NUCLEIC ACID TARGETING PROPROTEIN CONVERTASE SUBTILISIN/KEXIN 9 AND USES THEREOF
20240376476 ยท 2024-11-14
Inventors
Cpc classification
C12Y304/21061
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to the technical field of biotechnology, and discloses a nucleic acid targeting proprotein convertase subtilisin/kexin 9 and uses thereof. The nucleic acid provided by the present disclosure can effectively inhibit the expression of PCSK9, thereby being capable of treating and/or preventing hyperlipidemia related diseases.
Claims
1. A nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand contains a sequence having at least 80% sequence identity to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO: 29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO: 41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO: 53, SEQ ID NO:55 or SEQ ID NO:57; the antisense strand contains a sequence having at least 80% sequence identity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO: 22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO: 34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO: 46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56 or SEQ ID NO: 58.
2. The nucleic acid of claim 1, wherein at least 80% sequence identity refers to that there is one different base between the sequences; the different base in the sense strand is the last base of the sense strand, the different base in the antisense strand is the first base of the antisense strand.
3. The nucleic acid of claim 1, wherein the sense strand has 16-30 nucleotides; and/or the antisense strand has 16-30 nucleotides.
4. The nucleic acid of claim 1, wherein the nucleic acid is at least one selected from siRNA-1 having a sense strand sequence of SEQ ID NO: 1 and an antisense strand sequence of SEQ ID NO:2, siRNA-2 having a sense strand sequence of SEQ ID NO:3 and an antisense strand sequence of SEQ ID NO: 4, siRNA-3 having a sense strand sequence of SEQ ID NO:5 and an antisense strand sequence of SEQ ID NO:6, siRNA-4 having a sense strand sequence of SEQ ID NO:7 and an antisense strand sequence of SEQ ID NO:8, siRNA-5 having a sense strand sequence of SEQ ID NO: 9 and an antisense strand sequence of SEQ ID NO: 10, siRNA-6 having a sense strand sequence of SEQ ID NO: 11 and an antisense strand sequence of SEQ ID NO: 12, siRNA-7 having a sense strand sequence of SEQ ID NO: 13 and an antisense strand sequence of SEQ ID NO:14, siRNA-8 having a sense strand sequence of SEQ ID NO:15 and an antisense strand sequence of SEQ ID NO: 16, siRNA-9 having a sense strand sequence of SEQ ID NO:17 and an antisense strand sequence of SEQ ID NO: 18, siRNA-10 having a sense strand sequence of SEQ ID NO: 19 and an antisense strand sequence of SEQ ID NO:20, siRNA-11 having a sense strand sequence of SEQ ID NO: 21 and an antisense strand sequence of SEQ ID NO:22, siRNA-12 having a sense strand sequence of SEQ ID NO:23 and an antisense strand sequence of SEQ ID NO:24, siRNA-13 having a sense strand sequence of SEQ ID NO:25 and an antisense strand sequence of SEQ ID NO:26, siRNA-14 having a sense strand sequence of SEQ ID NO:27 and an antisense strand sequence of SEQ ID NO:28, siRNA-15 having a sense strand sequence of SEQ ID NO:29 and an antisense strand sequence of SEQ ID NO:30, siRNA-16 having a sense strand sequence of SEQ ID NO:31 and an antisense strand sequence of SEQ ID NO:32, siRNA-17 having a sense strand sequence of SEQ ID NO:33 and an antisense strand sequence of SEQ ID NO:34, siRNA-18 having a sense strand sequence of SEQ ID NO:35 and an antisense strand sequence of SEQ ID NO:36, siRNA-19 having a sense strand sequence of SEQ ID NO:37 and an antisense strand sequence of SEQ ID NO: 38, siRNA-20 having a sense strand sequence of SEQ ID NO:39 and an antisense strand sequence of SEQ ID NO:40, siRNA-21 having a sense strand sequence of SEQ ID NO:41 and an antisense strand sequence of SEQ ID NO:42, siRNA-22 having a sense strand sequence of SEQ ID NO: 43 and an antisense strand sequence of SEQ ID NO:44, siRNA-23 having a sense strand sequence of SEQ ID NO:45 and an antisense strand sequence of SEQ ID NO:46, siRNA-24 having a sense strand sequence of SEQ ID NO:47 and an antisense strand sequence of SEQ ID NO:48, siRNA-25 having a sense strand sequence of SEQ ID NO:49 and an antisense strand sequence of SEQ ID NO:50, siRNA-26 having a sense strand sequence of SEQ ID NO:51 and an antisense strand sequence of SEQ ID NO:52, siRNA-27 having a sense strand sequence of SEQ ID NO:53 and an antisense strand sequence of SEQ ID NO:54, siRNA-28 having a sense strand sequence of SEQ ID NO:55 and an antisense strand sequence of SEQ ID NO:56, siRNA-29 having a sense strand sequence of SEQ ID NO:57 and an antisense strand sequence of SEQ ID NO: 58.
5. The nucleic acid of claim 1, wherein the nucleic acid is selected from a siRNA-23 having a sense strand sequence of SEQ ID NO: 45 and an antisense strand sequence of SEQ ID NO: 46, and having the modifications at the nucleotide as follows: TABLE-US-00006 5-GsCsCAAGCfCUfCUfUCUUACUUCA-3 5-UsGfsAAfGUfAAGAAGAGfGCfUUGGCsUsU-3 wherein the lowercase letter f indicates that the nucleotide adjacent to the left side of the letter f is a 2-fluoro modified nucleotide; the lowercase letter s indicates that two nucleotides adjacent to the left side and right side of the letter s are connected through a thiophosphate diester bond; the underlined nucleotide indicates that the 2 hydroxyl group of the nucleotide is substituted by methoxyl group.
6. A targeted drug delivery system comprising a target group, a linkage group, and the nucleic acid of claim 1 connected with the target group via the linkage group.
7. The targeted drug delivery system of claim 6, wherein the targeted drug delivery system has a structure as shown below: ##STR00014##
8. A pharmaceutical composition comprising the nucleic acid of claim 1, or the targeted drug delivery system of claim 6, and a pharmaceutically acceptable carrier.
9. A method of inhibiting PCSK9 comprising administering the nucleic acid of claim 1 to a patient suffering from the hyperlipidemia related diseases.
10. The method of claim 9, wherein the hyperlipidemia related diseases is at least one selected from coronary atherosclerosis heart disease, ischemic stroke, arteriosclerosis cerebral infarction, hypertension, diabetes mellitus, nephropathy and peripheral vascular diseases.
11. The method of claim 9, wherein the patient is a human patient.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
DETAILED DESCRIPTION
[0018] The terminals and any value of the ranges disclosed herein are not limited to the precise ranges or values, such ranges or values shall be comprehended as comprising the values adjacent to the ranges or values. As for numerical ranges, the endpoint values of the various ranges, the endpoint values and the individual point value of the various ranges, and the individual point values may be combined with one another to produce one or more new numerical ranges, which should be deemed have been specifically disclosed herein.
[0019] The present disclosure provides a (modified or unmodified) nucleic acid comprising a sense strand and an antisense strand, the sense strand contains a sequence having at least 80% sequence identity with a sequence set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO: 7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO:13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ
[0020] ID NO: 31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO: 43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO: 55 or SEQ ID NO:57; the antisense strand contains a sequence having at least 80% sequence identity with a sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8,SEQ ID NO:10, SEQ ID NO: 12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56 or SEQ ID NO: 58.
[0021] Wherein a sequence having at least 80% sequence identity refers to the circumstance of including 0, 1, 2, 3 or 4 different bases with the referred sequence, as well as the circumstance of additionally binding with more bases on the basis of 0, 1, 2, 3 or 4 different bases with the referred sequence. Furthermore, the different bases may be located anywhere in the referred sequence, but preferably, along the 5-3 direction, the different bases in the sense strand are the last 1-4 bases, and the different bases in the antisense strand are the first 1-4 bases.
[0022] More preferably, the sense strand has 16-30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) nucleotides (bases). More preferably, the antisense strand has 16-30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) nucleotides (bases).
[0023] In the present disclosure, the sense strand and the antisense strand may have the same or different length.
[0024] All the nucleotide acid groups in the aforesaid nucleic acid may be chemically unmodified, or contain at least one modified nucleotide group, and the modification may be on a random site of the nucleotide.
[0025] In preferred embodiments of the present disclosure, as shown in Table 1, the nucleic acid is at least one selected from siRNA-1 having a sense strand sequence of SEQ ID NO:1 and an antisense strand sequence of SEQ ID NO:2, siRNA-2 having a sense strand sequence of SEQ ID NO: 3 and an antisense strand sequence of SEQ ID NO:4, siRNA-3 having a sense strand sequence of SEQ ID NO:5 and an antisense strand sequence of SEQ ID NO:6, siRNA-4 having a sense strand sequence of SEQ ID NO:7 and an antisense strand sequence of SEQ ID NO:8, siRNA-5 having a sense strand sequence of SEQ ID NO:9 and an antisense strand sequence of SEQ ID NO:10, siRNA-6 having a sense strand sequence of SEQ ID NO:11 and an antisense strand sequence of SEQ ID NO: 12, siRNA-7 having a sense strand sequence of SEQ ID NO: 13 and an antisense strand sequence of SEQ ID NO:14, siRNA-8 having a sense strand sequence of SEQ ID NO:15 and an antisense strand sequence of SEQ ID NO:16, siRNA-9 having a sense strand sequence of SEQ ID NO: 17 and an antisense strand sequence of SEQ ID NO:18, siRNA-10 having a sense strand sequence of SEQ ID NO: 19 and an antisense strand sequence of SEQ ID NO:20, siRNA-11 having a sense strand sequence of SEQ ID NO:21 and an antisense strand sequence of SEQ ID NO:22, siRNA-12 having a sense strand sequence of SEQ ID NO:23 and an antisense strand sequence of SEQ ID NO:24, siRNA-13 having a sense strand sequence of SEQ ID NO:25 and an antisense strand sequence of SEQ ID NO:26, siRNA-14 having a sense strand sequence of SEQ ID NO:27 and an antisense strand sequence of SEQ ID NO:28, siRNA-15 having a sense strand sequence of
[0026] SEQ ID NO:29 and an antisense strand sequence of SEQ ID NO:30, siRNA-16 having a sense strand sequence of SEQ ID NO:31 and an antisense strand sequence of SEQ ID NO:32, siRNA-17 having a sense strand sequence of SEQ ID NO:33 and an antisense strand sequence of SEQ ID NO: 34, siRNA-18 having a sense strand sequence of SEQ ID NO:35 and an antisense strand sequence of SEQ ID NO:36, siRNA-19 having a sense strand sequence of SEQ ID NO:37 and an antisense strand sequence of SEQ ID NO:38, siRNA-20 having a sense strand sequence of SEQ ID NO: 39 and an antisense strand sequence of SEQ ID NO:40, siRNA-21 having a sense strand sequence of SEQ ID NO:41 and an antisense strand sequence of SEQ ID NO:42, siRNA-22 having a sense strand sequence of SEQ ID NO:43 and an antisense strand sequence of SEQ ID NO:44, siRNA-23 having a sense strand sequence of SEQ ID NO:45 and an antisense strand sequence of SEQ ID NO:46, siRNA-24 having a sense strand sequence of SEQ ID NO:47 and an antisense strand sequence of SEQ ID NO:48, siRNA-25 having a sense strand sequence of SEQ ID NO:49 and an antisense strand sequence of SEQ ID NO:50, siRNA-26 having a sense strand sequence of SEQ ID NO:51 and an antisense strand sequence of SEQ ID NO:52, siRNA-27 having a sense strand sequence of SEQ ID NO:53 and an antisense strand sequence of SEQ ID NO:54, siRNA-28 having a sense strand sequence of SEQ ID NO:55 and an antisense strand sequence of SEQ ID NO: 56, siRNA-29 having a sense strand sequence of SEQ ID NO:57 and an antisense strand sequence of SEQ ID NO: 58.
[0027] The nucleic acid according to the present disclosure, wherein the nucleic acid comprises a nucleotide group as the basic structural unit, the nucleotide group comprising a phosphate group, a ribose group and a base group, preferably the nucleic acid comprises at least one modified nucleotide group. The modification will not result in the functional loss of the nucleic acid inhibiting the PCSK9, or the modified nucleic acid has an efficiency of inhibiting PCSK9 not less than 50% (e.g., 50%, 51%, 52%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) of the nucleic acid before modification.
[0028] The nucleic acid according to the present disclosure, wherein the modified nucleotide group is a nucleotide group in which the phosphate group and/or the ribose group is modified. The site with a modification may be at least the site 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of the nucleotides at the site 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of the sense strand and/or the antisense strand.
[0029] For example, modification of the phosphate group refers to the modification of oxygen in the phosphate group, including phosphorothioate modification and boranophosphate modification, etc. The oxygen in the phosphate group is substituted by sulfur, borane, amidogen, alkyl or alkoxy, respectively, as shown in the formulae below. Each of the modifications can stabilize structure of the nucleic acid, maintain high specificity and high affinity for the base pairing.
##STR00001## ##STR00002##
[0030] In the above structural formula, Base denotes the base A, U, C, G or T. X may be oxygen (O) or sulfur(S). R may be the same or different in the above structure, such as hydrogen (H), fluorine (F), methoxyl (OME) or Methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, amino, cyanoethyl, acetyl etc.; Rand R may each independently be hydrogen (H), methyl (CH.sub.3), ethyl (CH.sub.2CH.sub.3), propyl (CH.sub.2CH.sub.2CH.sub.3), isopropyl (CH(CH.sub.3).sub.2), allyl, propargyl, acyloxybenzyl and acyloxyethyl.
[0031] Modification of the ribose group refers to modification of the 2-hydroxyl group (2-OH) in the ribose group. After introducing certain substituents (e.g., methoxyl or fluorine) at the 2-hydroxyl of the ribose group, the nucleic acid is not readily cleaved by ribonuclease, thereby enhancing stability of the nucleic acid and allowing the nucleic acid to be more resistant to hydrolysis by the nuclease. Modifications of the 2-hydroxyl group in the nucleotide pentose include 2-fluoro modification (e.g., 2-arabino-fluoro modification), 2-methoxy modification (2- OME), 2-methoxyethyl modification (2-MOE), 2-2,4-dinitrophenol modification (2-DNP modification), 2,4-constrained ethyl modification, 2-Amino modification, 2-Deoxy modification, BNA, acyclic nucleic acid modification, mal-positioned nucleic acid modification, L-type nucleic acid modification and the like. BNA (internal ring bridged nucleotide) refers to a constrained or inaccessible nucleotide. BNA can contain a bridging structure of a five-, six-, or seven-membered ring. The bridge is typically incorporated into the 2-, 4-position of the ribose ring to provide the 2,4-BNA nucleotides such as locked ethyl modification (LNA), constrained ethyl modification (ENA), and constrained ethyl bicyclic nucleic acid modification (cET BNA). Acyclic nucleic acid is a nucleotide formed after the ribose ring of the nucleotide is opened, such as unlocked nucleic acid (UNA) nucleotides and glycerol nucleic acid (GNA) nucleotides. Mal-positioned nucleic acid modification refers to a 3,5-phosphate bond linkage substituted by the 2,5-phosphate bond linkage. L-type nucleic acid modification refers to a naturally occurring D-type nucleic acid being substituted by its mirror-stereoscopic counterpart L-type nucleic acid.
##STR00003## ##STR00004##
[0032] In the above structural formula, Base denotes the base A, U, C, G or T. R may be the same or different in the above structure, such as hydrogen (H), fluorine (F), methoxyl (OME) or Methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl and acetyl.
[0033] The nucleic acid according to the present disclosure, wherein the nucleotide group in which the ribose group is modified is preferably the nucleotide group in which the 2-OH of the ribose group is substituted by methoxyl or fluorine.
[0034] According to a particularly preferred embodiment of the present disclosure, wherein the sense strand of nucleic acid comprising the nucleotide group of uracil base or cytosine base, which is the nucleotide group in which the ribose group is modified, that is, the 2-OH of the ribose group in the sense strand of nucleic acid comprising the nucleotide group of uracil base or cytosine base is substituted by methoxyl or fluorine. More preferably, the 3-end of both the sense strand and antisense strand of nucleic acid may be linked with dTdT; alternatively, the 3-end of the antisense strand of nucleic acid may be linked with AA or UU, or any combination of two nucleic acids (the nucleic acids may be but are not limited to CC, GG or UG), to provide the sequence with specificity as inducement to mRNA degradation. Nucleic acids with such modifications exhibit more excellent in vivo inhibitory effect, and said modifications may further reduce the in vivo immunogenicity of the nucleic acids of the present disclosure.
[0035] The nucleic acid of the present disclosure may further comprise the modification in which a monophosphate nucleoside is linked to the 5-end of the antisense strand. The 5-monophosphate at the end of the guide strand of the siRNA is important for RISC recognition. Wherein phosphorylation of the 5-hydroxyl group plays a certain role on whether the siRNA can be effectively loaded on the intracellular Ago2. The monophosphate at 5-end of the guide strand in the siRNA has interaction with Argonaute-2 (Ago2) through the Hydrogen bond, in order to ensure accurate targeting and precise cleavage of the mRNA target. Several derivatives of the 5-monophosphate nucleosides are commonly used, this type of derivative of the phosphate nucleoside has been proven to exhibit certain stability in the biological metabolism medium, and to play a certain role in facilitating the loading of siRNA guide strand on the intracellular Ago2 (Nucleic Acids Research, 2015, 43, 2993-3011). The nucleic acid according to the present disclosure, wherein the trans-vinyl phosphate (VP) is preferably the first choice, the nucleic acid may comprise derivatives of the monophosphate nucleoside other than those mentioned above.
##STR00005##
[0036] In the above structural formula, Base denotes the base A, U, C, G or T. R may be the same or different in the above structure, such as hydrogen (H), fluorine (F), methoxyl (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, amino and acetyl.
[0037] According to the preferred embodiments of the present disclosure, the base sequences of the modified nucleic acids and the modification modes are as shown in Table 2 (f, s, underlined), i.e., the sense strand and antisense strand of the modified nucleic acids siRNA-9, siRNA-13, siRNA-16, siRNA-19 and siRNA-23 have the modifications indicated by f, s and underline as shown in Table 2, and the 3 end of the antisense strand is further connected with UU.
[0038] In a particularly preferred embodiment, the nucleic acid is selected from siRNA-23 having a sense strand sequence of SEQ ID NO: 45 and an antisense strand sequence of SEQ ID NO: 46, and having the modifications at the nucleotide as follows:
TABLE-US-00001 5-GsCsCAAGCfCUfCUfUCUUACUUCA-3 5-UsGfsAAfGUfAAGAAGAGfGCfUUGGCsUsU-3
[0039] wherein the lowercase letter f indicates that the nucleotide adjacent to the left side of the letter f is a 2-fluoro modified nucleotide (i.e., the 2-OH of the pentose in the nucleotide is substituted by fluorine); the lowercase letter s indicates that two nucleotides adjacent to the left side and right side of the letter s are connected through a thiophosphate diester bond (i.e., the non- bridging oxygen atom in the phosphodiester bond is substituted by sulfur atom); the underlined nucleotide indicates that the 2 hydroxyl group of the nucleotide is substituted by methoxyl group. Such modifications result in higher in vivo activity of the nucleic acid (siRNA).
[0040] The nucleic acid according to the present disclosure can be obtained by conventional methods in the art, for example through the solid-phase synthesis and solution-phase synthesis, wherein the solid-phase synthesis has the commercial customization service, thus it is commercially available. The modified nucleotide group can be introduced by means of the nucleotide monomer having the corresponding modification.
[0041] Based on the synthesized nucleic acid (siRNA) mentioned above, the present disclosure can further construct an expression plasmid of the shRNA having the identical or similar function with the siRNA, and the method for constructing the expression plasmid is well-known among those skilled in the art, the content will not be described in detail herein.
[0042] The present disclosure further provides a target gene sequence of a nucleic acid as described above. In some embodiments, the target gene sequence is set forth in any item of column 2 of Table 1.
TABLE-US-00002 TABLE1 Sense Antisense Target strand strand gene sequence sequence No. sites (5-3) (5-3) 1 3317-3337 AGCUCGGUGAGUG UCUGCCAUCACUCAC AUGGCAGA(1) CGAGCU(2) 2 3318-3336 GCUCGGUGAGUGA CUGCCAUCACUCACC UGGCAG(3) GAGC(4) 3 3183-3201 GCUCACACAGCAG CAGUUCCUGCUGUGU GAACUG(5) GAGC(6) 4 2117-2135 AGUCAAGGAGCAU GAUUCCAUGCUCCUU GGAAUC(7) GACU(8) 5 2730-2748 UCCUCAGGUCUCC CUUGGUGGAGACCUG ACCAAG(9) AGGA(10) 6 2890-2908 UGGAGGCUUAGCU CCAGAAAGCUAAGCC UUCUGG(11) UCCA(12) 7 3199-3217 CUGAGCCAGAAAC AUCUGCGUUUCUGGC GCAGAU(13) UCAG(14) 8 1889-1907 CUGCAGCGUCCAC AGCUGUGUGGACGCU ACAGCU(15) GCAG(16) 9 3318-3338 GCUCGGUGAGUGA UUCUGCCAUCACUCA UGGCAGAA(17) CCGAGC(18) 10 626-644 GCAUGUCUUCCAU AAGGCCAUGGAAGAC GGCCUU(19) AUGC(20) 11 827-845 GGUGGAGGUGUAU UAGGAGAUACACCUC CUCCUA(21) CACC(22) 12 893-911 GGUCACCGACUUC AUUCUCGAAGUCGGU GAGAAU(23) GACC(24) 13 893-913 GGUCACCGACUUC ACAUUCUCGAAGUCG GAGAAUGU(25) GUGACC(26) 14 3039-3059 AGCCAUCACCUAG AGUCAGUCCUAGGUG GACUGACU(27) AUGGCU(28) 15 2612-2632 GCAUUUCACCAUU CCUGUUUGAAUGGUG CAAACAGG(29) AAAUGC(30) 16 3466-3484 CCCAAGCAAGCAG AAAUGUCUGCUUGCU ACAUUU(31) UGGG(32) 17 3433-3451 CCAACAACUGUCC AAGGAGGGACAGUUG CUCCUU(33) UUGG(34) 18 3399-3418 GGAGAUGCUUCUA AUGCCUUAGAAGCAU AGGCAU(35) CUCC(36) 19 3192-3210 GCAGGAACUGAGC UUUCUGGCUCAGUUC CAGAAA(37) CUGC(38) 20 2900-2918 GCUUUCUGGAUGG UAGAUGCCAUCCAGA CAUCUA(39) AAGC(40) 21 2880-2898 CCCUGAUUAAUGG AAGCCUCCAUUAAUC AGGCUU(41) AGGG(42) 22 2744-2762 CCAAGGAGGCAGG AAGAAUCCUGCCUCC AUUCUU(43) UUGG(44) 23 3233-3253 GCCAAGCCUCUUC UGAAGUAAGAAGAGG UUACUUCA(45) CUUGGC(46) 24 2969-2989 GGGCAUUUCACCA AGUAAAGGUGGCUCA UUCAAACA(47) GGUUUC(48) 25 2978-2998 GCCACCUUUACUC AUAGAGCAGAGUAAA UGCUCUAU(49) GGUGGC(50) 26 3471-3489 GCAAGCAGACAUU AAGAUAAAUGUCUGC UAUCUU(51) UUGC(52) 27 2610-2628 GGGCAUUUCACCA UUUGAAUGGUGAAAU UUCAAA(53) GCCC(54) 28 2612-2630 GCAUUUCACCAUU UGUUUGAAUGGUGAA CAAACA(55) AUGC(56) 29 2722-2740 GCAUUCAAUCCUC AGACCUGAGGAUUGA AGGUCU(57) AUGC(58) Note: (1)recited in columns 3-4 denotes SEQ ID NO: 1, the number 3317-3337recited in column 2 represents nucleotides at sites 3317-3337 in PCSK9 gene sequence, and the like.
[0043] The coding sequence of human PCSK9 (NM_174936.4, SEQ ID NO: 59):
TABLE-US-00003 1 agcgacgtcgaggcgctcatggttgcaggcgggcgccgccgttcagttcagggtctgagc 61 ctggaggagtgagccaggcagtgagactggctcgggcgggccgggacgcgtcgttgcagc 121 agcggctcccagctcccagccaggattccgcgcgccccttcacgcgccctgctcctgaac 181 ttcagctcctgcacagtcctccccaccgcaaggctcaaggcgccgccggcgtggaccgcg 241 cacggcctctaggtctcctcgccaggacagcaacctctcccctggccctcatgggcaccg 301 tcagctccaggcggtcctggtggccgctgccactgctgctgctgctgctgctgctcctgg 361 gtcccgcgggcgcccgtgcgcaggaggacgaggacggcgactacgaggagctggtgctag 421 ccttgcgttccgaggaggacggcctggccgaagcacccgagcacggaaccacagccacct 481 tccaccgctgcgccaaggatccgtggaggttgcctggcacctacgtggtggtgctgaagg 541 aggagacccacctctcgcagtcagagcgcactgcccgccgcctgcaggcccaggctgccc 601 gccggggatacctcaccaagatcctgcatgtcttccatggccttcttcctggcttcctgg 661 tgaagatgagtggcgacctgctggagctggccttgaagttgccccatgtcgactacatcg 721 aggaggactcctctgtctttgcccagagcatcccgtggaacctggagcggattacccctc 781 cacggtaccgggcggatgaataccagccccccgacggaggcagcctggtggaggtgtatc 841 tcctagacaccagcatacagagtgaccaccgggaaatcgagggcagggtcatggtcaccg 901 acttcgagaatgtgcccgaggaggacgggacccgcttccacagacaggccagcaagtgtg 961 acagtcatggcacccacctggcaggggtggtcagcggccgggatgccggcgtggccaagg 1021 gtgccagcatgcgcagcctgcgcgtgctcaactgccaagggaagggcacggttagcggca 1081 ccctcataggcctggagtttattcggaaaagccagctggtccagcctgtggggccactgg 1141 tggtgctgctgcccctggcgggtgggtacagccgcgtcctcaacgccgcctgccagcgcc 1201 tggcgagggctggggtcgtgctggtcaccgctgccggcaacttccgggacgatgcctgcc 1261 tctactccccagcctcagctcccgaggtcatcacagttggggccaccaatgcccaagacc 1321 agccggtgaccctggggactttggggaccaactttggccgctgtgtggacctctttgccc 1381 caggggaggacatcattggtgcctccagcgactgcagcacctgctttgtgtcacagagtg 1441 ggacatcacaggctgctgcccacgtggctggcattgcagccatgatgctgtctgccgagc 1501 cggagctcaccctggccgagttgaggcagagactgatccacttctctgccaaagatgtca 1561 tcaatgaggcctggttccctgaggaccagcgggtactgacccccaacctggtggccgccc 1621 tgccccccagcacccatggggcaggttggcagctgttttgcaggactgtatggtcagcac 1681 actcggggcctacacggatggccacagccgtcgcccgctgcgccccagatgaggagctgc 1741 tgagctgctccagtttctccaggagtgggaagcggcggggcgagcgcatggaggcccaag 1801 ggggcaagctggtctgccgggcccacaacgcttttgggggtgagggtgtctacgccattg 1861 ccaggtgctgcctgctaccccaggccaactgcagcgtccacacagctccaccagctgagg 1921 ccagcatggggacccgtgtccactgccaccaacagggccacgtcctcacaggctgcagct 1981 cccactgggaggtggaggaccttggcacccacaagccgcctgtgctgaggccacgaggtc 2041 agcccaaccagtgcgtgggccacagggaggccagcatccacgcttcctgctgccatgccc 2101 caggtctggaatgcaaagtcaaggagcatggaatcccggcccctcaggagcaggtgaccg 2161 tggcctgcgaggagggctggaccctgactggctgcagtgccctccctgggacctcccacg 2221 tcctgggggcctacgccgtagacaacacgtgtgtagtcaggagccgggacgtcagcacta 2281 caggcagcaccagcgaaggggccgtgacagccgttgccatctgctgccggagccggcacc 2341 tggcgcaggcctcccaggagctccagtgacagccccatcccaggatgggtgtctggggag 2401 ggtcaagggctggggctgagctttaaaatggttccgacttgtccctctctcagccctcca 2461 tggcctggcacgaggggatggggatgcttccgcctttccggggctgctggcctggccctt 2521 gagtggggcagcctccttgcctggaactcactcactctgggtgcctcctccccaggtgga 2581 ggtgccaggaagctccctccctcactgtggggcatttcaccattcaaacaggtcgagctg 2641 tgctcgggtgctgccagctgctcccaatgtgccgatgtccgtgggcagaatgacttttat 2701 tgagctcttgttccgtgccaggcattcaatcctcaggtctccaccaaggaggcaggattc 2761 ttcccatggataggggagggggcggtaggggctgcagggacaaacatcgttggggggtga 2821 gtgtgaaaggtgctgatggccctcatctccagctaactgtggagaagcccctgggggctc 2881 cctgattaatggaggcttagctttctggatggcatctagccagaggctggagacaggtgc 2941 gcccctggtggtcacaggctgtgccttggtttcctgagccacctttactctgctctatgc 3001 caggctgtgctagcaacacccaaaggtggcctgcggggagccatcacctaggactgactc 3061 ggcagtgtgcagtggtgcatgcactgtctcagccaacccgctccactacccggcagggta 3121 cacattcgcacccctacttcacagaggaagaaacctggaaccagagggggcgtgcctgcc 3181 aagctcacacagcaggaactgagccagaaacgcagattgggctggctctgaagccaagcc 3241 tcttcttacttcacccggctgggctcctcatttttacgggtaacagtgaggctgggaagg 3301 ggaacacagaccaggaagctcggtgagtgatggcagaacgatgcctgcaggcatggaact 3361 ttttccgttatcacccaggcctgattcactggcctggcggagatgcttctaaggcatggt 3421 cgggggagagggccaacaactgtccctccttgagcaccagccccacccaagcaagcagac 3481 atttatcttttgggtctgtcctctctgttgcctttttacagccaacttttctagacctgt 3541 tttgcttttgtaacttgaagatatttattctgggttttgtagcatttttattaatatggt 3601 gactttttaaaataaaaacaaacaaacgttgtcctaa
[0044] The present disclosure also provides a targeted drug delivery system comprising a target group, a linkage group, and the aforementioned nucleic acid connected with the targeted group via the linkage group. Wherein the targeted group is capable of further improving targeting performance of the small nucleic acid, it may be provided by a monosaccharide (e.g., glucose, mannose, allose, altrose, galactose, galactosamine, N-acetylgalactosamine, talose, fructose, idose) and/or a polypeptide (e.g., protein, monoclonal antibody, nanoparticle). The linkage group may be selected from-O-[CH.sub.2CH.sub.2O].sub.n-, -[CH.sub.2O].sub.m13 CONH[CH.sub.2].sub.nO, O-[CH.sub.2CH.sub.2O].sub.mCONH[CH.sub.2].sub.nO, O[CH.sub.2].sub.mCONH [CH.sub.2H.sub.2O].sub.nO. Wherein m and n each may independently be an integer from 1 to 10.
[0045] According to a preferred embodiment of the present disclosure, the targeted drug delivery system has a structure shown below, wherein Nu represents a nucleic acid (siRNA) of the present disclosure, wherein the compound moiety can be coupled with the 5 end or the 3 end of the sense strand of siRNA via a phosphodiester bond, or can be coupled with the 5 end or the 3 end of the antisense strand of siRNA via a phosphodiester bond. Specifically, the compound moiety can be synthesized with a nucleoside monomer or a nucleoside attached to a solid phase carrier under coupling reaction conditions and in the presence of a coupling reagent, thereby allowing the compound moiety to be attached to the nucleic acid via coupling reaction. The targeted drug delivery system can improve the cell penetrating capability of the nucleic acid drug (Nu) by using the structural characteristics on the left side thereof, thereby enhance the stability of Nu in cells, and the preparation process is simple and highly practical.
##STR00006##
[0046] The present disclosure further provides a pharmaceutical composition comprising the aforementioned nucleic acid or targeted drug delivery system and a pharmaceutically acceptable carrier. The pharmaceutical composition can be prepared with the nucleic acid and the pharmaceutically acceptable carrier through conventional method. For example, the pharmaceutical composition may be an injection solution. The injection solution can be used for subcutaneous, intramuscular or intravenous injection.
[0047] The pharmaceutical composition according to the present disclosure, wherein the dosage
[0048] of nucleic acid or the targeted drug delivery system and the pharmaceutically acceptable carrier are not particularly defined, typically the amount of the pharmaceutically acceptable carrier may be within a range of 1-100,000 parts by weight (e.g. 1 part by weight, 5 parts by weight, 10 parts by weight, 50 parts by weight, 100 parts by weight, 500 parts by weight, 1,000 parts by weight, 5,000 parts by weight, 10,000 parts by weight, 50,000 parts by weight, 100,000 parts by weight or a random value between any two numerical values mentioned above) relative to 1 part by weight of the nucleic acid (or 1 part by weight of the targeted drug delivery system calculated in terms of the nucleic acid).
[0049] The pharmaceutical composition according to the present disclosure, wherein the pharmaceutically acceptable carrier may be various carrier conventionally used in the art, for example, the pharmaceutically acceptable carrier may include at least one of a pH buffer solution, a protective agent and an osmotic pressure conditioning agent. The pH buffer solution may be a tri (hydroxymethyl) aminomethane hydrochloride buffer having a pH of 7.5-8.5 and/or a phosphate buffer having a pH of 5.5-8.5, preferably a phosphate buffer having a pH of 5.5-8.5. The protective agent may be at least one of inositol, sorbitol and sucrose. The protective agent may be contained in an amount of 0.01-30 wt. % (e.g., 0.01 wt. %, 0.05 wt. %, 0.1 wt. %, 0.5 wt. %, 1 wt. %, 5 wt. %, 10 wt. %, 15 wt. %, 20 wt. %, 25 wt. %, 30 wt. % or a random value between any two numerical values thereof) based on the total weight of the pharmaceutical composition. The osmotic pressure conditioning agent may be sodium chloride and/or potassium chloride. The osmotic pressure conditioning agent is contained in an amount such that the osmotic pressure of the pharmaceutical composition is within a range of 200-700 milliosmols per kilogram. The amount of the osmotic pressure conditioning agent may be determined by those skilled in the art based on the desired osmotic pressure.
[0050] According to a preferred embodiment of the present disclosure, the pharmaceutically acceptable carrier is a liposome. The liposome may be any liposome capable of encapsulating nucleic acid, it may have a diameter of 25-1,000 nm, and may include but not limited to the cholesterol and analog or derivative thereof.
[0051] The dosage of the pharmaceutical composition according to the present disclosure may be
[0052] a conventional dosage in the art, the dosage may be determined according to various parameters, in particular the age, body weight and sex of a subject. For example, for female mice having a weight of 25-30 g at an age of 3-4 months, the pharmaceutical composition may be used in a dosage of 0.01-100 mg/kg body weight, preferably 1-10 mg/kg body weight, based on the amount of nucleic acid in the pharmaceutical composition.
[0053] The present disclosure also provides an use of the aforementioned nucleic acid, targeted drug delivery system or pharmaceutical composition in manufacture a medicament for treating and/or preventing hyperlipidemia related diseases. In the pharmaceutical composition for treating and/or preventing hyperlipidemia related diseases, the nucleic acid functions mainly through the mechanism of RNA interference.
[0054] The present disclosure further provides an use of the aforementioned nucleic acid, targeted drug delivery system or pharmaceutical composition in manufacture a medicament for reducing the expression level of proprotein convertase subtilisin/kexin 9 (e.g., in serum or liver).
[0055] The present disclosure also provides a method of inhibiting PCSK9, the method comprises administering the nucleic acid and/or pharmaceutical composition to a patient suffering from the hyperlipidemia related diseases. inhibiting refers to silencing the gene expression of PCSK 9. The patient may be a mammal, preferably a primate, more preferably a human. Administration may be performed through various routes, depending on whether the local or systemic treatment is required. The administration mode may be, but is not limited to, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, transdermal administration (e.g., by implantation of a device), and intra soft tissue administration. Hyperlipidemia related diseases may include coronary atherosclerosis heart disease,
[0056] ischemic stroke, arteriosclerosis cerebral infarction, hypertension, diabetes mellitus, nephropathy (or kidney disease), peripheral vascular diseases and the like.
[0057] In addition, the present disclosure further provides a method of inhibiting PCSK9 in vitro, the method comprises introducing the nucleic acid and/or pharmaceutical composition into a cell.
[0058] The present disclosure will describe in detail below with reference to examples. Unless
[0059] otherwise specified in the present disclosure, the reagents and culture media used therein are commercially available, the nucleic acid electrophoresis and other operations used in the present disclosure is performed in a conventional manner.
Example 1
[0060] The siRNA-1 to siRNA-29 listed in Table 1 were obtained by a solid phase synthesis method. 0.5 ml of cell culture fluid (DMEM, 10% FBS) containing 10.sup.5 Hep3B cells was added into a 24-well cell culture dish, and cultured overnight in a cell culture vessel containing 5% CO.sub.2 at the temperature of 37 C. Lipofectamine RNAiMAX (1-2 microliters/well) and small interfering nucleic acid siRNA-1 to siRNA-29 as shown in Table 1 were added into the serum-free cell culture fluid, and the serum-free cell culture fluid was added into the cell culture wells such that the final concentration of small interfering nucleic acid per well was 33 nM or 100 nM, and continued to culture for 48 hours in the cell culture vessel containing 5% CO.sub.2 at the temperature of 37 C. In order to extract RNA, the cell culture supernatant was pipetted completely, washed with PBS, and after pipetting completely, the RNA was extracted according to the operating instruction of the
[0061] RNAeasy Mini kit (QIAGEN, Article No. 74104). RT-PCR was performed according to the recommendation of High Capacity cDNA Reverse Transcription Kits (Thermo Fisher, Article No. 4368814), and 0.5 or 1 ug of RNA was contained in each reaction. The gene expression was quantified by using the real-time fluorescence PCR method, and the TaqMan probe of human PCSK9 was Hs00545399_m1, and the probe of the internal reference gene (human HPRT1) was Hs02800695_ml (Thermo Fisher Scientific, Waltham, MA, USA). The PCR conditions were 1 cycle for 20 sec at the temperature of 95 C., 40 cycles for 1 sec at 95 C. and 20 sec at 60 C., and the real-time fluorescence PCR instrument was StepOne Plus (Thermo Fisher). The PCSK9 gene expression was calculated based on the 2{circumflex over ()}-Ct, and the human HPRT1 gene expression was used as the internal reference. The expression level of PCSK9 gene was expressed as a percentage of treated group vs. control group (using RNAiMAX only) (see Table 2).
TABLE-US-00004 TABLE 2 No. 33 nM (%) 100 nM (%) 1 38.9 32.0 2 43.5 59.1 3 28.1 25.7 4 22.4 21.6 5 55.4 56.2 6 37.6 62.9 7 39.8 59.8 8 85.1 111.7 9 34.1 31.2 10 27.7 30.5 11 73.4 70.7 12 61.7 58.7 13 15.7 11.5 14 18.6 17.4 15 16.6 13.7 16 16.0 12.8 17 54.1 47.8 18 20.7 17.1 19 22.1 16.9 20 18.0 15.8 21 16.4 12.7 22 23.6 12.6 23 22.8 18.4 24 63.5 52.2 25 24.4 16.7 26 23.4 16.2 27 20.6 20.3 28 28.2 17.0 29 33.5 18.6
Example 2
[0062] (I) Preparation of siRNA drug according to the following steps.
Synthesis of Conjugate (603A)
[0063] 1. Compound 7 was prepared according to the following route:
##STR00007##
Synthesis of Compound Oxazoline 5
[0064] N-acetylgalactosamine tetraacetate 4 (10 g, 25.68 mmol) was dissolved in dichloroethane (60 mL) at room temperature, trimethylsilyl trifluoromethanesulfonate (8.6 g, 38.66 mmol) was added to the aforesaid solution under the stirring condition, stirring was continued and the solution was heated to 50 C. After reaction at 50 C. for 2 hours, the heating was stopped, and the stirring was continued for 12 hours at room temperature. The solution was poured into ice water containing saturated sodium bicarbonate, extracted with dichloromethane, and the organic phase was subjected to washing with water. The organic phase was separated out, and dried after adding anhydrous sodium sulfate, and evaporated and dried in reduced pressure to obtain a brownish-yellow foamy syrup-shaped compound 5. The compound 5 was directly used in the next step.
Synthesis of Compound 6
[0065] The compound oxazoline 5 (4.26 g, 12.9 mmol) was dissolved in dichloromethane (20 mL) at room temperature, and mixed with a solution of dry dichloromethane (20 mL) dissolved with 2-[2-(2-azidoethoxy) ethoxy] ethanol (3.4 g, 19 mmol) and stirred under the temperature condition of 0 C. Trimethylsilyl trifluoromethanesulfonate (TMSOTf, 1.4 g, 6.45 mmol) was added slowly at 0 C. into the solution and stirred for 1 hour. The mixed solution was stirred continuously for 14 hours at room temperature, the solution was then poured into ice water containing saturated sodium bicarbonate, extracted with dichloromethane (250 mL), and the organic phase was subjected to washing with water. The organic phase was separated out, and dried with anhydrous sodium sulfate, and rotary evaporated and concentrated in reduced pressure to a semi-dry state. Purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially rinsed with a mixed solvent (containing ethyl acetate/methanol, 10:1, v/v), the product components were collected, and the solvent was drained under reduced pressure to obtain the near-white compound 6 (5.3g, 81%). .sup.1H NMR (CDCl.sub.3): , 6.15 (d, 1H, NH), 5.32 (d, 1H, sugar-H-4), 5.07 (dd, 1H, J=11.2 Hz, J=3.3 Hz, sugar-H-3), 4.76 (d, 1H, J=8.6 Hz, sugar-H-1), 4.17 (m, 3H, sugar-H-2, sugar-H-6), 3.91 (m, 2H, CH.sub.2O), 3.89 (m, 1H, suger-H-5), 3.76-3.61 (m, 8H, CH.sub.2O), 3.47 (m, 2H, CH2N3), 2.16 (s, 3H, CH3, NHAc), 1.99, 2.00, 2.05 (3 xs, 9H, CH.sub.3, Ac). HRMS (ESI) m/z, C.sub.20H.sub.32N.sub.4O.sub.11 (M+H.sup.+). Theoretical value: 505.49, measured value: 505.20.
Synthesis of Compound 7
[0066] Azide 6 (522 mg, 1.04 mmol) was dissolved in 10 mL of ethyl acetate, Pd/C (80 mg) was added into 30 mL of ethyl acetate under the protection of nitrogen gas. The reaction bottle was connected to a hydrogen balloon, subjected to multiple replacements with hydrogen gas, the reaction bottle was connected to a hydrogen balloon at room temperature, the reaction solution was continuously stirred for 3 hours. Pd/C was filtered by the Celite, and 0.5 mL of hydrochloric acid (2M) was added dropwise and slowly, and the solution was reacted under continuous stirring for 30 minutes under a reaction temperature of 0 C. 10 mL of acetonitrile was added into the reaction solution, and subjected to azeotropic decompression concentration for twice. The concentrated solution was mixed with dichloromethane (10 mL), and concentration under reduced pressure was further performed for twice, resulting in an oily foamed crude product 7 (500 mg), which was directly used in the next step without further purification. 1H NMR (CDC13): 8, 8.25 (m, 2H, NH.sub.2), 5.34 (d, 1H, sugar-H-4), 5.21 (dd, 1H, J=11.2Hz, J=3.3Hz, sugar-H-3), 4.91 (d, 1H, J=8.5 Hz, sugar-H-1), 4.12 (m, 3H, sugar-H-6, sugar-H-2), 4.07 (m, 2H, sugar-H-5, NH), 3.76 (m, 2H, CH20), 3.68 (m, 2H, CH.sub.2O), 3.61 (m, 2H,-CH2O), 3.58 (m, 4H, 2 x-CH2O), 3.20 (m, 2H, NH.sub.2), 2.09 (s, 3H, NHCO.sub.2CH.sub.3), 2.04, 1.96, 1.89 (3 x s, 9H, CO.sub.2CH.sub.3). HRMS (ESI) m/z, C.sub.20H.sub.34N.sub.2O.sub.11 (M+H.sup.+). Theoretical values: 479.49, measured values: 479.20.
2. Compound 12 was prepared according to the following route:
[0067] ##STR00008##
Synthesis of Compound 9
[0068] Trihydroxymethyl aminomethane 8 (10 g, 82.6 mmol) was dissolved in 15 mL of dioxane, 1.26 mL of an aqueous potassium hydroxide solution with a concentration of 40 wt % was dropwise added into the reaction solution and stirred, 20 mL of dioxane was further added at room temperature. Acrylonitrile (18 mL, 272 mmol) was added dropwise and slowly to the reaction flask under the temperature of 0 C., and the entire dropwise adding process was maintained about 1 hour. The reaction solution was continuously stirred at room temperature for 24 hours. The reaction solution was poured into a saturated sodium chloride solution, and extracted with dichloromethane (250 mL), the organic phase was subjected to washing with water. The organic phase was separated out and dried with the added anhydrous sodium sulfate, and rotary evaporated and concentrated in reduced pressure to a semi-dry state. Purification was further performed with a silica gel chromatographic column, the purified product was first rinsed with dichloromethane and then rinsed with a solvent mixture (containing dichloromethane/methanol, 10:1, v/v), the product components were collected. The product components were subjected to rotary evaporation and concentration in reduced pressure to obtain a pale yellow oily substance 9 (20 g, 86%). .sup.1H NMR
[0069] (CDCl.sub.3): , 3.68 (t, 6H, J=7.1 Hz, 3 x CH.sub.2O), 3.44 (s, 6H, 3 x CH.sub.2CNH.sub.2), 2.61 (t, 6H, J=6.2 Hz, 3 x CH.sub.2CN), 1.70 (s, 2H, NH.sub.2). HRMS (ESI) m/z, C.sub.13H.sub.20N.sub.4O.sub.3 (M+H.sup.+). Theoretical value: 281.32, measured value: 281.20.
Synthesis of Compound 10
[0070] Tri[(cyanoethoxy) methyl] aminomethane 9 (1.2 g, 4.28 mmol) was dissolved in 10 mL of
[0071] anhydrous ethanol, 2 mL concentrated sulfuric acid and 10 mL anhydrous ethanol were then added dropwise and slowly to the solution in a reaction flask at room temperature. The reaction solution was heated to 80 C. and kept at reflux state for about 36 hours. After cooling the reaction solution to room temperature, 25 mL of ice solution of saturated sodium bicarbonate was added. Ethanol was distilled by rotary evaporation under reduced pressure. The aqueous solution was extracted with ethyl acetate (250 mL), the obtained organic phase was dried with anhydrous sodium sulfate, and then subjected to rotary evaporation and concentration in reduced pressure to obtain a pale yellow oily substance 10 (0.8 g, 46%). This crude product was directly used in the next reaction without further purification.
Synthesis of Compound 11
[0072] Crude product compound 10 (0.8 g, 1.9 mmol) was dissolved in 20 mL of dichloromethane. Di-tert-butyl dicarbonate (2 mL, 8.8 mmol) and 5 mL of triethylamine were added to the reaction solution. The reaction solution was stirred for 14 hours at room temperature. The reaction solution was poured into an aqueous solution containing saturated sodium bicarbonate, extracted with dichloromethane (250 mL), and the organic phase was subjected to washing with water. The organic phase was separated out, and dried with anhydrous sodium sulfate, and rotary evaporated and concentrated in reduced pressure to a semi-dry state, purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially washed with dichloromethane solvent, then rinsed with a mixed solvent (containing dichloromethane/methanol, 96:4, v/v), the product components were collected, and the solvent was drained under reduced pressure to obtain a near-white oily substance 11 (0.5 g, 51%), .sup.1H NMR (CDCl.sub.3): , 4.92 (b, 1H, CONH), 4.14 (m, 3x2H, CO.sub.2CH.sub.2), 3.69 (m, 3x2H,-OCH2-), 3.63 (s, 3x2H,-OCH2-), 2.53 (m, 3x2H, COCH.sub.2), 1.45 (s, 3x3H, CH.sub.3), 1.26 (t, 3x3H, CH.sub.2CH.sub.3). HRMS (ESI) m/z, C.sub.24H.sub.43NO.sub.11 (M+H.sup.+). Theoretical value: 522.60, measured value: 522.40.
Synthesis of Compound 12
[0073] Boc protected compound 11 (0.6 g, 1.43 mmol) was dissolved in 20 mL of absolute ethanol, 4 mL of sodium hydroxide solution (4M) was added dropwise and slowly into the reaction solution, the temperature of reaction solution was kept at 0 C. and stirred for 14 hours. The reaction progress was monitored constantly by LC-MS spectrum, while the peak of the reactant was vanished, the reaction solution was subjected to rotary evaporation under reduced pressure, after ethanol was evaporated, 10 mL of potassium bisulfate (1M) was added to the reaction solution and continuously stirred for 15 minutes at 0 C. The reaction solution was extracted with ethyl acetate (250 mL), the obtained organic phase was dried with anhydrous sodium sulfate, then rotary evaporated and concentrated in reduced pressure to obtain a viscous substance 12 (0.5 g, 81%). This crude product was directly used in the next step without further purification. 1H NMR (CDC13): d, 9.40 (b, 3H, CO.sub.2H), 5.0 (b, 1H, CONH), 3.70 (m, m, 3x2H, OCH.sub.2), 3.65 (s, 3x2H, OCH.sub.2), 2.60 (m, 3x2H, COCH.sub.2), 1.42 (s, 3x3H, CH.sub.3). HRMS (ESI) m/z, C.sub.18H.sub.31NO.sub.11 (M+H.sup.+). Theoretical values: 438.32, measured values: 438.20.
[0074] Compound 14 was prepared according to the following route:
##STR00009##
Synthesis of Compound 13
[0075] Tricarboxylic acid 12 (0.5 g, 1.14 mmol) was dissolved in 20 mL of dichloromethane, 2-(7-azobenzotriazole)-N,N,N,N-tetramethylurea hexafluorophosphate (1.3 g, 3.42 mmol) and N,N-diisopropylethylamine (0.2 g, 3.95 mmol) were added, 8mL of dimethylformamide was added simultaneously. The compound 7 (2.19 g, 4.08 mmol) was dissolved in 5 mL of dimethylformamide, 10 and 1 mL of N,N-diisopropylethylamine was added. The two solutions were blended and stirred at room temperature and continuously stirred for 14 hours. The complete disappearance of the reactants was confirmed by the chromatographic detection. 20 mL of aqueous solution of saturated sodium bicarbonate was added into the reaction solution, and extracted with 250 mL of dichloromethane, the organic phase was rotary evaporated and concentrated to a semi-dry state, purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially washed with dichloromethane solvent, then rinsed with a mixed solvent (containing dichloromethane/methanol, 85:15, v/v), the product components were collected, the solvent was drained under reduced pressure to obtain the near-yellow oily crude product 13 (2 g, 86%). This crude product 13 was further purified by using a reversed-phase chromatographic column, the rinsing solvent was a mixed solvent (containing H.sub.2O/MeOH, 1:1, v/v), the product components were collected, then rotary evaporated and concentrated to a full dry state to obtain a compound 13 (1.24 g, 60%). .sup.1H NMR (CDCl.sub.3): 5.32 (d, 3H, J=3.0 Hz, sugar-H-4), 5.18 (dd, 3H, sugar-H-3), 4.78 (d, 3H, sugar-H-1), 4.18-4.06 (m, 24H,-OCH2, sugar-H-5), 3.93 (m, 9H, sugar-2xH-6, sugar-H-2), 3.77, 3.64, 3.46 (m, 6H, CH.sub.2NH), 2.44, 2.20 (m, 6H, COCH.sub.2), 2.15 (s, 9H, NHCOCH.sub.3), 2.09 (s, 2H, CH.sub.2), 2.05, 1.99, 1.95 (3xs, 27H, OCOCH.sub.3), 1.81 (s, 9H, CH.sub.3, Boc). HRMS (ESI) m/z, C.sub.78H.sub.127N.sub.7O.sub.41 (M+2H.sup.+)/2. Theoretical value: 910.1, measured value: 910.0.
Synthesis of Compound 14
[0076] Purified Compound 13 (2 g, 1.1 mmol) was dissolved in 30 mL of dichloromethane, 1 mL of hydrochloric acid solution (4M) and 1 mL of dioxan were slowly added into the dichloromethane reaction solution at a temperature of 0 C. The reaction solution was stirred continuously for 30 minutes at a temperature of 0 C., and then stirred continuously for 30 minutes at room temperature.
[0077] The reactant was subjected to rotary evaporation and concentration to a full dry state to obtain a white foamy crude product 14 (1.7 g, 90%). This crude product was directly used in the next step without further purification. 1H NMR (CDCl.sub.3): , 8.20 (b, 2H, NH.sub.2), 5.35 (d, 3H, J=3.0 Hz, sugar-H-4), 5.22 (dd, 3H, sugar-H-3), 4.80 (d, 3H, sugar-H-1), 4.13 (m, 9H, sugar-2xH-6, sugar-H-2), 3.94-3.44 (m, 24H,-OCH.sub.2, sugar-H-5), 3.77, 3.64, 3.46 (m, 6H, CH.sub.2NH), 2.55, 2.43 (m, 6H, COCH.sub.2), 2.15 (s, 9H, NHCOCH.sub.3), 2.09 (s, 2H, CH.sub.2), 2.05, 1.98, 1.96 (3xs, 27H, OCOCH.sub.3). HRMS (ESI) m/z, C.sub.73H.sub.119N.sub.7O.sub.39 (M+H.sup.+)/2. Theoretical value: 860.4, measured value: 860.0.
[0078] Compound 21 was prepared according to the following route:
##STR00010##
Synthesis of Compound 16
[0079] 4,4-dimethoxytrityl chloride (1.8 g, 5.3 mmol) was dissolved in 5mL of dichloromethane, the solution was added dropwise and slowly into an anhydrous pyridine (10 mL) solution containing 3-hydroxy-2-hydroxymethyl-2-methyl-propanoic acid 15 (0.8 g, 5.97 mmol) at room temperature. The solution was stirred continuously for 14 hours at room temperature. 20 mL of water was added to the reaction mixture and extracted with 250 mL of ethyl acetate. The organic phase was subjected to rotary evaporation and concentration to a semi-dry state, purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially washed with n-hexane solvent, and then eluted with a mixed solvent (containing n-hexane/ethyl acetate, 1:1, v/v), the product components were collected, the solvent was drained under reduced pressure to obtain a yellow solid 16 (1.5 g, 58%). The product 16 was directly used in the next step.
Synthesis of Compound 19
[0080] Mono-methyl adipate 17 (0.16 g, 1 mmol) and N-(tert-butoxycarbonyl)-1,3-diaminopropane N-(3-aminopropyl) tert-butyl carbamate 18 (0.174 g, 1 mmol) were dissolved in 5 mL of anhydrous tetrahydrofuran at room temperature. The solution was blended with 0.892 mL of 1-propylphosphoric acid cyclic anhydride (0.892 mL, 1.5 mmol, in 50% (volume ratio 1:1) ethyl acetate) and 0.522 mL of N,N-diisopropylethylamine (DIPEA, 0.522 mL, 3 mmol). The mixed reaction solution was continuously stirred for 30 minutes at room temperature, 20 mL of ethyl acetate was then added into the reaction solution for dilution, and 20mL of saturated salt solution was added simultaneously, and extracted with 220mL of ethyl acetate. The organic phase was separated, and dried with anhydrous sodium sulfate, then rotary evaporated and concentrated to a full dry state, resulting in a yellowish foamed crude product 19 (0.29 g, 91%), which was directly used in the next step without further purification. .sup.1H NMR (CDCl.sub.3), , 5.89 (b, 1H, CONH), 4.97 (b, 1H, NHCO), 3.75 (s, 3H, CH.sub.3), 3.27 (m, 2H), 3.15 (m, 2H), 2.34 (m, 2H), 2.19 (m, 2H), 1.67 (m 2x2H), 1.64 (m, 2H), 1.4 (s, 9H). HRMS (ESI) m/z, C.sub.15H.sub.28N.sub.2O.sub.5. Theoretical values: 316.39, measured values: 316.40.
Synthesis of Compound 20
[0081] Compound 19 (0.8 g, 2.5 mmol) was dissolved in 5 mL of ethyl acetate, the reaction solution was mixed with 3.2 mL of aqueous hydrochloric acid solution (4M), and 5 mL of dioxane was further added. The mixed reaction solution was continuously stirred for 30 minutes at room temperature. After rotary evaporation and concentration, a viscous and thick crude product 20 (0.5 g, 92%) was obtained, which was directly used for the next step.
Synthesis of Compound 21
[0082] The crude product compound 20 (0.252 g, 1 mmol) was dissolved in 5 ml of dimethylformamide, the reaction solution was blended with 3-O-4,4-dimethoxytrityl-2-hydroxy-2-methylpropionic acid 16 (0.45 g, 0.9 mmol), and added 2-(7-azabenzotriazo)-N,N,N,N-tetramethylurea hexafluorophosphate (0.46 g, 1.2 mmol) and N,N-diisopropylethylamine (0.52 mL) at 0 C. and stirred for 20 minutes. The reaction solution was slowly heated to room temperature and continuously stirred for 14 hours. The reaction solution was blended with 20 mL of saturated sodium chloride solution, and extracted with 250 mL of ethyl acetate, the organic phase was dried with anhydrous sodium sulfate and then subjected to rotary evaporation and concentration in reduced pressure to obtain a crude product 21. Purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially washed with ethyl acetate solvent, followed by rinsing with a mixed solvent (containing ethyl acetate/methanol, 90:10, v/v), the product components were collected, and the solvent was drained under reduced pressure to obtain a compound 21 (0.38 g, 61%). .sup.1H NMR (CDCl.sub.3): , 8.01 (b, 1H, CONH), 7.26 (m, 4H, Trityl), 7.05 (m, 4H, Trityl), 6.67 (m, 4H, Trityl), 6.48 (b, 1H, NHCO), 5.25 (s, 3H,-OCH.sub.3), 3.78 (s, 6H, 2x-OCH.sub.3), 3.64 (s, 4H, 2X-CH.sub.2), 3.26 (m, 2H, NHCH.sub.2), 3.17 (m, 2H, CH.sub.2NH), 2.79 (m, 3H, OCH.sub.3), 2.31 (m, 2H), 2.18 (m, 2H), 1.65-1.56 (m, 6H), 1.25 (s, 3H). HRMS (ESI) m/z, C.sub.36H.sub.46N.sub.2O.sub.8, (M+Na.sup.+). Theoretical value: 657.34, measured value: 657.40.
[0083] Compound (603A) was prepared according to the following route:
##STR00011##
Synthesis of Compound 22
[0084] The purified compound 21 (0.7 g, 1.1 mmol) was dissolved in 5 mL of anhydrous methanol, 1.5 mL of methanol solution of lithium chloride (2M) was added slowly into the reaction solution at the temperature of 0 C. The reaction solution was stirred at 0 C. for 30 min, the reaction solution was then heated to room temperature and continuously stirred for 2 hours at room temperature. After mixing the reaction solution with 2 mL of water at room temperature, the reaction solution was subjected to rotary evaporation and concentration to a semi-dry state such that the methanol was removed, and separation was performed by using the preparative reverse phase high pressure liquid chromatography, the mobile phase solvent was methanol and water (MeOH: H.sub.2O, 1:1, v/v). The product components were collected, and the solvent was drained under reduced pressure to obtain a yellow solid compound 22 (0.66 g, 93%). .sup.1H NMR (CDCl.sub.3): , 7.38 (m, 4H, Trityl), 7.29 (b, 1H, CONH), 7.28 (m, 5H, Trityl), 7.16 (b, 1H, NHCO), 6.79 (m, 4H, Trityl), 3.76 (s, 10H, 2x-OCH.sub.3, 2x-CH.sub.2), 3.71 (m, 2H, CH.sub.2), 3.21 (m, 2H, NHCH.sub.2), 2.07 (m, 2H, CH.sub.2NH), 1.87 (m, 2H), 1.50 (m, 2H), 1.27 (m, 2H), 1.21 (s, 3H). HRMS (ESI) m/z, C35H43N208, (M+H.sup.++Na.sup.+). Theoretical value: 643.72, measured value: 643.20.
[0085] Synthesis of Compound (603A)
[0086] The purified compound 22 (0.65 g, 1.04 mmol) was dissolved in 15 mL of dichloromethane, and mixed with 0.723 mL of N,N-diisopropylethylamine (4.16 mmol) at room temperature. The mixed solution was blended with the purified compound 14 (1.83 g, 1.04 mmol), 2-(7-azabenzotriazo)-N,N,N,N-tetramethylurea hexafluorophosphate (0.435 g, 1.1 mmol) and N,N-diisopropylethylamine (0.723 mL, 4.16 mmol) and stirred for 30 minutes under the temperature of 0 C. The reaction solution was further added with 1 mL of N,N-diisopropylethylamine and continuously stirred at 0 C. for 1 hour. The reaction temperature was gradually raised from 0 C. to room temperature, then continuously stirred for 2 hours. The reaction solution was blended with 5 mL of saturated sodium chloride solution, and extracted with 250 mL of dichloromethane, the organic phase was dried with anhydrous sodium sulfate, followed by rotary evaporation and concentration in reduced pressure to obtain a crude product 603A. Purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially washed with dichloromethane solvent, then rinsed with a mixed solvent (containing dichloromethane/methanol/triethylamine, 94:5:1, v/v/v), the product components were collected, and the solvent was drained under reduced pressure to obtain a yellow solid compound 603A (1.56 g, 65%). .sup.1H NMR (CDCl.sub.3): , 7.38 (m, 3H, NH), 7.28 (m, 4H, trityl), 7.26 (m, 1H, NH), 7.18 (m, 1H, NH), 6.84 (m, 5H, trityl), 6.37 (m, 4H, trityl), 5.33 (m, 3H, sugar-H-4), 5.16 (dd, J=3.4 Hz, J=11.3 Hz, 3H, sugar-H-3), 4.77 (d, J=8.4 Hz, 3H, sugar-H-1), 4.18-4.07 (m, 3x2H, 3x1H, sugar-H-5, sugar-H-6), 3.94 (m, 3H, sugar-H-2), 3.77-3.53 (m, 14H), 3.42 (m, 2H, NHCH.sub.2), 3.30-3.19 (m, 2H, CH.sub.2NH), 2.42 (m, 2H), 2.19 (m, 4H), 2.15 (s, 9H), 2.07 (m, 2H), 2.05 (s, 9H, 2.01 (s, 9H), 1.96 (s, 9H), 1.20 (s, 3H). HRMS (ESI) m/z, C.sub.87H.sub.143N.sub.9O.sub.44, (M-trityl+H+)/2. Theoretical value: 1,010.55, measured value: 1,010.4.
[0087] Conjugate (603B) triethylamine carboxylate was prepared according to the following route:
##STR00012##
[0088] Compound (603A) (1.5 g, 0.646 mmol) was dissolved in 30 mL of dry dichloromethane, 5 mL of triethylamine was subsequently added. 4-dimethylaminopyridine (0.159 g, 1.3 mmol) was dissolved and stirred in the reaction solution, succinic anhydride (0.13 g, 1.3 mmol) was also dissolved in the reaction solution with the aid of stirring at room temperature, and the reaction was performed under stirring condition for 8 hours. Succinic anhydride (32 mg, 0.32 mmol) was further added and continuously stirred for 14 hours at room temperature. The reacted solution was then poured into a saturated saline solution, extracted with 250 mL of dichloromethane, the organic phase was separated, and dried with anhydrous sodium sulfate, then evaporated to a semi-dry state under reduced pressure. Purification was further performed with a silica gel chromatographic column, a gradient elution was used, initially washed with a mixed solvent (containing dichloromethane/methanol/triethylamine, 100:2:1, v/v/v), further rinsed with a mixed solvent (including dichloromethane/methanol/triethylamine, 100:5:1, v/v/v), then rinsed with a mixed solvent (containing dichloromethane/methanol/triethylamine, 100:5:1, v/v/v) to obtain the final product, the solvent was drained under the reduced pressure to obtain a white compound (603B) (1.56 g, 65%). .sup.1H NMR (CDCl.sub.3) , .sup.1H NMR (CDCl.sub.3): , 7.39 (m, 3H, NH), 7.28 (m, 5H, trityl), 7.22 (m, 1H, NH), 7.10 (m, 1H, NH), 6.80 (m, 4H, trityl), 6.37 (m, 4H, trityl), 5.32 (m, 3H, sugar-H-4), 5.29 (s, 2H), 5.15 (dd, J-3.4Hz, J=11.3Hz, 3H, sugar-H-3), 4.77 (d, J-8.4Hz, 3H, sugar-H-1), 4.18-4.07 (m, 3x2H, 3x1H, sugar-H-5, sugar-H-6), 3.94 (m, 3H, sugar-H-2), 3.67 (m, 9H), 3.61-3.53 (m, 42H), 3.42 (m, 2H, NHCH.sub.2), 3.30-3.19 (m, 2H, CH.sub.2NH), 2.42 (m, 2H), 2.19 (m, 4H), 2.15 (s, 9H), 2.07 (m, 2H), 2.05 (s, 9H, 2.01 (s, 9H), 1.96 (s, 9H), 1.23 (s, 3H). HRMS (ESI) m/z, C.sub.112H.sub.165N.sub.9O.sub.49, (M-H.sup.+)/2. Theoretical value: 1,209.27, measured value: 1,209.83.
[0089] Preparation of a conjugate (603C) by connecting the conjugate (603B) to the solid phase carrier according to the following process route:
##STR00013##
[0090] The conjugate (603B) (50 mg, 0.021mmol) and 2-(7-azabenzotriazo)-N,N,N,N-tetramethylurea hexafluorophosphate (10 mg, 0.026 mmol) were dissolved in 1.25 mL of anhydrous acetonitrile at room temperature. N,N-diisopropylethylamine (10 L) was added into the reaction solution, after all reagents were dissolved, 125 mg of long-chain amino alkane glass sand (500 A, native lcaa-CPG, Chemgenes, USA) was added into the reaction solution. The solid-phase and liquid-phase were rotated and stirred for 300 rpm at room temperature. After the reaction lasted for 2 hours, the residue liquid was filtered, the long-chain amino alkane glass sand (solid phase carrier) was washed with acetonitrile for three times (31 mL). 0.5 mL of a tetrahydrofuran solution of capping reagent A (acetic anhydride) having a concentration of 10% (v/v) and 0.5 mL of capping reagent B (a mixed solution of N-methylimidazole, pyridine and acetonitrile at a concentration of 15:10:75, v/v/v) and the long-chain amino alkane glass sand were rotated and stirred for 1 hour at room temperature. The reaction solution was filtered, the long-chain amino alkane glass sand (solid phase carrier) was rinsed with acetonitrile for three times, then dried under reduced pressure for 2 hours by using an oil vacuum pump, a glass sand solid phase carrier (603C, 130 mg) was obtained.
[0091] The solid phase carrier 603C (8.3 mg) was weighed and added into 100 mL of a dichloromethane solution of trichloroacetic acid having a concentration of 3%, then rotated and stirred for 30 seconds and stood still for 1 minute. The supernatant was taken to measure the visible light absorption at 498 nm, its light absorbance was 0.309, a loading capacity of the conjugate 603C (i.e., a loading capacity of (603B) on CPG) was calculated as 53.25 mol/g.
[0092] Preparation of sense and antisense strands of siRNA (preparation of siRNA drugs)
[0093] Pursuant to the solid phase synthesis method of phosphoramidites, the nucleoside monomers were linked one by one according to the sequence along the direction from 3-5 according to the above sequence. Each linking with a single nucleoside monomer included the four-step reaction of deprotection, coupling, capping and oxidation.
Formulation of Solid Phase Synthesis Reagent:
[0094] The deprotection reagent was a dichloromethane solution of trichloroacetic acid (TCA) or dichloroacetic acid (DCA) having a concentration of 3% (v/v). The nucleoside monomers were dissolved in anhydrous acetonitrile having a concentration of 0.05-0.1M, which was added with a small amount of molecular sieve 3A for anhydrous treatment. The coupling activator was anhydrous acetonitrile of 5-ethylthio-1H-tetrazole having a concentration of 0.25M or 0.45M, alternatively the activator may be selected from 1H-hetrazole, 5-benzyylthio-1H-tetrazole and 4,5-dicyanoimidazole. The capping reagent A was a tetrahydrofuran solution of acetic anhydride having a concentration of 10% (v/v). The capping reagent B was a mixed solvent of N-methylimidazole, pyridine and acetonitrile having a concentration of 15:10:75 (v/v/v). The oxidizing reagent was the water and pyridine solution of iodine having a concentration of 0.05M (95wt % of an aqueous pyridine solution). The sulfurization reagent was N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione having a concentration of 0.05M (pyridine/acetonitrile, 2:3, v/v). The deprotection reagent was concentrated aqueous ammonia with a concentration of 28 wt. %.
[0095] Wherein the solid phase carrier for solid phase synthesis of nucleotides was commercially available and commonly used solid phase carrier (NittoPhase HL UnyLinkerM 300; or 500 A, native lcaa-CPG, Chemgenes, USA).
Steps of Solid Phase Synthesis:
[0096] A solid phase carrier was blended with a dichloromethane solution of trichloroacetic acid having a concentration of 3% (v/v) with a molar ratio of 1:30 on a synthesizer. The reaction was performed for 1.5 minutes at room temperature, and the operation was repeated for three times, the dropwise adding of a deprotection reagent was stopped when the color of elution solution of solid phase carrier was changed from red color to colorless. After repeated washing with anhydrous acetonitrile, the nucleoside monomer and activator (coupling activator, 5-ethylthio tetrazole) were added (at a molar ratio of nucleoside monomer to activator of 1:20), and a molar ratio of the solid phase carrier and nucleoside monomer were 1: (5-6). The reagents were at room temperature and the time of the solid phase reaction was 3-4 minutes for one cycle, and after two cycles, the reaction was stopped. After washing with anhydrous acetonitrile, the oxidizing reagent solution was added, a molar ratio of the solid phase carrier and the oxidizing reagent were 1:6. The reaction time of the oxidizing reagent and the solid phase carrier at room temperature was about 2 minutes, the operation was repeated twice. After the coupling reaction, if a sulfidation reaction step was required, the sulfidation reagent solution was added, a molar ratio of the solid phase carrier and the sulfidation reagent was 1:6. The reaction time of the sulfidation reagent and the solid phase carrier at room temperature was about 4-5 minutes, and the operation was repeated twice. The capping protection reaction was performed by adding the capping reagent, a molar ratio of the solid phase carrier and the capping reagent was 1:80. The reaction time of the capping reagent and the solid phase carrier at room temperature was about 1-2 minutes, and the operation was repeated twice. The aforementioned deprotection, coupling, oxidizing and capping steps were cycled until the coupling of the last nucleotide was completed. The solid phase carrier loaded with the sense strand or the antisense strand of the nucleic acid sequence was transferred into a vial bottle, an aqueous ammonia solution having a concentration of 28% was added, and the glass cap was screwed tightly for sealing, the base protecting group of the sense strand or the antisense strand was hydrolyzed and removed at the temperature of 55 C., while the sense strand or the antisense strand was hydrolyzed and separated from the solid phase carrier. The reaction was run for 16 hours. The resulting solution of the small nucleic acid strand was filtered and separated from the solid phase carrier. After concentration, a crude product of the small nucleic acid strand was obtained.
Purification, Separation and Desalting by Using the Preparative High Pressure Liquid Chromatography
[0097] Small nucleic acid was purified by gradient elution of NaBr using a preparative type anion exchange chromatographic column (Source 15Q). Mobile phase A: 20 mM sodium phosphate (pH 8.0), mobile phase B: 20 mM sodium phosphate (pH 8.0), 1M sodium bromide in aqueous acetonitrile having a concentration of 10%. The column temperature was 65 C. The flow rate was 10 mL/min. The elution gradient was initiated a mobile phase A, followed by a change in mobile phase B from 0% to 20% at 12 minutes. The mobile phase B increased from 20% to 50% in the subsequent 15 minutes. The eluent was collected, and subjected to component analysis and component combination. Desalting was performed by using a reverse phase chromatography purification column, or a dialysis desalting process. The eluent was subjected to concentration and freeze drying to obtain purified small nucleotides. For the synthesized sense and antisense strands, purity was detected using the anion exchange liquid chromatogram (AEX-HPLC), and the full sequence molecular weight was identified and analyzed by reverse phase liquid chromatography- mass spectrometry (LC-MS), the measured value for molecular weight was consistent with the theoretical value to confirm success in synthesizing the nucleic acid sequence.
Annealing
[0098] The synthesized sense strand (S strand) and antisense strand (AS strand) were blended at an equimolar ratio in a normal saline for injection, heated at a temperature of 90 C. for 5 minutes, then cooled slowly to room temperature and stored in a refrigerator at 4 C. for 12 hours to form double-stranded structure through hydrogen bond, the siRNA drugs 30-34 were obtained (the sequences and modifications of nucleotides were shown in Table 3).
TABLE-US-00005 TABLE3 Sense Antisense strand strand sequence sequence No. (5-3) (5-3) 30 GsCsUCGGUfGAfGUfGAUG UsUfsCUfGCfCAUCACU GCAGAA-TriGalNAc(17) CfACfCGAGCsUsU (18+UU) 31 GsGsUCACCfGAfCUfUCGA AsCfsAUfUCfUCGAAGU GAAUGU-TriGalNAc(25) CfGGfUGACCsUsU (26+UU) 32 CsCsCAAGCfAAfGCfAGAC AsAfsAUfGUfCUGCUUf AUUU-TriGalNAc(31) GCfUUGGGsUsU (32+UU) 33 GsCsAGGAAfCUfGAfGCCA UsUfsUCfUGfGCUCAGf GAAA-TriGalNAc(37) UUfCCUGCsUsU (38+UU) 34 GsCsCAAGCfCUfCUfUCUU UsGfsAAfGUfAAGAAGA ACUUCA-TriGalNAc(45) GfGCfUUGGCsUsU (46+UU)
[0099] In the sequences shown in Table 3, the lowercase letter f indicates that the nucleotide adjacent to the left side of the letter f is a 2-fluoro modified nucleotide (i.e., the 2-OH of the pentose in the nucleotide is substituted by fluorine); the lowercase letter s indicates that two nucleotides adjacent to the left side and right side of the letter s are connected through a thiophosphate diester bond (i.e., the non-bridging oxygen atom in the phosphodiester bond is substituted by sulfur atom); the underlined nucleotide indicates that the 2 hydroxyl group of the nucleotide is substituted by methoxyl group. TriGaNAc denotes a target group and a linkage group for target delivery (i.e., a moiety of formula (603) other than Nu).
[0100] The sequence and structure of the synthesized siRNA drugs were confirmed by LC-MS analysis data. The modified siRNA in Table 3 was provided with a more stable nucleic acid structure as well as high specificity and high affinity of base pairing. In addition, the nucleic acid having the above modification exhibited more excellent in vivo inhibitory effect, and can further reduce the in vivo immunogenicity of the nucleic acid of the present disclosure.
[0101] (II) The male humanized PCSK9 mice (4-6 weeks old, Shanghai Model Organisms Technology Co., Ltd.) were randomly grouped by weight, 3 mg/kg of siRNA drug (the dosage was based on siRNA alone) was injected into the mice on the zero day, the 2.sup.nd day and the 4.sup.th day, serum was taken on the zero day, the 7.sup.th day, the 14th day, the 21.sup.st day and the 29.sup.th day, the PCSK9 concentration in serum was measured (control group was injected with normal saline). The serum human PCSK9 concentration measurement was accomplished by using a human PCSK9 ELISA kit (R&D Systems, Minneapolis, MN, USA, cat #DPC900), and the experimental procedures were performed as recommended by the manufacturer.
[0102] Meanwhile, the mice were killed at the 29.sup.th day and the liver tissue was removed, RNA was extracted according to the operation instruction of RNAeasy Mini kit (QIAGEN, Article No. 74104). RT-PCR was performed according to the recommendation of High Capacity cDNA Reverse
[0103] Transcription Kits (Thermo Fisher, Article No. 4368814), 1 g of RNA was contained in each reaction. The gene expression was quantified by using the real-time fluorescence PCR method, and the TaqMan probe of human PCSK9 was Hs00545399_m1, and the probe of the internal reference gene (mouse HPRT1) was Mm03024075_ml (Thermo Fisher Scientific, Waltham, MA, USA). The PCR conditions were 1 cycle for 20 sec at the temperature of 95 C., 40 cycles for 1 sec at 95 C. and 20 sec at 60 C., and the real-time fluorescence PCR instrument was StepOne Plus (Thermo Fisher). The PCSK9 gene expression was calculated based on the 2{circumflex over ()}-Ct, and the mouse HPRTI gene expression was used as the internal reference. The expression level of PCSK9 gene in liver was expressed as a percentage of treated group vs. control group (Table 2). The male humanized PCSK9 mice (4-6 weeks old, Shanghai Model Organisms
[0104] Technology Co., Ltd.) were randomly grouped by weight, the siRNA drug 34 was injected into the mice on the zero day, serum was taken on the 14.sup.th day, the PCSK9 concentration in serum was measured (the control group was the PCSK9 concentration of serum in mice injected with normal saline). The serum human PCSK9 concentration measurement was accomplished by using a human
[0105] PCSK9 ELISA kit (R&D Systems, Minneapolis, MN, USA, cat #DPC900), and the experimental procedures were performed as recommended by the manufacturer.
[0106] All publications, patents and patent applications mentioned in the specification are incorporated herein by reference, the extent is same as that each individual publication, patent and patent application is specifically and individually incorporated herein by reference.
[0107] The above content describes in detail the preferred embodiments of the present disclosure, but the present disclosure is not limited thereto. A variety of simple modifications can be made in regard to the technical solutions of the present disclosure within the scope of the technical concept of the present disclosure, including a combination of individual technical features in any other suitable manner, such simple modifications and combinations thereof shall also be regarded as the content disclosed by the present disclosure, each of them falls into the protection scope of the present disclosure.
[0108] While this invention has been particularly shown and described with references to
[0109] preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.