METHODS OF MODULATING SEX RATIO
20240373830 ยท 2024-11-14
Inventors
- Jennifer Hughes (Waltham, MA, US)
- David C. Page (Winchester, MA, US)
- Helen Skaletsky (Arlington, MA, US)
- Peter K. Nicholls (Sowerby Bridge, GB)
Cpc classification
A01K2217/058
HUMAN NECESSITIES
International classification
Abstract
Disclosed herein are compositions, methods, and transgenic animals for sex biasing offspring of male animals, as well as methods of screening for sex biasing agents.
Claims
1. A method of biasing the sex ratio of offspring of a male mammal, comprising i) contacting the mammal with an agent that modulates the expression or activity of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an x-linked homolog, or the x-linked homolog thereof, wherein the mammal is not a mouse and/or ii) contacting the mammal with an agent that modulates the expression or activity of PRSSLY or a PRSSLY homolog.
2. The method of claim 1, wherein the testis specific gene has at least two copies on the MSY or at least ten copies on the MSY.
3. (canceled)
4. The method of claim 1, wherein the x-linked homolog comprises at least two copies or at least ten copies.
5. (canceled)
6. The method of claim 1, wherein the testis specific gene is located in an ampliconic region.
7. The method of claim 1, wherein the mammal is bovine, porcine, gorilla, feline, equine, or human, or wherein the mammal is an ungulate.
8. The method of claim 1, wherein the sex ratio is biased to males or toward females.
9. (canceled)
10. The method of claim 1, wherein the agent comprises a targeting endonuclease or an RNAi agent or antisense oligonucleotide specifically reducing or eliminating the expression of the testis specific gene or x-linked homolog thereof or an RNAi agent or antisense oligonucleotide specifically reducing or eliminating the expression of a gene product of PRSSLY or a PRSSLY homolog.
11. (canceled)
12. The method of claim 1, wherein the agent comprises a nucleic acid, protein or small molecule that modulates the activity of a gene product of the testis specific gene or x-linked homolog thereof or a gene product of PRSSLY or a PRSSLY homolog.
13. (canceled)
14. The method of claim 1, wherein the testis specific gene is HSFY or HSFX.
15. (canceled)
16. The method of claim 1, wherein the agent is locally administered to the mammal's reproductive cells.
17. A non-human mammal comprising i) a non-naturally occurring mutation in a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an x-linked homolog, or the x-linked homolog thereof, ii) a non-naturally occurring nucleotide sequence capable of expressing an RNAi agent that reduces expression of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an x-linked homolog, or the x-linked homolog thereof, iii) a non-naturally occurring mutation that modulates the expression or activity of PRSSLY or a PRSSLY homolog as compared to a control non-human mammal, or iv) a non-naturally occurring nucleotide sequence capable of expressing an RNAi agent that reduces expression of PRSSLY or a PRSSLY homolog as compared to a control non-human mammal.
18. The non-human mammal of claim 17, wherein the testis specific gene has at least two copies on the MSY or at least ten copies on the MSY.
19. The non-human mammal of claim 17, wherein the non-human mammal is transgenic.
20. The non-human mammal of claim 17, wherein the x-linked homolog comprises at least two copies or at least ten copies.
21. (canceled)
22. The non-human mammal of claim 17, wherein the testis specific gene is located in an ampliconic region.
23. (canceled)
24. The non-human mammal of claim 17, wherein the mutation reduces expression or activity of a gene product of the gene or x-linked homolog thereof.
25. The non-human mammal of claim 17, wherein the non-human mammal comprises no functional copies of the testis specific gene or the x-linked homolog thereof or comprises at least 10 less functional copies of the testis specific gene or the x-linked homolog thereof than a wild-type mammal.
26. (canceled)
27. (canceled)
28. The non-human mammal of claim 17, wherein the RNAi agent is an siRNA or a microRNA.
29. The non-human mammal of claim 17, wherein the RNAi agent is expressed under the control of a tissue specific promoter.
30. (canceled)
31. A method of screening for a candidate agent that biases the sex ratio of offspring of a mammal, comprising: a. providing a composition comprising a cell or cell free expression system expressing the product of PRSSLY, a PRSSLY homolog, a testis specific gene located in a male-specific region of a Y chromosome (MSY) of a mammal having an x-linked homolog, or the x-linked homolog thereof; b. contacting the composition with a test agent; and c. measuring the expression or activity of the product, wherein if the expression or activity of the product is modulated as compared to a control then the agent is identified as a candidate agent that biases the sex ratio of offspring of a mammal.
32.-54. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
DETAILED DESCRIPTION OF THE INVENTION
[0051] The practice of the present invention will typically employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant nucleic acid (e.g., DNA) technology, immunology, and RNA interference (RNAi) which are within the skill of the art. Non-limiting descriptions of certain of these techniques are found in the following publications: Ausubel, F., et al., (eds.), Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, all John Wiley & Sons, N.Y., edition as of December 2008; Sambrook, Russell, and Sambrook, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001; Harlow, E. and Lane, D., AntibodiesA Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988; Freshney, R. I., Culture of Animal Cells, A Manual of Basic Technique, 5th ed., John Wiley & Sons, Hoboken, NJ, 2005. Non-limiting information regarding therapeutic agents and human diseases is found in Goodman and Gilman's The Pharmacological Basis of Therapeutics, 11th Ed., McGraw Hill, 2005, Katzung, B. (ed.) Basic and Clinical Pharmacology, McGraw-Hill/Appleton & Lange; 10th ed. (2006) or 11th edition (July 2009). Non-limiting information regarding genes and genetic disorders is found in McKusick, V. A.: Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore: Johns Hopkins University Press, 1998 (12th edition) or the more recent online database: Online Mendelian Inheritance in Man, OMIM. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD), as of May 1, 2010, ncbi.nlm.nih.gov/omim/and in Online Mendelian Inheritance in Animals (OMIA), a database of genes, inherited disorders and traits in animal species (other than human and mouse), at omia.angis.org.au/contact.shtml. All patents, patent applications, and other publications (e.g., scientific articles, books, websites, and databases) mentioned herein are incorporated by reference in their entirety. In case of a conflict between the specification and any of the incorporated references, the specification (including any amendments thereof, which may be based on an incorporated reference), shall control. Standard art-accepted meanings of terms are used herein unless indicated otherwise. Standard abbreviations for various terms are used herein.
Methods and Compositions for Sex Biasing by Modulating a Testis Specific Gene Located in a Male-Specific Region of the Y Chromosome (MSY) Having an X-Linked Homolog, or the X-Linked Homolog Thereof
[0052] Some aspects of the present disclosure are directed to a method of biasing the sex ratio of offspring of a male mammal, comprising contacting the mammal with an agent that modulates the expression or activity of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof.
[0053] In some embodiments, the sex ratio is biased towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more males: females offspring. In some embodiments, the sex ratio is biased towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more females: males offspring.
[0054] In some embodiments, the agent reduces the expression or activity (e.g., activity of the gen product) of the testis specific gene or the X-linked homolog thereof by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the agent increases the expression or activity (e.g., activity of the gen product) of the testis specific gene or the X-linked homolog thereof by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more.
[0055] The mammal is not limited. In some embodiments, the mammal is not a mouse. In some embodiments, the mammal is an ungulate. In some embodiments, the ungulate is a livestock animal. In some embodiments, the mammal is bovine, porcine, gorilla, feline, equine, primate, or human. In some embodiments, the male mammal is a bull (i.e., Bos taurus). In some embodiments, the male mammal is a human. In some embodiments, the human male has, or is at risk of developing, an X-linked recessive disease or disorder.
[0056] The testis specific gene located in the MSY is not limited as long as an X-linked homolog of the gene is also present in the genome of the mammal. In some embodiments, the testis specific gene is HSFY or VCY. In some embodiments, the X-linked homolog is HSFX or VCX. In some embodiments, the HSFY gene is accession number NM_033108, NM_153716, FJ527015, NM_001077006, NM_001040123, or GQ253469. In some embodiments, the HSFX gene is accession number NM_016153, XM_005594782, XM_001089561, XM_416447, NM_001164415, NM_001323079, NM_001351114, or GQ253474. In some embodiments, the HSFX gene is shown in SEQ ID NO: 1. In some embodiments, the HSFX gene is a Bos Taurus gene shown in SEQ ID NOS: 2-10.
[0057] In some embodiments, the testis specific gene has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 75, 80, 90, 100 or more copies on the MSY. In some embodiments, the testis specific gene has at least 2 copies on the MSY. In some embodiments, the testis specific gene has at least 10 copies on the MSY.
[0058] In some embodiments, the X-linked homolog gene has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 75, 80, 90, 100 or more copies on the X-chromosome. In some embodiments, the X-linked homolog gene has at least 2 copies on the X-chromosome. In some embodiments, the X-linked homolog gene has at least 10 copies on the X-chromosome.
[0059] In some embodiments, the testis specific gene is located in an ampliconic region. As used herein, an ampliconic region comprises ampliconic sequences, which are euchromatic repeats that display >99% identity over more than 10 kb. In some embodiments, the testis specific gene is located in an MSY comprising at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 99.5% ampliconic sequences.
[0060] The agent is not limited and may be any suitable agent capable of modulating the expression or activity of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof. The agent may be any agent described herein.
[0061] In some embodiments, the agent is an antagonist of a gene product of the testis specific gene or X-linked homolog thereof. In some embodiments, the agent is an agonist of a gene product of the testis specific gene or X-linked homolog thereof. In some embodiments, the agent is encoded by a synthetic RNA (e.g., modified mRNAs). In some embodiments, the synthetic agent expresses a gene product of the testis specific gene or X-linked homolog thereof.
[0062] In some embodiments, the agent is a targetable nuclease and, if appropriate, a guide molecule (e.g., one or more gRNA). In some embodiments, the agent is capable of making a mutation in a of a gene product of the testis specific gene or X-linked homolog thereof as described herein.
[0063] In some embodiments, the agent is a targetable nuclease capable of introducing a mutation reducing the expression or activity of a gene product of the testis specific gene or X-linked homolog thereof, or increasing the expression or activity of a gene product of the testis specific gene or X-linked homolog thereof. In some embodiments, the agent is an RNA-guided nucleases (RGNs) (e.g., the Cas proteins of the CRISPR/Cas Type II system targetable nuclease) and RNA template (e.g., gRNA) capable of specifically introducing a mutation reducing the expression or activity of a gene product of the testis specific gene or X-linked homolog thereof, or increasing the expression or activity of a gene product of the testis specific gene or X-linked homolog thereof.
[0064] In some embodiments, the agent comprises an RNA interference (RNAi) agent specifically reducing or eliminating the expression of the testis specific gene or X-linked homolog thereof. In some embodiments, the agent comprises antisense oligonucleotide specifically reducing or eliminating the expression of the testis specific gene or X-linked homolog thereof.
[0065] In some embodiments, an oligonucleotide and the target RNA sequence (e.g., an mRNA of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof) have 100% sequence complementarity. In some aspects, an oligonucleotide may comprise sequence variations, e.g., insertions, deletions, and single point mutations, relative to the target sequence. In some embodiments, an oligonucleotide has at least 70% sequence identity or complementarity to the target RNA (e.g., mRNA, pre-mRNA, or nascent RNA of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof). In certain embodiments, an oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to the target sequence.
[0066] Some aspects of the present disclosure are directed to compositions (e.g., pharmaceutical compositions including compositions for veterinary use) comprising an agent as described herein for sex biasing of offspring of a male mammal.
Transgenic Animals Comprising a Non-Naturally Occurring Mutation in a Testis Specific Gene Located in a Male-Specific Region of the Y Chromosome (MSY) Having an X-Linked Homolog, or the X-Linked Homolog Thereof
[0067] Some aspects of the present invention are directed to a non-human mammal (i.e., transgenic non-human mammal) comprising a non-naturally occurring mutation in a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof. The non-human mammal may be any suitable mammal described herein. In some embodiments, the mammal is a bull (Bos Taurus), bovine or other ungulate species (e.g., livestock ungulate). The testis specific gene or X-linked homolog thereof may be any testis specific gene or X-linked homolog thereof described herein. In some embodiments, the testis specific gene or X-linked homolog thereof is a Bos taurus HSFY or HSFX gene (e.g., a Bos taurus gene described or disclosed herein). In some embodiments, the testis specific gene has at least 2, 5, 10, 20, 30, 50, or more copies on the MSY. In some embodiments, the X-linked homolog gene has at least 2, 5, 10, 20, 30, 50, or more copies on the X-chromosome. In some embodiments, the testis specific gene is located in an ampliconic region.
[0068] In some embodiments, the mutation reduces expression or activity of a gene product of the gene or X-linked homolog thereof as compared to the wild-type of the non-human mammal. In some embodiments, the mutation reduces the expression or activity of the testis specific gene or the X-linked homolog thereof by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mutation increases the expression or activity of the testis specific gene or the X-linked homolog thereof by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more.
[0069] In some embodiments, the sex ratio is biased by the mutation towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more males: females offspring. In some embodiments, the sex ratio is biased by the mutation towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more females: males offspring. In some embodiments, sex ratio biasing as compared to wild-type is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold towards males or females.
[0070] In some embodiments, the mutation is one or more nucleotide insertions, deletions and/or substitutions. In some embodiments, the mutation reduces or eliminates expression or activity of the gene product (e.g., a frameshift mutation, a mutation rendering the gene product non-functional (inactive) or partially functional (less active), a mutation in a regulatory region that reduces or eliminates expression, a mutation deleting all or a portion of the gene product, a mutation deleting one or more copies of a gene). In some embodiments, the mutation increases expression or activity of the gene product (e.g., a mutation enhancing gene product activity, a mutation enhancing transcription of the gene product, a mutation adding one or more additional copies of the gene).
[0071] In some embodiments, the transgenic non-human mammal comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 75, 80, 90, or 100 less functional copies of the testis specific gene or the X-linked homolog thereof than a wild-type mammal. In some embodiments, the transgenic non-human mammal comprises at least 10 less functional copies of the testis specific gene or the X-linked homolog thereof than a wild-type mammal. In some embodiments, the transgenic non-human mammal comprises at least 1 less functional copy of the testis specific gene or the X-linked homolog thereof than a wild-type mammal. In some embodiments, the transgenic non-human mammal comprises no functional copies of the testis specific gene or the X-linked homolog thereof.
[0072] In some embodiments, the transgenic non-human mammal comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 75, 80, 90, or 100 more copies of the testis specific gene or the X-linked homolog thereof than a wild-type mammal. In some embodiments, the transgenic non-human mammal comprises at least 10 more copies of the testis specific gene or the X-linked homolog thereof than a wild-type mammal. In some embodiments, the transgenic non-human mammal comprises at least 1 more copy of the testis specific gene or the X-linked homolog thereof than a wild-type mammal.
[0073] Some aspects of the present disclosure are related to a non-human mammal (i.e., a transgenic mammal) comprising a non-naturally occurring nucleotide sequence capable of expressing an RNAi agent as described herein that reduces expression of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof. In some embodiments, the RNAi agent is an siRNA, shRNA, or a microRNA.
[0074] In some embodiments, the RNAi agent is expressed under the control of a tissue specific promoter. The tissue specific promoter is not limited and may be any suitable promoter. In some embodiments, the promoter is testis specific (e.g., a bull testis specific promoter). In some embodiments, the bull testis specific promoter is HSPB9, ADAM18, or RELN. In some embodiments, the promoter is an inducible promoter or tissue specific inducible promoter. In some embodiments, the transgenic gene is integrated into a safe harbor locus.
[0075] Standard methods of generating genetically modified animals, e.g., transgenic animals that comprises exogenous genes or animals that have an alteration to an endogenous gene, e.g., an insertion or an at least partial deletion or replacement can be used. In some embodiments, the genetically modified animal having a transgene is produced by a method comprising DNA microinjection, embryonic stem cell-mediated gene transfer, somatic cell nuclear transfer, retrovirus-mediated gene transfer, transposon-mediated gene transfer, or sperm-mediated gene transfer. In some embodiments, the transgenic animal is produced by a method comprising contacting an embryonic stem cell, zygote, or embryo with an agent as described herein wherein the agent is a targetable nuclease and, if appropriate, a guide molecule (e.g., one or more gRNA).
Breeding Methods for Modulating the Copy Number of the Testis Specific Gene or X-Linked Homolog Thereof
[0076] Some aspects of the present disclosure are directed to a method of selective breeding of non-human mammals to bias the sex ratio of offspring, comprising providing a wild-type copy number of a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or a wild-type copy number of the X-linked homolog thereof, identifying one or more members of a population of the non-human mammals having a copy number of the testis specific gene or X-linked homolog thereof that is greater than or less than the wild-type copy number, and selectively breeding said one or more members. In some embodiments, the selective breeding increases the copy number of the testis specific gene or X-linked homolog thereof. In some embodiments, the selective breeding decreases the copy number of the testis specific gene or X-linked homolog thereof.
[0077] In some embodiments, the offspring of the one or more members are screened for the presence of more or less copies of the testis specific gene or X-linked homolog thereof and selectively bred. This method may be repeated one or more times until a stable line of non-human animals is obtained having a biased sex ratio as compared to the wild-type animal.
[0078] The non-human mammals may be any mammals disclosed herein. In some embodiments, the mammals are cattle. In some embodiments, the mammals are livestock ungulates.
[0079] Methods of detecting the copy number of a gene in the genome of an animal are known in the art and any suitable method may be used. Said methods include, without limitation, in situ hybridization (ISH) (such as fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH) or silver in situ hybridization (SISH)), genomic comparative hybridization or polymerase chain reaction (such as real time quantitative PCR). In some embodiments, the method of detecting the copy number is disclosed in the Examples herein. In some embodiments, the method is or comprises Single-Haplotype Iterative Mapping and Sequencing (SHIMS) methodology (SHIMS). See, Bellott et al., Nat Protoc (2018) 13:787-809.
Methods of Screening for Agents Modulating the Product of a Testis Specific Gene Located in a Male-Specific Region of a Y Chromosome (MSY) of a Mammal Having an X-Linked Homolog, or the X-Linked Homolog Thereof
[0080] Some aspects of the present disclosure are directed to a method of screening for a candidate agent that biases the sex ratio of offspring of a mammal, comprising providing a composition comprising a cell or cell free expression system expressing the product of a testis specific gene located in a male-specific region of a Y chromosome (MSY) of a mammal having an X-linked homolog, or the X-linked homolog thereof; contacting the composition with a test agent; and measuring the expression or activity of the product, wherein if the expression or activity of the product is modulated as compared to a control then the agent is identified as a candidate agent that biases the sex ratio of offspring of a mammal. The testis specific gene or X-linked homolog thereof is not limited and may be any one disclosed herein. In some embodiments, the gene is HSFY or HSFX. The mammal may be any mammal disclosed herein. In some embodiments, the mammal is a bull. In some embodiments, the mammal is a livestock ungulate.
[0081] Some aspects of the present disclosure are directed to a method of screening for a candidate agent that biases the sex ratio of offspring of a bull, comprising providing a composition comprising a gene product of a HSFY or HSFX gene (e.g., a Bos taurus HSFY or HSFX gene, a Bos taurus HSFY or HSFX gene disclosed herein) and cognate heat shock binding elements nucleotide sequence; contacting the composition with a test agent; and determining if the test agent reduces or eliminates binding of the gene product to the binding elements. In some embodiments, the binding of the gene product to the binding elements causes expression of a gene product and reduced expression of the gene product can be used to detect if the agent is inhibiting binding of the gene product to the binding element.
Methods and Compositions for Sex Biasing by Modulating PRSSLY or a Homolog Thereof
[0082] Some aspects of the present disclosure are directed to a method of biasing the sex ratio of offspring of a male animal, comprising contacting the animal with an agent that modulates the expression or activity of PRSSLY or a PRSSLY homolog (e.g., GenBank Accession Number KJ780361 or a homolog thereof). In some embodiments, the agent modulates the activity of a gene product of PRSSLY or a PRSSLY homolog.
[0083] In some embodiments, the sex ratio is biased to males. In some embodiments, the sex ratio is biased toward females. In some embodiments, the sex ratio is biased towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more males: females offspring. In some embodiments, the sex ratio is biased towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more females: males offspring.
[0084] In some embodiments, the agent reduces the expression or activity (e.g., activity of the gene product) of PRSSLY or a PRSSLY homolog by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the agent increases the expression or activity (e.g., activity of the gene product) of PRSSLY or a PRSSLY homolog by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more.
[0085] The animal is not limited. In some embodiments, the wild-type animal expresses PRSSLY or a PRSSLY homolog. In some embodiments, the wild-type animal expresses PRSSLY. In some embodiments, the PRSSLY is selected from SEQ ID NO. 11 (cattle), SEQ ID NO. 12 (pig), SEQ ID NO. 13 (sheep), and SEQ ID NO. 14 (goat). In some embodiments, the animal is a eutherian mammal. In some embodiments, the animal is a human, chimpanzee, marmoset, mouse lemur, tree shrew, mouse, hamster, deer mouse, beaver, squirrel, damara mole rat, chinchilla, rabbit, sea otter, ferret, walrus, sea lion, monk seal, polar bear, dog, fox, horse, bovine, antelope, sheep, goat, deer, minke whale, pig, camel, flying fox, bat, elephant, wallaby, Tasmanian devil, echidna, or newt. In some embodiments, the animal is a non-human animal. In some embodiments, the animal is a livestock animal (e.g., bovine, equine, porcine, rabbit, sheep, goat, deer, camel). In some embodiments, the animal is a pig. In some embodiments, the animal is a bull. In some embodiments, the animal is a dog. In some embodiments, the animal is a mouse or rat.
[0086] The agent is not limited and may be any suitable agent capable of modulating the expression or activity of PRSSLY or a PRSSLY homolog. The agent may be any agent described herein.
[0087] In some embodiments, the agent comprises an RNAi agent or antisense oligonucleotide specifically reducing or eliminating the expression of PRSSLY or a PRSSLY homolog. In some embodiments, the agent comprises a targeting endonuclease. In some embodiments, the agent comprises a nucleic acid, protein or small molecule that modulates the activity (e.g., increases or decreases) of a gene product of PRSSLY or a PRSSLY homolog.
[0088] In some embodiments, the agent modulates a level (e.g., increases or decreases) of a gene product of PRSSLY or a PRSSLY homolog.
[0089] In some embodiments, the agent is an antagonist of a gene product of PRSSLY or a PRSSLY homolog. In some embodiments, the agent is an agonist of a gene product of PRSSLY or a PRSSLY homolog. In some embodiments, the agent is encoded by a synthetic RNA (e.g., modified mRNAs). In some embodiments, the synthetic agent expresses a gene product of PRSSLY or a PRSSLY homolog.
[0090] In some embodiments, the agent is a targetable nuclease and, if appropriate, a guide molecule (e.g., one or more gRNA). In some embodiments, the agent is capable of making a mutation in a of a gene product of PRSSLY or a PRSSLY homolog as described herein.
[0091] In some embodiments, the agent is a targetable nuclease capable of introducing a mutation reducing the expression or activity of a gene product of PRSSLY or a PRSSLY homolog, or increasing the expression or activity of PRSSLY or a PRSSLY homolog. In some embodiments, the agent is an RNA-guided nucleases (RGNs) (e.g., the Cas proteins of the CRISPR/Cas Type II system targetable nuclease) and RNA template (e.g., gRNA) capable of specifically introducing a mutation reducing the expression or activity of a gene product of PRSSLY or a PRSSLY homolog, or increasing the expression or activity of a gene product of PRSSLY or a PRSSLY homolog.
[0092] In some embodiments, the agent comprises an RNA interference (RNAi) agent specifically reducing or eliminating the expression of PRSSLY or a PRSSLY homolog. In some embodiments, the agent comprises antisense oligonucleotide specifically reducing or eliminating the expression of PRSSLY or a PRSSLY homolog.
[0093] In some embodiments, an oligonucleotide and the target RNA sequence (e.g., an mRNA of PRSSLY or a PRSSLY homolog) have 100% sequence complementarity. In some aspects, an oligonucleotide may comprise sequence variations, e.g., insertions, deletions, and single point mutations, relative to the target sequence. In some embodiments, an oligonucleotide has at least 70% sequence identity or complementarity to the target RNA (e.g., mRNA, pre-mRNA, or nascent RNA of PRSSLY or a PRSSLY homolog). In certain embodiments, an oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to the target sequence. In some embodiments, the PRSSLY is selected from SEQ ID NO. 11 (cattle), SEQ ID NO. 12 (pig), SEQ ID NO. 13 (sheep), and SEQ ID NO. 14 (goat).
[0094] Some aspects of the present disclosure are directed to compositions (e.g., pharmaceutical compositions including compositions for veterinary use) comprising an agent as described herein for sex biasing of offspring of a male animal. In some embodiments, the agent/composition is locally administered to the mammal's reproductive cells.
Transgenic Animals Comprising a Non-Naturally Occurring Mutation in PRSSLY or a PRSSLY Homolog
[0095] Some aspects of the present disclosure are directed to a transgenic non-human animal exhibiting differential expression or activity (e.g., increased or decreased) of PRSSLY or a PRSSLY homolog as compared to a control non-human animal. In some embodiments, the animal comprises a non-naturally occurring mutation that modulates (e.g., increases or decreases) the expression or activity of PRSSLY or a PRSSLY homolog as compared to a control non-human animal.
[0096] In some embodiments, the animal is a eutherian mammal. In some embodiments, the animal is a chimpanzee, marmoset, mouse lemur, tree shrew, mouse, hamster, deer mouse, beaver, squirrel, damara mole rat, chinchilla, rabbit, sea otter, ferret, walrus, sea lion, monk seal, polar bear, dog, fox, horse, bovine, antelope, sheep, goat, deer, minke whale, pig, camel, flying fox, bat, elephant, wallaby, Tasmanian devil, echidna, or newt. In some embodiments, the animal is a livestock animal.
[0097] In some embodiments, the sex ratio is biased to males. In some embodiments, the sex ratio is biased toward females.
[0098] In some embodiments, the transgenic non-human animal has at least 2, 5, 10, 20, 30, 50, or more copies of PRSSLY or a PRSSLY homolog as compared to a control wild-type animal.
[0099] In some embodiments, the mutation reduces expression or activity of a gene product of PRSSLY or a PRSSLY homolog as compared to the wild-type of a control non-human animal. In some embodiments, the mutation reduces the expression or activity of PRSSLY or a PRSSLY homolog by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mutation increases the expression or activity of PRSSLY or a PRSSLY homolog by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more. In some embodiments, the PRSSLY is selected from SEQ ID NO. 11 (cattle), SEQ ID NO. 12 (pig), SEQ ID NO. 13 (sheep), and SEQ ID NO. 14 (goat).
[0100] In some embodiments, the sex ratio is biased by the mutation towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more males: females offspring. In some embodiments, the sex ratio is biased by the mutation towards at least about 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5; 1:4, 1:4.5, 1:5 or more females: males offspring. In some embodiments, sex ratio biasing as compared to wild-type is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold towards males or females.
[0101] In some embodiments, the mutation is one or more nucleotide insertions, deletions and/or substitutions. In some embodiments, the mutation reduces or eliminates expression or activity of the gene product (e.g., a frameshift mutation, a mutation rendering the gene product non-functional (inactive) or partially functional (less active), a mutation in a regulatory region that reduces or eliminates expression, a mutation deleting all or a portion of the gene product, a mutation deleting one or more copies of a gene). In some embodiments, the mutation increases expression or activity of the gene product (e.g., a mutation enhancing gene product activity, a mutation enhancing transcription of the gene product, a mutation adding one or more additional copies of the gene). In some embodiments, the mutation modulates (e.g., increases or decreases) PRSSLY or a PRSSLY homolog promoter activity. In some embodiments, the PRSSLY is selected from SEQ ID NO. 11 (cattle), SEQ ID NO. 12 (pig), SEQ ID NO. 13 (sheep), and SEQ ID NO. 14 (goat).
[0102] Some aspects of the present disclosure are directed to a transgenic non-human animal comprising a non-naturally occurring nucleotide sequence capable of expressing an RNAi agent that reduces expression of PRSSLY or a PRSSLY homolog as compared to a control non-human animal. In some embodiments, the RNAi agent is an siRNA or a microRNA. In some embodiments, the RNAi agent is an siRNA, shRNA, or a microRNA.
[0103] In some embodiments, the RNAi agent is expressed under the control of a tissue specific promoter. The tissue specific promoter is not limited and may be any suitable promoter. In some embodiments, the promoter is testis specific (e.g., a bull testis specific promoter). In some embodiments, the promoter is an inducible promoter or tissue specific inducible promoter. In some embodiments, the transgenic gene is integrated into a safe harbor locus.
[0104] Standard methods of generating genetically modified animals, e.g., transgenic animals that comprises exogenous genes or animals that have an alteration to an endogenous gene, e.g., an insertion or an at least partial deletion or replacement can be used. In some embodiments, the genetically modified animal having a transgene is produced by a method comprising DNA microinjection, embryonic stem cell-mediated gene transfer, somatic cell nuclear transfer, retrovirus-mediated gene transfer, transposon-mediated gene transfer, or sperm-mediated gene transfer. In some embodiments, the transgenic animal is produced by a method comprising contacting an embryonic stem cell, zygote, or embryo with an agent as described herein wherein the agent is a targetable nuclease and, if appropriate, a guide molecule (e.g., one or more gRNA).
Breeding Methods for Modulating PRSSLY or a PRSSLY Homolog Expression or Activity
[0105] Some aspects of the present disclosure are directed to a method of selective breeding of non-human animals (e.g., non-transgenic) to bias the sex ratio of offspring, comprising identifying one or more members of a population of the non-human animals having differential (e.g., increased or decreased) PRSSLY or a PRSSLY homolog expression or activity, and selectively breeding said one or more members. In some embodiments, the selective breeding increases PRSSLY or a PRSSLY homolog expression or activity. In some embodiments, the selective breeding decreases PRSSLY or a PRSSLY homolog expression or activity. In some embodiments, the PRSSLY is selected from SEQ ID NO. 11 (cattle), SEQ ID NO. 12 (pig), SEQ ID NO. 13 (sheep), and SEQ ID NO. 14 (goat).
[0106] In some embodiments, the offspring of the one or more members are screened for modulated PRSSLY or a PRSSLY homolog expression or activity and selectively bred. This method may be repeated one or more times until a stable line of non-human animals is obtained having a biased sex ratio as compared to the wild-type animal.
[0107] The non-human animal may be any animal disclosed herein. In some embodiments, the non-human animal is a livestock animal. In some embodiments, the non-human animal is a bull or pig.
Methods of Screening for Agents Modulating the Product of PRSSLY or a PRSSLY Homolog
[0108] Some aspects of the present disclosure are directed to a method of screening for a candidate agent that biases the sex ratio of offspring of an animal, comprising (a) providing a composition comprising a cell or cell free expression system expressing the product of PRSSLY or a PRSSLY homolog; (b) contacting the composition with a test agent; and (c) measuring the expression or activity of the product, wherein if the expression or activity of the product is modulated as compared to a control then the agent is identified as a candidate agent that biases the sex ratio of offspring of an animal. In some embodiments, the PRSSLY is selected from SEQ ID NO. 11 (cattle), SEQ ID NO. 12 (pig), SEQ ID NO. 13 (sheep), and SEQ ID NO. 14 (goat).
[0109] The animal may be any animal disclosed herein. In some embodiments, the animal is a livestock animal. In some embodiments, the animal is a bull or pig.
Some Definitions and Embodiments
[0110] The terms decrease, reduced, reduction, decrease, and inhibit are all used herein generally to mean a decrease by a statistically significant amount. However, for avoidance of doubt, reduced, reduction or decrease or inhibit means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. absent level as compared to a reference sample), or any decrease between 10-100% as compared to a reference level.
[0111] The terms increased, increase, enhance or activate are all used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms increased, increase, enhance or activate means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.
[0112] The term statistically significant or significantly refers to statistical significance and generally means a two-standard deviation (2SD) below normal, or lower, concentration of the marker. The term refers to statistical evidence that there is a difference. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using the p-value.
[0113] Agent is used herein to refer to any substance, compound (e.g., molecule), supramolecular complex, material, or combination or mixture thereof. In some aspects, an agent can be represented by a chemical formula, chemical structure, or sequence. Example of agents, include, e.g., small molecules, polypeptides, nucleic acids (e.g., RNAi agents, antisense oligonucleotide, aptamers), lipids, polysaccharides, peptide mimetics, etc. In general, agents may be obtained using any suitable method known in the art. The ordinary skilled artisan will select an appropriate method based, e.g., on the nature of the agent. An agent may be at least partly purified. In some embodiments an agent may be provided as part of a composition, which may contain, e.g., a counter-ion, aqueous or non-aqueous diluent or carrier, buffer, preservative, or other ingredient, in addition to the agent, in various embodiments. In some embodiments an agent may be provided as a salt, ester, hydrate, or solvate. In some embodiments an agent is cell-permeable, e.g., within the range of typical agents that are taken up by cells and acts intracellularly, e.g., within mammalian cells. Certain compounds may exist in particular geometric or stereoisomeric forms. Such compounds, including cis- and trans-isomers, E- and Z-isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, ()- and (+)-isomers, racemic mixtures thereof, and other mixtures thereof are encompassed by this disclosure in various embodiments unless otherwise indicated. Certain compounds may exist in a variety or protonation states, may have a variety of configurations, may exist as solvates (e.g., with water (i.e. hydrates) or common solvents) and/or may have different crystalline forms (e.g., polymorphs) or different tautomeric forms. Embodiments exhibiting such alternative protonation states, configurations, solvates, and forms are encompassed by the present disclosure where applicable.
[0114] An analog of a first agent refers to a second agent that is structurally and/or functionally similar to the first agent. A structural analog of a first agent is an analog that is structurally similar to the first agent. Unless otherwise specified, the term analog as used herein refers to a structural analog. A structural analog of an agent may have substantially similar physical, chemical, biological, and/or pharmacological propert (ies) as the agent or may differ in at least one physical, chemical, biological, or pharmacological property. In some embodiments at least one such property differs in a manner that renders the analog more suitable for a purpose of interest. In some embodiments a structural analog of an agent differs from the agent in that at least one atom, functional group, or substructure of the agent is replaced by a different atom, functional group, or substructure in the analog. In some embodiments, a structural analog of an agent differs from the agent in that at least one hydrogen or substituent present in the agent is replaced by a different moiety (e.g., a different substituent) in the analog.
[0115] In some embodiments, the agent is a nucleic acid. The term nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The terms nucleic acid and polynucleotide are used interchangeably herein and should be understood to include double-stranded polynucleotides, single-stranded (such as sense or antisense) polynucleotides, and partially double-stranded polynucleotides. A nucleic acid often comprises standard nucleotides typically found in naturally occurring DNA or RNA (which can include modifications such as methylated nucleobases), joined by phosphodiester bonds. In some embodiments a nucleic acid may comprise one or more non-standard nucleotides, which may be naturally occurring or non-naturally occurring (i.e., artificial; not found in nature) in various embodiments and/or may contain a modified sugar or modified backbone linkage. Nucleic acid modifications (e.g., base, sugar, and/or backbone modifications), non-standard nucleotides or nucleosides, etc., such as those known in the art as being useful in the context of RNA interference (RNAi), aptamer, CRISPR technology, polypeptide production, reprogramming, or antisense-based molecules for research or therapeutic purposes may be incorporated in various embodiments. Such modifications may, for example, increase stability (e.g., by reducing sensitivity to cleavage by nucleases), decrease clearance in vivo, increase cell uptake, or confer other properties that improve the translation, potency, efficacy, specificity, or otherwise render the nucleic acid more suitable for an intended use. Various non-limiting examples of nucleic acid modifications are described in, e.g., Deleavey G F, et al., Chemical modification of siRNA. Curr. Protoc. Nucleic Acid Chem. 2009; 39:16.3.1-16.3.22; Crooke, ST (ed.) Antisense drug technology: principles, strategies, and applications, Boca Raton: CRC Press, 2008; Kurreck, J. (ed.) Therapeutic oligonucleotides, RSC biomolecular sciences. Cambridge: Royal Society of Chemistry, 2008; U.S. Pat. Nos. 4,469,863; 5,536,821; 5,541,306; 5,637,683; 5,637,684; 5,700,922; 5,717,083; 5,719,262; 5,739,308; 5,773,601; 5,886,165; 5,929, 226; 5,977,296; 6,140,482; 6,455,308 and/or in PCT application publications WO 00/56746 and WO 01/14398. Different modifications may be used in the two strands of a double-stranded nucleic acid. A nucleic acid may be modified uniformly or on only a portion thereof and/or may contain multiple different modifications. Where the length of a nucleic acid or nucleic acid region is given in terms of a number of nucleotides (nt) it should be understood that the number refers to the number of nucleotides in a single-stranded nucleic acid or in each strand of a double-stranded nucleic acid unless otherwise indicated. An oligonucleotide is a relatively short nucleic acid, typically between about 5 and about 100 nt long. In some embodiments, the nucleic acid agent codes for a gene product of the testis specific gene or X-linked homolog thereof.
[0116] Nucleic acid construct refers to a nucleic acid that is generated by man and is not identical to nucleic acids that occur in nature, i.e., it differs in sequence from naturally occurring nucleic acid molecules and/or comprises a modification that distinguishes it from nucleic acids found in nature. A nucleic acid construct may comprise two or more nucleic acids that are identical to nucleic acids found in nature, or portions thereof, but are not found as part of a single nucleic acid in nature.
[0117] In some embodiments, the agent is a small molecule. The term small molecule refers to an organic molecule that is less than about 2 kilodaltons (kDa) in mass. In some embodiments, the small molecule is less than about 1.5 kDa, or less than about 1 kDa. In some embodiments, the small molecule is less than about 800 daltons (Da), 600 Da, 500 Da, 400 Da, 300 Da, 200 Da, or 100 Da. Often, a small molecule has a mass of at least 50 Da. In some embodiments, a small molecule is non-polymeric. In some embodiments, a small molecule is not an amino acid. In some embodiments, a small molecule is not a nucleotide. In some embodiments, a small molecule is not a saccharide. In some embodiments, a small molecule contains multiple carbon-carbon bonds and can comprise one or more heteroatoms and/or one or more functional groups important for structural interaction with proteins (e.g., hydrogen bonding), e.g., an amine, carbonyl, hydroxyl, or carboxyl group, and in some embodiments at least two functional groups. Small molecules often comprise one or more cyclic carbon or heterocyclic structures and/or aromatic or polyaromatic structures, optionally substituted with one or more of the above functional groups.
[0118] In some embodiments, the agent is a protein or polypeptide. The term polypeptide refers to a polymer of amino acids linked by peptide bonds. A protein is a molecule comprising one or more polypeptides. A peptide is a relatively short polypeptide, typically between about 2 and 100 amino acids (aa) in length, e.g., between 4 and 60 aa; between 8 and 40 aa; between 10 and 30 aa. The terms protein, polypeptide, and peptide may be used interchangeably. In general, a polypeptide may contain only standard amino acids or may comprise one or more non-standard amino acids (which may be naturally occurring or non-naturally occurring amino acids) and/or amino acid analogs in various embodiments. A standard amino acid is any of the 20 L-amino acids that are commonly utilized in the synthesis of proteins by mammals and are encoded by the genetic code. A non-standard amino acid is an amino acid that is not commonly utilized in the synthesis of proteins by mammals. Non-standard amino acids include naturally occurring amino acids (other than the 20 standard amino acids) and non-naturally occurring amino acids. An amino acid, e.g., one or more of the amino acids in a polypeptide, may be modified, for example, by addition, e.g., covalent linkage, of a moiety such as an alkyl group, an alkanoyl group, a carbohydrate group, a phosphate group, a lipid, a polysaccharide, a halogen, a linker for conjugation, a protecting group, a small molecule (such as a fluorophore), etc.
[0119] In some embodiments, the agent is a peptide mimetic. The terms mimetic, peptide mimetic and peptidomimetic are used interchangeably herein, and generally refer to a peptide, partial peptide or non-peptide molecule that mimics the tertiary binding structure or activity of a selected native peptide or protein functional domain (e.g., binding motif or active site). These peptide mimetics include recombinantly or chemically modified peptides, as well as non-peptide agents such as small molecule drug mimetics.
[0120] In some embodiments, the agent is an antagonist of a gene product of gene disclosed herein. In some embodiments, the agent is an agonist of a gene product disclosed here. In some embodiments, the agent is encoded by a synthetic RNA (e.g., modified mRNAs). In some embodiments, the synthetic agent expresses a gene product of a gene disclosed herein.
[0121] The synthetic RNA can encode any suitable agent described herein. Synthetic RNAs, including modified RNAs are taught in WO 2017075406, which is herein incorporated by reference. In some embodiments, the agent is, or is encoded by, a synthetic RNA (e.g., modified mRNAs) conjugated to non-nucleic acid molecules. In some embodiments, the synthetic RNAs are conjugated to (or otherwise physically associated with) a moiety that promotes cellular uptake, nuclear entry, and/or nuclear retention (e.g., peptide transport moieties or the nucleic acids). In some embodiments, the synthetic RNA is conjugated to a peptide transporter moiety, for example a cell-penetrating peptide transport moiety, which is effective to enhance transport of the oligomer into cells.
[0122] In some embodiments, the agent is a targetable nuclease and, if appropriate, a guide molecule (e.g., one or more gRNA).
[0123] The term targetable nuclease refers to a nuclease that can be programmed to produce site-specific DNA breaks, e.g., double-stranded breaks (DSBs), at a selected site in DNA. Such a site may be referred to as a target site. The target site can be selected by appropriate design of the targetable nuclease or by providing a guide molecule (e.g., a guide RNA) directs the nuclease to the target site. Examples of targetable nucleases include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases (RGNs) such as the Cas proteins of the CRISPR/Cas Type II system, and engineered meganucleases.
[0124] In some embodiments, the agent comprises an RNA interference (RNAi) agent.
[0125] The term RNA interference (RNAi) encompasses processes in which a molecular complex known as an RNA-induced silencing complex (RISC) reduces gene expression in a sequence-specific manner in, e.g., eukaryotic cells, e.g., vertebrate cells, or in an appropriate in vitro system. RISC may incorporate a short nucleic acid strand (e.g., about 16-about 30 nucleotides (nt) in length) that pairs with and directs or guides sequence-specific degradation or translational repression of RNA (e.g., mRNA) to which the strand has complementarity. The short nucleic acid strand may be referred to as a guide strand or antisense strand. An RNA strand to which the guide strand has complementarity may be referred to as a target RNA. A guide strand may initially become associated with RISC components (in a complex sometimes termed the RISC loading complex) as part of a short double-stranded RNA (dsRNA), e.g., a short interfering RNA (siRNA). The other strand of the short dsRNA may be referred to as a passenger strand or sense strand. The complementarity of the structure formed by hybridization of a target RNA and the guide strand may be such that the strand can (i) guide cleavage of the target RNA in the RNA-induced silencing complex (RISC) and/or (ii) cause translational repression of the target RNA. Reduction of expression due to RNAi may be essentially complete (e.g., the amount of a gene product is reduced to background levels) or may be less than complete in various embodiments. For example, mRNA and/or protein level may be reduced by 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or more, in various embodiments. As known in the art, the complementarity between the guide strand and a target RNA need not be perfect (100%) but need only be sufficient to result in inhibition of gene expression. For example, in some embodiments 1, 2, 3, 4, 5, or more nucleotides of a guide strand may not be matched to a target RNA. Not matched or unmatched refers to a nucleotide that is mismatched (not complementary to the nucleotide located opposite it in a duplex, i.e., wherein Watson-Crick base pairing does not take place) or forms at least part of a bulge. Examples of mismatches include, without limitation, an A opposite a G or A, a C opposite an A or C, a U opposite a Cor U, a G opposite a G. A bulge refers to a sequence of one or more nucleotides in a strand within a generally duplex region that are not located opposite to nucleotide(s) in the other strand. Partly complementary refers to less than perfect complementarity. In some embodiments a guide strand has at least about 80%, 85%, or 90%, e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA over a continuous stretch of at least about 15 nt, e.g., between 15 nt and 30 nt, between 17 nt and 29 nt, between 18 nt and 25 nt, between 19 nt and 23 nt, of the target RNA. In some embodiments at least the seed region of a guide strand (the nucleotides in positions 2-7 or 2-8 of the guide strand) is perfectly complementary to a target RNA. In some embodiments, a guide strand and a target RNA sequence may form a duplex that contains no more than 1, 2, 3, or 4 mismatched or bulging nucleotides over a continuous stretch of at least 10 nt, e.g., between 10-30 nt. In some embodiments a guide strand and a target RNA sequence may form a duplex that contains no more than 1, 2, 3, 4, 5, or 6 mismatched or bulging nucleotides over a continuous stretch of at least 12 nt, e.g., between 10-30 nt. In some embodiments, a guide strand and a target RNA sequence may form a duplex that contains no more than 1, 2, 3, 4, 5, 6, 7, or 8 mismatched or bulging nts over a continuous stretch of at least 15 nt, e.g., between 10-30 nt. In some embodiments, a guide strand and a target RNA sequence may form a duplex that contains no mismatched or bulging nucleotides over a continuous stretch of at least 10 nt, e.g., between 10-30 nt. In some embodiments, between 10-30 nt is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nt.
[0126] As used herein, the term RNAi agent encompasses nucleic acids that can be used to achieve RNAi in eukaryotic cells. Short interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA) are examples of RNAi agents. siRNAs typically comprise two separate nucleic acid strands that are hybridized to each other to form a structure that contains a double stranded (duplex) portion at least 15 nt in length, e.g., about 15-about 30 nt long, e.g., between 17-27 nt long, e.g., between 18-25 nt long, e.g., between 19-23 nt long, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments the strands of an siRNA are perfectly complementary to each other within the duplex portion. In some embodiments the duplex portion may contain one or more unmatched nucleotides, e.g., one or more mismatched (non-complementary) nucleotide pairs or bulged nucleotides. In some embodiments either or both strands of an siRNA may contain up to about 1, 2, 3, or 4 unmatched nucleotides within the duplex portion. In some embodiments a strand may have a length of between 15-35 nt, e.g., between 17-29 nt, e.g., 19-25 nt, e.g., 21-23 nt. Strands may be equal in length or may have different lengths in various embodiments. In some embodiments, strands may differ by 1-10 nt in length. A strand may have a 5 phosphate group and/or a 3 hydroxyl (OH) group. Either or both strands of an siRNA may comprise a 3 overhang of, e.g., about 1-10 nt (e.g., 1-5 nt, e.g., 2 nt). Overhangs may be the same length or different in lengths in various embodiments. In some embodiments an overhang may comprise or consist of deoxyribonucleotides, ribonucleotides, or modified nucleotides or modified ribonucleotides such as 2-O-methylated nucleotides, or 2-O-methyl-uridine. An overhang may be perfectly complementary, partly complementary, or not complementary to a target RNA in a hybrid formed by the guide strand and the target RNA in various embodiments.
[0127] shRNAs are nucleic acid molecules that comprise a stem-loop structure and a length typically between about 40-150 nt, e.g., about 50-100 nt, e.g., about 60-80 nt. A stem-loop structure (also referred to as a hairpin structure) refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand (stem portion; duplex) that is linked on one side by a region of (usually) predominantly single-stranded nucleotides (loop portion). Such structures are well known in the art and the term is used consistently with its meaning in the art. A guide strand sequence may be positioned in either arm of the stem, i.e., 5y with respect to the loop or 3y with respect to the loop in various embodiments. As is known in the art, the stem structure does not require exact base-pairing (perfect complementarity). Thus, the stem may include one or more unmatched residues or the base-pairing may be exact, i.e., it may not include any mismatches or bulges. In some embodiments the stem is between 15-30 nt, e.g., between 17-29 nt, e.g., between 19-25 nt. In some embodiments the stem is between 15-19 nt. In some embodiments the stem is between 19-30 nt. The primary sequence and number of nucleotides within the loop may vary. Examples of loop sequences include, e.g., UGGU; ACUCGAGA; UUCAAGAGA. In some embodiments a loop sequence found in a naturally occurring miRNA precursor molecule (e.g., a pre-miRNA) may be used. In some embodiments a loop sequence may be absent (in which case the termini of the duplex portion may be directly linked). In some embodiments a loop sequence may be at least partly self-complementary. In some embodiments the loop is between 1 and 20 nt in length, e.g., 1-15 nt, e.g., 4-9 nt. The shRNA structure may comprise a 5 or 3 overhang. As known in the art, an shRNA may undergo intracellular processing, e.g., by the ribonuclease (RNase) III family enzyme known as Dicer, to remove the loop and generate an siRNA.
[0128] Mature endogenous miRNAs are short (typically 18-24 nt, e.g., about 22 nt), single-stranded RNAs that are generated by intracellular processing from larger, endogenously encoded precursor RNA molecules termed miRNA precursors (see, e.g., Bartel, D., Cell. 116 (2): 281-97 (2004); Bartel D P. Cell. 136 (2): 215-33 (2009); Winter, J., et al., Nature Cell Biology 11:228-234 (2009). Artificial miRNA may be designed to take advantage of the endogenous RNAi pathway in order to silence a target RNA of interest. The sequence of such artificial miRNA may be selected so that one or more bulges is present when the artificial miRNA is hybridized to its target sequence, mimicking the structure of naturally occurring miRNA: mRNA hybrids. Those of ordinary skill in the art are aware of how to design artificial miRNA.
[0129] An RNAi agent that contains a strand sufficiently complementary to an RNA of interest so as to result in reduced expression of the RNA of interest (e.g., as a result of degradation or repression of translation of the RNA) in a cell or in an in vitro system capable of mediating RNAi and/or that comprises a sequence that is at least 80%, 90%, 95%, or more (e.g., 100%) complementary to a sequence comprising at least 10, 12, 15, 17, or 19 consecutive nucleotides of an RNA of interest may be referred to as being targeted to the RNA of interest. An RNAi agent targeted to an RNA transcript may also be considered to be targeted to a gene from which the transcript is transcribed.
[0130] In some embodiments an RNAi agent is a vector (e.g., an expression vector) suitable for causing intracellular expression of one or more transcripts that give rise to a siRNA, shRNA, or miRNA in the cell. Such a vector may be referred to as an RNAi vector. An RNAi vector may comprise a template that, when transcribed, yields transcripts that may form a siRNA (e.g., as two separate strands that hybridize to each other), shRNA, or miRNA precursor (e.g., pri-miRNA or pre-mRNA).
[0131] Antisense oligonucleotides (ASO) are small sequences of DNA or RNA (e.g., about 8-50 base pairs in length) able to target RNA transcripts by Watson-Crick base pairing, resulting in reduced or modified protein expression. In some embodiments, oligonucleotides are unmodified. In other embodiments oligonucleotides include one or more modifications, e.g., to improve solubility, binding, potency, and/or stability of the antisense oligonucleotide. Modified oligonucleotides may comprise at least one modification relative to unmodified RNA or DNA. In some embodiments, oligonucleotides are modified to include internucleoside linkage modifications, sugar modifications, and/or nucleobase modifications. Examples of such modifications are known to those of skill in the art.
[0132] In some embodiments the oligonucleotide is modified by the substitution of at least one nucleotide with a modified nucleotide, such that in vivo stability is enhanced as compared to a corresponding unmodified oligonucleotide. In some aspects, the modified nucleotide is a sugar-modified nucleotide. In another aspect, the modified nucleotide is a nucleobase-modified nucleotide.
[0133] In some embodiments, oligonucleotides, may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the target-specific activity, e.g., the splice site selection modulating activity is not substantially affected, e.g., in a region at the 5-end and/or the 3-end of the oligonucleotide molecule. In some aspects, the ends may be stabilized by incorporating modified nucleotide analogues.
[0134] In some aspects preferred nucleotide analogues include sugar- and/or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of a ribonucleotide may be modified to include at least one of a nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphothioate group. In preferred sugar-modified ribonucleotides, the 2 OH group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or ON, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
[0135] In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety.
[0136] Modified oligonucleotides may comprise one or more nucleosides comprising an unmodified nucleobase. In some embodiments modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase.
[0137] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
[0138] Also preferred are nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Examples of modified nucleobases include, but are not limited to, uridine and/or cytidine modifications at the 5-position, e.g., 5-(2-amino) propyl uridine, 5-bromo uridine; adenosine and/or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine. Oligonucleotide reagents of the invention also may be modified with chemical moieties that improve the in vivo pharmacological properties of the oligonucleotide reagents.
[0139] In some embodiments, nucleosides of modified oligonucleotides are linked together using any internucleoside linkage.
[0140] Additional modifications are known by those of skill in the art and examples can be found in WO 2019/241648, U.S. Pat. Nos. 10,307,434, 9,045,518, and 10,266,822, each of which is incorporated herein by reference.
[0141] Oligonucleotides may be of any size and/or chemical composition sufficient to target a testis specific gene located in a male-specific region of the Y chromosome (MSY) having an X-linked homolog, or the X-linked homolog thereof. In some embodiments, an oligonucleotide is between about 5-300 nucleotides or modified nucleotides. In some aspects an oligonucleotide is between about 10-100, 15-85, 20-70, 25-55, or 30-40 nucleotides or modified nucleotides. In certain aspects an oligonucleotide is between about 15-35, 15-20, 20-25, 25-30, or 30-35 nucleotides or modified nucleotides.
[0142] In some embodiments, an oligonucleotide and the target RNA sequence have 100% sequence complementarity. In some aspects, an oligonucleotide may comprise sequence variations, e.g., insertions, deletions, and single point mutations, relative to the target sequence. In some embodiments, an oligonucleotide has at least 70% sequence identity or complementarity to the target RNA. In certain embodiments, an oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to the target sequence.
[0143] The method of administering the agent to the male mammal is not limited and may be any suitable method. In some embodiments, the agent is locally administered to the mammal's reproductive cells.
[0144] Agents disclosed herein and/or identified or validated using a method described herein may be administered by any suitable means such as orally, intranasally, subcutaneously, intramuscularly, intravenously, intra-arterially, parenterally, intraperitoneally, intrathecally, intratracheally, ocularly, sublingually, vaginally, rectally, dermally, or by inhalation, e.g., as an aerosol. The particular mode selected will depend, of course, upon the particular agent and the dosage required for therapeutic efficacy (e.g., the desired degree of sex bias). The methods, generally speaking, may be practiced using any mode of administration that is medically or veterinarily acceptable, meaning any mode that produces acceptable levels of efficacy without causing clinically unacceptable (e.g., medically or veterinarily unacceptable) adverse effects. The term parenteral includes intravenous, intramuscular, intraperitoneal, subcutaneous, intraosseus, and intrasternal administration, e.g., by injection or infusion techniques. In some embodiments, a route of administration is parenteral or oral. Optionally, a route or location of administration is selected based at least in part on the location of the male's reproductive cells (e.g., testes). For example, an agent may be administered locally to a target tissue or organ, e.g., a tissue or organ comprising reproductive cells. Local administration encompasses (1) administration directly into or near a target tissue or organ, (2) into or near a blood vessel that directly supplies a target tissue or organ, or (3) into a fluid-filled extravascular compartment in fluid communication with the target tissue or organ. Near in this context refers to locations up to 1 cm, 5 cm, or 10 cm from an edge or border of the target tissue, organ, or blood vessel. In some embodiments an agent is locally administered to the testes. Other appropriate routes and devices for administering agents will be apparent to one of ordinary skill in the art.
[0145] Suitable preparations, e.g., substantially pure preparations, of an active agent may be combined with one or more pharmaceutically acceptable carriers or excipients, etc., to produce an appropriate pharmaceutical composition. The term pharmaceutically acceptable carrier or excipient refers to a carrier (which term encompasses carriers, media, diluents, solvents, vehicles, etc.) or excipient which does not significantly interfere with the biological activity or effectiveness of the active ingredient(s) of a composition and which is not excessively toxic to the host at the concentrations at which it is used or administered. Other pharmaceutically acceptable ingredients can be present in the composition as well. Suitable substances and their use for the formulation of pharmaceutically active compounds is well-known in the art (see, for example, Remington 's Pharmaceutical Sciences, E. W. Martin, 19th Ed., 1995, Mack Publishing Co.: Easton, PA, and more recent editions or versions thereof, such as Remington: The Science and Practice of Pharmacy. 21st Edition. Philadelphia, PA. Lippincott Williams & Wilkins, 2005, for additional discussion of pharmaceutically acceptable substances and methods of preparing pharmaceutical compositions of various types).
[0146] Some aspects of the present disclosure are directed to compositions (e.g., pharmaceutical compositions including compositions for veterinary use) comprising an agent as described herein.
[0147] A pharmaceutical composition is typically formulated to be compatible with its intended route of administration. For example, preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media, e.g., sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; preservatives, e.g., antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Such parenteral preparations can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Pharmaceutical compositions and agents for use in such compositions may be manufactured under conditions that meet standards or criteria prescribed by a regulatory agency such as the USFDA (or similar agency in another jurisdiction) having authority over the manufacturing, sale, and/or use of therapeutic agents. For example, such compositions and agents may be manufactured according to Good Manufacturing Practices (GMP) and/or subjected to quality control procedures appropriate for pharmaceutical agents to be administered to humans.
[0148] For oral administration, agents can be formulated by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Suitable excipients for oral dosage forms are, e.g., fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers. Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
[0149] Pharmaceutical preparations which can be used orally include push fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art.
[0150] Formulations for oral delivery may incorporate agents to improve stability in the gastrointestinal tract and/or to enhance absorption.
[0151] For topical applications, pharmaceutical compositions may be formulated in a suitable ointment, lotion, gel, or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers suitable for use in such composition.
[0152] For local administration to the eye, pharmaceutical compositions may be formulated as solutions or micronized suspensions in isotonic, pH adjusted sterile saline, e.g., for use in eye drops, or in an ointment. In some embodiments intraocular administration is used. Routes of intraocular administration include, e.g., intravitreal injection, retrobulbar injection, peribulbar injection, subretinal, sub-Tenon injection, and subconjunctival injection
[0153] Pharmaceutical compositions may be formulated for transmucosal or transdermal delivery. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated may be used in the formulation. Such penetrants are generally known in the art. Pharmaceutical compositions may be formulated as suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or as retention enemas for rectal delivery.
[0154] In some embodiments, a pharmaceutical composition includes one or more agents intended to protect the active agent(s) against rapid elimination from the body, such as a controlled release formulation, implant, microencapsulated delivery system, etc. Compounds may be encapsulated or incorporated into particles, e.g., microparticles or nanoparticles. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, PLGA, collagen, polyorthoesters, polyethers, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. For example, and without limitation, a number of particle-based delivery systems are known in the art for delivery of siRNA. Use of such compositions is contemplated. In some embodiments lipidoid particles are used. In some embodiments non-lipid particles are used. Liposomes or other lipid-based particles can also be used as pharmaceutically acceptable carriers. In some embodiments a macroscopic implant is used to deliver an agent systemically or locally.
[0155] In some embodiments, a pharmaceutically acceptable derivative of an agent described herein or identified or validated as described herein, is provided. As used herein, a pharmaceutically acceptable derivative of a particular agent includes, but is not limited to, pharmaceutically acceptable salts, esters, salts of such esters, or any other adduct or derivative which upon administration to a subject in need thereof is capable of providing the compound, directly or indirectly. Thus, pharmaceutically acceptable derivatives can include salts, prodrugs, and/or active metabolites. The term pharmaceutically acceptable salt refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and/or lower animals without undue toxicity, irritation, allergic response and the like, and which are commensurate with a reasonable benefit/risk ratio. A wide variety of appropriate pharmaceutically acceptable salts are well known in the art. Pharmaceutically acceptable salts include, but are not limited to, those derived from suitable inorganic and organic acids and bases.
[0156] Pharmaceutical compositions are, in at least some embodiments, administered for a time and in an amount sufficient to promote sex biasing of offspring. Efficacy and toxicity of active agents can be assessed by standard pharmaceutical procedures in cell cultures or experimental animals. An effective dose (e.g., sufficient to promote sex biasing of offspring) of an active agent in a pharmaceutical composition may be within a range of about 0.001 to about 100 mg/kg body weight, about 0.01 to about 25 mg/kg body weight, about 0.1 to about 20 mg/kg body weight, about 1 to about 10 mg/kg. Other doses include, for example, about 1 g/kg to about 500 mg/kg, and about 100 g/kg to about 5 mg/kg. In some embodiments a single dose is administered while in other embodiments multiple doses are administered. Those of ordinary skill in the art will appreciate that appropriate doses in any particular circumstance depend upon the potency of the agent(s) utilized, and may optionally be tailored to the particular recipient. The specific dose level for a subject may depend upon a variety of factors including the activity of the specific agent(s) employed, the age, body weight, general health of the subject, etc.
[0157] It may be desirable to formulate pharmaceutical compositions, particularly those for oral or parenteral compositions, in unit dosage form for ease of administration and uniformity of dosage. Unit dosage form, as that term is used herein, refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active agent(s) calculated to produce the desired therapeutic effect in association with an appropriate pharmaceutically acceptable carrier.
[0158] It will be understood that a therapeutic regimen may include administration of multiple unit dosage forms over a period of time. In some embodiments, a subject is treated for between 1-7 days. In some embodiments a subject is treated for between 7-14 days. In some embodiments a subject is treated for between 14-28 days. In other embodiments, a longer course of therapy is administered, e.g., over between about 4 and about 10 weeks, 10-26 weeks, 26-52 weeks, or longer. In some embodiments, treatment is continued for 1-5 years, 1-10 years, 1-20 years, or more. A subject may receive one or more doses a day, or may receive doses every other day or less frequently, within a treatment period. Treatment courses may be intermittent. For example, a subject may be treated during sexual maturation.
[0159] In some embodiments of the screening methods disclosed herein, a high throughput screen (HTS) is performed. A high throughput screen can utilize cell-free or cell-based assays. High throughput screens often involve testing large numbers of compounds with high efficiency, e.g., in parallel. For example, tens or hundreds of thousands of compounds can be routinely screened in short periods of time, e.g., hours to days. Often such screening is performed in multiwell plates containing, at least 96 wells or other vessels in which multiple physically separated cavities or depressions are present in a substrate. High throughput screens often involve use of automation, e.g., for liquid handling, imaging, data acquisition and processing, etc. Certain general principles and techniques that may be applied in embodiments of a HTS of the present invention are described in Macarrn R & Hertzberg R P. Design and implementation of high-throughput screening assays. Methods Mol Biol., 565:1-32, 2009 and/or An WF & Tolliday N J., Introduction: cell-based assays for high-throughput screening. Methods Mol Biol. 486:1-12, 2009, and/or references in either of these. Useful methods are also disclosed in High Throughput Screening: Methods and Protocols (Methods in Molecular Biology) by William P. Janzen (2002) and High-Throughput Screening in Drug Discovery (Methods and Principles in Medicinal Chemistry) (2006) by Jorg Hser.
[0160] The term hit generally refers to an agent that achieves an effect of interest in a screen or assay, e.g., an agent that has at least a predetermined level of modulating effect on cell survival, cell proliferation, gene expression, protein activity, or other parameter of interest being measured in the screen or assay. Test agents that are identified as hits in a screen may be selected for further testing, development, or modification. In some embodiments a test agent is retested using the same assay or different assays. Additional amounts of the test agent may be synthesized or otherwise obtained, if desired. Physical testing or computational approaches can be used to determine or predict one or more physicochemical, pharmacokinetic and/or pharmacodynamic properties of compounds identified in a screen. For example, solubility, absorption, distribution, metabolism, and excretion (ADME) parameters can be experimentally determined or predicted. Such information can be used, e.g., to select hits for further testing, development, or modification. For example, small molecules having characteristics typical of drug-like molecules can be selected and/or small molecules having one or more unfavorable characteristics can be avoided or modified to reduce or eliminated such unfavorable characteristic(s).
[0161] Additional compounds, e.g., analogs, that have a desired activity can be identified or designed based on compounds identified in a screen. In some embodiments structures of hit compounds are examined to identify a pharmacophore, which can be used to design additional compounds. An additional compound may, for example, have one or more altered, e.g., improved, physicochemical, pharmacokinetic (e.g., absorption, distribution, metabolism and/or excretion) and/or pharmacodynamic properties as compared with an initial hit or may have approximately the same properties but a different structure. For example, a compound may have higher affinity for the molecular target of interest, lower affinity for a non-target molecule, greater solubility (e.g., increased aqueous solubility), increased stability, increased bioavailability, oral bioavailability, and/or reduced side effect(s), modified onset of therapeutic action and/or duration of effect. An improved property is generally a property that renders a compound more readily usable or more useful for one or more intended uses. Improvement can be accomplished through empirical modification of the hit structure (e.g., synthesizing compounds with related structures and testing them in cell-free or cell-based assays or in non-human animals) and/or using computational approaches. Such modification can make use of established principles of medicinal chemistry to predictably alter one or more properties. An analog that has one or more improved properties may be identified and used in a composition or method described herein. In some embodiments a molecular target of a hit compound is identified or known. In some embodiments, additional compounds that act on the same molecular target may be identified empirically (e.g., through screening a compound library) or designed.
[0162] Data or results from testing an agent or performing a screen may be stored or electronically transmitted. Such information may be stored on a tangible medium, which may be a computer-readable medium, paper, etc. In some embodiments a method of identifying or testing an agent comprises storing and/or electronically transmitting information indicating that a test agent has one or more propert (ies) of interest or indicating that a test agent is a hit in a particular screen, or indicating the particular result achieved using a test agent. A list of hits from a screen may be generated and stored or transmitted. Hits may be ranked or divided into two or more groups based on activity, structural similarity, or other characteristics
[0163] Once a candidate agent is identified, additional agents, e.g., analogs, may be generated based on it. An additional agent, may, for example, have increased cell uptake, increased potency, increased stability, greater solubility, or any improved property. In some embodiments a labeled form of the agent is generated. The labeled agent may be used, e.g., to directly measure binding of an agent to a molecular target in a cell. In some embodiments, a molecular target of an agent identified as described herein may be identified. An agent may be used as an affinity reagent to isolate a molecular target. An assay to identify the molecular target, e.g., using methods such as mass spectrometry, may be performed. Once a molecular target is identified, one or more additional screens maybe performed to identify agents that act specifically on that target.
[0164] Any of a wide variety of agents may be used as a test agent in various embodiments. For example, a test agent may be a small molecule, polypeptide, peptide, amino acid, nucleic acid, oligonucleotide, lipid, carbohydrate, or hybrid molecule. In some embodiments a nucleic acid used as a test agent comprises a siRNA, shRNA, antisense oligonucleotide, aptamer, or random oligonucleotide. In some embodiments a test agent is cell permeable or provided in a form or with an appropriate carrier or vector to allow it to enter cells.
[0165] Agents can be obtained from natural sources or produced synthetically. Agents may be at least partially pure or may be present in extracts or other types of mixtures. Extracts or fractions thereof can be produced from, e.g., plants, animals, microorganisms, marine organisms, fermentation broths (e.g., soil, bacterial or fungal fermentation broths), etc. In some embodiments, a compound collection (library) is tested. A compound library may comprise natural products and/or compounds generated using non-directed or directed synthetic organic chemistry. In some embodiments a library is a small molecule library, peptide library, peptoid library, cDNA library, oligonucleotide library, or display library (e.g., a phage display library). In some embodiments a library comprises agents of two or more of the foregoing types. In some embodiments oligonucleotides in an oligonucleotide library comprise siRNAs, shRNAs, antisense oligonucleotides, aptamers, or random oligonucleotides.
[0166] A library may comprise, e.g., between 100 and 500,000 compounds, or more. In some embodiments a library comprises at least 10,000, at least 50,000, at least 100,000, or at least 250,000 compounds. In some embodiments compounds of a compound library are arrayed in multiwell plates. They may be dissolved in a solvent (e.g., DMSO) or provided in dry form, e.g., as a powder or solid. Collections of synthetic, semi-synthetic, and/or naturally occurring compounds may be tested. Compound libraries can comprise structurally related, structurally diverse, or structurally unrelated compounds. Compounds may be artificial (having a structure invented by man and not found in nature) or naturally occurring. In some embodiments compounds that have been identified as hits or leads in a drug discovery program and/or analogs thereof. In some embodiments a library may be focused (e.g., composed primarily of compounds having the same core structure, derived from the same precursor, or having at least one biochemical activity in common). Compound libraries are available from a number of commercial vendors such as Tocris BioScience, Nanosyn, BioFocus, and from government entities such as the U.S. National Institutes of Health (NIH). In some embodiments a test agent is not an agent that is found in a cell culture medium known or used in the art, e.g., for culturing vertebrate, e.g., mammalian cells, e.g., an agent provided for purposes of culturing the cells. In some embodiments, if the agent is one that is found in a cell culture medium known or used in the art, the agent may be used at a different, e.g., higher, concentration when used as a test agent in a method or composition described herein.
[0167] Specific examples of certain aspects of the inventions disclosed herein are set forth below in the Examples.
[0168] One skilled in the art readily appreciates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The details of the description and the examples herein are representative of certain embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention. It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
[0169] The articles a and an as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include or between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention provides all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. It is contemplated that all embodiments described herein are applicable to all different aspects of the invention where appropriate. It is also contemplated that any of the embodiments or aspects can be freely combined with one or more other such embodiments or aspects whenever appropriate. Where elements are presented as lists, e.g., in Markush group or similar format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth in so many words herein. It should also be understood that any embodiment or aspect of the invention can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification. For example, any one or more nucleic acids, polypeptides, cells, species or types of organism, disorders, subjects, or combinations thereof, can be excluded.
[0170] Where the claims or description relate to a composition of matter, e.g., a nucleic acid, polypeptide, cell, or non-human transgenic animal, it is to be understood that methods of making or using the composition of matter according to any of the methods disclosed herein, and methods of using the composition of matter for any of the purposes disclosed herein are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where the claims or description relate to a method, e.g., it is to be understood that methods of making compositions useful for performing the method, and products produced according to the method, are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
[0171] Where ranges are given herein, the invention includes embodiments in which the endpoints are included, embodiments in which both endpoints are excluded, and embodiments in which one endpoint is included and the other is excluded. It should be assumed that both endpoints are included unless indicated otherwise. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. It is also understood that where a series of numerical values is stated herein, the invention includes embodiments that relate analogously to any intervening value or range defined by any two values in the series, and that the lowest value may be taken as a minimum and the greatest value may be taken as a maximum. Numerical values, as used herein, include values expressed as percentages. For any embodiment of the invention in which a numerical value is prefaced by about or approximately, the invention includes an embodiment in which the exact value is recited. For any embodiment of the invention in which a numerical value is not prefaced by about or approximately, the invention includes an embodiment in which the value is prefaced by about or approximately. Approximately or about generally includes numbers that fall within a range of 1% or in some embodiments within a range of 5% of a number or in some embodiments within a range of 10% of a number in either direction (greater than or less than the number) unless otherwise stated or otherwise evident from the context (except where such number would impermissibly exceed 100% of a possible value). It should be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited, but the invention includes embodiments in which the order is so limited. It should also be understood that unless otherwise indicated or evident from the context, any product or composition described herein may be considered isolated.
EXAMPLES
Example 1
[0172] Studies of Y-chromosome evolution have focused primarily on gene decay, a consequence of suppression of crossing over with the X chromosome. Here is provided evidence that suppression of X-Y crossing over unleashed a second dynamic: selfish X-Y arms races that reshaped the sex chromosomes in mammals as different as cattle, mice, and men. Using super-resolution sequencing, the Y chromosome of Bos taurus (bull) is found to be dominated by lineage-specific massive amplification of testis-expressed gene families, making it the most gene-dense Y chromosome sequenced to date. As in mice, an X-linked homolog of a bull Y-amplified gene has become testis-specific and amplified. This striking evolutionary convergence suggests that lineage-specific X-Y co-evolution through gene amplification, and the selfish forces underlying this phenomenon, are dominatingly powerful among diverse mammalian lineages. Together with Y gene decay, X-Y arms races molded mammalian sex chromosomes and influenced the course of mammalian evolution.
[0173] The inventors assembled the complete sequence of the Bos taurus (i.e. domestic cattle) Y chromosome and part of the X chromosome. The inventors discovered an X-Y gene pair, expressed exclusively in the testis, that is coamplified on the X and Y chromosomes. There are 79 copies of HSFY on the Y chromosome and at least 11 copies of HSFX on the X chromosome. This is only the second case of massive amplification of a testis-specific gene family on mammalian X and Y chromosomes. During sequencing of the mouse Y (published in 2014), it was discovered that an unrelated gene familySlx/Slyis testis-specific and has undergone co-amplification on the X and Y chromosomes. The inventors proposed that this X-Y co-evolution may be a manifestation of sex-linked meiotic drive, where the X and Y chromosomes compete for transmission to gametes during the process of meiosis. In mouse, it has been shown that altering the copy number of Sly and Slx changes the sex ratio, such that reduced Sly copy number results in more female offspring and reduced Slx copy number results in more male offspring. The inventors propose that the same situation might be true in cattle, and manipulation of the copy number of HSFY and HSFX could result in sex ratio skewing.
Introduction
[0174] Mammalian sex chromosomes evolved from an ordinary pair of autosomes (1-3). Differentiation of the X and Y chromosomes began 200-300 million years ago, propelled by gradual suppression of X-Y crossing over, most likely due to inversions on the Y chromosome (3, 4). While the X chromosome continues to participate in crossing over with its homolog during female meiosis, the male-specific region of the Y chromosome (MSY) lacks a partner for crossing over during male meiosis. Theoretical and empirical studies of Y chromosome evolution have largely focused on one specific outcome of crossover suppression-genetic decay. Gene loss is a nearly universal feature of MSY evolution, and has been reported in species as diverse as plants (papaya, white campion, and heartwing sorrel), flies, fish, frogs, lizards, and mammals (6-14).
[0175] Complete sequencing of four mammalian Y chromosomeshuman, chimpanzee (Pan troglodytes), rhesus macaque (Macaca mulatta), and mouse (Mus musculus)revealed that MSY decay has been counterbalanced to varying degrees by sequence acquisition and amplification (15-18). The super-resolution sequencing method employed for these MSY sequences is a requirement for elucidating the complex structure of ampliconic sequences, which are euchromatic repeats that display >99% identity over more than 10 kb. The mouse MSY stands in stark contrast to the three primate MSYs because it has been overtaken by ampliconic sequence. Nearly 98% of the mouse MSY is ampliconic, compared to 45%, 57%, and 5% in human, chimpanzee, and rhesus, respectively. The amplified mouse sequence bears no homology to any primate MSY sequence and contains three gene families that are expressed exclusively in the male germline. These MSY amplified genes have independently acquired and amplified germline-specific gene families on the mouse X chromosome. Mouse X-Y co-amplification may be a manifestation of sex-linked meiotic drive, where the X and Y chromosomes are competing against each other for transmission to the next generation (18).
[0176] Sex-linked meiotic drive has been reported in dozens of insect species but, in mammals, this phenomenon has only been observed in a few rodent species (19). In natural mouse populations, autosomes are known to engage in meiotic drive, with the t-haplotypes of chromosome 17 harboring a strong segregation distorter (20). It is unclear what features insects and rodents share that make them uniquely permissible to the proliferation of meiotic drive systems.
[0177] Here is presented the complete MSY sequence of the bull (Bos taurus, Hereford breed). This species represents a third major branch of the mammalian tree (
Results
[0178] Mapping, sequencing, and assembly of the bull MSY
[0179] The inventors produced and assembled a nearly complete sequence of the bull MSY (
Comparison of Five Sequenced MSYs Reveals Convergent Evolution in Bull and Mouse
[0180] The analysis of the mouse MSY revealed that it followed an evolutionary path distinct from that of the three sequenced primate MSYs: human, chimpanzee and rhesus macaque. The primate MSYs are by far the smallest chromosomes in their respective genomes; their euchromatic sequence content ranges from 12 Mb in rhesus to 26 Mb in chimpanzee. By contrast, the euchromatic sequence content of the mouse MSY totals nearly 90 Mb (18). The size disparity between the mouse and primate MSYs is due solely to massive amplification of lineage-specific sequences in mouse, since ancestral X-homologous regions of the MSY, presumed to be present in the mammalian ancestor, are markedly reduced in mouse. With only four complete MSY sequences in hand, it was impossible to know if this rampant MSY sequence expansion is a peculiarity of the mouse lineage.
[0181] The bull MSY sequence suggests that massive MSY sequence amplification may be a broad characteristic of mammalian MSYs. The bull MSY is more similar in structure to the mouse MSY than to any of the primate MSYs (
[0182] In all of the sequenced MSYs, ampliconic regions display extremely high inter-repeat nucleotide identities-up to 99.99%-because of ongoing gene conversion (as well as other forms of homologous recombination) between repeat units (26). Both the bull and mouse MSYs have ample substrates for gene conversion, so maps of intrachromosomal identities across these chromosomes were generated to visualize the extent of such sequence homogenization in bull and mouse (
[0183] While gene conversion, which is homologous recombination without crossing-over, between MSY amplicons results in sequence homogenization, homologous recombination with crossing-over can create inversions, duplications, and deletions, with duplications and deletions in ampliconic regions giving rise to copy number variation (27). To examine copy number variation within bull MSY amplicons, >200 publicly available bull whole-genome shotgun sequences were analyzed from four different breeds (28). Using read-depth mapping of raw sequencing data, it was determined that copy-number variability is indeed prevalent among bull MSY amplicons (
Evolutionary Conservation of Bull MSY Ampliconic Regions
[0184] The MSYs of bull and mouse differ radically in structure from the sequenced primate MSYs; one common feature that distinguishes these two disparate species from the three primates is domestication. It was previously demonstrated that the MSY of a Mus spretus-derived strain, diverged from Mus musculus three million years ago, carries ampliconic sequences homologous to the long-arm amplicons found in the sequenced MSY (from Mus musculus musculus, strain C57BL/6), ruling out the possibility that amplification was a consequence of selective breeding (18). Similarly, the inventors sought to determine if the bull MSY amplification predated the domestication of cattle. FISH analysis was used to examine six different ampliconic regions on the bull MSY, including the long-arm amplicon, across nine bovine species spanning 17 million years of evolution (29-31). The long-arm amplicon, as well as three other tandem arrays, are conserved and amplified on the MSY in all nine species (
Gene Content of Bull MSY
[0185] A second feature that distinguishes the bull and mouse MSYs from those of primates is their high gene densities, a consequence of the massive amplification of genes within their ampliconic regions (
[0186] In all previously sequenced MSYs (human, chimpanzee, rhesus, and mouse), it was found that multicopy genes were expressed exclusively or predominantly in testes, while most single-copy ancestral genes were found to be expressed more broadly (15-17, 37). Y-linked testis-specific genes likely have specialized functions related to spermatogenesis, while the broadly expressed genes have more widespread functions related to gene regulation (11). The inventors analyzed the expression of bull MSY genes, as well as their homologs on the X-chromosome or autosomes, across eight somatic tissues and testis using previously published datasets (38). All multicopy bull MSY genes, both ancestral and acquired, displayed largely testis-specific expression patterns (
X-Y Co-Amplification in Bull
[0187] The final common feature shared between the bull and mouse MSYsthe co-amplification of X and Y gene familieshas the greatest biological implications. The three acquired, amplified gene families on the mouse MSY long arm have non-allelic homologs on the X chromosome that have been amplified in parallel, and all of these sex-linked gene families are expressed exclusively in the male germline (18). It was speculated that this X-Y co-evolution may be a manifestation of sex-linked meiotic drive, which distorts the balanced ratio of male and female offspring.
[0188] X-Y co-amplification is also found in cattle. One of the amplified gene families on the bull MSY long arm is HSFY, which is present in at least 79 copies. HSFY is also multicopy in human and rhesus, but with only two or three copies, respectively. The X homolog of this gene, HSFX, is highly amplified in bull (
Discussion
[0189] The bull MSY is the seventh sex chromosome to be sequenced using the SHIMS approach, the only proven strategy for producing super-resolution assemblies of ampliconic regions. Of the finished sex chromosomes, the bull MSY is second only to the mouse MSY in total ampliconic sequence content, and SHIMS was vital for the elucidation of the complex repeat architecture of the bull Y long arm and an accurate representation of its gene content. Because the majority of ampliconic repeats comprising the bull Y long arm differ by less than one base pair (bp) per 1000 (
[0190] Until now, the mouse MSY stood alone, contrasting starkly with the three sequenced primate MSYs in terms of overall size and structure, leaving open the question of whether the comparatively large and mostly ampliconic mouse MSY was unique among mammals. The MSY of bull, which represents a third major branch of the mammalian tree, is decidedly more similar to the MSY of mouse, demonstrating that massive lineage-specific MSY amplification of testis-specific gene families is not a peculiarity of the mouse lineage, but is widely distributed among mammals. More limited sequencing surveys of additional mammalian MSYsincluding pig, gorilla, cat, and horseshow evidence for large-scale amplification of testis-specific gene families as well (40-43). Horse, which has multiple Y- and X-linked copies of a parasite-derived, testis-specific transcript, may provide another example of X-Y coamplification (42). To understand the extent, mechanism, and evolutionary trajectory of MSY amplification, complete SHIMS-based assemblies of ampliconic regions from these and other mammals will be required.
[0191] The MSY amplification of testis-specific gene families in both bull and mouse occurred in parallel with amplifications of related testis-specific gene families on the X chromosome (
[0192] In addition to HSFX/Y, there is another example of X-Y co-amplification in humans (Table 1).
TABLE-US-00001 TABLE 1 Extent of co-amplification of testis-specific gene families on X and Y chromosomes in bull, mouse, and human. % of X or Y euchromatin occupied X-Y co- Total copy by X-Y co- amplified number of X-Y co- amplified sequence gene families amplified genes X Y X Y X Y Bull 2 82 HSFX HSFY 11 79 Mouse 8 96 Sstx, Ssty, 64 629 Slx, Sly, Srsx Srsy Human 0.06 1.65 HSFX HSFY 4 2 0.04 0.33 VCX VCY 4 2
[0193] There are multiple copies of VCY (2 copies) and VCX (4 copies) in both human and chimpanzee, but no other primates. Both gene families are expressed exclusively in the male germline: VCX encodes a highly acidic protein while VCY encodes a highly basic protein, suggestive of antagonistic functions (47). The extent of X-Y co-amplification varies widely in these three examples. Roughly 96% of the mouse MSY euchromatic sequence arose as a consequence of this phenomenon, compared to less than 2% of the human MSY (Table 1). In bull, mouse, and human, the X chromosome sequence has not been affected to as large a degree as the Y chromosome (Table 1), perhaps because the requirement for recombination between X homologs during female meiosis serves to constrain runaway amplification. One study found intense positive selection and selective sweeps associated with numerous X-chromosome ampliconic regions in primates (48). Y-linked antagonists of these drivers are not necessarily homologous loci, so this phenomenon may have shaped the evolution of both X and Y chromosomes more deeply and extensively than is immediately apparent.
[0194] In mouse, this arms-race hypothesis is supported by knockdown studies where disruption of the X-linked homologs of one co-amplified gene familySlx/Slx1causes sex-ratio skewing towards males, while disruption of the Y-linked homologsSlycauses sex ratio skewing towards females (49, 50). Moreover, targeted deletion and duplication of the Slx/Slx1 gene family skews sex ratios towards males and females, respectively (51). While no comparable functional studies exist for cattle, examination of >200 bull genomes revealed that the long-arm amplicon varies considerably in size within and between breeds (
[0195] The bull Y chromosome sequence provides a second example of massive amplification driven by X-Y co-evolution in mammals, substantiating a second major theme of mammalian Y chromosome evolution, and one that is distinct from the process of Y decay (
Methods
BAC Selection and Sequencing
[0196] The Single-Haplotype Iterative Mapping and Sequencing (SHIMS) strategy (57) was used to assemble a path of sequenced clones selected from the CHORI-240 BAC library (bapac.chori.org) and a custom BAC library (BTDAEX) constructed by Amplicon Express (Pullman, WA). Both libraries are derived from a single male donor (L1 Domino, Bos taurus Hereford breed). Fingerprint contigs and end sequences had been generated previously for the CHORI-240 library (58), so the inventors relied primarily upon this library. The BTDAEX library was used to fill gaps. BAC tiling paths were selected for sequencing as previously described (15). The error rate in the finished sequence was estimated by counting mismatches in alignments between overlapping clones.
Assessing Copy Number Variability
[0197] Illumina sequence data generated from 234 bull genomes from four different Bos taurus breeds (28) were obtained from NCBI (project accession number SRP039339). Male Bos taurus indicus whole genome Illumina sequence data was also obtained from NCBI to use as an outgroup (project accession numbers PRJNA277147, PRJNA324270, and PRJNA324822). Bowtie was used to map reads (59), allowing up to two mismatches and up to a 650-bp insert size for paired-end reads; data from each animal was analyzed separately. First, reads were mapped to our entire bull MSY assembly, and only mapped reads were analyzed further. Next, these reads were mapped to the female Bos taurus genome (bosTau4), and mapped reads removed. The remaining reads were then mapped to five different MSY ampliconic regions (TPSY1 array, TSPY2-PRAME2 array, PRAME1 array, RBMY array, and long-arm amplicon) and to 1-Mb single-copy regions from both the MSY short and long arms. These reads were also mapped to HSFX and to a single-copy region on the X chromosome as a control. Bowtie parameters for this step were adjusted to allow up to 500 alignments per read and to prioritize the best alignments. The size of each ampliconic region was calculated relative to the 1-Mb single-copy short-arm region based on comparative read depths. The statistical significance of differences between means was determined using Welch's t-test.
Fluorescence In Situ Hybridization (FISH)
[0198] FISH on male cell lines derived from various cattle breeds was performed as previously described (60). A minimum of 20 images for metaphase and 50 images for interphase were obtained for each experiment.
Radiation Hybrid Mapping
[0199] 25 STS markers were tested on a 25,000-rad panel consisting of 132 hybrid clones. A cell line derived from the same donor animal (L1 Domino) as the BAC library was used to construct the panel. Data analyses were performed using RHMAPPER 1.22 (61).
Dotplot and Phylogenetic Analyses
[0200] Triangular and square dotplot analyses were performed using custom Perl codes (available at pagelab.wi.mit.edu/software). Circos plots were generated as previously described (62). For each MSY sequence, step-wise 50-kb segments were used as BLAST queries against the remainder of the unmasked MSY sequence, and non-gapped percent identities were calculated for top-hit alignments. For bull and human, tandem array-associated gaps (three in bull and two in human) are represented by model sequence. For phylogenetic analyses, alignments were generated using PRANK (63), and trees were generated using PhyML with default parameters (64). HSFY/X sequences used in this analysis can be found below.
Gene Expression Analyses
[0201] To generate the histograms shown in
Sequence Annotation
[0202] Interspersed repeats were electronically identified using RepeatMasker (www.repeatmasker.org). Protein-coding genes were identified as previously described (17). Active genes were distinguished from pseudogenes by 1) evidence for transcriptional activity by RT-PCR or RNA-seq, 2) intact splice sites (if multi-exonic), and 3) full-length open reading frames (compared to other members of Y-linked multi-copy gene family, Y-homologs in other species, or X/autosomal homologs in Bos taurus). Loci with confirmed transcription but without significant ORFs were considered non-coding transcripts.
TABLE-US-00002 TABLE 2 GenBank accession numbers and references for bull MSY genes Gene Accession name number Reference AMELY NM_174240.2 Gibson C., et al. Biochemistry 30: 1075 (1991). DDX3Y FJ659845.1 Gotherstrom A., et al. Proc Royal Society B 272: 2345 (2005) EIF1AY NM_001145757.1 Van Laere, A. S., et al. Genome Res 18: 1884 (2008) EIF2S3Y FJ627276.1 This disclosure HSFY NM_001077006.1 Moore et al., Direct GenBank submission: BC103406 (2007) OFDIY JN193532.1 Van Laere, A.S., et al. Genome Res 18: 1884 (2008) PRAMEY1 NM_001245953.1 Chang, T. C., et al. PLoS ONE 6: E16867 (2011) PRAMEY2 GU144302.1 Chang, T. C., et al. PLoS ONE 6: E16867 (2011) PRAMEY3 XM_003587135.2 This disclosure RBMY GU304599.2 Bellott, D. W., et al. Nature 508: 494 (2014) SRY NM_001014385.1 Payen, E. J. and Cotinot, C. Y. Nucleic Acids Res 21: 2772 (1993) PRSSLY KC120771.1 This disclosure TSPY1 JN585955.1 Jakubiczka, S., et al. Genomics 3: 732 (1993) TSPY2 JN585956.1 This disclosure USP9Y FJ627275.1 Van Laere, A. S., et al. Genome Res 18: 1884 (2008) UTY FJ627278.1 This disclosure ZFY NM_177491.1 Aasen, E. and Medrano, J. F. Biotechnology 8: 1279 (1990) ZNF280BY NM_001078120.1 Yang, Y., et al. BMC Genomics 12: 13 (2011) ZRSR2Y GAPO01000004.1 Hamilton, C. K., et al. Theriogenology 77: 1587 (2012)
[0203] Accession numbers for confirmed cDNA sequences: [0204] Human HSFY1 NM_033108 [0205] Human HSFY2 NM_153716 [0206] Human HSFX1 NM_016153 [0207] Human HSFX2 NM_001164415 [0208] Human HSFX3 NM_001323079 [0209] Human HSFX4 NM_001351114 [0210] Rhesus HSFY FJ527015 [0211] Bull HSFY NM_001077006 [0212] Cat HSFY NM_001040123 [0213] Opossum HSFY GQ253469 [0214] Opossum HSFX GQ253474
[0215] Accession numbers for predicted genes: [0216] Rhesus HSFX1 XM_005594782 [0217] Rhesus HSFX3 XM_001089561 [0218] Chicken HSFXL XM_416447
[0219] Predicted cat HSFX cDNA sequence obtained from whole-genome assembly (felCat5):
TABLE-US-00003 >catX (SEQIDNO:1) TGAGACATTCTCATGGCAAAAGTGCTCTTGGTCTAGACTAGC TCCATGGCTAGTCAGAGTGCTAAGGAGATACCCAAAGGGAAGCTGGCCCC ATCTGATGATGGAGAGCCAGCACCAGAATTACCATCTAGTTCATCCCAGG ATCCAAATTTGGATTCCGGGGAGATTTTGGTGATGAATAGGGACCAAGCA GTGATCCAAGATCCAGGCCCCCAAGACAACCCACAACCACAGGCCCCAAA CCAAGGCGCCGCCAACGTGGGAGAAAACAACAGTATTCTTGGGCTCTCCT TCCCAAGAAAGCTTTGGATGATCCTGGAGGACAACACCTTCACGTCCGTG CGCTGGAACGATGCCGGGGACACCGTGATCATCGACGAAGACCTTTTCCA GAGGGAGGTTCTTCACCGCAGAGGCGCGGAGAGAATCTTTGAAACTGACA GCTTGAAGACTTTCATCCGCCTGCTGAACCTGTACGGCTTCAGCAAAATAC GCGATTTACCGCAACGCCAACTTTCAGAGAGACAAGCCTTTCCTGCTCAG GAACATTCAGAGGAAAAGTGACCTGAGAGTCACCACCACCTGGCTAGGCA CCAGTGCACCAACTCCAAAGAGAAAGAAGCCGGTGGCAGCAACAAGACA GTCCCCACGAATCCATCACGAGGAACCCGCCAACGACGACAAGACGGTCC TCGGCGCAGCCCCAAATGCTCAGGGTCCCAGCAGCAGCCAGCCCTTCGCC TTCTCTGGCATTTGGTCTCTGAGCAGCGCAGCCGGGTATGCCATGGCAACT CATGGCCCGAGTGAGCCAGGTGGCCTGAGTGGGGAGGGCACCTCCAGGA ACATGATGTTTGTGCCCCTGGCTACTGCCAGAAGGGATGACACAGGGGAA CTGCCCGTCAGCCCCCCAGTTTACCCCGACTATGGTACAGTGATGTCTCTG TATAACACCTGTTATTCCATCCTGCTGGCAGCCCTGTCAGTCATGTCCCCA AATGAGGCCCCCAGTGAGAACGAGGAGCAGGAGGGCTCCTCAGATTACA AGTGTGCCCTCTGTGAACATTTCAAGGAAAATCCAGGTCCCTAGGCTCAC AGGCCACTGATGACAGCTAAAAAGTCACCACTGTAACCATCAATCTATTT TCGGCTTTAATGGAAACAAACACAACTCCGCGGGAGTAAATAAACAGTC
[0220] Predicted bull HSFX cDNA sequences obtained from sequencing non-overlapping CHORI-240 BACs:
TABLE-US-00004 >Hsfx.184P17 (SEQIDNO:2) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCAGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.2120M19 (SEQIDNO:3) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGATAGACAG CATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTCC GCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTCC AATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAGG CAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAGA GAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAAC GAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACTG CTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTGG GCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGGG CAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCTG TGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAGC CCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTGT TACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCCT GAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCTG TGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGGA CACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAAA GTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.379D24 (SEQIDNO:4) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC TGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATAGC TGTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGA GCCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCT GTTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCC CTGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTC TGTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGG GACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATA AAGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.431M19 (SEQIDNO:5) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.5107K24 (SEQIDNO:6) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGAG >Hsfx.6392J12 (SEQIDNO:7) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGGGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCTATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAATAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAACCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGACCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCAGATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.754K1 (SEQIDNO:8) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.8176L20 (SEQIDNO:9) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA >Hsfx.9437020 (SEQIDNO:10) GAGTATTTATGGGGCACCCCGACCATGGTCTGAGGCCCGTTT TCCCTGAGCACTCACTGCTTGGATAGATAATGCTCCTTAGCTAGACTGGCT CCATGGCTAGTCAGAGTTCCCATGAGGCACGGGCAGCCCTGCTGATCCTA TCAACTGATGGGGAGCCTGCAGCAGGGGACACCCGTGATTCCTCCCCAGA TCCAAACCTGGATTTAGGAGAGGCTTTGGAGAAGCAGGGTGACCAGCCCA AGAGCCCAGATCCAGGCCTCCATGACAATCCACTCCAACAGGGCCCAAAC CCAGAAATGGCCAAAGAGGAAGAGAACAACGCCATCCTTGGGCTGTCCTT CCCCAGGAAGCTCTGGAGGATTGTGGAGGATGCAGCCTTCACCTCTGTGC ACTGGAACGATGAGGGAGATACAGTGGTCATCGAGGCAGATCTCTTCCAG ATAGAGGTACTCCAGCGCAGAGGCATGGACCAGATCTTCGAGACAGACA GCATCAAGAGCTTCATCCGTGAACTGAATCTGTACGGGTTCAGGAAAGTC CGCCCTTCGAGTCACTCTACAGGGAAGAAGCTCATGATCTATCGAAACTC CAATTTTCAGAGAGACAAGCCTCTCCTTCTGCATAACATCCAGAGGAAAG GCAACCCCAGAACAACTTCTCAGCCTGCCACTGGCACAACAACTCCAAAG AGAAAGAAGCGAGTGGTGGCAACCAGACACTCTCCTCAATTCCACCACAA CGAGTTCACCCAAAAGGCTGGCAACAAAGTCCAGAAGGGGATGCCAACT GCTCGCAGAACCCCCAGCCAGTGCTCATTTGTGTTCTCTGACCTGTCTGTG GGCAGTGTAGCCAGGCGGGCTGGGGAAAACCATCTCCCCAGTGAGCAGG GCAGCCCCAGCAGGGCGGCTGGAGAGGGCACATCCAGCAATGCCATATCT GTGCCCTCGGCTACTGCTGAAAGGGACAGCCCAGGGAAACTGCCCGAGAG CCCCCCGGTGTACCCAGATTACGAATCGGTGATGGCTTTGTACAACACCTG TTACTCCATCCTGATGGCGGGCCTTTTAGTCATGGCACCAGATGAGGCCCC TGAGGCGGAGGATGAGCAGGGAGAGTCCTCACATTATAAGTGTGCCCTCT GTGAGCAGCTCAAGAACAAGCCCAATCCCTGAGCTGCCAGATACCTAGGG ACACTCAAAAGCACTCTCTTATAATTAAAAATAGATTTCTGGCTCTAATAA AGTCAAGCAAAACTCCATTGGAGTAAATAAACAATCAAACGA
REFERENCES
[0221] 1. Ohno S. Sex Chromosomes and Sex-linked Genes. Berlin: Springer-Verlag; 1967. [0222] 2. Bellot D W, Skaletsky H, Pyntikova T, Mardis E R, Graves T, Kremitzki C, Brown L G, Rozen S, Warren W C, Wilson R K, Page D C. Convergent evolution of chicken Z and human X chromosomes by expansion and gene acquisition. Nature (2010) 466:612-6. [0223] 3. Lahn B T, Page D C. Four evolutionary strata on the human X chromosome. Science (1999) 286:964-7. [0224] 4. Ross M T, Grafham D V, Coffey A J, Scherer S, McLay K, Muzny D, Platzer M, Howell G R, Burrows C, Bird C P, Frankish A, Lovell F L, Howe K L, Ashurst J L, Fulton R S, Sudbrak R, Wen G, Jones M C, Hurles M E, Andrews T D, Scott C E, Searle S, Ramser J, Whittaker A, Deadman R, Carter N P, Hunt S E, Chen R, Cree A, Gunaratne P, Havlak P, Hodgson A, Metzker M L, Richards S, Scott G, Steffen D, Sodergren E, Wheeler D A, Worley K C, Ainscough R, et al. The DNA sequence of the human X chromosome. Nature (2005) 434:325-37. [0225] 5. Bachtrog D. Y-chromosome evolution: emerging insights into processes of Y-chromosome degeneration. Nat Rev Genet (2013) 14:113-24. [0226] 6. Chibalina M V, Filatov D A. Plant Y chromosome degeneration is retarded by haploid purifying selection. Curr Biol (2011) 21:1475-9. [0227] 7. Hough J, Hollister J D, Wang W, Barrett S C, Wright S I. Genetic degeneration of old and young Y chromosomes in the flowering plant Rumex hastatulus. PNAS (2014) 111:7713-8. [0228] 8. Kaiser V B, Zhou Q, Bachtrog D. Nonrandom gene loss from the Drosophila miranda neo-Y chromosome. Genome Biol Evol (2011) 3:1329-37. [0229] 9. Miura I, Ohtani H, Ogata M. Independent degeneration of W and Y sex chromosomes in frog Rana rugosa. Chromosome Res (2012) 20:47-55. [0230] 10. Zhou Q, Zhu H M, Huang Q F, Zhao L, Zhang G J, Roy S W, Vicoso B, Xuan Z L, Ruan J, Zhang Y, Zhao R P, Ye C, Zhang X Q, Wang J, Wang W, Bachtrog D. Deciphering neo-sex and B chromosome evolution by the draft genome of Drosophila albomicans. BMC Genomics (2012) 13:109. [0231] 11. Bellott D W, Hughes J F, Skaletsky H, Brown L G, Pyntikova T, Cho T J, Koutseva N, Zaghlul S, Graves T, Rock S, Kremitzki C, Fulton R S, Dugan S, Ding Y, Morton D, Khan Z, Lewis L, Buhay C, Wang Q, Watt J, Holder M, Lee S, Nazareth L, Alfoldi J, Rozen S, Muzny D M, Warren W C, Gibbs R A, Wilson R K, Page D C. Mammalian Y chromosomes retain widely expressed dosage-sensitive regulators. Nature (2014) 508:494-9. [0232] 12. Liu Z, Moore P H, Ma H, Ackerman C M, Ragiba M, Yu Q, Pearl H M, Kim M S, Charlton J W, Stiles J I, Zee F T, Paterson A H, Ming R. A primitive Y chromosome in papaya marks incipient sex chromosome evolution. Nature (2004) 427:348-52. [0233] 13. Lisachov A P, Makunin A I, Giovannotti M, Pereira J C, Druzhkova A S, Caputo Barucchi V, Ferguson-Smith M A, Trifonov V A. Genetic content of the neo-sex chromosomes in Ctenonotus and Norops (Squamata, Dactyloidae) and degeneration of the Y chromosome as revealed by high-throughput Sequencing of individual chromosomes. Cytogenet Genome Res (2019) 157:115-22. [0234] 14. Peichel C L, McCann S R, Ross J A, Naftaly A F S, Urton J R, Cech J N, Grimwood J, Schmutz J, Myers R M, Kingsley D M, White M A. Assembly of the threespine stickleback Y chromosome reveals convergent signatures of sex chromosome evolution. Genome Biol (2020) 21:177. [0235] 15. Hughes J F, Skaletsky H, Brown L G, Pyntikova T, Graves T, Fulton R S, Dugan S, Ding Y, Buhay C J, Kremitzki C, Wang Q, Shen H, Holder M, Villasana D, Nazareth L V, Cree A, Courtney L, Veizer J, Kotkiewicz H, Cho T J, Koutseva N, Rozen S, Muzny D M, Warren W C, Gibbs R A, Wilson R K, Page D C. Strict evolutionary conservation followed rapid gene loss on human and rhesus Y chromosomes. Nature (2012) 483:82-6. [0236] 16. Hughes J F, Skaletsky H, Pyntikova T, Graves T A, van Daalen S K, Minx P J, Fulton R S, McGrath S D, Locke D P, Friedman C, Trask B J, Mardis E R, Warren W C, Repping S, Rozen S, Wilson R K, Page D C. Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content. Nature (2010) 463:536-9. [0237] 17. Skaletsky H, Kuroda-Kawaguchi T, Minx P J, Cordum H S, Hillier L, Brown L G, Repping S, Pyntikova T, Ali J, Bieri T, Chinwalla A, Delehaunty A, Delehaunty K, Du H, Fewell G, Fulton L, Fulton R, Graves T, Hou S F, Latrielle P, Leonard S, Mardis E, Maupin R, McPherson J, Miner T, Nash W, Nguyen C, Ozersky P, Pepin K, Rock S, Rohlfing T, Scott K, Schultz B, Strong C, Tin-Wollam A, Yang S P, Waterston R H, Wilson R K, Rozen S, Page D C. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature (2003) 423:825-37. [0238] 18. Soh Y Q, Alfoldi J, Pyntikova T, Brown L G, Graves T, Minx P J, Fulton R S, Kremitzki C, Koutseva N, Mueller J L, Rozen S, Hughes J F, Owens E, Womack J E, Murphy W J, Cao Q, de Jong P, Warren W C, Wilson R K, Skaletsky H, Page D C. Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes. Cell (2014) 159:800-13. [0239] 19. Jaenike J. Sex chromosome meiotic drive. Annu Rev Ecol Syst (2001) 32:25-49. [0240] 20. Silver L M. Mouse t haplotypes. Annu Rev Genet (1985) 19:179-208. [0241] 21. Bellott D W, Cho T J, Hughes J F, Skaletsky H, Page D C. Cost-effective high-throughput single-haplotype iterative mapping and sequencing for complex genomic structures. Nat Protoc (2018) 13:787-809. [0242] 22. Mueller J L, Skaletsky H, Brown L G, Zaghlul S, Rock S, Graves T, Auger K, Warren W C, Wilson R K, Page D C. Independent specialization of the human and mouse X chromosomes for the male germ line. Nat Genet (2013) 45:1083-7. [0243] 23. Bellott D W, Skaletsky H, Cho T J, Brown L, Locke D, Chen N, Galkina S, Pyntikova T, Koutseva N, Graves T, Kremitzki C, Warren W C, Clark A G, Gaginskaya E, Wilson R K, Page D C. Avian W and mammalian Y chromosomes convergently retained dosage-sensitive regulators. Nat Genet (2017) 49:387-94. [0244] 24. Hamilton C K, Revay T, Domander R, Favetta L A, King W A. A large expansion of the HSFY gene family in cattle shows dispersion across Yq and testis-specific expression. PLOS One (2011) 6: e17790. [0245] 25. Yang Y, Chang T C, Yasue H, Bharti A K, Retzel E F, Liu W S. ZNF280B Y and ZNF280A Y: autosome derived Y-chromosome gene families in Bovidae. BMC Genomics (2011) 12:13. [0246] 26. Rozen S, Skaletsky H, Marszalek J D, Minx P J, Cordum H S, Waterston R H, Wilson R K, Page D C. Abundant gene conversion between arms of palindromes in human and ape Y chromosomes. Nature (2003) 423:873-6. [0247] 27. Lange J, Noordam M J, van Daalen S K, Skaletsky H, Clark B A, Macville M V, Page D C, Repping S. Intrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms. Genomics (2013) 102:257-64. [0248] 28. Daetwyler H D, Capitan A, Pausch H, Stothard P, van Binsbergen R, Brondum R F, Liao X, Djari A, Rodriguez S C, Grohs C, Esquerre D, Bouchez O, Rossignol M N, Klopp C, Rocha D, Fritz S, Eggen A, Bowman P J, Coote D, Chamberlain A J, Anderson C, VanTassell C P, Hulsegge I, Goddard M E, Guldbrandtsen B, Lund M S, Veerkamp R F, Boichard D A, Fries R, Hayes B J. Whole-genome sequencing of 234 bulls facilitates mapping of monogenic and complex traits in cattle. Nat Genet (2014) 46:858-65. [0249] 29. Bradley D G, MacHugh D E, Cunningham P, Loftus R T. Mitochondrial diversity and the origins of African and European cattle. PNAS (1996) 93:5131-5. [0250] 30. Hernandez Fernandez M, Vrba E S. A complete estimate of the phylogenetic relationships in Ruminantia: a dated species-level supertree of the extant ruminants. Biol Rev Camb Philos Soc (2005) 80:269-302. [0251] 31. Loftus R T, MacHugh D E, Bradley D G, Sharp P M, Cunningham P. Evidence for two independent domestications of cattle. PNAS (1994) 91:2757-61. [0252] 32. Bovine Genome S, Analysis C, Elsik C G, Tellam R L, Worley K C, Gibbs R A, Muzny D M, Weinstock G M, Adelson D L, Eichler E E, Elnitski L, Guigo R, Hamernik D L, Kappes S M, Lewin H A, Lynn D J, Nicholas F W, Reymond A, Rijnkels M, Skow L C, Zdobnov E M, Schook L, Womack J, Alioto T, Antonarakis S E, Astashyn A, Chapple C E, Chen H C, Chrast J, Camara F, Ermolaeva O, Henrichsen C N, Hlavina W, Kapustin Y, Kiryutin B, Kitts P, Kokocinski F, Landrum M, Maglott D, Pruitt K, et al. The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science (2009) 324:522-8. [0253] 33. Mank J E. Small but mighty: the evolutionary dynamics of W and Y sex chromosomes. Chromosome Res (2012) 20:21-33. [0254] 34. Perry G H, Tito R Y, Verrelli B C. The evolutionary history of human and chimpanzee Y-chromosome gene loss. Mol Biol Evol (2007) 24:853-9. [0255] 35. Hughes J F, Skaletsky H, Pyntikova T, Minx P J, Graves T, Rozen S, Wilson R K, Page D C. Conservation of Y-linked genes during human evolution revealed by comparative sequencing in chimpanzee. Nature (2005) 437:100-3. [0256] 36. Das P J, Chowdhary B P, Raudsepp T. Characterization of the bovine pseudoautosomal region and comparison with sheep, goat, and other mammalian pseudoautosomal regions. Cytogenet Genome Res (2009) 126:139-47. [0257] 37. Bentley D R, Balasubramanian S, Swerdlow H P, Smith G P, Milton J, Brown C G, Hall K P, Evers D J, Barnes C L, Bignell H R, Boutell J M, Bryant J, Carter R J, Keira Cheetham R, Cox A J, Ellis D J, Flatbush M R, Gormley N A, Humphray S J, Irving L J, Karbelashvili M S, Kirk S M, Li H, Liu X, Maisinger K S, Murray L J, Obradovic B, Ost T, Parkinson M L, Pratt M R, Rasolonjatovo I M, Reed M T, Rigatti R, Rodighiero C, Ross M T, Sabot A, Sankar S V, Scally A, Schroth G P, Smith M E, et al. Accurate whole human genome sequencing using reversible terminator chemistry. Nature (2008) 456:53-9. [0258] 38. Merkin J, Russell C, Chen P, Burge C B. Evolutionary dynamics of gene and isoform regulation in mammalian tissues. Science (2012) 338:1593-9. [0259] 39. Lesch B J, Silber S J, McCarrey J R, Page D C. Parallel evolution of male germline epigenetic poising and somatic development in animals. Nat Genet (2016) 48:888-94. [0260] 40. Skinner B M, Lachani K, Sargent C A, Yang F, Ellis P, Hunt T, Fu B, Louzada S, Churcher C, Tyler-Smith C, Affara N A. Expansion of the HSFY gene family in pig lineages: HSFY expansion in suids. BMC Genomics (2015) 16:442. [0261] 41. Brashear W A, Raudsepp T, Murphy W J. Evolutionary conservation of Y Chromosome ampliconic gene families despite extensive structural variation. Genome Res (2018) 28:1841-51. [0262] 42. Janecka J E, Davis B W, Ghosh S, Paria N, Das P J, Orlando L, Schubert M, Nielsen M K, Stout T A E, Brashear W, Li G, Johnson C D, Metz R P, Zadjali A M A, Love C C, Varner D D, Bellott D W, Murphy W J, Chowdhary B P, Raudsepp T. Horse Y chromosome assembly displays unique evolutionary features and putative stallion fertility genes. Nat Commun (2018) 9:2945. [0263] 43. Tomaszkiewicz M, Rangavittal S, Cechova M, Campos Sanchez R, Fescemyer H W, Harris R, Ye D, O'Brien P C, Chikhi R, Ryder O A, Ferguson-Smith M A, Medvedev P, Makova K D. A time- and cost-effective strategy to sequence mammalian Y Chromosomes: an application to the de novo assembly of gorilla Y. Genome Res (2016) 26:530-40. [0264] 44. Presgraves D C. Sex chromosomes and speciation in Drosophila. Trends Genet (2008) 24:336-43. [0265] 45. Meiklejohn C D, Tao Y. Genetic conflict and sex chromosome evolution. Trends Ecol Evol (2010) 25:215-23. [0266] 46. MacEachern S, Hayes B, McEwan J, Goddard M. An examination of positive selection and changing effective population size in Angus and Holstein cattle populations (Bos taurus) using a high density SNP genotyping platform and the contribution of ancient polymorphism to genomic diversity in Domestic cattle. BMC Genomics (2009) 10:181. [0267] 47. Lahn B, Page D. A human sex-chromosomal gene family expressed in male germ cells and encoding variably charged proteins. Hum Mol Genet (2000) 9:311-9. [0268] 48. Nam K, Munch K, Hobolth A, Dutheil J Y, Veeramah K R, Woerner A E, Hammer M F, Great Ape Genome Diversity P, Mailund T, Schierup M H. Extreme selective sweeps independently targeted the X chromosomes of the great apes. PNAS (2015) 112:6413-8. [0269] 49. Cocquet J, Ellis P J, Mahadevaiah S K, Affara N A, Vaiman D,
[0270] Burgoyne P S. A genetic basis for a postmeiotic X versus Y chromosome intragenomic conflict in the mouse. PLOS Genet (2012) 8: e1002900. [0271] 50. Cocquet J, Ellis P J, Yamauchi Y, Mahadevaiah S K, Affara N A, Ward M A, Burgoyne P S. The multicopy gene Sly represses the sex chromosomes in the male mouse germline after meiosis. PLOS Biol (2009) 7: e1000244. [0272] 51. Kruger A N, Brogley M A, Huizinga J L, Kidd J M, de Rooij D G, Hu Y C, Mueller J L. A neofunctionalized X-linked ampliconic gene family is essential for male fertility and equal sex ratio in mice. Curr Biol (2019) 29:3699-706 e5. [0273] 52. Jegalian K, Page D C. A proposed path by which genes common to mammalian X and Y chromosomes evolve to become X inactivated. Nature (1998) 394:776-80. [0274] 53. Lyttle T W. Segregation distorters. Ann Rev Genet (1991) 25:511-57. [0275] 54. Hurst L D, Pomiankowski A. Causes of sex ratio bias may account for unisexual sterility in hybrids: a new explanation of Haldane's rule and related phenomena. Genetics (1991) 128:841-58. [0276] 55. Frank S A. Divergence of meiotic drive-suppression systems as an explanation for sex-biased hybrid sterility and inviability. Evolution (1991) 45:262-7. [0277] 56. Ellis P J, Clemente E J, Ball P, Toure A, Ferguson L, Turner J M, Loveland K L, Affara N A, Burgoyne P S. Deletions on mouse Yq lead to upregulation of multiple X- and Y-linked transcripts in spermatids. Human Mol Genet (2005) 14:2705-15. [0278] 57. Kuroda-Kawaguchi T, Skaletsky H, Brown L G, Minx P J, Cordum H S, Waterston R H, Wilson R K, Silber S, Oates R, Rozen S, Page D C. The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet (2001) 29:279-86. [0279] 58. Snelling W M, Chiu R, Schein J E, Hobbs M, Abbey C A, Adelson D L, Aerts J, Bennett G L, Bosdet I E, Boussaha M, Brauning R, Caetano A R, Costa M M, Crawford A M, Dalrymple B P, Eggen A, Everts-van der Wind A, Floriot S, Gautier M, Gill C A, Green R D, Holt R, Jann O, Jones S J, Kappes S M, Keele J W, de Jong P J, Larkin D M, Lewin H A, McEwan J C, Mckay S, Marra M A, Mathewson C A, Matukumalli L K, Moore S S, Murdoch B, Nicholas F W, Osoegawa K, Roy A, Salih H, et al. A physical map of the bovine genome. Genome Biol (2007) 8: R165. [0280] 59. Langmead B, Trapnell C, Pop M, Salzberg S L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol (2009) 10: R25. [0281] 60. Raudsepp T, Chowdhary B P. FISH for mapping single copy genes. Methods Mol Biol (2008) 422:31-49. [0282] 61. Slonim D, Kruglyak L, Stein L, Lander E. Building human genome maps with radiation hybrids. J Comput Biol (1997) 4:487-504. [0283] 62. Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones S J, Marra M A. Circos: an information aesthetic for comparative genomics. Genome Res (2009) 19:1639-45. [0284] 63. Loytynoja A. Phylogeny-aware alignment with PRANK.
Methods Mol Biol (2014) 1079:155-70.
[0285] 64. Guindon S, Delsuc F, Dufayard J F, Gascuel O. Estimating maximum likelihood phylogenies with PhyML. Methods Mol Biol (2009) 537:113-37. [0286] 65. Bellve A R. Purification, culture, and fractionation of spermatogenic cells. Methods Enzymol (1993) 225:84-113. [0287] 66. Bray N L, Pimentel H, Melsted P, Pachter L. Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol (2016) 34:525-7.
Example 2
Abstract
[0288] Meiotic drivers are selfish genetic elements that promote the transmission of the chromosome that carries them. When meiotic drive elements reside on sex chromosomes, they skew the sex ratio, resulting in selection for an unlinked suppressor to restore an equal sex ratio. Sex-chromosome meiotic drive elements have been identified in a number of insect, rodent, and plant species, but are usually species-specific, implying their transient nature. Applicants discovered that an ancient, broadly conserved gene-PRSSLY (protease, serine-like Y), located on the Y chromosome in eutherian mammals-appears to be a meiotic drive factor because it is essential for equal sex ratio in mice. Applicants show that Prssly knockouts produce offspring with a female-biased sex ratio. Across eutheria, PRSSLY's expression is testis-specific, and, in mouse, it is most robustly expressed in post-meiotic germ cells. PRSSLY homologs are found on the X chromosome and autosomes in more distant animals, including marsupials, monotremes, lizards, newts, and caecilians. Notably, PRSSLY is absent from some eutherian groups, including primates and felines. The closest paralog to PRSSLY is the autosomal gene PRSS55, which is expressed exclusively in testes, involved in sperm differentiation and migration, and essential for male fertility in mice. If the function of PRSSLY is conserved in diverse eutheria, then it would be the first example of a sex-linked meiotic drive element conserved for >100 million years.
Introduction
[0289] Selfish genetic elements exist for the sole purpose of self-promotion in their host genome. Meiotic drivers are a particular class of selfish elements with the ability to promote the non-Mendelian transmission of the chromosome where they reside (1). Meiotic drive elements can arise on autosomes or sex chromosomes, but appear to be more frequent on the latter. This suggests that sex chromosomes are a favorable target, or that sex-linked drivers are more frequently identified because they result in sex-ratio skewing, which is a readily observable outcome of their appearance (2).
[0290] Although apparently more common than its autosomal counterpart, sex-linked meiotic drive can have dire consequences. Sex-ratio distortion results in more frequent production of offspring of the more common sex, which lessens the likelihood of their future mating success, and if strong enough, sex-ratio skewing can eventually lead to extinction (1, 3). Therefore, suppressors of sex-chromosome drivers, which can appear on the opposite sex chromosome or on autosomes, are strongly favored by selection (1-3). These drive-suppression systems may cycle in and out of populations, with the loss of drivers leading to relaxed selection for suppressor maintenance (4). Support for the relatively short-lived nature of sex-linked meiotic drive systems comes from their disparate species distribution. They are largely species-specific and limited to a handful of Drosophila, fly, mosquito, butterfly, rodent, and plant species (2).
[0291] Applicants identified a widespread yet uncharacterized mammalian Y-linked genePRSSLY (protease, serine-like Y)that may function in meiotic drive mechanisms, suggesting that sex-linked meiotic drive may be more widespread than previously appreciated. PRSSLY escaped notice until recently because it is not present on the first three Y chromosomes sequenced to completion-human, chimpanzee, and rhesus macaque (5-7). PRSSLY was first discovered on the mouse (8) and dog (9) available chromosomes (initially named DYNG in dog), and homologs were subsequently found on the Y chromosomes of bull (10) and pig (11). PRSSLY appears to encode a massive protein (2,667 amino acid residues in dog compared to the 400 residue average for mammalian proteins). However, PRSSLY contains only one identifiable domain-trypsin-like serine protease-making it part of the large PRSS gene family, which consists of 27 autosomal family members in human. PRSSLY's expression pattern is testis-specific, suggesting a role in sperm development. Given its distinctive species distribution (conserved in diverse mammals, but lost in primates, felines, etc.), gene structure, and expression pattern, Applicants explored the function and evolution of PRSSLY, finding it to be a candidate for the first ancient, broadly conserved, meiotic driver.
Results
Sex Ratio of PRSSLY-Knockout Offspring is Skewed Towards Females
[0292] Applicants explored PRSSLY's function by generating CRISPR knockout mutations in mice. Applicants designed guide RNAs to target exons 6 and 8, which are part of the conserved trypsin-like serine protease domain (
[0293] Applicants continued breeding the mutant lines and a clear phenotype gradually emerged: the sex ratio of the offspring of the PRSSLY mutant males was skewed towards female. Applicants generated a total of 95 litters and 601 mice. Among these 601 offspring of PRSSLY mutant males, 47.4% were male, which is significantly lower than the 52.2% males Applicants observed among 255 offspring of control males (
[0294] Next, Applicants set out to determine the conservation of PRSSLY in mammals by conducting a comprehensive survey of mammalian genomes for the presence or absence of PRSSLY. The number of complete Y chromosomes available for analysis is limited, so Applicants searched available male genomic DNA and testis RNA-seq datasets. In total, Applicants examined datasets from 47 mammals and found that PRSSLY is present in species representing every major mammalian lineage, but it has been lost or pseudogenized repeatedly in multiple lineages: primates, felines, naked mole rat, horse, dolphin, and opossum (
TABLE-US-00005 TABLE 3 Common GenBank accession Species name Chromosome number(s) Microcebus Mouse Y SRX670586, murinus lemur SRX270644 Tupaia belangeri Treeshrew nd NW_006200268, chinensis SRX157965 Mus musculus Mouse Y KJ780361, AC279166 Rattus Rat 14 MW769785, norvegicus SRX196307, SRX196316, SRX196298 Mesocricetus Golden Y SRX9824657 auratus hamster Ellobius Mole vole autosome SRX1466572 lutescens Myodes Bank vole autosome SRX2209239 glareolus Peromyscus Deer Y SRX2186902-3, maniculatus mouse SRX2186910-12, SRX2186914 Neotoma lepida Desert nd LZPO01017748.1 woodrat Castor Beaver nd NW_017873024, canadensis SRX2387506-9 Urocitellus Arctic nd NW_020540734 parryii ground squirrel Fukomys Damara nd NW_011045669, damarensis mole rat SRX347948, SRX347953 Talpa Spanish nd XM_037518333, occidentalis mole SRX4746078-9 Chinchilla Chinchilla Y SRX114649 lanigera Oryctolagus Rabbit Y SRX110711 cuniculus Enhydra lutris Sea otter nd NW_019154294 kenyoni Mustela Ferret Y NW_004577698, putorius furo SRX112813 Mustela Ermine Y XM_032331896.1 erminea Odobenus Walrus nd NW_004450708 rosmarus Zalophus Sea lion Y SRX4928796 californianus Neomonachus Hawaiian Y NW 018729642 schauinslandi monk seal Ursus maritimus Polar bear Y NW_007926558 Canis lupus Dog Y KP081776, familiaris SRX5279848 Vulpes vulpes Red fox Y SRX2834490 Bos taurus Cattle Y AC152072 Pantholops Tibetan nd NW 005810830 hodgsonil antelope Ovis aries Sheep Y SRX3274362, SRX3279754, SRX3279767 Capra hircus Goat Y SRX1947628, SRX1947629, SRX1947630 Odocoileus White- Y NW_018333206, virginianus tailed deer SRX2175795, SRX2175797 Balaenoptera Minke Y NW_006729412 acutorostrata whale scammoni Sus scrofa Pig Y MK393871, SRX229765-9 Camelus ferus Camel Y NW_006220272, SRX4610991 Pteropus alecto Black nd XM_025044285, flying fox NW_006433510 Pteropus Indian nd XM_039875739.1 giganteus flying fox Rousettus Egyptian nd NW_015493161, aegyptiacus fruit bat SRX1429054 Loxodonta Elephant Y SRX339470 africana Macropus Wallaby X ABQ0011031366, eugenii GL141582, CU234131, DRX012262 Sarcophilus Tasmanian X ERX779191, harrisii devil ERX779192, ERX779194, ERX779195, ERX2811915-8 Vombatus Wombat nd NW_020941101.1, ursinis ERX2730373, ERX2730372 Ornithorhynchus Platypus 6 SRX081891-2 anatinus Tachyglossus Echidna nd SRX317056, aculeatus SRX317058, SRX7214458 Anolis Anole lizard 1 SRX2704219-21, carolinensis SRX3367762, SRX3436885-6 Pogona vitticeps Bearded 1 ERX379375, dragon ERX697263 Paroedura picta Ocelot nd BDOT01000386.1 gecko Zootoca vivpara Viviparous nd XM_035097262 lizard Lacerta agilis Sand lizard 16 XM_033173881 Podarcis muralis Common 17 XM 028711624, wall lizard SRX5274936 Cynops Japanese nd SRX682040 pyrrhogaster fire belly newt Rhinatrema Two-lined NC_042615, bivittatum caecilian 1 SRX2848297 Microcaecilia Tiny 2 XM_030192074 unicolor cayenne caecilian Geotrypetes Gaboon 1 XM_033921891 seraphini caecilian
[0295] The unusual gene structure of PRSSLY differs vastly between species (
PRSSLY is Testis-Specific in Eutherians but More Broadly Expressed in Other Animals
[0296] Next, Applicants investigated the expression pattern of PRSSLY and its homologs across species. Applicants examined expression in species where RNA-seq datasets from multiple tissues, including testis, were publicly available and the transcriptome was well annotated. In eutherian mammals, where Y linkage is nearly universal, PRSSLY is testis-specific (
[0297] Next, Applicants examined the timing of PRSSLY expression in finer detail. For mouse, Applicants examined publicly available single-cell RNA-seq datasets generated from adult whole testis (16). Our analysis confirmed that PRSSLY is expressed only in germ cells and is absent in six somatic cell types included in this dataset (
[0298] Applicants also examined publicly available testis RNA-seq datasets covering multiple developmental timepoints from embryo to adult (17). Such datasets were available for rat and rabbit, and in both species the onset of PRSSLY expression correlates with the onset of meiosis (
[0299] Outside of eutherians, PRSSLY homologs, which are located on the X chromosome or autosomes, are more broadly expressed (
[0300] The chromosomal location and expression pattern of PRSSLY has evolved over time. The most parsimonious explanation for its evolutionary trajectory is supported by synteny analysis (
Discussion
[0301] Applicants characterized a novel testis-specific Y-linked genePRSSLYthat is widespread in eutherian mammals and has ancient origins, dating back at least 350 million years. Applicants found that PRSSLY knockout mice are fully fertile and appear to have normal spermatogenesis, yet produce more female offspring than expected, indicating that this gene is involved in meiotic drive. In mice, another sex-linked meiotic drive system exists: Sly-Slx/Slx1. Unlike PRSSLY, Sly-Slx/Slx1 are not conserved outside of the Mus lineage. Sly-Slx/Slx1 are also highly amplified on the sex chromosomes, with 120 copies of Sly on the mouse Y long arm and 40 copies of Slx/Slx1 on the mouse X chromosome. Mice with a deletion encompassing two-thirds of the Y long-arm produce excess females (38% male) (18). ShRNA-knockdowns of Slx/Slx1 in males results in offspring sex ratio skewing towards males (60% males) (19). A separate study showed that targeted deletion and duplication of the Slx/Slx1 gene family skewed sex ratios towards males and females, respectively (20). Another contrast with PRSSLY is that Sly and Slx/Slx1 deficiencies result in sperm head/spermatid elongation defects and sperm release defects, respectively (18, 21). Double knock-down of Sly and Slx/Slx1 rescues both the sperm defects and sex ratio (19).
[0302] Although Applicants have not identified an X-linked meiotic drive partner, Applicants surmise that PRSSLY may have arisen to suppress such a driver. X-linked drivers are much more common in nature than Y-linked drivers (2). Theory predicts that X drive and Y drive would initially have opposite effects on population size, increasing with X drive and decreasing with Y drive. Because the limiting factor for population growth is production of the egg, increasing the proportion of males via Y drive would quickly drive a population towards extinction (1). When an X-linked driver emerges, selection will strongly favor the evolution of a Y-linked or autosomal suppressor to restore a balanced sex ratio (3), and most characterized X drivers exist in equilibrium with a suppressor (2). Y-linked suppressors are more accurately described as resistant Y chromosomes, since X drive is thought to occur by impairing Y-bearing sperm (1). If a driver is lost through mutation, then selection to maintain the suppressor is eased, thus creating a cyclical arms race (22). PRSSLY's independent loss in multiple lineages is consistent with the instability of meiotic drive genes. Perhaps the unknown X-linked driver that PRSSLY confers resistance to was lost in primates, felines, etc., leading to loss of PRSSLY in those lineages.
[0303] Although Applicants do not yet know the mechanism by which PRSSLY balances the sex ratio, perhaps by promoting the survival of Y-bearing sperm, PRSSLY likely operates directly in the male germline at or after the onset of meiosis based on its expression pattern. The function of PRSSLY's closest relativePRSS55may also provide some clues. PRSS55 is essential for male mouse fertility, playing a role in sperm migration and sperm-egg binding (23) as well as structural differentiation and energy metabolism (24). Although PRSSLY is not required for fertility, it may act in a similar post-meiotic fashion to ensure the propagation of Y-bearing sperm. Indeed, the post-meiotic mechanisms of many X drivers are well characterized (25, 26), while the functions of suppressors of drive remain enigmatic.
[0304] This study uncovers the first putative meiotic drive system beyond rodents, insects, and plants. Unlike all other meiotic drive factors, PRSSLY is not lineage-specific, but has been conserved across tens of millions of years of evolution. Future investigations regarding PRSSLY's partner in meiotic drive and its precise function in spermatogenesis will help explain its unusual longevity. The identification of PRSSLY has practical applications as well, opening the door to the possibility of manipulating sex ratios in livestock, which would be of great interest, both biologically and commercially.
Materials and Methods
Identification of PRSSLY Homologs
[0305] Applicants performed tblastn searches of NCBI's non-redundant nucleotide database using PRSSLY sequences from bull and mouse as query sequences. Once more divergent PRSSLY sequences were identified (i.e., wallaby, lizard, and caecilian), Applicants repeated the tblastn searches with the newly identified sequences as queries. To search for PRSSLY in species without available male genomic sequence, Applicants scanned NCBI's Sequence Read Archive database for available testis RNA-seq datasets and performed mapping analyses using PRSSLY sequence from the closest relative species (See Table 3).
Alignment, Phylogenetic, and Dot Plot Analyses
[0306] Nucleotide sequence alignment of conserved regions of PRSSLY homologs was performed using PRANK with default parameters (27). Phylogenetic tree using nucleotide alignment was generated using PhyML with default parameters (28). Dotplots were generated in Mac Vector using default parameters. Amino acid sequence alignment was performed using Muscle with default parameters (29).
RNA-Seq Analysis
[0307] For each species, RNA-seq datasets were downloaded from NCBI's Sequence Read Archive database, and transcriptomes were downloaded from Ensembl. For bulk analyses, RNA-seq reads were mapped to their respective transcriptomes using Salmon with the mapping validation option enabled (30). For single-cell analysis, reads were mapped using Bowtie version 1.2.2 (31), and cell types were assigned as previously published (16).
Generation of CRISPR Mutations
[0308] The Prssly knockout mice were generated via a CRISPR/Cas9-mediated strategy on the C57BL/6J background. Applicants designed two gRNAs, one targeting the end of exon 6 and the other targeting the start of exon 8, with the goal of producing a cut at both sites, and ideally, a deletion of the genomic DNA between these two sites. Experimental and control animals were backcrossed to C57BL/6J for an additional two generations or more. Deletions and insertions in founders and offspring were confirmed by PCR amplification and Sanger sequencing. Male offspring with edits to Prssly were subsequently backcrossed to C57BL/6J for two or more additional generations. The integrity of the long arm was confirmed by 18 PCR assays spanning the mouse Y. All experiments conformed to principles and guidelines approved by the Committee on Animal Care at the Massachusetts Institute of Technology.
Sequences
[0309] Accession numbers for confirmed cDNA sequences: [0310] Bull KC120771 [0311] Mouse KJ780361
[0312] Accession numbers for predicted genes: [0313] Camel XM_006195429 [0314] Antelope XM_005964542 [0315] Flying fox XM_025044285 [0316] Polar bear XM_008710443 [0317] Minke whale XM_007188461 [0318] Tree shrew XM_006162722 (verified with RNAseq data; GenBank accession: SRX157965) [0319] >Cattle (assembled from Y chromosome genomic sequence: accession number AC152072) SEQ ID NO: 11
TABLE-US-00006 AGAGACTGCCCCTTTCACAGTCCCAACATGGACTCTGGCTAAAAG ACCAGCTGTAAAATCCTGGAGAGAGAATGTGCCTTTCACAACTCCACCATGGACA TTGGCTGAAGGTCCACCTGTAAATACCTGGAGAGAAACTCTGCCTTTCATAGGCC CACCTTGGACTCATGCTGAAAGTACAGCTATAAATAGTTGGAGAGGGACTGTGCC ATTTGCAACTGCACTATGGGCTCTAGATAAAGGTCCAGCTGTAAATACCTGGAGA GAGATGATGACTTTCACAGCCCCACCATGGACACAGGCTGAAGGTCCAGCTGTA AATACATGGAGAGAGACTATTCCTTTTACAGTCCCACCATGGACTCAGGATGAAA GTCCAGGTGTAATTACCTGGGGAGCAACTGTCCCTTTCAGAGTCCCATCAAGGAC ACAGATTGAAAGTCCAGATATAAACACCTGGAGAGAGACTGCACCTTTCACAGC CCCAGCATGGGCACAGGCTGAACCTCCAGCTGTAAATTCCTGGAGAGAGATTATG CCTTTTTCAGTCCCACCATGGACACAGGATGAAAATCCAGGTGTAATTACCTGGG GAGAGACTGTCACTTTCAGAGCCCCACCAAGGACACAGATTGAAAGTCCAGATG TAAACACCTGGAGAGAGACTGTGCCTTTCACAGCACTACCATGGACACAGGCTG AAGGTCCAGATGTAAATACCCAAAGAGATACTGTGCCTTTCACAGGTCTACCTTG GACTCAGGCTGAAAGTACAGCTGTGCATACTGGGAGAGATATTGTACCTTTCACA GCTCCACCATGGACTCAAGATAAAGGCCCAGCTTTAAATACCCGGACAGAGACT GTACCTTTAACAGGCTCACCTTGGACTCAGGCTGAAAATCCAACTGTAAATACCT GGAGAGATAAGATGCCTTTAACAGCCCCACCCTGGTCACAGGTTGAACGTCCAGC TGTAAATACATGGAGAGAGACTGTGCCTTTCACAGCACCACCATGGACTCAGGCT GAACGTCCTGCTATAAATAGCTGGAGAGAGACTATGCCTTTCTCAGCTCTACCAT GGACTCAGGCTGAAAGTCCAGCTGTAAACACCTGGAGAGACACTATGCCTTTCAC AGACCCATCATGGACTCAAGATAAAAGTCCAGCTGTAAATAGCTGGAGACAGAT TTTGACTTTCCCAGCCCAACCTTGGCCACAGGCTGAAAGTATAGCTGCAAATGAC TGGACACGGAACGCCCCTTTTACAGCTCCACTGTGGTCACACACTGAAAGTCCAG CTGTAAATACCTGGACAGAGGCTATGCTTTTCACAGGCCCTCCATGGACTCAGGC TGAAAATCCAGCTACACATACCTGGAAAGTGAACGTGCATTACAGAGGCCCACC ATGGACTCAGTCTGACTCTGCACAAGCAAACCCTTGGACATCAACTGAAAGTTTT AGAATCAGATCATGGACTCATGGAGTAAAGCAAGTTTTGAATATTTGGACAGAG CCAATAGCTTCCACAGTTACACTTCGGACTCAGGCTGAATATTCAACACTAAAAT ATTGGGCAGAGACTAAAGTCATTTACATAGTCACACCATTGACCCAGTGTCAGTT TCCAATAAATACTTTGACAGAATCTGTAGGATCCATAATCACACCTTGGACATCT GCTGAATCTCTAGTATTAAGTTCTTTCACACAGAATATTATTGATATAATCAAATT TTGGCCAGTGCTTAAAACTGAGTCTAAGAAAAGGTGGAATCTGCCTCAAACTGAT ACACTCATATTTTCACTAAATCCTCAAACTGATACTTTTGGATCCTTGAACCAAAT TGAAAATCAAGAATCTCCTCTGTGGACACATCCTGAAATTGATAATGTCAATACA ATGAACTTTCTTGAATCTGGAACACTCATATCACAGGTAGTATCTCTGCCCCAAG CAGCTAGACTCTGGCCCCAAACTGAAGCTGATATTAGCAAAACTTGGTTTGTATC CTCTGAAAGAATAAATTCTTGGGACCAATCAGAGTCTCAAAGAATGAGTACCTCA ACCCATTTTGGAGTGGGTAGAGTAAAGCCCTTGGCCCAACATGAAACTGCTATAG TCATGTCATGGCTTCAGATTGAAACTGGTATATTCTACCCTTGGAACCAGTCTGA GGGAGACACAGTGAGGTTCTGGCCCCTTTCTGAAACTGAGGATGTAAGAGAATG GATCCAAACTGGAGCCAGTAGAGTTAACTCTTGGACTCAACCGAGAACTAGTATA GTCAGAGCTTGGCCCCAAGCTGAATCTGAACTAGTCAGACCCTGGACACAAACTA AAACTAATGCAATCACACTATTGACCCAGGCTGATACTATCAAACCTTGGTTCCA AACTCAAATTAATGCAATAAGAGAAGGAGCCCAAACTCAATCTCAAATTGTTACT AGTATCCAAACACAGTTGCAAATAGTTAACCCCTGGATTCAGCCTAAAAGTGATT CAATCAGATTTTGGACCCAGCCTTGGATCCAAGCTGAAACCCACACAGTCAGACT CTTTTATGAAATTGATATAAGAAAATCATGGGCCTCATTTGGATCTCAGTCAGTC ACATTTTGGTCACTGAGTCAAAATTCAGTTAGGACCTCATTTCACTTTGAATCTCA GATGACATGTTCCTGGATCGGAAATGAATTTGATATAATCAGTCTTTGGAATCAA TATGAAACTAGTTCAGTTGGATCCTGCATCAAGTCTGAAACTGGTACATGTCAAC CCTGGGTCCATATTGAATCTTCTACAATCACACCATGGACCCAATATGAAACTTT AGAGATCTACCCTTCAACCCAGCCTGAGACTGATACAGCATTAAGGCATTGGTTC CAGCCCCAAATTGATCCAATTAATACTTGGAATCAGCCCGAAGTAGATACAATCA GATTCTGGACCCAAGTTGAAACAGAAACAATTTCAGTTTGGACCCAGATTGGAAG TCAAGTAGTTAAACTTTCCAACTTTTCTGAAGTTGGCATAGTTACACCTTGGCTAG AGACTGAAACTGATACAAGTAGACCCTGGATTCAGTCTGACTTTCAGTCAGTCCA TCCTTGGACCCAGACTGGATTTGGTATAATTAACCCCTGGTATCAGCCAAGAGCT GCTGTAAATCAACCCTGGACATTTGTTCAAACACAGTCAATCGGACCCTGGACTA AGGTGGAAGCCAATACAATCAAATCTTGGTTTCATGTTCAAATGAAAAAAGTCAG ACTGGGGATTCCTGCTGAGTCTCAAATATTGAGTTTCTGGATGCAGTCTGATGTTA GTAGAGTTAATGCTTGGATCCAACCAGAAACCCAGGCAGTCAATCCTGGGGCTCA TCCTAAATCTGGTAATGTTGCATCCCTGGCTATTCCTAAGCCTGAAAGAGTCAGA ATGTGGATCCAGCCTGAAACAGAAATAAGGCCTGGCATCATTTATAAAACTGATA TAACCACATCATTTGCTTCTCCTGAAATTGAACCAGATGGAACAATTAGTCATTTT GATTTCTTGTCTAATCGTGTAACATTTTTAACAATAGAAACTGTTCCTTCCCTAGA TGAGCATTTTGCAGCTTTGTCAACTGAAATAGCTGCAGTAGAAAGCCAAGGTCAA ATAAATTCTGTCCAACCCAGTGAGATCACAAATACTCTCTTTCTTACACTTTCAAG CACATGGCTTCCTGGAGGAGCTGGTTACCTGAACTTTGCCAATAAATTGCAAATT ACCAAAACAAAAGGAAGCCCTAATGTCCCATCTAGTTCTCTCAACCCACTTTTTC CATCTTTTTCCTTTCCTGTTCCTTGTTTTATCCCATTTTCATGTTCTTTGTCCCTTAC TTGTTCAGTCTTTTCTTCTTGCACACTTTCTTCACCATGTACTTTTCCTTCTTGCTCA GTTCTTCCTCTTGTGGCTTTCTCTCCTGTTCTTCCCTTAGCTGCTTCTGATAGTTCT CTCCAGAAACCATCTTCCTCAGAAGTTACTGAAGACACCATTCTTTCCCATACTTT TTCATCCTTGCATGCTGCTCCAGCCACTCTTTTAACAAAGCAACCATCTCTGATGC CTGGATTTCAATCTGAAACCAAGTCTAATCGGCCTGAACAAGATCTTCCTAAGTA TTCTGAACTCAATGTTTCCCTTGCTGAGTGTCGCCTGGATGTGGTCTGGAAAGAG AGTCTCCAGGCTTTCTCGCTCTTCAAGACAGCTGTTATTTCTCATGAAATCACAGA GTGTGGATTACGCCCTGGCCTTGTTCCACACTGCCCCAACTGCTGGGAGGCTGAA GTGGGTGAATTCCCTTGGATGGTTTCTGTGCAACTCTCTTTCTCCCATTTCTGTGCT GGTTCTATACTGAATGAACAGTGGATTCTCACTACAGCTAGATGTGCAAATTTCA TAAAAAACTCAGAAGCATTGGCCCATGTCCAGGTGGGGCTGATTGATCTTCAAGA CCCTGCTCAAGCTCAAACTGTAGGCATTCATCGTGCCATGCCCTACCTGGGCCCT AGAGGACCTTTGGGACCTGGTCTAATCTTCTTGAAGCAACCATTACATTTTCAAC CCCTGGTTCTTCCTATCTGCCTGGAGGAGAACCTAGAGCAAGAGAAAAATATACA ACTATATGACTGCTGGCTACCTAGTTGGTCCCTCATGAGAGGAAGTCCTGGAATT TTGCAAAAAAGGCATCTGAGCATCCTGCAAGTCATCACATGTGCCCAGTTTTGGC CCAGCCTGAATGAATTTACTTTCTGTGTGGCAGCCAAGAAAGCTATGGGGGAGGC TGGCTGTAAGGGTGACCTGGGGGCACCTCTTATATGTCATCTGCAACAAAAAGAC ACATGGGTGCAGGTGGGAATCTTGACTCACTTTGATGAACACTGCAGAAAGCCCT ATGTCTTCAGCCAAGTGAGCCCTTTCCTTTTCTGGCTCCAGGGAGTTACACGACCC AGCCAAGCACCCTGGTCCAAGCAAGGGCCCATGACCACCTCTGCTTCCATCTCCC TTTCAGTCTCCACCTCTATGAATGCCTCAGCTTTTACCTCCACACCTGCTTCTGTCC GGCCACATTTCATCTCTCTGCCACAGCCTCAGACTTTGGCAGATCGAATTTCTCTG AGATATGCCATGCCTTGGCAGGCCATGATCATCAGTTGTGGCAGTCAAATTTGCA GTGGTTCCATTGTTAGCAGCTCTTGGGTACTCACCGCGGCTCACTGTGTCAGGAA TATGAATCCTGAAGACACAGCTGTAATATTGGGCCTGAGGCACCCTGGGGCACCT CTGAGAGTTGTTAAGATCTCTACCATTCTTCTGCATGAAAGATTTCGATTGGTGAG TAGGGCAGCAAGAAACGATCTAGCATTGCTGCTCCTTCAAGAGGTCCAGACTCCC ATTCAGCTTTTAGCACCGTTGGGTCATCTGAAGAACCTGAACAGCTCAGAATGCT GGCTGTCTGGGCCAAGAATTCTTAAGCCAGGAGAGACAGATGAAAATCCAGAAA TATTACAGATGCAGGTGATAGGAGCTTCAAGCTGTGCCCACCTATACCCTGATAT AGGTAGTTCCATTGTCTGCTTCATTACACAAGACAAAGATTCTGACACAAGTGTG GAACCAGTGAGTCCAGGCAGTGCTGTCATGTGCAGACCAATCTCTAGGAATGGA AGCTGGAGACAGATAGGCCTCACTAGTCTGAAGGCACTGGCTACCATTGTGAGCC CCCACTTCTCATGGATATTATCCACTTCATCAAAAGCAGGGCATCCATTAAGCCA TGAACTAATGCCTTGGATGGAAAAGCCTAAGTCCTCTAGTCTCATAAAACAGCCA GCCACCCTGCCATTTTATTCAATAATAATTGTTATACTACAAAAGCTTTCATAACT CACTGTGAAAATAAGGCAGGGCTAATCTATTCAAACTATTTATAATAAAAATTTT AAACAACATTAAAGAAAATTAAGACCCTATGCAACCTAGGAG [0320] >Pig (assembled from Y chromosome sequence and testis RNA-seq: accession numbers MK393871. SRX229765-9) (SEQ ID NO: 12)
TABLE-US-00007 ctcagagaaaaatcttggctgcagtctgattttgaaaaattctcaccttCAACCCAGGTTCAATTT GTATTGGTAAAACCCTGGACACAGTCTGAAAATGATACACTCATGCCATGGACCC AGGTTCAACCTTCTGCAGTAAATGTCTGGACAAAGGCTACAGCTTTCACAGTCAT ACCATGGACTCAAGATGAATTTTTTGCAGAAAAGTCCTGGACAGAGACTGTGGTT TCCATAGTCACACTGTGGATTAAGGCTACATCTCCAGAAGTAAATACCTGGACAG AGGTTTCTCTTTCCACAGTCACACCAGGGTCTCAAACTGGATCTCCAGAGGTAAA ACCCTGGGCAGAGGCTCTAACTTCCACAGTTATACCCACACTACTGCCTCAGGAT GAAATTTCTGCAACAAAATCCTGGACAAAGAATGTGGGTGCCAGAGTCACACTA TGGACTCAGCCTGAATCTCCATCTGTCCATCCCTGGGCACAGACTGTAGCTTCCA CAGTCACACTCACACCATGGACTCAGGATGAATTTTCTGTAACAAAATTCTGGAC AGAGACTTTTTTTTCCACAGTTCCACAGTGGACTCAGGCTCAATCTCCCTTAAATC CTTTGACAGAGACTATAGATGCCATAGTCACACCATGGATTCAGGCTGAATCTCC AGGAGTAAATCATTTGACAGAGGCTGTTTCTTCCATAGTCACACCTACACCATGG ACTCAGGCTAAAGATTCAGCAATAAAACCCTGGACACAGACTGTCACACCATGG ATTCACACTCAATCTCCAGAAGTAAATCCCTGGACACAGACTGCAGCTTCCACAG CTGCATTGTGGACTCATATTGAATCTCTAGCATTAAGTTATTCCGCACAGAGTATT ACTGATACAGTTATATTTTGGACCATGCTTCAAACTGAATCTAAGAAACCCTGGA GTCTTTCCAAACCTAGTTTATTCACTATTTCACTGAATACTCAAAGTGATCTTACT GGATCACTGATTCATAATGAAAATCAAGCATATCTTCTGTTGACACATTCTGAAA TTTATAATGTCAAGACACTGAACTTGCCTAAATCTGAAACACTCATATCATGGAC AGTGCCCTTTCCTCAAGCAGTCAGTCTCTGGCCCCAATCTGAAGTTGATATTACCA GAACTTGGTTTAAAATACCAGAAAGAAAAACATCCTGGGCCCAGTCAGAATCTCT GACAATGAGTACCATGACACAGATAGGAGATGCTGGAATGAGGATGATAGCACA GCATGAACCTGCTGAAGTCACATCATGGATTCAGACTGAAAGTGGTATATTCCAC CCTTGGGAGAAGTCTGAAGGAGATATAGTGAGATTCTGGACCCCTTCTGAAACTA AGCCTGTAAAACCATGGATGCAAACTGGAACTGCTTTAGTCACTCCACTGACCCA GCCTGAAATGCAAGCATTAAAATACATGAGCATGCCTGACATTAATTCTATCAGA CCTTGGTTCAAGACTCAAACTGAGCCTATAAGAGAAGGCACTCAACCTGAATCTC AAATAGTTTCTACTAGGATCCAACCAGAACCACAAATCATCCATCCATGGTTCCA GCCTGAAAGTAATGCAGTCAGATTCTGGACTCAGCCTAAAGGTAATTTAGCCCAA TCCTGGTTTCAAGCTAAAGCCAATATAGTAAGATTCCAGACTCAGTATGAAATTG ATACAGGAAAACCATGGACCCAGCCTGAATCTCAGTCAGTCACATTTTTGTCCTT AACGCAAAATGATGCAATTAGTCCCACATCCCACTTTGAATCTCAGAAGACGTGT TCCTGGACCCAAAATGAATTTGGTATAATCAGTCTTTGGACTCAGTCTGAAACTA GTTCAGTCATATTTGGAACCAAGCTTGAAACTATTACAGGCCAACCCTGGCTTCA TCTTGAATCTGCTACATGCAGACCATGGACCCTGCATGAAACCTTAACCCAGCCT GAAGCTGCTACAGTAAGACACTGGCTCCATACCCAAATGGACTTAAAAGAACCTT GGAATCAGCCTGAAGATGATGCAGTTATACACTGGACCCAGCTTGAAACAGAAA CAATTTATGTTTGGACCCAGACTGAAAGAGAAGTAGTAAAACCTCCAACTTTATC TGAAGTCAATTTAGTCACATCTTGGTTACAGACTCAAAGTGATATAATTAGACCT TGGATTAAACCTGAGTTTCAGTCAGTCATTCCTTCGATCCACACTGGAGTTGATAT ACTTCACTTCTGGTCTCAGCAAAGAGCTGCTACAAATCAACCCAGAACATACCCC AAAACCCAGGTAGTCAGACCATGGATCAAGCTGGAGGCTGATACAATCAAATCT TGGTTCCACATTCAAAGGAATAAAGTCAGACCATGGATGCCTACAAAATCTCAAA TATTGAGCCTCTGGAGGCAGCATGAAGTTGATATAGTCCATCCATGGATCCAGCC AGAAACCCTGGCAGACAGACCCTGGTCCCACTCTGAAACTGAGATTGCATTCTTG GAAAGTTATAAACCTGACCAAGTTAGAACATGGATCCAGCCTGAAATAGAAATA AGGCCTGGCATCCATTATAAAGCTGATAAAATGACATCATTTACTTCTCCTGAAG TAGAGCAAAATGAAACAACCCAATTAACCAGTCACTTTGGCTCTTGGTATAAACA TAAACCTTTTATACCAACAGAAAGTATTCCTTCCCCGGATGAGTATTTTACAGCTT TGTCAACTGAGATAACTACACAAGAAATCCAAGATCAAATCAATTCTGTCCAACC CACTGAGCTCACAGATATTCTCTTTTTCACCCTTTCAAGCATGTGGTTTCCTGAAG GAGTTGGTTATCTAAAATTTGGCAGTAAATTACAAATTACCAAAACAAAAGGAA GCCCTGAGTTCCCATCTACTTCTCAGAGCCCCCTTTCTCCATCCCTTTCCTTTCCTG TTCCATGTTTTTCACCATCCCTGTGTTCCTTGTCCCTTTCCTGTTCGGTGTTTTCTTC TTGCGCATTCCCTAGACCCTGTATTTTCCCTTCTTGCTCAAGTCTTTCCTCTGTGGT ATTCTCTCCTATTCTCCTTCCCTTAGCTGCTTCTGATAGTTTTCTCCAGAAACTATA TTACTCAAAAGTTACTGAAGAAACCATTCTTTCTCATACTTCTCCATCCCTGAATA TTGCTTCAGCCATACTTTTAACAAAGCAGCCTTCCCTGATGTCTGGATCTCAATCT GGAACCAAGTCTAATCAACCTGAACAAGATCCTCTCAAGTATTCTGAACTCAATA TTTCCTTGGCTGAATGTCACCTGGGTGTGGTCTGGAAAGAGAATCTCCAAGCTTT CTGGCTATTCAAAACAGCTGTTATTTCCCATGAAACCACAGAGTGTGGATTACGC CCTGGCCTCGTCCCACATTGTCCCAACTGCTGGGAAGCAGAAGTGGGTGAATTCC CTTGGATGGTTTCTGTGCAACTGTCTTTCTCTCATTTCTGTGCTGGCTCCATACTGA ATGAACAGTGGATCCTTACTACCGCTAGATGCGCAAATTTCATAAAAAACTCAGA AGCACTGGCCCTTGTCCAGGTGGGGCTTATTGATCTTCAAGACACTGCCCAAGCT CAAACAGTAGGCATTCATCGTGCCATGCCCTACCTAGGTCCTAAGGGCCCTTTGG GACCTGGGCTGATCTTCCTTAAGCAGCCATTACATTTTCAACCTCTGGTGCTTCCT ATCTGCCTGGAAGAGAGTCTGGAGCAAGAGAAAAACATACAACTGTATGACTGC TGGCTACCTAGTTGGTCTCTCATGAGAGGAAGTCCTGGAATTCTGCAAAAAAGAC ACCTAAGCATCCTGCAAGTCAGCACGTGTGCTCAATTTTGGCCCAATTTGAGTGA ATTTACTTTCTGTGTAGAAGCCAAGAAAGCTATGGGGGAAGCTGGCTGTAAGGGT GACCTGGGGGCACCTTTGGTGTGCCATCTACAACAAAAGGACACATGGGTGCAG GTGGGAATATTGAGTCATTTTGATGAACATTGCACAAAGCCCTACGTCTTCAGCC AAGTGAGCCCTTTCCTTTTCTGGCTCCAGGGAGTTACACGACCAAGCCATGCTCC CTGGTCCAAGCAAGGGCCCATGACTACTTCTGCTTCCATCTCACTTTCAGTATCTA CCTCTACGAATGCTTCAGCTTTTACCTCCACTCCTGCTTCTGTCCAGCCTCACTTC ATCTCACTGCCACAGCCTCAGACTCTGGCAGATCGGGTTTCTCTAAGATATGCCA TGCCTTGGCAGGCCATGATTATCAGCTGTGGCAGTCAAATTTGCAGTGGTTCCAT TGTTAGCAGCTCCTGGGTACTCACTGCTGCTCACTGTGTCAGGAACATGAATCCT GAAGACACTGCTGTAATACTGGGCCTGAGACACCCAGGGGCACCTCTGAGAGTT GTCAAGGTATCCACCATTTTACTGCATGAGAGATTCCGGTTGGTAAGTGGAGCAG CAAGAAATGACCTAGCATTGCTGCTGCTTCAAGAGGTACAGACTCCCATTCAGCT TTTAGCACCCTTAGGCCATCTAAAGAACTTGAATAGCTCAGAATGCTGGCTCTCA GGACCACGGATTCTAAAGCCAGGAGAGACAGATGAAAATCCAGAAATACTGCAG ATGCAGGTGATAGGAGCTTCAAGCTGTGCCCACCTCTATCCAGACATAGGCAGTT CTATTGTGTGCTTCATTACACAGGACAAAGACTCCAATACAAATGTGGAACCGGT GAGCCCAGGCAGTGCTGTTATGTGCCGACCAATGTCTGGGAATGGAAGCTGGAG ACAGATAGGGCTCACCAGTCTGAAAGCTCTAGCTACCATTGTGAGACCCCACTTC TCCTGGATATTATCCACTTCTGCAAAAGCAGGGCATCCCCTAAACCAAGCACTCA TGCCTTGGGTAGAAAAGGCCAAATCCTCTAGTCTCTTAAAAAAGCCAACCATATT ACCATCAGTAATAATTATTGCAATACAAAGCCTTTTGTAAGTTAATAGCTATAGA GGGAGGAGATAATCTGTTCACACTGTACTGGAAAGTATATTAACAATGTCATAAC AAGACTGATACATTTAGATAGAACTCAGTAATTCTGAAATAAAGAAATACTCTAT CTAAATGACTAATTTCTTTTAAAACACTTAAAAAACAAATTAT [0321] >Sheep (assembled from testis RNA-seq: accession numbers SRX3274362. SRX3279754. SRX3279767) (SEQ ID NO: 13)
TABLE-US-00008 CTCAGGATGACAGTCCAGGTGTAATTACCTGGGGAGAGACTGTTC CTTTCAGAACCACATCAAGGACACCGATTGAAAGTCCAGATATAAACACCTGGA GAGAGACTGTGCCTTTCACAGCCTCACAATGGACTCAGGCTGAACCTCCAGCTAT AAATTCTTGGAGAGAGATGATACCTTTTTCCATCCCACCATGGACACAGGATGGA AGTCCAGGTGTAATTACCTGGGGAGAGACTGTCCCTTTCAGAGCCCCACCAAGGA CGCAAATTGAAAGTCCAGATGTAAACACCTGGAGAGAGATTGTGCCTTTCACAGC ACTACCATGGACACAGGCTGAAGGTCCAGATGTAAATACCCAGAGAGATACTGT GCCTTTTACAGGTCGGACTCAGGCTGAAAGTACAGCTGTGCATACTGGGAGAGAT ACTGTGCCTTTCACAGCTCCACCATGGACTCAAGATAAAGGCCCAGATGTAAATA ACAGCAGTGAGGTGCTGAGTTTCACAGGACCATCATTGGCACATGCTAAAGGTCC AGCTTTAAATAACTGGAGGGAGACTGTACCTATAATAGGCTCATCCTGGACTCAG GCTGAAAATCCAACTGTAAATGCCTGGAGAGAGAATATGCCTTTAACAGCCCCAC CCTGGTCACAGGTTGAACATCCAGCTATAAATACATGGAGAGAAACTGTGCCTTT CACAGAGCCACCATGGACTCAGGCTGAATATCCTGCTGTAAACACCTGGAGAGA AACTGTGCCTTTCTCAGCTCTACCATGGACTCAGGCTGAAAGTCCAGCTGTAAAC ACCTGGAGAGAGGCTATGCCTTTCACAGACCCATCATGGATTCAAGAGAAAAGT CTAACTGTAAATAGCTGGAGACAGATTTTTACTTTCCCAGCCCAACCATGGCCAC AGACTGAAAGTACAGTGGAAAACGACTGGATATGGAATGCCCCTTTTACAGCTCC ACCATGGTCACACACTGAAAGTTCAGCTGTAAATACCTGGACTGAGCCTATGCTT TTTATAGCCCCTCCATGGACTGAGGCTGAAAATCCAGCTACAAATACCTGGAAAG TGAATATGCATTACAGAGACACACTATGGCCTCAGTCTGACTTTGCACCAGCAAA CCCTTGGACATCAACTGAAAGTTTCAGAATCACCTCATGGACTCATACTGTAAAG CAAGTTTTAAATATTTGGACAGAGCCAATAGCTTCCACAGCCACACTGTGGACTC AGGCTGAATATTCAACACCAACATATTGGACAGAGATTAAGGCCATTTATATAGT CACACCATTGACCCAGTATCAGTTTTCAATAAATACTTTGACAAAATCTGTAGGA GCCATAATCACACTTTGGACGTCTGCTGAATCTCTGTCATTAAGTTCTTTCACACA GAATAGTATCGATACAATCGAATTTTGGCCAATGCTTAAAACTGAGTCTAAGAAA AGGTGGAATCTGCCTCAAACTAGTACATTCATGTTTTCACTAAATCCTCAAATTG ATACTTTTGGATCCTTGAACCAAATTGAAAATCAAGAATCTCCTCGGTGGGCCCA TCCTGAGATTGATAATGCCAATACAATGGCCTTTCTTGAATTTGGAACACTCATAT CACAGGTAGTACCTTTGCCCCAAGCAGCTAGACTCTGGCCCCAAACTGAAGCTGC TAATAGCAAAATTTGGTTTGTATCCTCTGAAAGAATAAATTCCTGGGACCAATCA GAGTCTCAAAGAATGAGTACCTCAATCCATTTTGGAGTGGGTAGAGTGAAGCCCC TGGCCCAACATGAAACTGCTATAGTCATGTCATGGCTTCAGATTGAAACTGGTAT ATTCCACCCTTGGAACAAGTCTGAAGGAGGCACAGGGAGGTTCTGGCCCCTTTCT GAAACTGAGGATATAAGAGAATGGATCCAAACTGGAGCCAGTACAGTTAACTCT TGGACTCAACTGAGAACTAATATAGTCAGAGCTTGTCCCCAAGCTGAATCTGAAT TAGTCAGACCCTGGACACAAGCTAAAACTAATGCAATCACACTATTGACCCAGAC TGATGCTATCAAACCTTGGTTCCAAACTAAAATTAATTCACTAAGAGAAGGGACC CAAACTCAATCTCAAATTGTTACTACTTGGATCCAAACACAGTTGCAAATATTTC ACCCCTGGATTCAGCCTAAAAGTGATTCAGTCAGATTTTGGACCCAGCCTTGGAT CCAAGCTGAAACCCACACAGTCAGACTCTATTATGAAATTGATGTAAGAAAATCA TGGGCTTCATCTGAATCTCAGTCAGTCACATTTTGGTCACTGAGTCAAAATTCAGT TAGGACCTCATTTCACTTTGAATCTCAGATGACATGTTCCTGGGTCCGAAATGAA TTTGATATAATCAGTCCTTGGAATCAATATGAAACTAGTTCTGTTGGATCCTGGAT CCAGTCTGAAACTGGTACATGTCAACCCTGGTTCCATATTGAATCTTCTACAATCA CACCATGGACCCAATATGAAACTTTAGAGATCTCCCCTTCAACCCATCCTGAGAC TGATACAGCAATAAGGCATTTGTTCCAGCCCCAAATTGATCCAATTAGTACTTGG AATCAGCCTGAGGTAGATACAATCAGATTCTGGACCCAAGTTGAAACAGAAACA ATTCCAATTTGGATCCAGATTGGAAGTCAAGTAGTTAAACCTCCCAACTTTTCTG AAGTTGGTATAGTTACACCTTGGCTAAAGACTGAAACTGATGCAATTATTCCCTG GATTCAGTCTGACTTTCAGTCAATCCATCCTTCGACCCAGACTGGATTTGGTATAA TTGACCCCTGGTTTCAGCCAAGAGCTTCTGTAAATCAACCCTGGACCTTTGTTCAA ACACAGTCAATCAGACCTTGGATTAAAGTGGAATCCAATACAATCAAATCTTGGT TTCATGTTCCAATGAAAAAAGTCAGACTGGGGATTCCTTCTGAGTCTCAAATATT GAGTTTCTGGTTGCAGTCTGATGTTAGTAGAGTTAATGCTTGGATCCAACCAGAA ACCCAGGCAGTCAATCCTGGGGCTCATCCTAAAACTGGTAATGTTGCATCCCTGA CTATTCCTAAGCCTGAAAGAGTCAGAATGTGGATCCAGCCTGAAAGAGAAATGA GACCTGGCATCATTTATAAAACTAATATAACCACATCATTTGCTTCTGAAATTGA ACCAGATGGAACAATTAGTCATTTTGATTCCTGGGCTAACCATGTAACATTTTTAC CAATAGAAACTGTTCCTTCCCTAGATGAGCATTTTGCAGCTTTGTCAACTGAAAT AGCTGCAGTAGAAAGCCAAGGTCAAATAAATCCTGTCCAACCCAGTGAAATCAC AAATATTATCTTTCTTACAGTTTCAAGCACACAGCTTCCTGGAGGAGCTGGTTACC TGAACTTTGGCAACAAATTACAAATTACCAATTCAAAAGGAAGTCCTAATGTCCC ATCTAGTTCTCTCAACCCACTTTTTCCATCTTTTTCCTTTATTGTTCCTTGTTTTTTC CCATTTTCATGTTCTTTGTCCCTTACTTGTTCAGTCTTTTCTTCTTGCACATTTTCTT CACCATGTACTTTTCCTTCTTGCTCAGTTCTTCCTATTGTGGGTCTCTCTCCTGTTC CTCCCTTAGCTGCTTCTGATAGTTCTCTCCAGAAACCATCTTCCTCGAAAGTTATT GAAGACACCATTCTTTCCCATACTTTTTCATCCTTTCATGCTGCTCCAGCCACTCTT TTAACAAAGCAACCATCTCTGATGCCTGGATTTCAATTGGAAACCAAGTCTAATC AGCCTGAACAAGATCTTCCTAAGTATTCTGAACTCAATATTTCCCTTGCTGAGTGT CGCCTGGGTGTGGTCTGGAAAGAAAGTCTCCAGGCTTTCTCGCTCTTCAAGACAG CTGTTATTTCTCATGAGATCACAGAGTGTGGATTACGCCCTGGCCTTGTTCCACAC TGTCCCAACTGCTGGGAGGCTGAAGTGGGTGAATTCCCTTGGATGGTTTCTGTGC AACTCTCTTTCTCCCATTTTTGTGCTGGTTCTATACTGAATGAACAATGGATTCTC ACTACAGCTAGGTGTGCAAATTTCATAAAAAACTCAGAAGCACTGGCCCATGTCC AGGTGGGGCTTATCGATCTTCAAGACCCTGCTCAAGCTCAAACTATAGGCATTCA TCGTGCCATGCCCTACCTGGGCCCTAGAGGACCTCTGGGGCCTGGTCTAATCTTCT TGAAGCAACCATTACATTTTCAACCCCTGGTTCTTCCTATCTGCCTGGAGGAGAG CCTAGAGCAAGAGAAAAATATACAACTGTATGACTGCTGGCTACCCAGTTGGTCC CTCATGAGAGGAAGTCCTGGAATTTTGCAAAAAAGGCACCTGAGCATCCTGCAA GCCATCACATGTGCCCAGTTTTGGCCCAAACTGAATGAATTTACTTTCTGTGTGGC AGCCAAGAAAGCTATGGGGGAGGCTGGCTGTAAGGGTGACCTGGGGGCACCTCT TGTGTGTCATCTGCAACAAAAAGACACATGGGTGCAGGTGGGAATTTTGACTCAC TTTGATGAACACTGCACAAAGCCCTACGTCTTCAGCCAAGTGAGCCCTTTCCTTTT CTGGCTCCAGGGAGTTACACGACCTAGCCAAGCACCCTGGTCCAAGCAAGGGCC CATGACCACCTCTGCTTCAGTCTCCCTTTCAGTCTCTACCTCTACGAATGCCTCAG CTTTTACTTCCACACCTGCTTCTGTCCGGCCACATTTCATCTCTCTGCCACAGCCTC AGACTTTGGCAGATCGAATTTCTCTGAGATATGCCATGCCTTGGCAGGCCATGAT CATCAGTTGTGGCAGTCAAATTTGTAGTGGTTCCATTGTTAGCAGCTCTTGGGTAC TCACTGCGGCCCACTGTGTCAGGAATATGAATCCTGAAGACACAGCTGTAATATT GGGTCTGAGGCACCCTGGGGCACCTCTGAGAGTTGTTAAGATCTCTACCATTCTT CTGCATGAGAGATTTCGATTGGTGAGTAGGGCAGCAAGAAACGATCTAGCATTG CTGCTCCTTCAAGAGGTCCAGACTCCCATTCAGATTTTAGCACCGCTAGGTCATCT GAAGAATCTGAACAGCTCAGAATGCTGGCTGTCTGGGCCACGAATTCTTAAGCCA GGAGAGACAGATGAAAATCCAGAAATATTACAGATGAAGGTGATAGGAGCTTCA AGCTGTGCCCACCTTTACCCTGATATAGGCAGTTCTATTGTGTGCTTCATTACACA AGACAAAGACGCTGACACAAATGTGGAACCAGTGAGTCCAGGCAGTGCTGTCAT GTGCAGACCAATGTCTAGGAATGGAAGCTGGAGACAGATAGGCCTCACTAGTCT GAAGGCACTGGCTACCATTGTGAGCCCCCACTTCTCATGGATATTATCCACTTCAT CAAAGGCAGGACATCCATTAAACCATGCACTCATGCCTTGGATGGAAAAGCCTA AGTCCTCTAGTCTTGTAAAACAGCCAACCACCCTGCCATTTTGTTCAACAATAATT GTTATACTACAAAGGCTTTCATAACTCATTGCAAAAATAAGGCAGGGCTAATCTA TTCAAACTATTCATAATAAAAATGTTAAACAATGTTAAAAAAAATTAAGACCCTA TGCAACCTAGGAATATATGTCATGAATAAAC [0322] >Goat (assembled from testis RNA-seq: accession numbers SRX1947628. SRX 1947629. SRX 1947630) (SEQ ID NO: 14)
TABLE-US-00009 CACAGATTGAAAGTCCAGATATAAACACCTGGAGAGAGACTGTGC CTTTCACAGCCTCACAATGGACAAAGGCTGAACCTCCAGCTATAAATTCCTGGAG AGAGAATATGCCTTTTTCAGTCCCACCATGGACACAGGATGGAAGTCCAGGTGTA ATTACCTGGGGAGAGACTGTCACTTTCAGAGACCCACAAAGGACACAAATTGAA AGTCCAGATATAAACACCTGGAGAGAGACTGTGCCTTTCATAGCACTACCATGGA CACAGGCTGAAGGTCCAGATGTAAATACCCAGAGAGATACTTTGCCTTTTACAGG TCTACGTTGGACTCAGGCTGAAAGTACAGCTGTGCATACTGGGAGAGATATTGTG CCTTTCACAGCCCCATCATGGACACAGGCTGAACCTCCAGCTGTAAATTCCTGGA GAGAGATTATGCCTTTTTCAGTCCCATCATGGACACAGGATGGAAATCCAGGTGT AATTACCTGGGGAGAAACTGTCCCTTTCAGAATCCCACCAAAGTCACAGATTGAA AGTCCAGATGTAAACACCTGGAGAGAGACTATGCCTTTCATAGCACTACCATGGA CACAGGCTGAAGGTCCAGATGTAAATACCCAGAGAGATACTGTGCCTTTTGCAGG TCTACACTGGACTCAGGCTGAAAGTACAGCTGTGCATACTGGGAGAGATATTGTG CCTTTCACAGCCCCATCATGGACTCAAGATAAAGGCCCAGATGTAAATAACTGGA GTGAGATGCTGAGTTTCACAGGACCATCATGGGTACATGCTAAAGGTCCAGCTTT AAATACCTGGACAGAGACTGTCTGGAGGGAGACTGTACCTTTAACAGTCTCACCT TGGACTCAGACTGAAAATCCAACTGTAAATACCTGGAGAGAGAATATGCTTTTAA CAGCCCTACCCTGGTCACAGGTTGAATATCCAGCTGTAAATACATGGAGAGAAAC CGTACATTTCACAGAGCCACCATGGAATCAGGCTGAATATCCTGCTGTAAACACC TGGAGAGAAACTGTGCCTTTCTCAGCTCTACAATGGACTCAGGCTGAAAGTCCAG CTGTAAACACCTGGAGAGAGGCTATGCCTTTCACAGACCCATCATGGATTCAAGA TAAAAGTCCAACTGTAAATAGCTGGAGACGGATTTTTACTTTCCCAGCCCAACCA TGGCCACAGACTGAAAGTACAGTGGAAAACGACTTGATATGGAATGCCCCTTTTA CAGCTCCACCGTGGTCACACACTGAAAGTCCAGCTGTAAATACCTGGACAGAGCC TATGCTTTTTATCGCCCCTCCATGGACTCAGGCTGAAAATCCATCTACAAATACCT GGAAAGTGAATATGCATTACAGAGACCCACTATGGCCTCAGTCTGACTTTGCACC AGCAAACCCTTGGACATCAACTGAAAGTTTTAGAATCACATCATGGACTCTTACA GGAAAGCAAGTTTTAAATATTTGGACAGAGCCAATAGCTTCCACAGCCACACTGT GGACTCAGGCTGAATATTCAACACCAAAATATTGGACAGAGACTAAGGCCATTT ATATAGTCACATCATTGACCCAGTGTCAGTTTCCAATAAATACTTTGACAGAATC TGTAGGAGCCATAATCACACTTTGTACATCTGCTGAATCTCTATCATTAAGTTCTT TCACACAGAATATTATTGATACAATTGAATTTTGGCCAATGGTTAAAACTGAGTC TAAGAAAAGGTGGAATCTGCCTCAAACTAGTACATTCATGTTTTCACTAAATCCT CAAACTGATACTTTTGGATCCTTGAACCAAATTGAAAATCAAGAATCTCCTCTGT GGACCCATCCTGAAATTGATAATGTCAATACAATGGCGTTTCTTGAATTTGGAAC ACTCATATCACAGGTAGTACCTTTGCCCCAAGCAGCTAGATTCTGGCCCCAAACT GAAGCTGATACTAGCAAAATTTGGTTTGTCTCCTCTGAAAGAATAAATTCCTGGG ACCAATCAGAGTCTCAAAGAATGAGTACCTCAATCCATTTTGGAGTGGGTAGAGT GAAGCCCCTCGCCCAACATGAAACTGCTACAGTCATGTCATGGCTTCAGATTGAA ACTGGTATATTCCACCCTTGGAACAAGTCTGAAGGAGGCACAGGGAGGTTCTGGC CCCTTTCTGAAACTGAGGATGTAAGAGAATGGATCCAAACTGGAGCCGGTACAG TTAACTCTTGGACTCAACTGAGAACTAATATAGTCAGAGCTTGGCCCCAAGCTGA ATCTGAACTAGTCAGACCCTGGACACAAACTAAAACGAATGCAATCACACTATTG ACCCAGACTGATGCTATCAAACCTTGGTTCCAAACTAAAATTAATGCACTAAGAG AAGGGACCCAAACTCAATCTCAAATTGTTACTACTTGGATCCAAACACAGTTGCA AATATTTCACCCCTGGATTCAGCCTAAAAGTGATTCAGTCAGATTTTGGACCCAG CCTTGGATCCAAGCTGAAACCCACACAGTCAGACTCTATTATGAAATTACTATAA GAAAATCATGGGCCTCATCTGAATCTCAGTCAGTCACATTTTCATCACTGAGTCA AAATTCAGTTAAGAACTCATTTCACTTTGAATCTCAGATGACATGTTCCTGGGTCC GAAATGAATTTGATATAATCAGTCCTTGGAATCAATATGAAACTAGTTCTGTTGG ATCCTGGTTCCAGTCTGAAACTGGTACCTGTCAACCCTGGCTCCATATTGAATCTT CTACAATCACACCATGGACCCAATATGAAACATTAGAGATCTCCCCTTCAACCAA TCCTGAGACTGATACAGCAATAAGGAATTTGTTCCAGCCCCAAATTGATCTAATT AGTACTTGGAATCAGCCTGAAGTAGACACAATCAGATTCTGGACCCAAGTTGAA ACAGAAACAATTCCAATGTGGACCCAGATTGGAACTCAAGTAGTTAAACCTCTCA ACTTTTCTGAAGTTGGTATAGTTACACCTTGGCTAAAGACTGAAACTGATGCAAG TAGACCCTGGATTCAGTCTGACTTTCAGTCAATCCATCCGTGGAGCCAGATTGGA TTTGGTATAATTGCCCCCTGGTCTCAGCCAGGAGCTTCTGTAAATCAACCCTGGA CCTTTGTTCAAACACAGTCAATCAGACCTTGGATTACAGTGGAATCCAATAGAAT CAAATATTGGTTTCATGTTCCAATGAAAAAAGTCAGACTGAGGATTCCTTCTGAG TCTCAAATATTGAGTTTCTGGATGCAGTCTGATGTTAGTAGAGTTAATGCTTGGAT CCAACCAGAAACCCAGGCAGTCAATCCTGGGGCTCATCCTAAAACTGGCAATGTT GCATCCCTGACTATTCCTAACCCTGAAAGAGTCAGAATGTGGATCCAGCCTGAAA CAGAAATAAGACTTGGCATCATTTATAAAACTAATATAGCCACATCATTTGCTTC TGAAATTGAACCAGATGGAACAATTAGTTATTTTGATTCGTGGTCTATCCATGTA ACATTTTTACCAATAGAAACTGTTACTTCCCTAGATGAGCATTTTGCAGCTTTGTC AACTGAAATAGCTGCAGTAGAAAGCCAAGGTCAAATAAATTCTGTCCAACCCAG TGAGATCACAAATATTCTCTTTCTTACAATTGCAAGCACACAGCTTCCTGGAGGA TTTGGTTACCTGAACTTTGGCAACAAATTACAAATTACCAATTCAAAAGGAAGCC CTAATGTCCCATATAGTTCTCTCAACCCACTTTTTCCGTCTTTTTCCTTTCCTGTTC CTTGTTTTTTCCCATTTTCATGTTCTTTGTCCCTTACTTGTTCAGTCTTTTCTTCTTG CACATTTTCTTCACCATGTACTTTTCCTTCTTGCTCAGTTCTTCCTATTGTGGGTTT CTCTCCTGTTCCTCCCTTAGCTGCTTCTGATAGTTCTCTCCAGAAACCATCTTCCTC AAAAGTTATTGAAGACACCATTCTTTCCCATACTTTTTCATCCTTTCATGCTGCTC CAGCCACTCTTTTAACAAAGCAACCATCTCTGATGCCTGGATTTCAATTGGGAAC CAAGTCTAATCAGCCTGAACAAGATCTTCCTAAGTATTCTGAACTCAATATTTCCC TTGCTGAGTGTCGCCTGGGTGTGGTCTGGAAAGAGAGTCTCCAGGCTCTCTCGCT CTTCAAGACAGCTGTTATTTCTCATGAAATCACAGAGTGTGGATTGCGCCCTGGC CTTGTTCCACACTGTCCCAACTGCTGGGAGGCTGAAGTGGGTGAATTCCCTTGGA TGGTTTCTGTGCAACTCTCTTTCTCCCATTTTTGTGCTGGTTCTATACTAAATGAAC AATGGATTCTCACTACAGCTAGATGTGCAAATTTCATAAAAAACTCAGAAGCACT GGCCCATGTCCAGGTGGGGCTTATAGATCTTCAAGACCCTGCTCAAGCTCAAACT GTAGGCATTCATCGTGCCATGCCCTACCTGGGCCCTAGAGGACCTCTGGGACCTG GTCTAATCTTCTTGAAGCAACCATTACATTTTCAACCCCTGGTTCTTCCTATCTGC CTGGAGGAGAACCTAGAGCAAGAGAAAAATATACAACTGTATGACTGCTGGCTA CCCAGTTGGTCCCTCATGAGAGGAAGTCCTGGAATTTTGCAAAAAAGGCACCTGA GCATCCTGCAAGCCATCACATGTGCCCAGTTTTGGCCCAAACTGAATGAATTTAC TTTCTGTGTGGCAGCCAAGAAAGCTATGGGGGAGGCTGGCTGTAAGGGTGACCT GGGGGCACCTCTTGTGTGTCATCTGCAACAAAAAGACACATGGGTGCAGGTGGG AATTTTGACTCACTTTGATGAACACTGCACAAAGCCCTACGTCTTCAGCCAAGTG AGCCCTTTCCTTTTCTGGCTCCAGGGAGTTACACGACCTAGCCAAGCACCCTGGT CCAAGCAAGGGCCCATGACCACCTCTGCTTCCATCTCCCTTTCAGTCTCTACCTCT ATGAATGCCTCAGCTTTTACTTCCACGCCTGCTTCTGTCCGGCCACATTTCATCTC TCTGCCACAGCCTCAGACTTTGGCAGATCGAATTTCTCTGAGATATGCCATGCCTT GGCAGGCCATGATCATCAGTTGTGGCAGTCAAATTTGCAGTGGTTCCATTGTTAG CAGCTCTTGGGTACTCACTGCAGCCCACTGTGTCAGGAATATGAATCCTGAAGAC ACAGCTGTAATATTGGGCCTGAGGCACCCTGGGGCACCTCTGCGAGTTGTTAAGA TCTCTACCATTCTTCTGCATGAAAGATTTCGGTTGGTGAGTAGGGCAGCAAGAAA CGATCTAGCATTGCTGCTCCTTCAAGAGGTCCAGACTCCTATTCAGATTTTAGCAC CGCTAGGTCATCTGAAGAACCTGAACAGCTCAGAATGCTGGCTGTCTGGGCCACG AATTCTTAAGCCAGGAGAGACAGATGAAAATCCAGAAATATTACAGATGCAGGT GATAGGAGCATCAAGCTGTGCCCACCTTTACCCTGATATAGGTAGTTCTATTGTG TGCTTCATTACACAAGACAAAGATGCTGACACAAATGTGGAACCGGTGAGTCCA GGCAGTGCTGTCATGTGCAGACCAATGTCTAGGAATGGAAGCTGGAGACAGATA GGCCTCACTAGTCTGAAGGCACTGGCTACCATTGTGAGCCCCCACTTCTCATGGA TATTATCCACTTCATCAAAGGCAGGACATCCATTAAGCCATGCACTCATGCCTTG GATGGAAAAGCCTAAGTCCTCTAGTATCATGAAACAGCCAACCACTCTGCCATTT TATTCAACAATAATTGTTATACTACAAAGGCTTTAATAACTCATTGCAAAAATAA TGCAGGGCTAATCTATTCAAACTATTCATAATAAAAATGTTAACGTTAAAAAAAA TAAGGCCCTAT
REFERENCES
[0323] 1. Lyttle T W. Segregation distorters. Annual review of genetics (1991) 25:511-57. [0324] 2. Jaenike J. Sex chromosome meiotic drive. Annu Rev Ecol Syst (2001) 32:25-49. [0325] 3. Fisher R A. The Genetical Theory of Natural Selection: Oxford University Press; 1930. 291 p. [0326] 4. Hall D W. Meiotic drive and sex chromosome cycling. Evolution (2004) 58:925-31. [0327] 5. Skaletsky H, Kuroda-Kawaguchi T, Minx P J, Cordum H S, Hillier L, Brown L G, Repping S, Pyntikova T, Ali J, Bieri T, Chinwalla A, Delehaunty A, Delehaunty K, Du H, Fewell G, Fulton L, Fulton R, Graves T, Hou S F, Latrielle P, Leonard S, Mardis E, Maupin R, McPherson J, Miner T, Nash W, Nguyen C, Ozersky P, Pepin K, Rock S, Rohlfing T, Scott K, Schultz B, Strong C, Tin-Wollam A, Yang S P, Waterston R H, Wilson R K, Rozen S, Page D C. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature (2003) 423:825-37. [0328] 6. Hughes J F, Skaletsky H, Brown L G, Pyntikova T, Graves T, Fulton R S, Dugan S, Ding Y, Buhay C J, Kremitzki C, Wang Q, Shen H, Holder M, Villasana D, Nazareth L V, Cree A, Courtney L, Veizer J, Kotkiewicz H, Cho T J, Koutseva N, Rozen S, Muzny D M, Warren W C, Gibbs R A, Wilson R K, Page D C. Strict evolutionary conservation followed rapid gene loss on human and rhesus Y chromosomes. Nature (2012) 483:82-6. [0329] 7. Hughes J F, Skaletsky H, Pyntikova T, Graves T A, van Daalen S K, Minx P J, Fulton R S, McGrath S D, Locke D P, Friedman C, Trask B J, Mardis E R, Warren W C, Repping S, Rozen S, Wilson R K, Page D C. Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content. Nature (2010) 463:536-9. [0330] 8. Soh Y Q, Alfoldi J, Pyntikova T, Brown L G, Graves T, Minx P J, Fulton R S, Kremitzki C, Koutseva N, Mueller J L, Rozen S, Hughes J F, Owens E, Womack J E, Murphy W J, Cao Q, de Jong P, Warren W C, Wilson R K, Skaletsky H, Page D C. Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes. Cell (2014) 159:800-13. [0331] 9. Li G, Davis B W, Raudsepp T, Pearks Wilkerson A J, Mason V C, Ferguson-Smith M, O'Brien P C, Waters P D, Murphy W J. Comparative analysis of mammalian Y chromosomes illuminates ancestral structure and lineage-specific evolution. Genome Res (2013) 23:1486-95. [0332] 10. Hughes J F, Skaletsky H, Pyntikova T, Koutseva N, Raudsepp T, Brown L G, Bellott D W, Cho T J, Dugan-Rocha S, Khan Z, Kremitzki C, Fronick C, Graves-Lindsay T A, Fulton L, Warren W C, Wilson R K, Owens E, Womack J E, Murphy W J, Muzny D M, Worley K C, Chowdhary B P, Gibbs R A, Page D C. Sequence analysis in Bos taurus reveals pervasiveness of X-Y arms races in mammalian lineages. Genome Res (2020) 30:1716-26. [0333] 11. Skinner B M, Sargent C A, Churcher C, Hunt T, Herrero J, Loveland J E, Dunn M, Louzada S, Fu B, Chow W, Gilbert J, Austin-Guest S, Beal K, Carvalho-Silva D, Cheng W, Gordon D, Grafham D, Hardy M, Harley J, Hauser H, Howden P, Howe K, Lachani K, Ellis P J, Kelly D, Kerry G, Kerwin J, Ng B L, Threadgold G, Wileman T, Wood J M, Yang F, Harrow J, Affara N A, Tyler-Smith C. The pig X and Y Chromosomes: structure, sequence, and evolution. Genome Res (2016) 26:130-9. [0334] 12. Piovesan A, Antonaros F, Vitale L, Strippoli P, Pelleri M C, Caracausi M. Human protein-coding genes and gene feature statistics in 2019. BMC Res Notes (2019) 12:315. [0335] 13. Mueller J L, Skaletsky H, Brown L G, Zaghlul S, Rock S, Graves T, Auger K, Warren W C, Wilson R K, Page D C. Independent specialization of the human and mouse X chromosomes for the male germ line. Nat Genet (2013) 45:1083-7. [0336] 14. Soh Y Q, Junker J P, Gill M E, Mueller J L, van Oudenaarden A, Page D C. A Gene Regulatory Program for Meiotic Prophase in the Fetal Ovary. Plos Genet (2015) 11: e1005531. [0337] 15. Lesch B J, Silber S J, McCarrey J R, Page D C. Parallel evolution of male germline epigenetic poising and somatic development in animals. Nat Genet (2016) 48:888-94. [0338] 16. Green C D, Ma Q, Manske G L, Shami A N, Zheng X, Marini S, Moritz L, Sultan C, Gurczynski S J, Moore B B, Tallquist M D, Li J Z, Hammoud S S. A Comprehensive Roadmap of Murine Spermatogenesis Defined by Single-Cell RNA-Seq. Developmental cell (2018) 46:651-67 e10. [0339] 17. Cardoso-Moreira M, Halbert J, Valloton D, Velten B, Chen C, Shao Y, Liechti A, Ascencao K, Rummel C, Ovchinnikova S, Mazin P V, Xenarios I, Harshman K, Mort M, Cooper D N, Sandi C, Soares M J, Ferreira P G, Afonso S, Carneiro M, Turner J MA , VandeBerg J L, Fallahshahroudi A, Jensen P, Behr R, Lisgo S, Lindsay S, Khaitovich P, Huber W, Baker J, Anders S, Zhang Y E, Kaessmann H. Gene expression across mammalian organ development. Nature (2019) 571:505-9. [0340] 18. Conway S J, Mahadevaiah S K, Darling S M, Capel B, Rattigan A M, Burgoyne P S. Y353/B: a candidate multiple-copy spermiogenesis gene on the mouse Y chromosome. Mammalian Genome (1994) 5:203-10. [0341] 19. Cocquet J, Ellis P J, Mahadevaiah S K, Affara N A, Vaiman D, Burgoyne P S. A genetic basis for a postmeiotic X versus Y chromosome intragenomic conflict in the mouse. Plos Genet (2012) 8: e1002900. [0342] 20. Kruger A N, Brogley M A, Huizinga J L, Kidd J M, de Rooij D G, Hu Y C, Mueller J L. A Neofunctionalized X-Linked Ampliconic Gene Family Is Essential for Male Fertility and Equal Sex Ratio in Mice. Curr Biol (2019) 29:3699-706 e5. [0343] 21. Cocquet J, Ellis P J, Yamauchi Y, Riel J M, Karacs T P, Rattigan A, Ojarikre O A, Affara N A, Ward M A, Burgoyne P S. Deficiency in the multicopy Sycp3-like X-linked genes Slx and Slx11 causes major defects in spermatid differentiation. Mol Biol Cell (2010) 21:3497-505. [0344] 22. Helleu Q, Gerard P R, Montchamp-Moreau C. Sex chromosome drive. Cold Spring Harb Perspec Biol (2015) 7: a017616. [0345] 23. Shang X, Shen C, Liu J, Tang L, Zhang H, Wang Y, Wu W, Chi J, Zhuang H, Fei J, Wang Z. Serine protease PRSS55 is crucial for male mouse fertility via affecting sperm migration and sperm-egg binding. Cell Mol Life Sci (2018) 75:4371-84. [0346] 24. Zhu F, Li W, Zhou X, Chen X, Zheng M, Cui Y, Liu X, Guo X, Zhu H. PRSS55 plays an important role in the structural differentiation and energy metabolism of sperm and is required for male fertility in mice. J Cell Mol Med (2021) 25:2040-51. [0347] 25. Courret C, Chang C H, Wei K H, Montchamp-Moreau C, Larracuente A M. Meiotic drive mechanisms: lessons from Drosophila. Proc Biol Sci (2019) 286:20191430. [0348] 26. Kruger A N, Mueller J L. Mechanisms of meiotic drive in symmetric and asymmetric meiosis. Cell Mol Life Sci (2021) 78:3205-18. [0349] 27. Loytynoja A. Phylogeny-aware alignment with PRANK. Methods Mol Biol (2014) 1079:155-70. [0350] 28. Guindon S, Delsuc F, Dufayard J F, Gascuel O. Estimating maximum likelihood phylogenies with PhyML. Methods Mol Biol (2009) 537:113-37. [0351] 29. Edgar R C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res (2004) 32:1792-7. [0352] 30. Patro R, Duggal G, Love M I, Irizarry R A, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods (2017) 14:417-9. [0353] 31. Langmead B, Salzberg S L. Fast gapped-read alignment with Bowtie 2. Nat Methods (2012) 9:357-9.