subjects (n=12) underwent supplementation with Nichi Glucan (Aureobasidium pullulans strain AFO-202 (also referred to as FO-68 [(accession number) FERM BP-19327]) derived Beta 1,3-1,6 Glucan) food supplement along with conventional treatment. Each subject consumed two sachets (0.5 g each) of Nichi Glucan dailyone sachet with a meal twice dailyfor a period of 90 days.

    Inclusion Criteria:

    [0207] i. Age: 3 to 18 years; [0208] ii. Gender: Both male and female; [0209] iii. ASD criteria as per CARS score; and, [0210] iv. Parents/caretakers willing to provide consent for their children to actively participate in the study.

    Exclusion Criteria:

    [0211] i. Subjects aged more than 18 years old; [0212] ii. Any child with acute general illness or who has been on any antibiotic, anti-inflammatory, or antioxidant treatment in the two weeks prior to enrolment in the study; [0213] iii. Hyperallergic to any of the investigational products; and, [0214] iv. Subjects with long-standing infections.

    Outcome Measures:

    [0215] i. Childhood autism rating scale (CARS): [0216] The CARS was monitored at baseline and after 90 days between the Gr.1 (control) and Gr.2 (Nichi Glucan). The CARS score was calculated based on a cumulative score obtained on the CARS scale, wherein a score below 30 indicates absence of sufficient signs and symptoms indicative of autism, a score between 30 and 36 indicates mild-to-moderately severe autism, and a score from 37 to 60 is correlated with severe autism (Ramaekers et al., 2019). The psychologist who performed the assessment and the parents were blind to the participant's treatment status; hence, this is a double-blind study. [0217] ii. Evaluation of plasma alpha-synuclein: [0218] Human alpha-synuclein (-syn) levels in plasma were measured in peripheral blood at baseline and after the study's completion at 90 days. The measurement was performed using the human -synuclein (-syn) ELISA kit (KINESISDx, USA) as per the manufacturer's instructions.

    Data Analysis:

    [0219] All data were analysed using Excel software statistics package analysis software (Microsoft Office Excel(R)); Student's paired t-tests were also calculated using this package; and p-values<0.05 were considered significant.

    Results:

    [0220] During enrolment, six subjects with ASD (n=6) could be enrolled in the control group (Gr. 1), whereas in the treatment group (Gr. 2), one of them dropped out before the start of the study. During the study, four subjects were lost to follow-up: two in Gr. 1 (one dropped out due to social problems in the family, and the other relocated to another city) and two in Gr. 2 (one dropped out due to social problems in the family, and the other relocated to another city). A total of 13 subjects (four in Gr. 1 and nine in Gr. 2) completed the study. One female subject was in both Gr. 1 and Gr. 2. The rest were male.

    Adverse Effects:

    [0221] Only one child exhibited possible mild adverse effects related to increased bowel movements in Gr. 2 for one week after supplementation with Nichi Glucan, which settled on its own. No adverse effects were found in any of the other children.

    Score on CARS Scale:

    [0222] Among the children in the control group (Gr.1), all four were in the category of severe autism, and their score at baseline ranged from 37 to 52 (mean=42.755.76). Among the nine children in Gr.2, two were in the mild-to-moderate category of autism (mean=33.52.5), whereas the remaining seven were in the category of severe autism (mean=43.714.80).

    [0223] After the intervention, the mean CARS score in the four children of the control group was 42.55.4, while in Gr.2 (Nichi Glucan), the mean of the CARS score in the two children with mild-to-moderate autism was 32.50.5. In the remaining seven children, the CARS score after Nichi Glucan intervention had a mean of 40.15.96. Thus, there was a significant decrease in the CARS score in all of the children in the Nichi Glucan Gr.2 group compared to the control (p-value=0.034517), with an average of 3 points in the improvement of autism's signs and symptoms, whereas the improvement was very mild or nil in Gr.1 (FIG. 26).

    [0224] Among the various parameters assessed on the CARS, there was visible subjective improvement in the emotional response, including reduction in irritability and anger (88%), sleep improvement (88%), speech characteristics with improvement in finger pointing and monosyllables in 77%, and improved responses to the caregiver in 77% of the children in Nichi Glucan Gr. 2, but these improvements were very mild or nil in Gr.1.

    [0225] Plasma levels of alpha-synuclein ranged between 0.12 and 20.41 ng/dl (mean=9.73 ng/dl) in the control group and between 0.45 and 41.12 ng/dl (mean=9.39 ng/dl) in the treatment group at baseline. After the intervention, plasma levels of alpha-synuclein increased, with a mean increase in levels of 26.72 ng/dl in the treatment (Nichi Glucan) Gr.2 group compared to the control group Gr. 1 (mean increase=10.56 ng/dl) (p-value=0.091701) (FIG. 27).

    Discussion:

    [0226] In this study of 13 subjects, the behavioural pattern evaluated by the CARS score improved in all nine subjects of Gr.2 (Nichi Glucan) (FIG. 14), especially on the emotional aspects and sleep-related parameters, and the alpha-synuclein levels increased significantly in these nine subjects compared to the control (FIG. 26). Alpha-synuclein plays a key role in the synaptic functions of neurons by regulating CADPS2 mRNA expression. There are reports that the neural overconnectivity and synapse alteration associated with the pathogenesis of ASD may actually owe their aetiology to alpha-synuclein dysregulation (Kadak et al., 2015; Sriwimol et al., 2018; Obergasteiger et al., 2014).

    [0227] Further, alpha-synuclein has recently been considered one of the important biomarkers for the diagnosis of autism and ASD, wherein the levels are low compared to age-matched controls (Kadak et al., 2015; Sriwimol et al., 2018; Siddique et al. 2020). In regard to neurodegenerative diseases such as PD, the reports have been varied, with some reporting lower than normal levels and others higher. In a correlating hypothesis of the plasma alpha-synuclein level, between autism and neurodegenerative diseases, it has been proposed that alpha-synuclein aggregation in the neural synapse may lead to lower plasma levels (Sriwimol et al., 2018).

    [0228] Whether the increase in alpha-synuclein levels in plasma in the ASD patients after Nichi Glucan supplementation is due to regulation/prevention of alpha-synuclein's aggregation in the neural synapse must be investigated because an earlier study on beta-glucan from yeast showed reduction in alpha-synuclein expression on the brain substantia nigra in Parkinson's rat model (Masruroh et al., 2017). However, no single mechanism, intervention, or therapy has proven its ability to regulate alpha-synuclein levels, especially in children with ASD. In our study, which is the first of its kind, the plasma alpha-synuclein levels showed significant increase after Nichi Glucan supplementation, and the levels were in line with those that were reported for children without ASD (Kadak et al., 2015; Sriwimol et al., 2018).

    [0229] Studies on children with ASD have indicated there is an underlying neuroinflammatory process occurring in different regions of the brain involved in microglial activation, thus resulting in a loss of connections or underconnectivity of neurons and leading to behavioural manifestations (Shah et al., 2009). MCP-1, IL-6, IL-10, and TNF- have been shown to be expressed in higher levels in children with autism (Shah et al., 2009). Beta-glucan has been proven to reduce the expression of inflammatory and proinflammatory markers, including II-6 and TNF- (Ikewaki et al., 2007), apart from having a neuroprotective effect by attenuating inflammatory cytokine production through microglia (Alp et al., 2012). This mechanism of counteracting ASD inflammation by Nichi Glucan supplementation deserves further research.

    [0230] In another study, beta-glucan reduced induced microglia activation and its phagocytosis of synaptic puncta and upregulation of proinflammatory cytokine (TNF-, IL-1, and IL-6) mRNA expression apart from promoting Tau signalling and improving cognition and brain function via the gut-brain axis (Shi et al., 2020). The mechanism by which the beta-glucan promoted behavioural improvement in the present study and correlated with the regulation of alpha-synuclein levels needs further in-depth research, not only for ASD but also for neurodegenerative diseases such as AD, PD, and so on, especially with regard to its effects on the gut-microbial ecosystem. The evolving data on the gut-brain axis and gut microbiota indicate there are two major approaches to balancing gut microbiota: probiotic and prebiotic.

    [0231] Probiotic approaches, such as nutritional probiotics, faecal transplantation, and so on, involve direct administration of the beneficial microorganisms that have to colonise the gut (Peng et al., 2020). However, the gut environment must be conducive for such probiotic supplementation. This is where prebiotic approaches come in, such as Nichi Glucan, which help in regulating the gut-microbial ecosystem and preventing chronic inflammatory status Peng et al., 2020); this must be validated by future studies in terms of the effects of Nichi Glucan and gut microbiota in their relevance to ASD.

    [0232] The limitation of the study is the limited number of participants, the unequal distribution of genders, and the number of participants between the groups. However, this is only a pilot study, and larger randomized, multi-centric clinical trials are warranted. Nevertheless, the study is significant as it has identified a simple nutritional supplemental intervention based on a naturally derived beta-glucan, the Nichi Glucan, which could stimulate endogenous alpha-synuclein secretion, promote better synaptic regulation, and improve the behaviour symptoms of children with autism. However, the results suggest that the benefits will be considerable when evaluated in terms of social and emotional well-being and alleviation of caregiver stress, which is extremely significant.

    Conclusion:

    [0233] Patients with ASD showed improvement in behavioural symptoms and improved levels of plasma alpha-synuclein; thus, this pilot clinical study of nutritional supplementation with an AFO-202 strain of black yeast Aureobasidium pullulans produced the biological response modifier beta-glucan (Nichi Glucan). Evaluation as per the CARS score has also shown significant beneficial effects. Although further validations need to be performed, the study definitely confirms the potential of Nichi Glucan as a simple but effective food supplement to be considered as a routine in children with ASD. Further research on the mechanisms of its action in improving alpha-synuclein levels and balancing the immune system in the context of managing chronic inflammation and gut-microbiota regulation as a prebiotic is likely to improve understanding of other diseases caused by neuroinflammation such as PD and AD.

    Comparison of Different Beta Glucans with AFO-202
    Alpha-Synuclein Suppression Data from F26S Study

    Methods

    [0234] Neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) (MERCK) was suspended in 10% FCS-DMEM/F12 medium and seeded into 96-well microplates to achieve a cell count of 5104 cells/well. After 24 hours of incubation, the cells were washed with 10% FCS-DMEM/F12 medium and new 10% FCS-DMEM/F12 medium was added.

    [0235] Then, the different beta glucans (Product 1: Micelle Glucan(R) (gel or liquid type) purchased from RL-JP Co., Japan; Product. 2: Beta-glucan NEW EX (gel or liquid type) purchased from Aureo BIS, Japan; Product 3: Yeast Glucan (capsule, inside powder?) purchased from Shell Life Japan Co., Japan) were added to the medium, and the cells were cultured for 1 day. After incubation, the wells were washed three times with PBS and fixed in 0.25% glutaraldehyde-PBS for 1 hour at room temperature. After fixation, the wells were washed three times with PBS-0.05% Tween (PBS-T). After washing the wells with PBS-T, -synuclein polyclonal antibody (proteintech Co. 10842-1-AP; x1,000 dilution) was added to the wells and incubated at room temperature for 1 h. Then, 2% BSA-PBS-T was added and left for 1 h (to block non-specific reactions).

    [0236] After 1 hour, the wells were washed with PBS-T and 50 L of biotin-labeled anti-rabbit IgG antibody (Cosmo Bio) diluted 5,000-fold was added to the wells and the reaction was carried out for 40 minutes at room temperature. After washing the wells, 50 L of 10,000-fold diluted peroxidase-labeled streptavidin (Cosmo Bio) was added and the reaction was carried out for 20 minutes at room temperature. After washing the wells again, 50 L of TMB (Cosmo Bio) was added to the wells, and the reaction was stopped with 0.5 M-HCl for 10 minutes.

    [0237] After that, the absorbance (OD value) was measured with a microplate reader (450 nm) (Tosoh). Data were expressed as OD value (sample OD valueblank OD value). The expression rate was calculated based on the control (None).

    Results:

    [0238] Results are found in Table 10.

    TABLE-US-00010 TABLE 10 Expression of -synuclein on the neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) treated with several beta-glucans (BGs) OD: 450 nm Expression % Suppression % Treatment Mean SD vs. None vs. None None 0.776 0.0211 100.0 0.0 P.1: Micelle BG 0.733 0.1047 94.46 5.54 50 g/mL P.2: text missing or illegible when filed BG 0.709 0.0075 91.41 8.59 50 g/mL P.3: text missing or illegible when filed BG 0.745 0.0111 96.05 3.96 50 g/mL AFO-202 0.630 0.0644 81.19 18.81 50 g/mL text missing or illegible when filed indicates data missing or illegible when filed

    [0239] Decrease in -synuclein expression was highest in AFO-202 beta glucan. Since these cell lines produced -synuclein are considered to be abnormal/misfolded and capable of aggregation, their decrease in expression is considered to be a suppression of production of abnormal -synuclein and hence an advantage.

    Improving Sleep Pattern and Serum Melatonin

    Introduction:

    [0240] Sleep problems are reported in 50 to 80% of children with Autism and Autism Spectrum disorders (ASD) [C1]. In adolescents and older children with ASD, sleep problems are higher including delayed sleep onset, shorter sleep duration and daytime sleepiness whereas in younger children bedtime resistance, sleep anxiety, parasomnias and night waking are predominant [C2]. Problems in sleep exacerbate the other features of autism such as tantrums, aggression, self-injury, inattention, hyperactivity, social interactions and repetitive behaviours, adding to the parental stress and the entire family's well-being [C1, C3].

    [0241] Melatonin, a neurohormone secreted by the pineal gland which regulates circadian rhythms including sleep patterns has been shown to be released at lower levels in individuals with autism and has been shown to have a positive effect on sleep in autism by acting on relieving Anxiety, improving sensory processing, possess anti-nociceptive effects on pain, and also gastro-intestinal dysfunction or gut dysbiosis [C3]. A significant proportion of children with ASD have chronic gastrointestinal problems such as diarrhea and/or constipation, irritable bowel syndrome etc. These GIT symptoms have been related cortisol response to stress and gut dysbiosis induced chronic inflammation in ASD [C2] which in turn has associations with altered melatonin levels in autism [C2]. Thus, melatonin supplementation [C2,C4,C5] is one of the main pharmacological approaches under consideration for ASD.

    [0242] Clinical studies of supplemental melatonin in ASD children have shown to improve sleep latency and quality [C2,C4,C5] in varying degrees [C3]. It is also to be noted that melatonin, though the side effects have been reported to be minimal, it has been found to be effective mostly in short term treatment of sleep disorders and the positive effects have waned during follow up (6-12 months) in specific clinical studies [C6]. Beta ()-glucans which are naturally occurring compounds have been shown to have a wide range of biological response modifying beneficial effects in metabolism, anti-cancer as well as in reducing the stress and mental disorders by acting on the immune system related pathways [C7]. An animal study has earlier shown that melatonin levels were upregulated in the blood serum of rats in the presence of rice bran (RB) and Beta ()-glucan present in a mushroom Sarcodon aspratus (S)'s extracts [C7,C8]. We and other research teams have earlier reported the beneficial effects of Nichi Glucan, a black yeast (Aureobasidium pullulans) AFO-202 derived 1,3-,16 beta glucan in metabolic disorders [C9,C10], cancer [C11,C12] in human clinical studies and as a suggested vaccine adjuvant for COVID-19 [C13]. Herein we undertook to study the effects of Nichi Glucan on sleep pattern and serum melatonin levels of ASD children in this pilot clinical study.

    Example 4

    Materials and Methods:

    [0243] Thirteen children with ASD, four in the control group (Gr.1) and nine in the treatment group (Gr.2) age range 2.5 to 13 years were included in the study. The subjects of Gr.2 consumed 1 gram of Nichi glucan (Aureobasidium pullulans strain AFO-202 (also referred to as FO-68 [(accession number) FERM BP-19327]) derived Beta 1,3-1,6 Glucan) as food supplement along with conventional therapies while Gr. 1 underwent conventional therapies alone for a duration of 90 days. The serum melatonin levels were evaluated before and after the study along with assessment of the subjective parameters in sleep pattern by means of a questionnaire to the caregiver in both the groups.

    Results:

    [0244] In the Nichi Glucan supplementation group (Gr. 2), the serum melatonin increased on an average from 238.85 ng/dl pre-intervention to 394.72 ng/dl post-intervention which was greater than the control group (Gr.1). All the children in the Nichi Glucan group (Gr.2) showed improvement in sleep pattern and quality.

    Conclusion:

    [0245] Aureobasidium pullulans derived Beta 1,3-1,6 Glucan after 90-days consumption has shown visible improvement in sleep quality, pattern and serum melatonin levels in this first of its kind report in the literature which warrants a larger multicentric study for validation and in-depth research on the mechanisms to recommend this as a routine supplementation in kids with ASD to improve their quality of sleep.

    Example 5

    Materials and Methods:

    [0246] This study was approved by our Institutional ethics committee of Kenmax Medical Service Private Limited, Madurai, India and registered in the Clinical trial registry of India (CTRI/2020/10/028322).

    Study Design:

    [0247] The subjects enrolled in the study had clinical diagnosis of ASD by a developmental paediatrician using standard assessment verified using a clinical interview that incorporated CARS (Childhood Autism Rating Scale).

    [0248] Eighteen subjects (n=18) with ASD in total were enrolled in this prospective open label pilot clinical trial comprising of two arms,

    [0249] Arm 1 or Group (Gr.) 1: Control: Six subjects with ASD (n=6) underwent conventional treatment which comprised of remedial behavioural therapies and L-Carnosine 500 mg per day.

    [0250] Arm 2 or Group (Gr.) 2: Treatment arm: Twelve subjects (n=12) underwent supplementation with Nichi Glucan (Aureobasidium pullulans strain AFO-202 (also referred to as FO-68 [(accession number) FERM BP-19327]) derived Beta 1,3-1,6 Glucan) food supplement along with conventional treatment. The subjects consumed 2 sachets (0.5 g each) of Nichi Glucan, one sachet with a meal twice daily for a period of 90 days.

    Inclusion Criteria:

    [0251] i. Age: 3 to 18 years; [0252] ii. 2. Gender: Both male and female; [0253] iii. ASD criteria as per CARS (Childhood Autism Rating Scale) score; and, [0254] iv. Parents willing to consent for their children for actively participating in the study.

    Exclusion Criteria:

    [0255] i. Subjects aged more than 18 years old; [0256] ii. Any child with acute general illness or is on any antibiotic, anti-inflammatory, or antioxidant treatment in the two weeks prior to enrolment in the study; [0257] iii. Hyperallergic to any of the investigational products; and, [0258] iv. Subjects with long standing infections

    Outcome Measures:

    [0259] i. Sleep pattern assessment by questionnaire: [0260] The Parent or caregiver completed a survey questionnaire, the Children's Sleep Habits Questionnaire-Abbreviated (CSHQ-A) was used in this research to assess the sleep problems which consisted of 22 questions (NICHD SECCYD-Wisconsin), with adaptations to suit the local cultural and social conditions. [0261] ii. Evaluation of serum melatonin: [0262] Melatonin levels in serum were measured in peripheral blood collected at daytime (and evaluation was performed using Human Melatonin ELISA Kit (BT-LAB-Bioassay Technology Laboratory kit, China)

    Data Analysis:

    [0263] All data were analysed using Excel software statistics package analysis software (Microsoft Office Excel(R)); Student's paired t-tests were also calculated using this package; P-values<0.05 were considered significant.

    Results:

    [0264] During enrolment, six subjects with ASD (n=6) could be enrolled in the control Gr.1 while in treatment group (Gr. 2), one of them dropped out even before start of the study. During the study, three subjects were lost to follow-up, one in Gr.1 (subject relocated to another city) and 2 in Gr. 2 (one due to social problems in the family and other relocated to another city). Totally 13 subjects (4 in Gr.1 and 9 in Gr.2) completed the study. There was one female subject in both Gr.1 and Gr. 2. The rest were male.

    Improvement in Sleep Pattern:

    [0265] On the Children's Sleep Habits related Questionnaire (CSHQ), there was significant reduction in the total score especially in terms of decrease in bedtime resistance and time of onset of sleep in the Gr.2 compared to Gr.1 (Table 11). The total sleep score ranged from 66 to 67 in Gr.1 (Mean=66.250.5) in the Gr.1 Control group while it ranged from 62 to 75 in Gr.2 at baseline (Mean=725.02) in Gr.2 (Nichi Glucan) at baseline. At the end of the study the total sleep score ranged from 58 to 66 in Gr.1 (Mean=644) in the Gr.1 Control group while it ranged from 51 to 70 in Gr.2 (Mean=64.227.47) in Gr.2 (Nichi Glucan). The reduction in sleep score after intervention indicating improvement in sleep behaviour was statistically significant in Gr.2 (p value=0.009879) indicating a significant improvement in the sleep patterns of the subject in the Nichi Glucan arm while the difference in sleep score did not show any statistically significant improvement in the control arm (p value=0.153494). The total sleep score also decreased well in the Nichi Glucan group compared to the control (FIG. 28).

    TABLE-US-00011 TABLE 11 Results of Children's Sleep Habits related Questionnaire (CSHQ), with significant reduction in the total score indicating improvement in bedtime resistance and time of onset of sleep in Nichi Glucan Gr. 2 compared to Control, Gr. 1 Gr. 1 (Mean values) Gr. 2 (Mean values) Parameters Baseline End of Study Baseline End of Study Bedtime resistance 28 25.75 28.5556 23.2222 Time of Onset of Sleep 20.25 20.25 21.8889 19.4444 Duration of Sleep 6 6 6.44444 5.55556 Night waking 6 6 6 6 Day-time sleepiness 6 6 9.11111 10

    Serum Melatonin Levels:

    [0266] In the control group (Gr.1), the serum Melatonin increased on an average from 110.585 to only 114.11 post-intervention (FIG. 29A) while in the Nichi Glucan supplementation group (Gr.2), the serum Melatonin increased on an average from 238.85 ng/dl pre-intervention to 394.72 ng/dl post-intervention (FIG. 29B). The fold increase in Nichi Glucan group Gr. 2 was 2.29 compared to 1 in Gr.1 (FIG. 29C) though higher in Gr.2 was not statistically significant (p-value=0.065786)

    Adverse Effects:

    [0267] Only one child exhibited possible mild adverse effects related to increased bowel movements in Gr. 2 for one week after supplementation with Nichi Glucan which settled on its own. There were no adverse effects in any of the other children.

    Discussion:

    [0268] In this open-label clinical trial of supplementation with Nichi Glucan, we found that majority of the children in the Nichi Glucan group (Gr.2), 8 out of 9 subjects (88%) had an improvement in sleep pattern and quality of sleep observed by decrease in sleep score after Nichi Glucan supplementation. The serum melatonin increased to a greater extent in Gr. 2 compared to Gr.1. The sleep score significantly decreased in Gr. 2 compared to gr.1 (FIG. 28).

    [0269] There were only minimal adverse effects. This is the first of its kind study, in which a nutritional supplement that is not a pharmacological drug has been able to improve sleep pattern with evidence in laboratory evaluation of corresponding serum melatonin and in children with ASD.

    [0270] Sleep difficulties are a major problem in children with ASD with 53% having been reported to have difficulty in sleep onset (53%), 40% restless sleep, 34% night-time awakening and 32% difficulty in arousal from sleep [C14]. Lack of good sleep also affects emotional and functioning ability in turn leading to impairment in academic and social functioning and maintaining relationships in these children. Therefore, ensuring good quality sleep becomes an essential part of therapy for ASD. Among pharmacological interventions, melatonin [C2,C4,C5], trazodone, benzodiazepines, and SSRI antidepressants represent the most commonly used medications in the paediatric population [C15]. Melatonin supplementation remains the treatment of choice, given the side effects of other interventions and clinical trials having showed positive outcome of its supplementation [C15]. Nevertheless, there are reports that melatonin is more effective as short term rather than long term though those studies have mostly been in individuals without ASD [C6].

    [0271] A nutritional supplement which can be simple, easy to administer and has minimal or no adverse effects will be an ideal alternative to melatonin. In the current study, Nichi Glucan which has been in consumption as a food supplement for several decades [C16] with proven benefits in metabolic disorders, cancer etc. [C9-12] has been shown to be a promising strategy based on the current study's results in terms of improvement in quality of sleep and increase in daytime serum melatonin levels.

    [0272] It has been postulated that low melatonin levels in ASD children could have its etiologic origin in melatonin deficiency in mothers of these children exerting its effects during neurodevelopment in embryo [C17]. Another study has reported the clear correlation between gut microbiome profiles of children with ASD and their mothers suggesting the importance for assessing the microbiome during the early stage in mothers during pregnancy and planning of personalized treatment and prevention of ASD via microbiota modulation [C17]. Beta glucan has also been shown to reduce the underlying chronic inflammation due to gut dysbiosis and helping to modulate towards a healthy microbiome, which will be further advantageous in ASD as chronic inflammation has been shown to be associated with severity of ASD symptoms [C18], Thus, with the current study showing that beta glucans can enhance melatonin and sleep quality in children with ASD, the ability of Beta glucans to modulate gut microbiota and reverse gut dysbiosis as the possible mechanism behind the increase in levels of melatonin [C6,C19,C20], thereby improving sleep, needs further research.

    [0273] This is only a pilot study and the limitation with the very less ample number is planned to be overcome by additional large-scale studies apart from studying the possible beneficial effects of Nichi Glucan on the behavioural aspects and other symptoms in patients with ASD.

    Conclusion:

    [0274] Patients with ASD have shown improvement in quality of sleep and improved levels of serum melatonin, in this open label pilot clinical study of nutritional supplementation with an AFO-202 strain of black yeast Aureobasidium pullulans produced 1,3-1,6 beta Glucan (Nichi-Glucan). The efficacy of Nichi Glucan in terms of behavioural improvement and other parameters observed in this pilot study in children with ASD, when confirmed in a larger study with long-term follow-up, it is worth recommending it as a supplementary food in such children. Further in-depth evaluation of the mechanisms and their correlation with other neurological parameters is recommended, which may throw light on novel solutions and drug candidates from such findings.

    Melatonin and Gut Microbiome Correlation

    AFO-202 Study

    Methods

    [0275] The study involved 18 subjects with ASD who were randomly allocated: six subjects in the control group (Group 1) underwent conventional treatment comprising remedial behavioural therapies and L-carnosine 500 mg per day, and 12 subjects (Group 2) underwent supplementation with Nichi Glucan 0.5 g twice daily along with the conventional treatment for 90 days. The subjects' stool samples were collected at baseline and after the intervention.

    [0276] Whole genome metagenome (WGM) sequencing was performed.

    Results

    [0277] The results are shown in FIGS. 31-34.

    Inference:

    [0278] All the species, R. Hominis, R. intestinalis, R. inulinivorans and R. faecis increased greatly post-intervention in AFO-202 treatment group. R. inulinivorans and R. faecis decreased in the control group. The increase in melatonin and improved sleep reported in the study (doi: 10.21203/rs.3.rs-701988/v1) can be attributed to the increase in abundance of Roseburia.

    F5s gut Microbiome in Autism and Epilepsy

    Seed Average of Gut Microbiome

    What is SEED?:

    [0279] In 2004, the SEED (http://pubseed.theseed.org/) was created to provide consistent and accurate genome annotations across thousands of genomes and as a platform for discovering and developing de novo annotations. The SEED is a constantly updated integration of genomic data with a genome database, web front end, API and server scripts. It is used by many scientists for predicting gene functions and discovering new pathways

    Methods:

    [0280] Eighteen subjects with ASD were enrolled in this prospective, open-label, pilot clinical trial comprised of two arms. Arm 1 or Group 1 (control group): Six subjects with ASD underwent conventional treatment comprising remedial behavioural therapies and L-carnosine 500 mg per day. Arm 2 or Group 2 (Nichi Glucan group): 12 subjects underwent supplementation with Nichi Glucan food supplement along with conventional treatment (remedial behavioural therapies and L-carnosine 500 mg per day). Each subject consumed two sachets (0.5 g each) of Nichi Glucan dailyone sachet with a meal twice dailyfor 90 days.

    [0281] Faecal samples were collected at baseline and 90 days after the intervention using a sterile faecal collection kit and the samples were kept at 20 C. until they were transferred to the laboratory and processed. Samples for DNA extraction were stored at 80 C. until needed for analysis.

    [0282] The samples were then taken for whole genome metagenome analysis. Initially, the reads were filtered for human DNA contamination. The filtered reads were then aligned to bacterial, fungal, viral and archea genomes. De novo assembly was carried out using the pre-processed reads to obtain the scaffolds. These scaffolds were then used for gene prediction. The abundances in terms of SEED annotations were analysed.

    Results

    [0283] The results are shown in FIG. 35 and Table 9.

    Interpretation

    [0284] There is several fold decrease in all the gene annotations (metabolites and metabolic functions) in the AFO-202 Nichi Glucan treatment group including Carbohydrates, Fatty acids, lipids, virulence, metabolite damage, nitrogen metabolism, mitochondrial electron transport system etc.

    Inference:

    [0285] 1. Most of the metabolic pathways and related functional genes are enriched or elevated in Autism and epilepsy; [0286] 2. A ketogenic diet which is advocated for autism and epilepsy has shown decrease in these pathways by SEED analysis in other studies; and, [0287] 3. Therefore, the several fold decrease in the SEED relative average data in AFO-202 group in the present study shows the benefits of this beta glucan in decreasing the metabolic pathways of the gut microbiota which is responsible for the positive clinical outcome reported in the study
    F5S StudyAlpha-Synuclein-Support Data from F26S Study:

    Methods

    [0288] Neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) (MERCK) was suspended in 10% FCS-DMEM/F12 medium and seeded into 96-well microplates to achieve a cell count of 5104 cells/well. After 24 hours of incubation, the cells were washed with 10% FCS-DMEM/F12 medium and new 10% FCS-DMEM/F12 medium was added.

    [0289] Then, -glucan AFO-202 (50 g/mL) and PMA (500 ng/mL) (Sigma) were added to the medium, and the cells were cultured for 1 to 3 days. After incubation, the wells were washed three times with PBS and fixed in 0.25% glutaraldehyde-PBS for 1 hour at room temperature. After fixation, the wells were washed three times with PBS-0.05% Tween (PBS-T). After washing the wells with PBS-T, 50 L of 500-fold diluted -synuclein polyclonal rabbit antibody (proteintech Co. 10842-1-AP) was added to the wells and incubated at room temperature for 1 h. Then, 2% BSA-PBS-T was added and left for 1 h (to block non-specific reactions).

    [0290] After 1 hour, the wells were washed with PBS-T and 50 L of biotin-labeled anti-rabbit IgG antibody (Cosmo Bio) diluted 5,000-fold was added to the wells and the reaction was carried out for 40 minutes at room temperature. After washing the wells, 50 L of 10,000-fold diluted peroxidase-labeled streptavidin (Cosmo Bio) was added and the reaction was carried out for 20 minutes at room temperature. After washing the wells again, 50 L of TMB (Cosmo Bio) was added to the wells, and the reaction was stopped with 0.5 M-HCl for 10 minutes.

    [0291] After that, the absorbance (OD value) was measured with a microplate reader (450 nm) (Tosoh). Data were expressed as OD value (sample OD valueblank OD value). The expression rate was calculated based on the control (None).

    Results

    [0292] The results are shown in FIGS. 36A-B and Table 12 below.

    TABLE-US-00012 TABLE 12 Expression of -synuclein on the neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) stimulated beta-glucans(BGs) or PMA -synuclein expression (%) Stimulation Concentration OD value vs. None None 0.281 100.0 BG-AF202 50 g/mL 0.198 70.5 PMA 500 ng/mL 0.166 50.1

    [0293] The neuroblastoma cell line (SHSY-5Y Tet-On: SCC291) was stimulated with BGs or PMA for 3 days. An -synuclein polyclonal antibody (proteintech Co. 10842-1-AP) was used in this experiment (glutaraldehyde-fixed cellular ELISA).

    AFO-202 Beta Glucan Decreases -Synuclein Expression

    Interpretation-I

    [0294] Alpha synuclein expression is decreased by AFO-202 in cell lines. Since these cell lines produced ASN are abnormal/misfolded and capable of aggregation, their decrease in expression is considered to be a suppression of production of abnormal ASN and hence an advantage.

    Interpretation-II

    [0295] Beta Glucans having been able to control ROS and mitochondrial Stress and hence the above suppression of abnormal Syn could be attributed due to that mechanism.

    Interpretation-III

    [0296] It is the abnormal ASN causing aggregates which can show transmission from cell to cell and prone to propagation like prions through gut brain axis and therefore AFO-202 making their production lesser at cellular level is helping to address the issue at the root cause itself.

    Interpretation-IV

    [0297] Since AFO-202 can regulate dyslipidemia and because alpha-synuclein binding with oxidized lipid metabolites can lead to mitochondrial dysfunction, leading to neuronal disorders, AFO-202 (i) decreasing misfolded alpha-synuclein production and (ii) regulating lipids has an advantage.

    Interpretation-V

    [0298] The increase in plasma levels of Alpha-Synuclein in the autism children (http://dx.doi.org/10.1136/bmjno-2021-000203) can be attributed to the clearing of the deposits by NK cells activated by AFO-202 beta glucan.

    Interpretation-VI

    [0299] Capacity of beta glucans to activate microglia will be of advantage in clearing the aggregates in the CNS therefore attributing to the behaviour and sleep pattern improvement of AFO-202 in the autism study (http://dx.doi.org/10.1136/bmjno-2021-000203)

    Modifications and Other Embodiments

    [0300] Various modifications and variations of the described glucan products, compositions and methods as well as the concept of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed is not intended to be limited to such specific embodiments. Various modifications of the described modes for carrying out the invention which are obvious to those skilled in the chemical, biological, medical, environmental, cosmetic or food arts or related fields are intended to be within the scope of the following claims.

    REFERENCES

    [0301] A1. Miller A L, Bessho S, Grando K, Tkel . Microbiome or Infections: Amyloid-Containing Biofilms as a Trigger for Complex Human Diseases. Front Immunol. 2021 Feb. 26; 12:638867. [0302] A2. Kang D W, Park J G, Ilhan Z E, Wallstrom G, Labaer J, Adams J B, Krajmalnik-Brown R. Reduced incidence of Prevotella and other fermenters in intestinal microflora of autistic children. PLoS One. 2013 Jul. 3; 8(7):e68322. [0303] A3. Liu F, Li J, Wu F, Zheng H, Peng Q, Zhou H. Altered composition and function of intestinal microbiota in autism spectrum disorders: a systematic review. Transl Psychiatry. 2019 Jan. 29; 9(1):43. [0304] A4. Shahi S K, Freedman S N, Murra A C, Zarei K, Sompallae R, Gibson-Corley K N, Karandikar N J, Murray J A, Mangalam A K. Prevotella histicola, A Human Gut Commensal, Is as Potent as COPAXONE(R)(R) in an Animal Model of Multiple Sclerosis. Front Immunol. 2019 Mar. 22; 10:462 [0305] Al-Mazidi, S., & Al-Ayadhi, L. Y (2021). Plasma Levels of Alpha and Gamma Synucleins in Autism Spectrum Disorder: An Indicator of Severity. Medical principles and practice: international journal of the Kuwait University, Health Science Centre, 30(2), 160-167. [0306] Bartels, T., De Schepper, S., & Hong, S. (2020). Microglia modulate neurodegeneration in Alzheimer's and Parkinson's diseases. Science (New York, N.Y.), 370(6512), 66-69. [0307] Boziki, M. K., Kesidou, E., Theotokis, P., Mentis, A. A., Karafoulidou, E., Melnikov, M., Sviridova, A., Rogovski, V., Boyko, A., & Grigoriadis, N. (2020). Microbiome in Multiple Sclerosis; Where Are We, What We Know and Do Not Know. Brain sciences, 10(4), 234. [0308] Ding, X., Xu, Y, Zhang, X., Zhang, L., Duan, G., Song, C., Li, Z., Yang, Y, Wang, Y, Wang, X., & Zhu, C. (2020). Gut microbiota changes in patients with autism spectrum disorders. Journal of psychiatric research, 129, 149-159. [0309] DeAngelis, M., Piccolo, M., Vannini, L., Siragusa, S., De Giacomo, A., Serrazzanetti, D. I., Cristofori, F., Guerzoni, M. E., Gobbetti, M., & Francavilla, R. (2013). Fecal microbiota and metabolome of children with autism and pervasive developmental disorder not otherwise specified. PloS one, 8(10), e76993. [0310] Dedeepiya, V. D., Sivaraman, G., Venkatesh, A. P., Preethy, S., & Abraham, S. J. (2012). Potential effects of nichi glucan as a food supplement for diabetes mellitus and hyperlipidemia: preliminary findings from the study on three patients from India. Case reports in medicine, 2012, 895370. [0311] Dilsizoglu Senol, A., Samarani, M., Syan, S., Guardia, C. M., Nonaka, T., Liv, N., Latour-Lambert, P., Hasegawa, M., Klumperman, J., Bonifacino, J. S., & Zurzolo, C. (2021). -Synuclein fibrils subvert lysosome structure and function for the propagation of protein misfolding between cells through tunneling nanotubes. PLoS biology, 19(7), e3001287. [0312] Earls, R. H., Menees, K. B., Chung, J., Gutekunst, C. A., Lee, H. J., Hazim, M. G., Rada, B., Wood, L. B., & Lee, J. K. (2020). NK cells clear -synuclein and the depletion of NK cells exacerbates synuclein pathology in a mouse model of -synucleinopathy. Proceedings of the National Academy of Sciences of the United States of America, 117(3), 1762-1771. [0313] Ganesh, J. S., Rao, Y. Y., Ravikumar, R., Jayakrishnan, G. A., Iwasaki, M., Preethy, S., & Abraham, S. J. (2014). Beneficial effects of black yeast derived 1-3, 1-6 Beta Glucan-Nichi Glucan in a dyslipidemic individual of Indian origina case report. Journal of dietary supplements, 11(1), 1-6. [0314] Grimaldi, R., Gibson, G. R., Vulevic, J., Giallourou, N., Castro-Mejia, J. L., Hansen, L. H., Leigh Gibson, E., Nielsen, D. S., & Costabile, A. (2018). A prebiotic intervention study in children with autism spectrum disorders (ASDs). Microbiome, 6(1), 133. [0315] .sup.aIkewaki N, Onaka T, Ikeue Y, Nagataki M, Kurosawa G, Dedeepiya V D, Rajmohan M, Vaddi S, Senthilkumar R, Preethy S, Abraham S J K. Beneficial effects of the AFO-202 and N-163 strains of Aureobasidium pullulans produced 1,3-1,6 beta glucans on non-esterified fatty acid levels in obese diabetic KKAy mice: A comparative study.bioRxiv 2021.07.22.453362; doi: 10.1101/2021.07.22.453362 [0316] .sup.bIkewaki N, Kurosawa G, Iwasaki M, Preethy S, Dedeepiya V D, Vaddi S, Senthilkumar R, Levy G A, Abraham S J K. Hepatoprotective effects of Aureobasidium pullulans derived Beta 1,3-1,6 biological response modifier glucans in a STAM-animal model of non-alcoholic steatohepatitis.bioRxiv 2021.07.08.451700; doi: 10.1101/2021.07.08.451700 [0317] .sup.cIkewaki N, Sonoda T, Kurosawa G, Iwasaki M, Dedeepiya V D, Senthilkumar R, Preethy S, Abraham S J K. Immune and metabolic beneficial effects of Beta 1,3-1,6 glucans produced by two novel strains of Aureobasidium pullulans in healthy middle-aged Japanese men: An exploratory study. medRxiv 2021.08.05.21261640. doi: 10.1101/2021.08.05.21261640 [0318] Ikewaki N, Fujii N, Onaka T, Ikewaki S, Inoko H. Immunological actions of Sophy beta-glucan (beta-1,3-1,6 glucan), currently available commercially as a health food supplement. Microbiol Immunol. 2007; 51:861-73. [0319] Kang, D. W., Adams, J. B., Coleman, D. M., Pollard, E. L., Maldonado, J., McDonough-Means, S., Caporaso, J. G., & Krajmalnik-Brown, R. (2019). Long-term benefit of Microbiota Transfer Therapy on autism symptoms and gut microbiota. Scientific reports, 9(1), 5821. [0320] Kang, D. W., Park, J. G., Ilhan, Z. E., Wallstrom, G., Labaer, J., Adams, J. B., & Krajmalnik-Brown, R. (2013). Reduced incidence of Prevotella and other fermenters in intestinal microflora of autistic children. PloS one, 8(7), e68322. [0321] Kang, D. W., Ilhan, Z. E., Isern, N. G., Hoyt, D. W., Howsmon, D. P., Shaffer, M., Lozupone, C. A., Hahn, J., Adams, J. B., & Krajmalnik-Brown, R. (2018). Differences in fecal microbial metabolites and microbiota of children with autism spectrum disorders. Anaerobe, 49, 121-131. [0322] Lindefeldt, M., Eng, A., Darban, H., Bjerkner, A., Zetterstrm, C. K., Allander, T., Andersson, B., Borenstein, E., Dahlin, M., & Prast-Nielsen, S. (2019). The ketogenic diet influences taxonomic and functional composition of the gut microbiota in children with severe epilepsy. NPJ biofilms and microbiomes, 5(1), 5. [0323] Luna, E., & Luk, K. C. (2015). Bent out of shape: -Synuclein misfolding and the convergence of pathogenic pathways in Parkinson's disease. FEBS letters, 589(24 Pt A), 3749-3759. [0324] Miller, A. L., Bessho, S., Grando, K., & Tkel, . (2021). Microbiome or Infections: Amyloid-Containing Biofilms as a Trigger for Complex Human Diseases. Frontiers in immunology, 12, 638867. [0325] Morato Torres, C. A., Wassouf, Z., Zafar, F., Sastre, D., Outeiro, T. F., & Schle, B. (2020). The Role of Alpha-Synuclein and Other Parkinson's Genes in Neurodevelopmental and Neurodegenerative Disorders. International journal of molecular sciences, 21(16), 5724. [0326] Murros, K. E., Huynh, V. A., Takala, T. M., & Saris, P. (2021). Desulfovibrio Bacteria Are Associated With Parkinson's Disease. Frontiers in cellular and infection microbiology, 11, 652617. [0327] Oh, D., & Cheon, K. A. (2020). Alteration of Gut Microbiota in Autism Spectrum Disorder: An Overview. Soach'ongsonyon chongsin uihak=Journal of child & adolescent psychiatry, 31(3), 131-145. [0328] Raghavan, K., Dedeepiya, V. D., Suryaprakash, V., Rao, K. S., Ikewaki, N., Sonoda, T., Levy, G. A., Iwasaki, M., Senthilkumar, R., Preethy, S., & Abraham, S. J. (2022). Beneficial effects of novel Aureobasidium pullulans strains produced beta-1,3-1,6 glucans on interleukin-6 and D-dimer levels in COVID-19 patients; results of a randomized multiple-arm pilot clinical study. Biomedicine & pharmacotherapy=Biomedecine & pharmacotherapie, 145, 112243. [0329] .sup.aRaghavan, K., Dedeepiya, V. D., Ikewaki, N., Sonoda, T., Iwasaki., M., Preethy. S., Abraham, S. J. K. Improvement of behavioural pattern and alpha-synuclein levels in autism spectrum disorder after consumption of a beta-glucan food supplement in a randomized, parallel-group pilot clinical study. BMJ Neurology Open (In print). Preprint in MedRxiv: https://doi.org/10.1101/2021.06.28.21259619 [0330] .sup.bRaghavan, K., Dedeepiya, V. D. Kandaswamy, R., Balamurugan. M., Ikewaki, N., Sonoda, T., Kurosawa, G., Iwasaki, M., Preethy, S., Abraham, S. J. K. (2021). Improvement of sleep patterns and serum melatonin levels in children with autism spectrum disorders after consumption of beta-1,3/1,6-glucan in a pilot clinical study. Research Square rs.3.rs-701988/v1; doi: 10.21203/rs.3.rs-701988/v1 [0331] .sup.cRaghavan, K., Kandaswamy, R. S., Ikewaki, N., Iwasaki, M., & Abraham, S. (2021). Potentials to alleviate coagulopathy and enhance microglial function of beta ()-glucans, making them worth a clinical study for COVID-19's neurological sequalae. Journal of the neurological sciences, 427, 117554. [0332] Sampson, T. R., Challis, C., Jain, N., Moiseyenko, A., Ladinsky, M. S., Shastri, G. G., Thron, T., Needham, B. D., Horvath, I., Debelius, J. W., Janssen, S., Knight, R., Wittung-Stafshede, P., Gradinaru, V., Chapman, M., & Mazmanian, S. K. (2020). A gut bacterial amyloid promotes -synuclein aggregation and motor impairment in mice. eLife, 9, e53111. [0333] Santocchi, E., Guiducci, L., Prosperi, M., Calderoni, S., Gaggini, M., Apicella, F., Tancredi, R., Billeci, L., Mastromarino, P., Grossi, E., Gastaldelli, A., Morales, M. A., & Muratori, F. (2020). Effects of Probiotic Supplementation on Gastrointestinal, Sensory and Core Symptoms in Autism Spectrum Disorders: A Randomized Controlled Trial. Frontiers in psychiatry, 11, 550593. [0334] Swirski, M., Miners, J. S., de Silva, R., Lashley, T., Ling, H., Holton, J., Revesz, T., & Love, S. (2014). Evaluating the relationship between amyloid-3 and -synuclein phosphorylated at Ser129 in dementia with Lewy bodies and Parkinson's disease. Alzheimer's research & therapy, 6(5-8), 77. [0335] Souza, N. C., Mendonca, J. N., Portari, G. V., Jordao Junior, A. A., Marchini, J. S., & Chiarello, P. G. (2012). Intestinal permeability and nutritional status in developmental disorders. Alternative therapies in health and medicine, 18(2), 19-24. [0336] Tomova A, Husarova V, Lakatosova S, Bakos J, Vlkova B, Babinska K, Ostatnikova D. Gastrointestinal microbiota in children with autism in Slovakia. Physiol Behav. 2015; 138:179-87. [0337] Werner, T., Horvath, I., & Wittung-Stafshede, P. (2020). Crosstalk Between Alpha-Synuclein and Other Human and Non-Human Amyloidogenic Proteins: Consequences for Amyloid Formation in Parkinson's Disease. Journal of Parkinson's disease, 10(3), 819-830. [0338] Shen R L, Dang X Y, Dong J L, Hu X Z. Effects of oat -glucan and barley -glucan on fecal characteristics, intestinal microflora, and intestinal bacterial metabolites in rats. J Agric Food Chem. 2012 Nov. 14; 60(45):11301-8. [0339] Turunen K, Tsouvelakidou E, Nomikos T, Mountzouris K C, Karamanolis D, Triantafillidis J, Kyriacou A. Impact of beta-glucan on the faecal microbiota of polypectomized patients: a pilot study. Anaerobe. 2011 December; 17(6):403-6 [0340] Zhen W, Liu Y, Shao Y, Ma Y, Wu Y, Guo F, Abbas W, Guo Y, Wang Z. Yeast -Glucan Altered Intestinal Microbiome and Metabolome in Older Hens. Front Microbiol. 2021 Dec. 17; 12:766878. [0341] 1. Al-Mazidi, S., & Al-Ayadhi, L. Y. (2021). Plasma Levels of Alpha and Gamma Synucleins in Autism Spectrum Disorder: An Indicator of Severity. Medical principles and practice: international journal of the Kuwait University, Health Science Centre, 30(2), 160-167. https://doi.org/i0.1159/000513935 [0342] 2. Alp, H., Varol, S., Celik, M. M., Altas, M., Evliyaoglu, O., Tokgoz, O., Tanriverdi, M. H., & Uzar, E. (2012). Protective effects of beta glucan and gliclazide on brain tissue and sciatic nerve of diabetic rats induced by streptozosin. Experimental diabetes research, 2012, 230342. https://doi.org/10.1155/2012/230342 [0343] 3. Centers for Disease Control and Prevention. What is Autism Spectrum Disorder? Retrieved from https://www.cdc.gov/ncbddd/autism/facts.html [0344] 4. Dedeepiya, V. D., Sivaraman, G., Venkatesh, A. P., Preethy, S., & Abraham, S. J. (2012). [0345] 5. Potential effects of nichi glucan as a food supplement for diabetes mellitus and hyperlipidemia: preliminary findings from the study on three patients from India. Case reports in medicine, 2012, 895370. https://doi.org/10.1155/2012/895370 [0346] 6. Ganesh, J. S., Rao, Y. Y., Ravikumar, R., Jayakrishnan, G. A., Iwasaki, M., Preethy, S., & Abraham, S. J. (2014). Beneficial effects of black yeast derived 1-3, 1-6 Beta Glucan-Nichi Glucan in a dyslipidemic individual of Indian origina case report. Journal of dietary supplements, 11(1), 1-6. https://doi.org/10.3109/19390211.2013.859211 [0347] 7. Ikewaki, N., Fujii, N., Onaka, T., Ikewaki, S., & Inoko, H. (2007). Immunological actions of Sophy beta-glucan (beta-1,3-1,6 glucan), currently available commercially as a healthfood supplement. Microbiology and immunology, 51(9), 861-873. https://doi.org/10.1111/j.1348-0421.2007.tb03982.x [0348] 8. Ikewaki, N., Iwasaki, M., Kurosawa, G., Rao, K. S., Lakey-Beitia, J., Preethy, S., & Abraham, S. J. (2021). -glucans: wide-spectrum immune-balancing food-supplement-based enteric (p3-WIFE) vaccine adjuvant approach to COVID-19. Human vaccines & immunotherapeutics, 1-6. Advance online publication. https://doi.org/10.1080/21645515.2021.1880210 [0349] 9. Kadak, M. T., Cetin, I., Tarakcioglu, M. C., Ozer, O. F., Kacar, S., & imen, B. (2015). Low Serum Level -Synuclein and Tau Protein in Autism Spectrum Disorder Compared to Controls. Neuropediatrics, 46(6), 410-415. https://doi.org/10.1055/s-0035-1565273 [0350] 10. Karhu, E., Zukerman, R., Eshraghi, R. S., Mittal, J., Deth, R. C., Castejon, A. M., Trivedi, M., Mittal, R., & Eshraghi, A. A. (2020). Nutritional interventions for autism spectrum disorder. Nutrition reviews, 78(7), 515-531. https://doi.org/10.1093/nutrit/nuz092 [0351] 11. Obergasteiger, J., berbacher, C., Pramstaller, P. P., Hicks, A. A., Corti, C., & Volta, M. (2017). CADPS2 gene expression is oppositely regulated by LRRK2 and alpha-synuclein. Biochemical and biophysical research communications, 490(3), 876-881. https://doi.org/10.1016/j.bbrc.2017.06.134 [0352] 12. Peng, M., Tabashsum, Z., Anderson, M., Truong, A., Houser, A. K., Padilla, J., Akmel, A., Bhatti, J., Rahaman, S. O., & Biswas, D. (2020). Effectiveness of probiotics, prebiotics, and prebiotic-like components in common functional foods. Comprehensive reviews in food science and food safety, 19(4), 1908-1933. https://doi.org/10.1111/1541-4337.12565 [0353] 13. Rahayu, M., Kurniawan, S. N., Husna, M., Hermawan, H. O. (2016). The effect of beta glucan of Saccharomyces cerevisae on the decrease of alpha synuclein expression in the brain substantia nigra of parkinson's wistar strain rats (Rattus novergicus) model induced with rotenone. Malang Neurology Journal 2(1). ISSN 2442-5001. Retrieved from https://mnj.ub.ac.id/index.php/mnj/article/view/32 [0354] 12. Ramaekers, V. T., Sequeira, J. M., DiDuca, M., Vrancken, G., Thomas, A., Philippe, C., Peters, M., Jadot, A., & Quadros, E. V. (2019). Improving Outcome in Infantile Autism with Folate Receptor Autoimmunity and Nutritional Derangements: A Self-Controlled Trial. Autism research and treatment, 2019, 7486431. https://doi.org/10.1155/2019/7486431 [0355] 13. Shah, V. B., Williams, D. L., & Keshvara, L. (2009). beta-Glucan attenuates TLR2- and TLR4-mediated cytokine production by microglia. Neuroscience letters, 458(3), 111-115. https://doi.org/10.1016/j.neulet.2009.04.039 [0356] 14. Shi, H., Yu, Y., Lin, D., Zheng, P., Zhang, P., Hu, M., Wang, Q., Pan, W., Yang, X., Hu, T., Li, Q., Tang, R., Zhou, F., Zheng, K., & Huang, X. F. (2020). -glucan attenuates cognitive impairment via the gut-brain axis in diet-induced obese mice. Microbiome, 8(1), 143. https://doi.org/10.1186/s40168-020-00920-y [0357] 15. Siddique, A., Khan, H. F., Ali, S., Abdullah, A., Munir, H., & Ariff, M. (2020). Estimation of Alpha-Synuclein Monomer and Oligomer Levels in the Saliva of the Children With Autism Spectrum Disorder: A Possibility for an Early Diagnosis. Cureus, 12(8), e9936. https://doi.org/10.7759/cureus.9936 [0358] 16. Srikantha, P., & Mohajeri, M. H. (2019). The Possible Role of the Microbiota-Gut-Brain-Axis in Autism Spectrum Disorder. International journal of molecular sciences, 20(9), 2115. https://doi.org/10.3390/ijms20092115 [0359] 17. Sriwimol, W., & Limprasert, P. (2018). Significant Changes in Plasma Alpha-Synuclein and Beta-Synuclein Levels in Male Children with Autism Spectrum Disorder. BioMed research international, 2018, 4503871. https://doi.org/10.1155/2018/4503871 [0360] 18. Xu, M., Mo, X., Huang, H., Chen, X., Liu, H., Peng, Z., Chen, L., Rong, S., Yang, W., Xu, S., & Liu, L. (2020). Yeast -glucan alleviates cognitive deficit by regulating gut microbiota and metabolites in A1-42-induced AD-like mice. International journal of biological macromolecules, 161, 258-270. https://doi.org/10.1016/j.ijbiomac.2020.05.180 [0361] 19. Vargas, K. J., Schrod, N., Davis, T., Fernandez-Busnadiego, R., Taguchi, Y V., Laugks, U., Lucic, V., & Chandra, S. S. (2017). Synucleins Have Multiple Effects on Presynaptic Architecture. Cell reports, 18(1), 161-173. https://doi.org/10.1016/j.celrep.2016.12.023 [0362] C1. Goldman S E, Richdale A L, Clemons T, Malow B A. Parental sleep concerns in autism spectrum disorders: variations from childhood to adolescence. J Autism Dev Disord. 2012 April; 42(4):531-8. [0363] C2. Malow B, Adkins K W, McGrew S G, Wang L, Goldman S E, Fawkes D, Burnette C. Melatonin for sleep in children with autism: a controlled trial examining dose, tolerability, and outcomes. J Autism Dev Disord. 2012 August; 42(8):1729-37 [0364] C3. Gagnon K, Godbout R. Melatonin and Comorbidities in Children with Autism Spectrum Disorder. Curr Dev Disord Rep. 2018; 5(3):197-206. [0365] C4. Maras A, Schroder C M, Malow B A, Findling R L, Breddy J, Nir T, Shahmoon S, Zisapel N, Gringras P. Long-Term Efficacy and Safety of Pediatric Prolonged-Release Melatonin for Insomnia in Children with Autism Spectrum Disorder. J Child Adolesc Psychopharmacol. 2018 December; 28(10):699-710. [0366] C5. Cortesi F, Giannotti F, Sebastiani T, Panunzi S, Valente D. Controlled-release melatonin, singly and combined with cognitive behavioural therapy, for persistent insomnia in children with autism spectrum disorders: a randomized placebo-controlled trial. J Sleep Res. 2012 December; 21(6):700-9. doi: 10.1111/j.1365-2869.2012.01021.x. [0367] C6. Russcher M, Koch B C, Nagtegaal J E, van Ittersum F J, Pasker-de Jong P C, Hagen E C, van Dorp W T, Gabrels B, Wildbergh T X, van der Westerlaken M M, Gaillard C A, Ter Wee P M. Long-term effects of melatonin on quality of life and sleep in haemodialysis patients (Melody study): a randomized controlled trial. Br J Clin Pharmacol. 2013 November; 76(5):668-79. doi: 10.1111/bcp.12093. [0368] C7. Costa H F B, Chemical and biological characterization of an aqueous Sambucus nigra L. flower extract 2019. [0369] C8. Dutta S D, Patel D K, Ganguly K, Lim K T. Effects of GABA/-glucan supplements on melatonin and serotonin content extracted from natural resources. PLoS One. 2021 Mar. 5; 16(3):e0247890. doi: 10.1371/journal.pone.0247890. [0370] C9. Dedeepiya V D, Sivaraman G, Venkatesh A P, et al. Potential effects of nichi glucan as a food supplement for diabetes mellitus and hyperlipidemia: preliminary findings from the study on three patients from India. Case Rep Med 2012 (2012):895370. [0371] C10. Ganesh J S, Rao Y Y, Ravikumar R, Jayakrishnan G A, Iwasaki M, Preethy S, Abraham S J. Beneficial effects of black yeast derived 1-3, 1-6 Beta Glucan-Nichi Glucan in a dyslipidemic individual of Indian origina case report. J Diet Suppl (2014)11:1-6. [0372] C11. Mizobuchi S, Taniwaki C, Watanabe Y, Sasaguri S. Antitumor effects of combined therapy with intraperitoneal CDDP and oral Sofy -glucan. Abstract presented at the 63rd General Meeting of the Japanese Society of Gastroenterology, Japan (2008). [0373] C12. Mio M. Effect of oral intake of black yeast beta-glucan on NK activity in the elderly and patients with cancer. Abstract presented at 29th Annual Meeting of the Japanese Society of Venous and Enteral Nutrition Pacifico Yokohama, Japan (2014). [0374] C13. Katoh S, Rao K S, Suryaprakash V, Horiguchi A, Kushibiki T, Ojima K, Iwasaki M, Takeda M, Senthilkumar R, Rajmohan M, Karthick R, Preethy S, Abraham S. -Glucans: Wide-spectrum Immune-balancing Food-supplement-based Enteric (-WIFE) Vaccine Adjuvant Approach to COVID-19. Human Vaccines & Immunotherapeutics (2021) [0375] C14. Parvataneni T, Srinivas S, Shah K, Patel R S. Perspective on Melatonin Use for Sleep Problems in Autism and Attention-Deficit Hyperactivity Disorder: A Systematic Review of Randomized Clinical Trials. Cureus. 2020 May 28; 12(5):e8335. doi: 10.7759/cureus.8335. [0376] C15. Ikewaki N, Fujii N, Onaka T, Ikewaki S, Inoko H. Immunological actions of Sophy beta-glucan (beta-1,3-1,6 glucan), currently available commercially as a health food supplement. Microbiol Immunol. 2007; 51(9):861-73. doi: 10.1111/j.1348-0421.2007.tb03982.x. [0377] C16. Braam W, Ehrhart F, Maas APHM, Smits M G, Curfs L. Low maternal melatonin level increases autism spectrum disorder risk in children. Res Dev Disabil. 2018 November; 82:79-89. doi: 10.1016/j.ridd.2018.02.017. [0378] C17. Li N, Yang J, Zhang J, Liang C, Wang Y, Chen B, Zhao C, Wang J, Zhang G, Zhao D, Liu Y, Zhang L, Yang J, Li G, Gai Z, Zhang L, Zhao G. Correlation of Gut Microbiome Between ASD Children and Mothers and Potential Biomarkers for Risk Assessment. Genomics Proteomics Bioinformatics. 2019 February; 17(1):26-38. doi: 10.1016/j.gpb.2019.01.002. Epub 2019 Apr. 23. PMID: 31026579; PMCID: PMC6520911. [0379] C18. Innate Immunity and Neuroinflammation in Neuropsychiatric Conditions Including Autism Spectrum Disorders: Role of Innate Immune Memory. Harumi Jyonouchi DOI: 10.5772/intechopen.87167 [0380] C19. Cheng W Y, Lam K L, Pik-Shan Kong A, Chi-Keung Cheung P. Prebiotic supplementation (beta-glucan and inulin) attenuates circadian misalignment induced by shifted light-dark cycle in mice by modulating circadian gene expression. Food Res Int. 2020 November; 137:109437. doi: 10.1016/j.foodres.2020.109437. [0381] C20. Shi H, Yu Y, Lin D, Zheng P, Zhang P, Hu M, Wang Q, Pan W, Yang X, Hu T, Li Q, Tang R, Zhou F, Zheng K, Huang X F. -glucan attenuates cognitive impairment via the gut-brain axis in diet-induced obese mice. Microbiome. 2020 Oct. 2; 8(1):143. doi: 10.1186/s40168-020-00920-y. [0382] D1. Valdes A M, Walter J, Segal E, Spector T D. Role of the gut microbiota in nutrition and health. BMJ. 2018 Jun. 13; 361:k2179. [0383] D2. Ghaisas S, Maher J, Kanthasamy A. Gut microbiome in health and disease: Linking the microbiome-gut-brain axis and environmental factors in the pathogenesis of systemic and neurodegenerative diseases. Pharmacol Ther. 2016 February; 158:52-62. [0384] D3. Shreiner A B, Kao J Y, Young V B. The gut microbiome in health and in disease. Curr Opin Gastroenterol. 2015 January; 31(1):69-75. doi: 10.1097/MOG.0000000000000139. PMID: 25394236; PMCID: PMC4290017. [0385] D4. Zierer J, Jackson M A, Kastenmller G, Mangino M, Long T, Telenti A, Mohney R P, Small K S, Bell J T, Steves C J, Valdes A M, Spector T D, Menni C. The fecal metabolome as a functional readout of the gut microbiome. Nat Genet. 2018 June; 50(6):790-795. [0386] D5. Dedeepiya V, Sivaraman G, Venkatesh A, Preethy S, Abraham S. Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia; Preliminary Findings from the Study on Three Patients from India. Case Reports in Medicine 2012 (2012), Article ID 895370 [0387] D6. Ganesh J S, Rao Y Y, Ravikumar R, Jayakrishnan A G, Iwasaki M, Preethy S, Abraham S. Beneficial effects of Black yeast derived 1-3, 1-6 beta glucan-Nichi Glucan in a dyslipidemic individual of Indian originA case report. J Diet Suppl. 2014; 11(1):1-6. [0388] D7. Raghavan K, Dedeepiya V D, Ikewaki N, Sonoda T, Iwasaki M, Preethy S, Abraham S J K. Improvement of behavioural pattern and alpha-synuclein levels in autism spectrum disorder after consumption of a beta-glucan food supplement in a randomized, parallel-group pilot clinical study. BMJ Neurology Open (In print) [0389] D8. Raghavan K, Dedeepiya V D, Kandaswamy R, Balamurugan M, Ikewaki N, Sonoda T, Kurosawa G, Iwasaki M, Preethy S, Abraham S J K. Improvement of sleep patterns and serum melatonin levels in children with autism spectrum disorders after consumption of beta-1,3/1,6-glucan in a pilot clinical study. Research Square rs.3.rs-701988/v1; doi: 10.21203/rs.3.rs-701988/v1 [0390] D9. Raghavan K, Dedeepiya V D, Srinivasan S, Pushkala S, Subramanian S, Ikewaki N, Iwasaki M, Senthilkumar R, Preethy S, Abraham S. Disease-modifying immune-modulatory effects of the N-163 strain of Aureobasidium pullulans-produced 1,3-1,6 Beta glucans in young boys with Duchenne muscular dystrophy: Results of an open-label, prospective, randomized, comparative clinical study. medRxiv 2021.12.13.21267706 [0391] D10. Ikewaki N, Kurosawa G, Iwasaki M, Preethy S, Dedeepiya V D, Vaddi S, Senthilkumar R, Levy G A, Abraham S J K. Hepatoprotective effects of Aureobasidium pullulans derived Beta 1,3-1,6 biological response modifier glucans in a STAM-animal model of non-alcoholic steatohepatitis.bioRxiv 2021.07.08.451700; doi: 10.1101/2021.07.08.451700 [0392] D11. Pushkala S, Seshayyan S, Theranirajan E, Sudhakar D, Raghavan K, Dedeepiya V D, Ikewaki N, Iwasaki M, Preethy S, Abraham S. Efficient control of IL-6, CRP and Ferritin in Covid-19 patients with two variants of Beta-1,3-1,6 glucans in combination, within 15 days in an open-label prospective clinical trial. medRxiv 2021.12.14.21267778; doi: 10.1101/2021.12.14.21267778 [0393] D12. Raghavan K, Dedeepiya V D, Suryaprakash V, Rao K S, Ikewaki N, Sonoda T, Levy G A, Iwasaki M, Senthilkumar R, Preethy S, Abraham S J K. Beneficial Effects of novel Aureobasidium pullulans strains produced beta-1,3-1,6 glucans on interleukin-6 and D-Dimer levels in COVID-19 patients; results of a randomized multiple-arm pilot clinical study. Biomedicine and Pharmacotherapy 2021. sciencedirect. https://doi.org/10.1016/j.biopha.2021.112243 [0394] D13. Raghavan K, Dedeepiya V D, Yamamoto N, Ikewaki N, Sonoda T, Kurosawa G, Iwasaki M, Kandaswamy R, Senthilkumar R, Preethy S, Abraham S J K. Beneficial reconstitution of gut microbiota and control of alpha-synuclein and curli-amyloids-producing enterobacteria, by beta 1,3-1,6 glucans in a clinical pilot study of autism and potentials in neurodegenerative diseases. medRxiv 2021.10.26.21265505; doi: 10.1101/2021.10.26.21265505 [0395] D14. Bashir K M I, Choi J S. Clinical and Physiological Perspectives of -Glucans: The Past, Present, and Future. Int J Mol Sci. 2017 Sep. 5; 18(9):1906. [0396] D15. Ikewaki N, Fujii N, Onaka T, Ikewaki S, Inoko H. Immunological actions of Sophy beta-glucan (beta-1,3-1,6 glucan), currently available commercially as a health food supplement. Microbiol Immunol. 2007; 51(9):861-73. [0397] D16. Ikewaki N, Onaka T, Ikeue Y, Nagataki M, Kurosawa G, Dedeepiya V D, Rajmohan M, Vaddi S, Senthilkumar R, Preethy S, Abraham S J K. Beneficial effects of the AFO-202 and N-163 strains of Aureobasidium pullulans produced 1,3-1,6 beta glucans on non-esterified fatty acid levels in obese diabetic KKAy mice: A comparative study.bioRxiv 2021.07.22.453362; doi: 10.1101/2021.07.22.453362 [0398] D17. Ikewaki N, Sonoda T, Kurosawa G, Iwasaki M, Dedeepiya V D, Senthilkumar R, Preethy S, Abraham S J K. Immune and metabolic beneficial effects of Beta 1,3-1,6 glucans produced by two novel strains of Aureobasidium pullulans in healthy middle-aged Japanese men: An exploratory study. medRxiv 2021.08.05.21261640; doi: 10.1101/2021.08.05.21261640 [0399] D18. STAM Model. https://www.smccro-lab.com/service/service_disease_area/stam.html [0400] D19. Nakashima A, Sugimoto R, Suzuki K, Shirakata Y, Hashiguchi T, Yoshida C, Nakano Y Anti-fibrotic activity of Euglena gracilis and paramylon in a mouse model of non-alcoholic steatohepatitis. Food Sci Nutr. 2018; 7(1):139-147 [0401] D20. Dantzer R. Neuroimmune Interactions: From the Brain to the Immune System and Vice Versa. Physiol Rev. 2018 Jan. 1; 98(1):477-504. [0402] D21. KolodziejczykAA, Zheng D, Shibolet O, Elinav E. The role of the microbiome in NAFLD and NASH. EMBO Mol Med. 2019 February; 11(2):e9302. doi: 10.15252/emmm.201809302. PMID: 30591521; PMCID: PMC6365925. [0403] D22. Chen J, Vitetta L. Gut Microbiota Metabolites in NAFLD Pathogenesis and Therapeutic Implications. Int J Mol Sci. 2020 Jul. 23; 21(15):5214. doi: 10.3390/ijms21155214. PMID: 32717871; PMCID: PMC7432372. [0404] D23. Kang D W, Adams J B, Vargason T, Santiago M, Hahn J, Krajmalnik-Brown R. Distinct Fecal and Plasma Metabolites in Children with Autism Spectrum Disorders and Their Modulation after Microbiota Transfer Therapy. mSphere. 2020 Oct. 21; 5(5):e00314-20. doi: 10.1128/mSphere. 00314-20. PMID: 33087514; PMCID: PMC7580952. [0405] D24. Vascellari S, Palmas V, Melis M, Pisanu S, Cusano R, Uva P, Perra D, Madau V, Sarchioto M, Oppo V, Simola N, Morelli M, Santoru M L, Atzori L, Melis M, Cossu G, Manzin A. Gut Microbiota and Metabolome Alterations Associated with Parkinson's Disease. mSystems. 2020 Sep. 15; 5(5):e00561-20. doi: 10.1128/mSystems. 00561-20. PMID: 32934117; PMCID: PMC7498685. [0406] D25. Gibson C M, Childs-Kean L M, Naziruddin Z, Howell C K. The alteration of the gut microbiome by immunosuppressive agents used in solid organ transplantation. Transpl Infect Dis. 2021 February; 23(1):e13397.