Gene expression cassette capable of initiating translation after completion of transcription for producing high-quality recombinant protein in bacteria

12139715 ยท 2024-11-12

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a gene expression cassette which, for the production of a high-quality recombinant protein in bacteria, initiates translation after completion of transcription, and more specifically, to a gene expression cassette consisting of a switch capable of stopping translation initiation and a trigger system capable of activating the translation initiation from the switch by re-configuring the transcription-translation coupled system inherent in bacteria such that the translation is initiated only by a full-length mRNA chain template. The transcription and translation in the bacteria can be uncoupled by inserting a trigger sequence activating the translation initiation from the switch into the downstream (3 terminal) of a target recombinant gene by replacing a natural transcription translation-coupled 5 UTR with the switch. The productivity of a high-quality full-length recombinant protein can be increased while reducing the costs associated with a purification process.

Claims

1. A DNA molecule capable of forming a stem loop structure during transcription into mRNA, the stem loop structure having a ribosome-binding site located therein, the DNA molecule comprising: a first DNA sequence encoding a first RNA sequence designed such that a part of the first RNA sequence can participate in a formation of the stem loop structure; and a second DNA sequence encoding a second RNA sequence located after a stop codon that can complementarily bind to the first RNA sequence designed such that the part of the first RNA sequence can participate in the formation of the stem loop structure.

2. The DNA molecule according to claim 1, wherein the DNA molecule comprises a multiple cloning site after the ribosome-binding site and before the second DNA sequence.

3. A vector comprising the DNA molecule according to claim 1.

4. An mRNA forming a stem loop structure, the stem loop structure having a ribosome-binding site located therein, the mRNA comprising: a first RNA sequence having a part of the sequence participating in the stem loop structure; and a second RNA sequence having a complementary sequence capable of binding to the first RNA sequence and being located after a stop codon.

5. The mRNA according to claim 4, wherein the mRNA initiates translation while the stem loop structure is released when the second RNA sequence binds to the first RNA sequence.

6. The mRNA according to claim 5, wherein the translation is initiated when a ribosome binds to the ribosome-binding site.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) a) of FIG. 1 is a schematic diagram illustrating the mechanism of operation of a ProQC gene expression cassette in which a trigger sequence for initiating translation from a switch is located in the same mRNA as the switch, and b) of FIG. 1 is a schematic diagram illustrating whether or not a ribosome binds to a ribosome-binding site (RBS) in the respective cases of mRNA having switch and trigger sequences and mRNA not having switch and trigger sequences.

(2) FIG. 2 is a schematic diagram illustrating a txtl-Cis-sfGFP gene expression cassette in which a trigger sequence for initiating translation from a switch is located in the same mRNA as the switch, and is a schematic diagram illustrating a natural gene expression cassette (txtl-Trans-sfGFP) in which a trigger is located in a plasmid different from the switch expressing the target gene.

(3) FIG. 3 is a graph comparing unit fluorescence obtained by expressing the reporter protein sfGFP in the ProQC gene expression cassette and the natural gene expression cassette, and normalizing the unit fluorescence in each system with the expression value of the natural gene expression cassette (unit fluorescence of ProNC-sfGFP=1).

(4) FIG. 4 is a genetic circuit diagram showing the degree of intramolecular and intermolecular interactions of the switch and trigger sequences of mRNA transcribed in the ProQC gene expression cassette.

(5) FIG. 5 is a graph showing the proportion of unit fluorescence of ProIntra cells using sfGFP protein as a marker (index) for initiation of translation by interaction in mRNA molecules.

(6) FIG. 6 is a schematic diagram illustrating a method for constructing an mCherry_lacZ_gfp (MLG) fusion protein, a ProQC-MLG plasmid-expressing MLG protein, and a ProNC-MLG gene.

(7) a) of FIG. 7 is a graph showing the amounts of amino and carboxyl ends of the MLG fusion protein of each of ProQC-MLG and ProNC-MLG strains, wherein fluorescence per cell is calculated by dividing mCherry and sfGFP fluorescence by the absorbance at a wavelength of 600 nm, and the fluorescence per cell is converted to the amount of each fluorescent protein and then normalized to the amount of mCherry, and b) of FIG. 7 is a graph comparing the expression level of full-length protein (based on the sfGFP at the carboxyl end), when the unit fluorescence of ProNC-sfGFP is normalized to 1, in order to determine the productivity of the fusion protein of unit cells in ProQC-MLG and ProNC-MLG.

(8) FIG. 8 shows the result of SDS-PAGE of proteins expressed from the ProQC-MLG strain and the ProNC-MLG (control) strain, wherein Full length represents a fusion protein purified using a histidine tag at the carboxy terminal as a full-length marker.

BEST MODE

(9) The present invention provides a gene expression cassette that is capable of releasing the transcription-translational coupling of bacteria and allowing translation to be initiated only in the mRNA strand in which transcription has been completed. That is, the present invention provides a gene expression cassette that includes a nucleic acid sequence preventing the initiation of translation of an mRNA template transcribed to an incomplete length (hereinafter referred to as a switch) and a nucleic acid sequence capable of binding to the switch upon transcription of the full length thereof to activate translation initiation (hereinafter referred to as a trigger). More specifically, after complete termination of transcription, when the trigger nucleic acid sequence at the 3 end of the mRNA is exposed to the mRNA and binds complementarily to the switch sequence at the 5 UTR of the mRNA, the stem loop structure in which the switch sequence particulates is released, thus resulting in translation initiation. The transcriptional translation non-coupling system of the present invention enables a full-length, high-quality recombinant protein to be produced in bacteria.

(10) A schematic diagram of the gene expression cassette of the present invention is illustrated in FIG. 1. The mRNA molecule transcribed from DNA in bacteria has a sequence capable of binding to a ribosome, that is, a ribosome-binding site (RBS) thereon. When the ribosome binds to this ribosome-binding site, translation can be initiated. Additionally, the present invention aims to control the time point at which translation is initiated through the so-called switch-trigger system of the present invention.

(11) The schematic diagram of FIG. 1 will be described in detail. The so-called switch sequence (RNA sequence (a) in the present invention) and the trigger sequence (RNA sequence (b) in the present invention) of the present invention are present in the same mRNA strand. A part of the switch sequence participates in the formation of the stem loop structure containing RBS. The trigger sequence (RNA sequence (b) in the present invention) is located at the 3 end of the same mRNA, preferably after the stop codon.

(12) When the stem loop structure is formed, translation is not initiated. In the case of a fully transcribed mRNA, the trigger sequence is exposed onto the mRNA, and the exposed mRNA binds to the complementary switch sequence to release the stem loop structure and thereby induce initiation of translation. That is, the trigger sequence that initiates translation from the switch is located in the same mRNA as the switch. As shown in a) of FIG. 1, when the trigger sequence at the 3 end of the mRNA is exposed onto the mRNA through a complete transcription process, it pairs with the switch sequence of 5 UTR and binds complementarily thereto to form a signal for initiating (turning on) translation. When the ribosome binds to the ribosome-binding site in the state in which the switch and trigger sequences complementary bind to each other, translation is initiated normally, and when the translation is terminated by a stop codon located in front of the trigger sequence, a complete protein can be produced from a complete mRNA template having an intact 3 end.

(13) When the gene expression cassette of the present invention is used, as shown in b) of FIG. 1, it can be seen that translation cannot be initiated because the ribosome cannot bind to the ribosome-binding site of an mRNA having no switch-trigger system, whereas translation can be initiated because the ribosome binds only to the mRNA ribosome-binding site having the switch-trigger system according to the present invention.

(14) Meanwhile, in the present invention, a part of the switch sequence preferably participates in the formation of the stem loop structure. When the entirety of the switch sequence participates in the formation of the stem loop structure, even if the trigger sequence complementarily binds to the switch sequence, the binding force of the trigger sequence participating in the stem loop structure formation is equal to the binding force with the trigger sequence, making it difficult to release the formation of the stem loop structure.

(15) Meanwhile, in a second aspect, the present invention provides a DNA molecule capable of forming a stem loop structure during transcription into mRNA, the stem loop structure having a ribosome-binding site located therein, the DNA molecule including a DNA sequence (a) encoding an RNA sequence designed for a part of the sequence to participate in the formation of the stem loop structure, and a DNA sequence (b) encoding an RNA sequence complementarily binding to the RNA sequence designed for a part of the sequence to participate in the formation of the stem loop structure, and being located after a stop codon, and a vector including the DNA molecule.

(16) In the second aspect of the present invention, a switch-trigger system operated at the mRNA level is implemented on DNA, and the DNA of the present invention functions as a gene expression cassette system that ensures high-efficiency expression of the target protein, and the vector including the DNA molecule according to the second aspect of the present invention functions to transport this expression system. The bacterium transformed with the vector of the present invention can produce a target protein in an intact form, as described above, and thus can produce a recombinant target protein with high efficiency.

(17) Meanwhile, in the present invention, a variety of promoters and terminators required for initiation and termination of expression can be designed, and the amount of the target protein can be adjusted according to the intensity of the promoter.

(18) Meanwhile, in the present invention, the DNA molecule preferably includes a multiple cloning site after the ribosome-binding site and before the DNA sequence (b) (the so-called trigger sequence), and various genes encoding target proteins can be inserted into the multiple cloning site.

(19) Hereinafter, the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the examples, and includes variations and technical concepts equivalent thereto.

Example 1: Production of Transcriptional-Translation Uncoupling Gene Expression Cassette

(20) In order to construct a synthetic gene expression cassette (ProQC gene expression cassette) that allows translation to be initiated only in the mRNA strand that has been completely transcribed in bacteria, a T7 promoter, which is a strong promoter widely used in the production of recombinant proteins, was used. Mach-TIR strains were used for all cloning in the example.

(21) First, the vector section containing the chloramphenicol resistance gene (CamR) was amplified using the ECONI-PT7-NheI-TT7-F/SpeI-pACYC-R primer set shown in Table 2 and a pACYC_Duet plasmid as a template to remove unnecessary restriction enzyme sites from the vector. By cloning the pACYC_Duet plasmid using EcoNI and NheI and the amplified PCR product using EcoNI and SpeI restriction enzymes, respectively, the NheI restriction enzyme sequence of the existing plasmid was removed, and pACYC* in which a cloning site capable of accommodating a gene expression cassette is inserted between the T7 promoter and T7 terminator sequences was constructed.

(22) The conventional switch and trigger systems for controlling the initiation of translation facilitate translation initiation in the presence of a trigger by transcribing the trigger sequence from plasmids having a high number of copies or relatively strong promoters. However, in the present invention, one trigger molecule is present per switch for initiating translation, that is, at an equal ratio. For this reason, in order to determine whether or not translation initiation occurs smoothly even under conditions where there are not many trigger molecules, a genetic circuit was constructed using green fluorescent protein (sfGFP) as a reporter, as shown in FIG. 2.

(23) Next, sfGFP was primarily amplified using a pBR322-J23100-sfGFP plasmid as a template and a Swit-sfGFP-F1/SpeI-SacI-sfGFP-R primer set shown in Table 2, and was then amplified again using a BsaI-Swit-sfGFP-F2/BsaI-Trig-R2 primer set, a toehold switch was attached to the 5 end of the sfGFP, and a trigger sequence was attached to the 3 end thereof. After cutting the pACYC* vector with BsaI and NheI restriction enzymes, the amplification product was cloned using the BsaI restriction enzyme sequence to construct a txtl-Cis-sfGFP plasmid, and the amplification product was cloned using the BsaI and SpeI restriction enzyme sequences to construct a txtl-Trans-sfGFP plasmid. Further, plasmids for transcribing the trigger for gene expression of the txtl-Trans-sfGFP plasmid were constructed.

(24) The sequence from the T7 promoter to the T7 terminator of pACYC* was cloned into a pCDF Duet vector using EcoNI and Bsu36I restriction enzyme sequences to construct a pCDF-Term plasmid, and a trigger sequence amplified using a BsaI-Trigger #3-F/BsaI-Trig-R2 primer set shown in Table 2 was cut with a BsaI restriction enzyme, and was then cloned into a pCDF-Term vector cut with BsaI and NheI restriction enzymes to construct a pCDF-Trigger plasmid.

(25) Since the pCDF-Trigger plasmid has a higher number of copies (about 40 copies per cell) than the pACYC_Duet plasmid (about 12 to 15 copies per cell), and is continuously supplied, translation from the natural gene expression cassette is initiated independently of transcription termination of sfGFP.

Experimental Example 1: Determination of ProQC Gene Expression Cassette Efficiency

(26) In order to compare the translation initiation efficiency from the constructed ProQC gene expression cassette with that of the natural gene expression cassette, a pair of a txtl-Cis-sfGFP plasmid and a pCDF-Term plasmid, and a pair of a Trans-sfGFP plasmid and a pCDF-Trigger plasmid were transformed into Escherichia coli BL21 (DE3), which is widely used for recombinant protein production.

(27) Screening was conducted on a plate containing spectinomycin (Spec, 50 ug/mL) and chloramphenicol (Cam, 34 ug/mL) antibiotics to maintain the plasmid, the formed colonies were inoculated into a liquid LB (Lysogeny broth) medium supplemented with Spec and Cam and grown overnight, and the absorbance was measured using a UV-1700 spectrophotometer.

(28) After dilution to the initial absorbance (OD.sub.600; optical density at 600 nm) of 0.05, incubation was conducted until OD.sub.600 reached 0.8, followed by induction with 0.2 mM IPTG. At 4 hours, a certain volume of cells was harvested and washed with a PBS (phosphate-buffered saline) buffer, and fluorescence was measured using a Hydex filter for wavelengths of 486 nm and 535 nm. The experiment for measuring fluorescence was performed in triplicate, and the value, measured with a multiplate reader, was divided by the OD.sub.600 of each sample to convert the same to fluorescence per cell.

(29) As a result, as can be seen from FIG. 3, based on the relative fluorescence when the fluorescence in the natural gene expression system is set to 1, the translation initiation efficiency of the ProQC gene expression cassette (ProQC-sfGFP) is almost the same as that of the natural gene expression system (ProNC-sfGFP).

Experimental Example 2: Construction of Genetic Circuit for Measuring Intramolecular and Intermolecular Interactions of Switch and Trigger Sequences of mRNA, and Measurement of mRNA Intramolecular and Intermolecular Interactions

(30) There are a variety of molecules in cells. In particular, when a lot of mRNA is transcribed from a T7 promoter, which has a strong intensity, translation can also be initiated from the switch of the mRNA strand having no trigger through intermolecular interaction by a trigger at the 3 end of another mRNA.

(31) In order to create a system that allows translation to be initiated from an intact full-length mRNA by controlling the translation to be initiated by a trigger at the 3 end, which is exposed upon termination of transcription, the interaction within one mRNA molecule should be stronger than the interaction between mRNA molecules.

(32) Thus, in order to verify this, by introducing different reporter proteins into one switch and removing a trigger from the mRNA of one reporter protein, a gene circuit that does not initiate translation only using the corresponding mRNA was designed and constructed.

(33) Since the conventional mCherry sequence has an unintended translation initiation sequence at the amino terminal, the translation initiation sequence was removed in order to secure control of the switch. The mCherry gene, excluding an 8-amino-acid sequence at the N-terminal thereof, was amplified using the pET28a-mCherry plasmid as a template and the BsaI-Trc-mcherry-F/SpeI-mCherry-R primer set shown in Table 2, and was then inserted into the pACYC* vector using BsaI and SpeI (BsaI and NheI restriction enzymes were used for vectors), and the sequence from the T7 promoter to the T7 terminator was cloned into the pCDF Duet vector using the EcoNI and Bsu36I restriction enzyme sequences to construct a genetic circuit for conducting transcription of mRNA that allows control of the switch but has no trigger (FIG. 4).

(34) Next, BL21 (DE3) was transformed with txtl-Cis-sfGFP and pCDF-txtl-Trans-mCherry plasmids, and then GFP and mCherry fluorescence of cells were measured.

(35) As a result, as can be seen from FIG. 5, the ratio at which the 3-end trigger sequence of txtl-Cis-sfGFP causes initiation of translation from the switch of pCDF-txtl-Trans-mCherry by the interaction between mRNA molecules is 6.3%, and the ratio at which the 3-end trigger sequence of txtl-Cis-sfGFP causes initiation of translation from the switch of pCDF-txtl-Trans-mCherry by the interaction in mRNA molecules is 93.7%. That is, even if the same switch is present on different mRNA strands, the efficiency of translation initiation by the interaction in molecules having a trigger in the same mRNA strand is high.

Experimental Example 3: Comparison of Quality of Protein Produced from ProQC Gene Expression Cassette

(36) A long mRNA encoding a long protein is easily damaged during transcription. For this reason, whether or not the productivity of the long protein was improved when the ProQC gene expression cassette prepared in Example 1 was used was determined.

(37) In order to produce a 4581-bp-long mCherry-lacZ-sfGFP (MLG) fusion protein as a model system, first, an amplification product BL21 (DE3), in which the stop codon of mCherry was removed and a linker was attached thereto, was prepared using the BsaI-Trc-mcherry-F/KpnI-Lnk-MR/Lnk-M-R primer set shown in Table 2 and using the pET28a plasmid as a template, a lacz gene amplification product, in which the start codon and the stop codon were removed, was prepared using a KpnI-lacZ-F/BsaI-lacz-R primer set and using chromosome as a template, and an sfGFP gene amplification product, in which a linker was attached to the amino terminal, was prepared using a BsaI-Lnk-sfGFP-F/SpeI-sfGFP-R primer set and the pBR322-J23100-sfGFP plasmid as a template. Among the three amplification products, the mCherry was cut with BsaI and KpnI restriction enzymes, the lacz was cut with KpnI and BsaI restriction enzymes, and the sfGFP was cut with BsaI and SpeI restriction enzymes. Then, the products were purified and ligated in one tube, and finally amplified using a BsaI-Trc-mcherry-F/SpeI-sfGFP-R primer set to conduct amplification of the strand to which three genes were connected in sequence, and then TA cloning was performed thereon.

(38) The MLG was amplified using a BsaI-his-MF/SpeI-SacI-sfGFP-R primer set and a pMD19-MLG plasmid as a template, the vector sequence was amplified using a BsaI-Swit #3-R/SpeI-Trig-F primer set and a txtl-Cis-sfGFP plasmid as a template, and the resulting amplification products were cloned using BsaI and SpeI restriction enzyme sequences to construct a txtl-Cis-MLG_NH plasmid, and were cloned using BsaI and NheI restriction enzyme sequences to construct a txtl-Trans-MLG_NH plasmid (FIG. 6).

(39) The mCherry-lacZ-sfGFP (MLG) fusion protein produced through the above process has an mCherry fluorescent protein at the amino terminal (5-end) and an sfGFP fluorescent protein at the carboxyl terminal (3 end). Thus, whether or not the two ends of the long protein produced in cells are lost can be determined by measuring the ratio of mCherry and sfGFP fluorescence of individual cells.

(40) Next, the unit fluorescence was calculated to convert the two types of fluorescence emitted from the cell into the number of molecules. For this purpose, the sfGFP gene was amplified using a Duet-F/His-G-R primer set shown in Table 2 and a txtl-Trans-sfGFP plasmid as a template, and six repeated histidine tags (6His) were attached to the carboxyl terminal of sfGFP and then cloning into the pACYC* vector was conducted using EcoNI and SacI restriction enzyme sequences to construct a txtl-Trans-sfGFP CH plasmid. The mCherry gene was amplified using a Duet-F/His-MR primer set shown in Table 2 and a pCDF-txtl-Trans-mCherry plasmid as a template, and histidine tags (6His) were attached to the carboxyl terminal of mCherry and then cloning into the pACYC* vector was conducted using EcoNI and SacI restriction enzymes to construct a txtl-Trans-mCherry_CH plasmid.

(41) In addition, in order to calculate the fluorescence per unit mass of the fluorescent protein, a pair of the txtl-Trans-mCherry-CH plasmid and pCDF-Trigger plasmid was transformed into BL21 (DE3) to produce Unit-sfGFP, and a pair of the txtl-Trans-sfGFP plasmid and pCDF-Trigger plasmid was transformed into BL21 (DE3) to produce Unit-mCherry. Fluorescent proteins were expressed in the Unit-sfGFP and Unit-mCherry in the same manner as in Experimental Example 1. After 4 hours, the cells were harvested. The sfGFP and mCherry were each purified from the harvested cells by Ni-NTA purification, a protein purification method using histidine tags, and then the correlation between the protein amount and fluorescence intensity was determined. Here, the amount of the protein was measured by a Bradford assay, and the fluorescence was measured from the purified sample diluted with PBS buffer at various ratios. A formula describing the relationship between the protein amount and fluorescence intensity of each of sfGFP and mCherry was established (when measured with Hidex, a formula for fluorescence intensity per gram of protein was established).

(42) Next, in order to prevent the lacz contained in BL21 (DE3) from being purified or bound with the MLG fusion protein, the lacZ gene was removed from the chromosome. In this case, gene removal was performed using a conventional gene recombination method using homology.

(43) For this purpose, FRT-Kan-FRT was amplified using the lacZ-Del-F1/lacZ-Del-R1/lacz-Del-F2/lacz-Del-R2 primer set shown in Table 2 and the pFRT72 plasmid as a template, and was then treated with DpnI restriction enzyme to remove the template plasmid. The amplification product was subjected to PCR purification and ethanol concentration to transform the BL21 (DE3)/pKD46 strain expressing the recombinant enzyme. Additionally, the insertion of the FRT-Kan-FRT sequence, instead of the lacz gene, was identified through colony PCR using the lacz-check-F/lacZ-check-R primer set. Then, transformation with pCP20 plasmid and expression of the FLP recombinase were conducted to remove the kanamycin resistance gene (Kan.sup.R) to thereby produce a BL21 (DE3) lacZ strain.

(44) The BL21 (DE3) lacZ was transformed with a txtl-Cis-MLG/pCDF-Term plasmid pair to produce a ProQC-MLG strain, and was transformed with a txtl-Trans-MLG/pCDF-Trigger plasmid pair to produce a ProNC-MLG strain.

(45) The ProQC-MLG and ProNC-MLG strains were incubated overnight in a LB (Lysogeny broth) medium containing Spec and Cam antibiotics, diluted to OD.sub.600 of 0.05, followed by induction with 0.2 mM IPTG when OD.sub.600 reached 0.8, to express a recombination protein. After 4 hours, the sfGFP and mCherry fluorescence of the cells was measured, divided by a unit fluorescence, and converted into the amounts of amino and carboxyl terminal of the MLG fusion protein in the cells, and then the values were normalized to the amounts of mCherry in respective systems. As can be seen from a) of FIG. 7, the proportion of the full-length protein including the carboxyl terminal (sfGFP) in the ProQC gene expression cassette was much higher than that of the natural gene expression cassette.

(46) In addition, in order to determine the productivity of the fusion protein of the unit cells in ProQC-MLG and ProNC-MLG, the expression level of the full-length protein including the carboxyl terminal (sfGFP) was detected. As shown in b) of FIG. 7, the result shows that, when the expression level of ProNC-MLG was normalized to 1, the amount of full-length MLG fusion protein in each cell, when the ProQC gene expression cassette was applied, was also 1.7 times higher than that of ProNC-MLG.

(47) Next, in order to determine the length distribution of the MLG fusion protein produced in the actual cell, the MLG fusion protein expressed from each of the ProQC-MLG and ProNC-MLG strains was purified using the 6 histidine tag at the amino terminal through a Ni-NTA method. When the amino-terminal tag is used, peptides synthesized from the corresponding expression cassette can be recovered without distinction therebetween. At this time, peptides that are terminated prematurely or that have not been translated to the stop codon due to mRNA degradation are also purified. As a control group for comparison with the experimental group, the txtl-Cis-MLF CH plasmid was transformed into BL21 (DE3) lacz, and then the MLG fusion protein, which had been completely translated to the end, was purified using a histidine tag at the carboxyl terminal, which was marked as Full length.

(48) For distinction on the SDS-PAGE gel, the concentration of the protein purified from ProQC and ProNC was measured through a Bradford assay, and the same amount of the protein was injected into one cell. As can be seen from FIG. 8, the result of SDS-PAGE showed that the protein purified from ProQC had a higher amount of full-length proteins and a lower amount of shortened proteins than the protein purified from ProNC, which was clearly distinguished from Full-length.

(49) Meanwhile, the sequences, strains, plasmids and primer sequences used in Examples and Experimental Examples are shown in Tables 1 to 3 below.

(50) TABLE-US-00001 TABLE 1 Used strains and plasmids Related characteristics Source Strain name Mach-T1.sup.R E. coliF- 80(lacZ)M15 lacX74 hsdR(rK- Invitrogen mK+)recA1398 endA1 tonA BL21(DE3) E. colistr. B F- ompT gal dcm lon hsdSB(rB-mB-) Prior (DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5])[malB+]K- research 12(S) BL21(DE3)lacZ BL21(DE3)lacZ Present invention BL21(DE3)-NC BL21(DE3)/pACYC_Duet/pCDF-Term Present invention ProQC-sfGFP BL21(DE3)/txtl-Cis-sfGFP/pCDF-Term Present invention ProNC-sfGFP BL21(DE3)/txtl-Trans-sfGFP/pCDF-Trigger Present invention ProIntra BL21(DE3)/txtl-Cis-sfGFP/pCDF-txtl-Trans-mCherry Present invention Unit-sfGFP BL21(DE3)/txtl-Trans-sfGFP_NH/pCDF-Trigger Present invention Unit-mCherry BL21(DE3)/txtl-Trans-mCherry_NH/pCDF-Trigger Present invention BL21(DE3)lacZ-NC BL21(DE3)lacZ/pACYC_Duet/pCDF-Term Present invention ProQC-MLG BL21(DE3)lacZ/txtl-Cis-MLG_NH/pCDF-Term Present invention ProNC-MLG BL21(DE3)lacZ/txtl-Trans-MLG_NH/pCDF-Trigger Present invention Plasmid name pACYC_Duet Expression vector, Cm.sup.R, p15A.sub.ori Novagen pACYC* pACYC_DuetNheI/P.sub.T7-BsaI-NheI-T.sub.T7 Present invention pCDF_Duet Expression vector, Sm.sup.R, cloDF13.sub.ori Novagen pBR322-J23100-sfGFP pBR322/BBaJ23100-UTR-sfGFP Prior research pET28a-mCherry pET28a-BBaJ23100-UTR-mCherry Prior research pMD19 TA cloning vector TaKaRa txtl-Cis-sfGFP pACYC*/P.sub.T7-Switch#3-sfGFP-Trigger-T.sub.T7 Present invention txtl-Trans-sfGFP pACYC*/P.sub.T7-Switch#3-sfGFP-T.sub.T7 Present invention pCDF-Term pCDF_Duet/P.sub.T7-BsaI-NheI-T.sub.T7 Present invention pCDF-Trigger pCDF_Duet/P.sub.T7-Trigger-T.sub.T7 Present invention pCDF-txtl-Trans-mCherry pCDF_Duet/P.sub.T7-Switch#3-mCherry.sup.Trc-T.sub.T7 Present invention txtl-Trans-sfGFP_CH pACYC*/P.sub.T7-Switch#3-sfGFP_6XHis-T.sub.T7 Present invention txtl-Trans-mCherry_CH pACYC*/P.sub.T7-Switch#3-mCherry.sup.Trc_6XHis-T.sub.T7 Present invention pMD19-MLG pMD19/P.sub.T7-Switch#3-mCherry.sup.Trc_lacZ_sfGFP-Trigger-T.sub.T7 Present invention txtl-Cis-MLG_NH pACYC*/P.sub.T7-Switch#3-6XHis_mCherry.sup.Trc_lacZ_sfGFP-Trigger-T.sub.T7 Present invention txtl-Trans-MLG_NH pACYC*/P.sub.T7-Switch#3-6XHis_MLG-T.sub.T7 Present invention txtl-Cis-MLG_CH pACYC*/P.sub.T7-Switch#3-MLG_6XHis-Trigger-T.sub.T7 Present invention txtl-Trans-MLG_CH pACYC*/P.sub.T7-Switch#3-MLG_6XHis-T.sub.T7 Present invention pKD46 Red recombinase expression vector, Amp.sup.R Prior research pFRT72 pGEM-FRT-Kan-FRT variant Prior research pCP20 FLP recombinase expression vecotor, Amp.sup.R, Cm.sup.R Prior research

(51) TABLE-US-00002 TABLE2 Primersequenceused Primername Sequence EcoNI-PT7- ACTCCTGCATTAGGAAATTAATACGACTCACTATAggagaccCG NheI-TT7-F CAGCGcTAGCATAACCCCTTGGGGC(SEQIDNO:8) SpeI- ACCACTAGTGCTGATGTCCGGCG(SEQIDNO:9) pACYC-R BsaI-Swit- cccGGTCTCCTATAGGGATCTATTACTACTTACCATTGTCTTGC sfGFP-F2 TCTATacagaaacagaggagatATAGAatgAGACAATGGAACCTGGCG GCAGCGCAAAAG(SEQIDNO:10) Swit-sfGFP- AGGAGATATAGAATGAGACAATGGAACCTGGCGGCAGCGCA F1 AAAGGCTAGCAAGGGCGAGGAGC(SEQIDNO:11) SpeI-SacI- GGGACATCGGAATGTCCCATCAGACTAGTCAATACGATTACT sfGFP-R TTCTGTGAGCTCACTTGTACAGCTCGTCCATGC(SEQIDNO:12) BsaI-Titg-R2 TATggtctctCTAgCTTATCTATTACTACTTACCATTGTCTTGCTCT TATTGATGGGACATCGGAATGTCCCATC(SEQIDNO:13) BsaI- cccGGTCTCCTATAGGGTGATGGGACATTCCGATGTCC(SEQID Trigger#3-F NO:14) BsaI-Trc- ACAGGTCTCTCTAGCGCTATCATTAAAGAGTTCATGCG(SEQ mcherry-F IDNO:15) SpeI- CAGACTAGTCAATACGATTACTTTCTGTGAGCTCATTTGTACA mCherry-R GCTCATCCATGC(SEQIDNO:16) Duet-F CGGGATCTCGACGCTCTCC(SEQIDNO:17) His-G-R TGTACTAGTGAGCTCATTAGTGATGGTGATGGTGATGCTTGT ACAGCTCGTCCATGCCGAG(SEQIDNO:18) His-M-R TGTACTAGTGAGCTCATTAGTGATGGTGATGGTGATGTTTGT ACAGCTCATCCATG(SEQIDNO:19) lacZ-Del-F1 GCCGTTCGACGATTCTCCATATGGGAGTACTCGCGGTTGACT GAG(SEQIDNO:20) lacZ-Del-R1 CTAGCAAGAATCATATGGAGAGCGAGTGCTGGAGCGAACTG CGAAG(SEQIDNO:21) lacZ-Del-F2 GCAGACATGGCCTGCCCGGTTATTATTATTTTTGACACCAGA GCCGTTCGACGATTCTCCATATG(SEQIDNO:22) lacZ-Del-R2 GGCTCGTATGTTGTGTGAAATTGTGAGCGGATAACAATTTCA CACACTAGCAAGAATCATATGGAGAGCG(SEQIDNO:23) lacZ-check-F TCACTTTTGCTGATATGGTTGATGTC(SEQIDNO:24) lacZ-check-R CGACTGGAAAGCGGGCAGTGAG(SEQIDNO:25) KpnI-Lnk-M-R ACGGTCTCCATGGTACCAGCACTACCAGCAC(SEQIDNO:26) Lnk-M-R CTTGCTAGCACCAGCACTACCAGCACTACCAGCACTATCTTT GTACAGCTCATCCATG(SEQIDNO:27) KpnI-lacZ-F AGTGGTCTCACCATGATTACGGATTCACTG(SEQIDNO:28) BsaI-lacZ-R ACCGGTCTCTGAATCTTTTTGACACCAGACCAAC(SEQIDNO:29) BsaI-Lnk- AGCGGTCTCGATTCAGCAGGCTCAGCAGGCTCAGCAGGCGCT sfGFP-F AGCAAGGGCGAGG(SEQIDNO:30) SpeI-sfGFP-R CAGACTAGTCAATACGATTACTTTCTGTGAGCTC(SEQIDNO:31) BsaI-Swit#3-R ATTGGTCTCTCTAGCCTTTTGCGCTGCCGCCAGG(SEQIDNO:32) SpeI-Trig-F TGACTAGTCTGATGGGACATTCCGATGTCCCATCAATAAGAG CAAGACAATGGTAAGTAG(SEQIDNO:33) BsaI-his-M-F AAGGGTCTCACTAGCCATCACCATCACCATCACGCTATCATT AAAGAGTTCATGCG(SEQIDNO:34)

(52) TABLE-US-00003 TABLE 3 Toehold switch and gene sequences Remarks Toehold switch switch#3 (DNA Sequence) SEQ ID NO: 1 switch#3 (DNA Sequence) SEQ ID NO: 2 Trigger#3 (DNA Sequence) SEQ ID NO: 3 Trigger#3 (DNA Sequence) SEQ ID NO: 4 Gene mCherry.sup.Trc SEQ ID NO: 5 sfGFP SEQ ID NO: 6 mcherry_lacZ_sfGFP SEQ ID NO: 7