CRY2 variant having increased photosensitivity and use thereof

12139519 ยท 2024-11-12

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a CRY2 variant in which E279 and/or E281 having a negative charge in a N.sub.277SEGE.sub.281 sequence of SEQ ID NO: 1 is substituted with any one selected from the neutral amino acid group of alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), methionine (M) and tryptophan (W), or in which S278 or G280 of a N.sub.277SEGE.sub.281 sequence of SEQ ID NO: 1 is substituted with any one selected from the bulky amino acid group of tryptophan (W) and phenylalanine (F).

Claims

1. A CRY2 variant in which at least one of E279 and E281 having a negative charge among a N.sub.277SEGE.sub.281 sequence of SEQ ID NO: 1 is substituted with any one selected from the neutral amino acid group of alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), methionine (M), and tryptophan (W), or S278 or G280 in the N.sub.277SEGE.sub.281 sequence of SEQ ID NO: 1 is substituted with any one selected from a bulky amino acid group of tryptophan (W) and phenylalanine (F).

2. The CRY2 variant of claim 1, wherein the E281 is substituted with any one selected from the neutral amino acid group of alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), methionine (M), and tryptophan (W).

3. The CRY2 variant of claim 1, wherein the neutral amino acid group is alanine (A).

4. The CRY2 variant of claim 1, wherein the substitution comprises E281A.

5. The CRY2 variant of claim 1, wherein a sequence consisting of at least 7 to 9 amino acids selected from the group of arginine (R), aspartic acid (D), proline (P), asparagine (N), alanine (A), and leucine (L) at the carboxy terminal of SEQ ID NO: 1 is inserted.

6. The CRY2 variant of claim 5, wherein the inserted sequence consists of a peptide of SEQ ID NO: 2 to SEQ ID NO: 16.

7. The CRY2 variant of claim 6, wherein E281 is substituted with any one selected from a neutral (or hydrophobic) amino acid group of alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), methionine (M), and tryptophan (W).

8. The CRY2 variant of claim 6, wherein the neutral amino acid group is alanine (A).

9. The CRY2 variant of claim 6, wherein the substitution comprises E281A.

10. The CRY2 variant of claim 6, wherein the substitution is E281A and the inserted sequence is SEQ ID NO: 5 or 6.

11. A gene encoding the variant of claim 1.

12. An expression vector comprising the gene of claim 11.

13. A transfectant transfected with an expression vector of claim 12.

14. A Ca.sup.2+ modulator comprising the CRY2 variant of claim 1 and an STIM1 protein bound to the N-terminus or C-terminus of the CRY2 variant.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a polypeptide (SEQ ID NO: 1) of wild-type Arabidopsis thaliana cryptochrome 2 (CRY2).

(2) FIG. 2 is a model structure showing two adjacent protruding loops of Arabidopsis CRY2 predicted by SWISS-MODEL.

(3) FIG. 3 is a schematic view of a Ca.sup.2+ modulator (CRY2 variant-STIM1) and a schematic view showing an on/off mechanism of a CRAC (Ca.sup.2+ Release Activated Ca.sup.2+) channel by light.

(4) FIG. 4 is a graph showing a correlation between light stimulation [Ca.sup.2+].sub.i (x-axis, dark state) and [Ca.sup.2+].sub.i (y-axis, light stimulation) measured using Fura-2 in a Ca.sup.2+ modulator including a CRY2 variant.

(5) FIG. 5 is a plot showing a correlation between the half-maximal time point (x-axis) for reaching saturated R-GECO1 levels upon light stimulation and basal R-GECO1 levels in the dark (y-axis) for each indicated strain (n100 for each strain).

(6) FIG. 6 is a graph showing the maximum R-GECO1 fluorescence intensity based on various light densities (1 to 50 W mm.sup.2).

(7) FIG. 7 is a heat plot showing the degree of responsive cell population upon light stimulation at each indicated light density.

(8) FIG. 8 is a graph showing the efficiency of Ca.sup.2+ introduction induced upon stimulation with different light densities.

(9) FIG. 9 is a graph showing the average maximum R-GECO1 fluorescence level at various light densities.

(10) FIG. 10 shows a custom transcranial illumination system.

(11) FIG. 11 is a schematic view showing the expression and activation of Ca.sup.2+ modulators by non-invasive light stimulation.

(12) FIG. 12 is images showing c-Fos-positive cells.

(13) FIG. 13 is a summary chart showing a quantified population of c-Fos-positive (+) cells expressing the OptoSTIM1 variant. (P<0.0001; Sidak's tests).

(14) FIG. 14 shows images of c-Fos stained cells with or without monSTIM1 activation in two different brain regions.

(15) FIG. 15 is a graph showing the percentage of c-Fos-positive cells expressing monSTIM1 (P<0.0001; Sidak's tests).

(16) FIG. 16 is a schematic view for explaining the observational fear learning paradigm.

(17) FIG. 17 is summary data showing the average time of freezing.

(18) FIG. 18 is a graph showing the percentage of freezing time during a 24-hour memory test (P value is determined by Tukey's test).

MODE FOR INVENTION

(19) Hereinafter, the embodiments will be described in detail so that those skilled in the art can easily perform the embodiments. The embodiments may be implemented in various different forms, and the present disclosure is not limited only to the specific embodiments described herein.

(20) Unless the definition of some terms used in the present disclosure is defined otherwise below, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

(21) The techniques and processes described in this disclosure are generally performed according to conventional methods, which are presented throughout this application. In general, nomenclatures and experimental procedures in molecular biology, biochemistry, analytical chemistry, and cell culture used in this disclosure are well known in the art and are the same as those commonly used.

(22) Variant

(23) The present disclosure provides a CRY2 polypeptide that is thermally stabilized by site-specific mutagenesis. In the present disclosure, a mutation is produced by site-specific mutagenesis after rationally predicting the most optimal amino acid at a new position that is not known previously through a bioinformation analysis and protein design using a computer.

(24) FIG. 1 shows a polypeptide (SEQ ID NO: 1) of wild-type Arabidopsis thaliana cryptochrome 2 (CRY2).

(25) In the present disclosure, the term wild-type refers to native CRY2 having the most common amino acid sequence among members of the species. In the present disclosure, wild-type CRY2 is a polypeptide having a length of 498 amino acids (SEQ ID NO: 1, FIG. 1).

(26) In the present disclosure, fragment refers to a functional fragment of a CRY2 polypeptide having CRY2 activity. In addition, it refers to a functional fragment of a CRY2 polypeptide having 85% or more sequence identity with the sequence of SEQ ID NO: 1. The fragment of the CRY2 polypeptide may also have at least one or more substitutions according to the invention. Sequence identity of at least 96%, 97%, 98%, 99%, or 100% is preferred. The fragment is intended as a polypeptide consisting only of a part of the intact polypeptide sequence and structure, and may include C-terminal or N-terminal deletion of the variant. The functional fragment may have a cell binding region and a heparin binding segment of the CRY2 protein of interest according to the present invention.

(27) In the present disclosure, sequence identity means that the same amino acid residues are found in the CRY2 polypeptide according to the present invention as described above. When the specified contiguous segments of the amino acid sequence of the CRY2 polypeptide are aligned and compared with the specific amino acid sequence corresponding to the reference molecule, the wild-type Arabidopsis thaliana CRY2 polypeptide is used as a reference. The percentage (%) of sequence identity is calculated by measuring the number of positions in which the same amino acid residue exists in both sequences, dividing this by the total number of positions in the segment compared with the reference molecule, and multiplying this by 100 to calculate the percentage (%) of sequence identity. Sequence alignment methods are well known in the art. The reference sequence as used herein refers to the specifically corresponding wild-type Arabidopsis CRY2 protein according to the invention. It is desirable that the sequence identity is at least 96%, 97%, 98%, or 99% or more, or 100%. A person of an ordinary skill in the art may appreciate that the remaining 15% or less of the amino acids in the full length of the CRY2 protein according to the present invention may be variable, for example, using other sources of CRY2 species or due to suitable non-CRY2 peptide sequences generally known in the art or an addition of a tag.

(28) The present inventors have confirmed that the protruding loop that contributes to the dimer interface of CRY2 in the wild-type Arabidopsis thaliana is closely related to the photosensitivity of CRY2. In particular, it has been confirmed that the N.sub.277SEGE.sub.281 sequence consisting of five amino acids in close contact between two dimerized overhanging loops plays an important role. In particular, it has been confirmed that reducing the interaction of these five amino acids may reduce the photodependence of dimerization (or homo-association).

(29) In particular, it has been confirmed that in order to reduce potential electrostatic interactions in these sequences, photosensitivity may be increased by substituting glutamic acid (E279 or E281) having a negative charge with any one selected from the neutral (or hydrophobic) amino acid group of alanine (A), isoleucine (I), leucine (L), valine (V), phenylalanine (F), methionine (M), and tryptophan (W).

(30) In addition, it has been confirmed that the photosensitivity may be increased by substituting S278 or G280 in N.sub.277SEGE.sub.281 with any one selected from the bulky amino acid group of tryptophan (W) and phenylalanine (F).

(31) Accordingly, a possible variant in the present disclosure may be any one of various variants disclosed in Table 1.

(32) TABLE-US-00001 TABLE 1 Number of mutations Type of mutation 1 position mutation E279A, E279I, E279L, E279V, E279F, E279M, E281A, E281I, E281L, E281V, E281F, E281M, S278W, S278F, G280W, G280F 2 position mutations (E279A, E281A) (E279A, E281I) (E279A, E281L) (E279A, E281V) (E279A, E281F) (E279A, E281M) (E279A, S278W) (E279A, S278F) (E279A, G280W) (E279A, G280F) (E279I, E281A) (E279I, E281I) (E279I, E281L) (E279I, E281V) (E279I, E281F) (E279I, E281M) (E279I, S278W) (E279I, S278F) (E279I, G280W) (E279I, G280F) (E279L, E281A) (E279L, E281I) (E279L, E281L) (E279L, E281V) (E279L, E281F) (E279L, E281M) (E279L, S278W) (E279L, S278F) (E279L, G280W) (E279L, G280F) (E279V, E281A) (E279V, E281I) (E279V, E281L) (E279V, E281V) (E279V, E281F) (E279V, E281M) (E279V, S278W) (E279V, S278F) (E279V, G280W) (E279V, G280F) (E279F, E281A) (E279F, E281I) (E279F, E281L) (E279F, E281V) (E279F, E281F) (E279F, E281M) (E279F, S278W) (E279F, S278F) (E279F, G280W) (E279F, G280F) (E279M, E281A) (E279M, E281I) (E279M, E281L) (E279M, E281V) (E279M, E281F) (E279M, E281M) (E279M, S278W) (E279M, S278F) (E279M, G280W) (E279M, G280F) (E281A, S278W) (E281A, S278F) (E281A, G280W) (E281A, G280F) (E281I, S278W) (E281I, S278F) (E281I, G280W) (E281I, G280F) (E281L, S278W) (E281L, S278F) (E281L, G280W) (E281L, G280F) (E281V, S278W) (E281V, S278F) (E281V, G280W) (E281V, G280F) (E281F, S278W) (E281F, S278F) (E281F, G280W) (E281F, G280F) (E281M, S278W) (E281M, S278F) (E281M, G280W) (E281M, G280F) (278W, 280W) (278W, 280F) (278F, 280W) (278F, 280F) 3 position mutations (E279A, E281A, 278W) (E279A, E281A, 278F)(E279A, E281A, 280W) (E279A, E281A, 280F) (E279A, E281I, 278W) (E279A, E281I, 278F)(E279A, E281I, 280W) (E279A, E281I, 280F) (E279A, E281L, 278W) (E279A, E281L, 278F)(E279A, E281L, 280W) (E279A, E281L, 280F) (E279A, E281V, 278W) (E279A, E281V, 278F)(E279A, E281V, 280W) (E279A, E281V, 280F) (E279A, E281F, 278W) (E279A, E281F, 278F)(E279A, E281F, 280W) (E279A, E281F, 280F), (E279A, E281M, 278W) (E279A, E281M, 278F)(E279A, E281M, 280W) (E279A, E281M, 280F) (E279I, E281A, 278W) (E279I, E281A, 278F)(E279I, E281A, 280W) (E279I, E281A, 280F) (E279I, E281I, 278W) (E279I, E281I, 278F)(E279I, E281I, 280W) (E279I, E281I, 280F) (E279I, E281L, 278W) (E279I, E281L, 278F)(E279I, E281L, 280W) (E279I, E281L, 280F) (E279I, E281V, 278W) (E279I, E281V, 278F)(E279I, E281V, 280W) (E279I, E281V, 280F) (E279I, E281F, 278W) (E279I, E281F, 278F)(E279I, E281F, 280W) (E279I, E281F, 280F), (E279I, E281M, 278W) (E279I, E281M, 278F)(E279I, E281M, 280W) (E279I, E281M, 280F) (E279L, E281A, 278W) (E279L, E281A, 278F)(E279L, E281A, 280W) (E279L, E281A, 280F) (E279L, E281I, 278W) (E279L, E281I, 278F)(E279L, E281I, 280W) (E279L, E281I, 280F) (E279L, E281L, 278W) (E279L, E281L, 278F)(E279L, E281L, 280W) (E279L, E281L, 280F) (E279L, E281V, 278W) (E279L, E281V, 278F)(E279L, E281V, 280W) (E279L, E281V, 280F) (E279L, E281F, 278W) (E279L, E281F, 278F)(E279L, E281F, 280W) (E279L, E281F, 280F), (E279L, E281M, 278W) (E279L, E281M, 278F)(E279L, E281M, 280W) (E279L, E281M, 280F) (E279L, E281A, 278W) (E279L, E281A, 278F)(E279L, E281A, 280W) (E279V, E281A, 280F) (E279V, E281I, 278W) (E279V, E281I, 278F)(E279V, E281I, 280W) (E279V, E281I, 280F) (E279V, E281L, 278W) (E279V, E281L, 278F)(E279V, E281L, 280W) (E279V, E281L, 280F) (E279V, E281V, 278W) (E279V, E281V, 278F)(E279V, E281V, 280W) (E279V, E281V, 280F) (E279V, E281F, 278W) (E279V, E281F, 278F)(E279V, E281F, 280W) (E279V, E281F, 280F), (E279V, E281M, 278W) (E279V, E281M, 278F) (E279V, E281M, 280W) (E279V, E281M, 280F) (E279F, E281A, 280F) (E279F, E281I, 278W) (E279F, E281I, 278F)(E279F, E281I, 280W) (E279F, E281I, 280F) (E279F, E281L, 278W) (E279F, E281L, 278F)(E279F, E281L, 280W) (E279F, E281L, 280F) (E279F, E281V, 278W) (E279F, E281V, 278F)(E279F, E281V, 280W) (E279F, E281V, 280F) (E279F, E281F, 278W) (E279F, E281F, 278F)(E279F, E281F, 280W) (E279F, E281F, 280F), (E279F, E281M, 278W) (E279F, E281M, 278F) (E279F, E281M, 280W) (E279F, E281M, 280F) (E279M, E281A, 280F) (E279M, E281I, 278W) (E279M, E281I, 278F)(E279M, E281I, 280W) (E279M, E281I, 280F) (E279M, E281L, 278W) (E27M, E281L, 278F)(E279M, E281L, 280W) (E279M, E281L, 280F) (E279M, E281V, 278W) (E279M, E281V, 278F)(E279M, E281V, 280W) (E279M, E281V, 280F) (E279M, E281F, 278W) (E279M, E281F, 278F)(E279M, E281F, 280W) (E279M, E281F, 280F), (E279M, E281M, 278W) (E279M, E281M, 278F) (E279M, E281M, 280W) (E279M, E281M, 280F)(E279A, S278W, G280W) (E279A, S278F, G280W) (E279A, S278W, G280F) (E279A, S278F, G280F) (E279I, S278W, G280W) (E279I, S278F, G280W) (E279I, S278W, G280F) (E279I, S278F, G280F) (E279L, S278W, G280W) (E279L, S278F, G280W) (E279L, S278W, G280F) (E279L, S278F, G280F) (E279V, S278W, G280W) (E279V, S278F, G280W) (E279V, S278W, G280F) (E279V, S278F, G280F) (E279F, S278W, G280W) (E279F, S278F, G280W) (E279F, S278W, G280F) (E279F, S278F, G280F) (E279M, S278W, G280W) (E279M, S278F, G280W) (E279M, S278W, G280F) (E279M, S278F, G280F) (E281A, S278W, G280W) (E281A, S278F, G280W) (E281A, S278W, G280F) (E281A, S278F, G280F) (E281I, S278W, G280W) (E281I, S278F, G280W) (E281I, S278W, G280F) (E281I, S278F, G280F) (E281L, S278W, G280W) (E281L, S278F, G280W) (E281L, S278W, G280F) (E281L, S278F, G280F) (E281V, S278W, G280W) (E281V, S278F, G280W) (E281V, S278W, G280F) (E281V, S278F, G280F) (E281F, S278W, G280W) (E281F, S278F, G280W) (E281F, S278W, G280F) (E281F, S278F, G280F) (E281M, S278W, G280W) (E281M, S278F, G280W) (E281M, S278W, G280F) (E281M, S278F, G280F) 4 position mutations (E279A, E281A, S278W, G280W) (E279A, E281I, S278W, G280W) (E279A, E281L, S278W, G280W) (E279A, E281V, S278W, G280W) (E279A, E281F, S278W, G280W) (E279A, E281M, S278W, G280W) (E279I, E281A, S278W, G280W) (E279I, E281I, S278W, G280W) (E279I, E281L, S278W, G280W) (E279I, E281V, S278W, G280W) (E279I, E281F, S278W, G280W) (E279I, E281M, S278W, G280W) (E279L, E281A, S278W, G280W) (E279L, E281I, S278W, G280W) (E279L, E281L, S278W, G280W) (E279L, E281V, S278W, G280W) (E279L, E281F, S278W, G280W) (E279L, E281M, S278W, G280W) (E279V, E281A, S278W, G280W) (E279V, E281I, S278W, G280W) (E279V, E281L, S278W, G280W) (E279V, E281V, S278W, G280W) (E279V, E281F, S278W, G280W) (E279V, E281M, S278W, G280W) (E279F, E281A, S278W, G280W) (E279F, E281I, S278W, G280W) (E279F, E281L, S278W, G280W) (E279F, E281V, S278W, G280W) (E279F, E281F, S278W, G280W) (E279F, E281M, S278W, G280W) (E279M, E281A, S278W, G280W) (E279M, E281I, S278W, G280W) (E279M, E281L, S278W, G280W) (E279M, E281V, S278W, G280W) (E279M, E281F, S278W, G280W) (E279M, E281M, S278W, G280W)

(33) Among the various mutations mentioned in Table 1, the mutation in which E281 is substituted with any one selected from a neutral (or hydrophobic) amino acid group of alanine (A), isoleucine (1), leucine (L), valine (V), phenylalanine (F), methionine (M), and tryptophan (W) is most effective in enhancing the photosensitivity, which is proven by the fact that E281 is structurally and most closely positioned in the two adjacent protruding loop structures (structure predicted by SWISS-MODEL) of Arabidopsis CRY2 shown in FIG. 2.

(34) Meanwhile, when an insertion sequence consisting of at least 7 to 9 amino acids (CRY2clust) selected from the group of arginine (R), aspartic acid (D), proline (P), asparagine (N), alanine (A), and leucine (L) at the carboxy terminal of SEQ ID NO: 1 illustrated in FIG. 1 is additionally inserted, the photosensitivity may be increased more synergistically.

(35) The specific insertion sequence (CRY2clust) may be SEQ ID NOs: 2 to 16 in Table 2.

(36) The effects of these insertion sequences (CRY2clust) are disclosed in KR2019-0000080 which is the prior application of the present inventor, and the contents are incorporated herein.

(37) TABLE-US-00002 TABLE2 SEQIDNO: Sequence 9aminoacidinsertion 2 ARDPPDLDN (A9) 3 ARDPPDIDN 4 ARDPPDADN 5 ARDPPDKDN 6 ARDPPDDDN 8aminoacidinsertion 7 ARDPDLDN (A8) 8 ARDPDIDN 9 ARDPDADN 10 ARDPDKDN 11 ARDPDDDN 7aminoacidinsertion 12 ARDPPDL (A7) 13 ARDPPDI 14 ARDPPDA 15 ARDPPDK 16 ARDPPDD
Ca.sup.2+ Modulator

(38) FIG. 3 is a schematic view of the Ca.sup.2+ modulator and the on/off mechanism of the CRAC (Ca2 Release Activated Ca.sup.2+) channel by light.

(39) A Ca.sup.2+ modulator (hereinafter, OptoSTIM1) may be constructed by fusing a protein of a STIM1 (Stromal Interaction Molecule 1) protein that may control the on/off of a CRAC (Ca.sup.2+ Release Activated Ca.sup.2+) channel and a CRY2 variant according to the embodiment. EGFP is a protein fused to fluorescently confirm the operation of the Ca2 modulator.

(40) When CRY2 is dimerized by light (hv), STIM1 is also homo-associated, and the homo-associated STIM1 turns on the CRAC channel and causes a flux of Ca.sup.2+ ions into the cell.

(41) The reaction by light is reversible, and when the light is removed, CRY2 is separated into monomers, and finally STIM1 is also separated into monomers, and CRAC is closed.

(42) Since the CRY2 variant according to the embodiments constituting the Ca.sup.2+ modulator according to the embodiments may dimerize only with low light irradiation, it is possible to operate even when light is irradiated to cells in a non-invasive manner. In particular, the Ca.sup.2+ modulator including the CRY2.sup.E281A-A9 variant with the best photosensitivity is called monSTIM1.

(43) The specific mechanism and sequence of STIM1 are described in papers (Soboloff, J. et al. Nat Rev Mol Cell Biol 13, 549-565 (2012).

(44) Hereinafter, preferred experimental examples are presented to aid the understanding of the present invention, but the following experimental examples are only illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

(45) Experiment Method

(46) Plasmid Construction

(47) In these experimental examples, OptoSTIM1 encompasses the photolyase homology region (PHR) and STIM1 (amino acids 238-668) at the C-terminus of CRY2 (amino acids 1-498), and mutagenesis was induced through PCR (Polymerase Chain Reaction) using mutagenesis oligonucleotides in forward and reverse directions corresponding to each and two flanking primers. It was mutated through the polymerase chain reaction of CRY2 ( )-driven overlap extension. The flanking primers and mutagenesis oligonucleotides used for mutagenesis of CRY2 are as follows. flanking primer, 5-GTA ACC GGT CAT GAA GAT GGA CAA AAA GAC CAT CGT CTG-3 (forward direction) (SEQ ID NO: 17) and 5-CTC CGC CTC CCC CAC TGA ATT CGG CAG CAC CGA TCA TAA TC-3 (reverse direction) (SEQ ID NO: 18) E279A, 5-AAC AGC GCC GGC GAA GAA AGC GCC GAT CTG TTC CTG-3 (forward direction) (SEQ ID NO: 19) and 5GCT TTC TTC GCC GGC GCT GTT TTT ATC GCG AGC CCA-3(reverse direction) (SEQ ID NO: 20) G280W, 5AAC AGC GAA TGG GAA GAA AGC GCC GAT CTG TTC C-3 (forward direction) (SEQ ID NO: 21) and 5-GCT TTC TTC CCA TTC GCT GTT TTT ATC GCG AGC CCA-3(reverse direction) (SEQ ID NO: 22) E281A, 5-GAA GGC GCC GAA AGC GCC GAT CTG TTC CTG-3 (forward direction SE ID NO: 23 and 5-GCT TTC GGC GCC TTC GCT GTT TTT ATC GCG AG-3 (reverse direction) (SEQ ID NO: 24)

(48) TABLE-US-00003 flankingprimer, (forwarddirection) (SEQIDNO:17) 5-GTAACCGGTCATGAAGATGGACAAAAAGACCAT CGTCTG-3 and (reversedirection) (SEQIDNO:18) 5-CTCCGCCTCCCCCACTGAATTCGGCAGCACCGA TCATAATC-3 E279A, (forwarddirection) (SEQIDNO:19) 5-AACAGCGCCGGCGAAGAAAGCGCCGATCTGTTC CTG-3 and (reversedirection) (SEQIDNO:20) 5GCTTTCTTCGCCGGCGCTGTTTTTATCGCGAGC CCA-3 G280W, (forwarddirection) (SEQIDNO:21) 5AACAGCGAATGGGAAGAAAGCGCCGATCTGTTC C-3 and (reversedirection) (SEQIDNO:22) 5-GCTTTCTTCCCATTCGCTGTTTTTATCGCGAGC CCA-3 E281A, (forwarddirection) (SEQIDNO:23) 5-GAAGGCGCCGAAAGCGCCGATCTGTTCCTG-3 and (reversedirection) (SEQIDNO:24) 5-GCTTTCGGCGCCTTCGCTGTTTTTATCGCGAG-3

(49) The PCR-amplified sequence encoding the CRY2 variant was cloned into the OptoSTIM1 (CRY2) vector at AgeI and EcoRI sites or BspEI and BamHI sites. OptoSTIM1 including oligomer variants CRY2olig (E490G) and CRY2clust (A9) was also constructed in the same way. For construction of OptoSTIM1 having both CRY2 E281A and oligomer variants (E490G or A9), the sequence encoding the CRY2 (E281A) variant was inserted into OptoSTIM1 (CRY2-A9) or OptoSTIM1 (CRY2 E490G) at the AgeI and SacI sites.

(50) Cell Culture and Transfection

(51) HeLa cells and HEK293T (ATCC) were maintained in DEME (Dulbecco's Modified Eagle's Medium, PAA Laboratories GmbH) medium supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37 C. in a humidified 10% CO.sub.2 atmosphere. Cells were transfected using a microporator (Neon Transfection System; Invitrogen) or Lipofectamine LTX (Invitrogen) according to the manufacturer's instructions.

(52) Live-Cell Imaging

(53) The prepared cells were plated on a 96-well polymer cover slip bottom plate (-plate 96 well ibiTreat; ibidi). R-GECO1 fluorescence imaging using blue light illumination for OptoSTIM1 activation is performed using a Nikon A1R confocal microscope (Nikon Instruments) which is mounted on an inverted Eclipse Ti body (Nikon) and mounted with a CFI Plan Apochromat VC objective (60/1.4 numerical aperture (NA)) and digital zoom Nikon imaging software (NIS Element AR 64-bit version 3.21; laboratory imaging). During image processing, cells were maintained at 10% CO.sub.2 and 37 C. by culturing in a Chamlide TC system (Live Cell Instruments, Inc., Korea). Immediately before imaging, the medium was replaced with OPTIMEM (Invitrogen). For blue light photo excitation (power density, 500 W mm.sup.2), a 488 nm laser was delivered at intervals of 5 seconds for 1 minute.

(54) Fura-2 Imaging and Calibration

(55) HeLa cells were incubated with Fura-2 AM (Invitrogen) for 30 minutes at room temperature and loaded, and then dissolved in dimethyl sulfoxide, diluted into 2 M in DMEM, and washed three times for 5 minutes in each step. Fura-2 imaging was performed by intermittent excitation using a 340 nm and 380 nm filtered fluorescent lamp with a LAMBDA DG-4 lamp (Sutter Instrument Company) and a 40/0.75 NA CFI Plan Fluor objective lens. Light emitted through a 510 nm emission filter was collected with a Nikon DS-Qi1 black and white digital camera. Free [Ca.sup.2+] was calculated according to a formula [Ca2+].sub.free=Kd.sub.EGTA(RR.sub.min)/(R.sub.maxR)F380.sub.max/F380.sub.min, where Kd.sub.EGTA Is a dissociation constant of Fura-2, R.sub.min and R.sub.max are ratios at zero free Ca.sup.2+ and saturated Ca.sup.2+, and F380.sub.max and F380.sub.min are respectively fluorescence intensity for zero free Ca.sup.2+ and saturated free Ca.sup.2+ at a wavelength of 380 nm. Kd.sub.EGTA was determined using a Fura-2 Ca.sup.2+ imaging calibration kit (Invitrogen) according to the manufacturer's instructions.

(56) Animal Experiment

(57) Mice were treated and managed according to guidelines of the KAIST Animal Care and Use Committee (Daejeon). In-vivo mouse experiments were performed in 8 to 13 week-old male C56BL/6J mice purchased from Jackson Laboratory. The mice were housed in a cage with free access to food pellets and water and maintained in a 12-hour light/dark cycle (8 am to 8 pm) at 22 C. and 40% humidity. All behavioral experiments were performed at the same time of day during the light phase of the light/dark cycle.

(58) Preparation of Lentivirus

(59) Plasmids for lentiviral vectors including the CaMKII promoter were prepared as described in the plasmid construct description. AgeI and EcoRI sites were used to prepare plasmids for other variants by cloning exchange PCR-amplified CRY2 variants (CRY2.sup.E281A-A9, CRY2.sup.D387A) into pLenti-CaMKII-EGFP-CRY2-STIM1. PacI and BamHI sites were used to prepare plasmids including a GfABC1 D promoter by cloning and exchanging a PCR-amplified GfABC1 D promoter in pLenti-CaMKII-EGFP-CRY2-STIM1. The lentiviral vectors with VSV-G and 8.9 required for lentiviral production were co-transfected into the HEK293T cell line by using a PEI transfection reagent. After 72 hours' transfection, a supernatant was collected therefrom, centrifuged at 2000 rpm for 5 minutes, and then filtered through a 0.45 M filter unit (millipore). For purification of lentivirus, ultracentrifugation (25,000 rpm) was performed at 4 C. for 2 hours. After the ultracentrifugation, the supernatant was removed, and pellets were resuspended in phosphate buffered saline (PBS), aliquoted, and stored at 80 C. The lentivirus was titrated by using a Lenti-X qRT-PCR titration kit (Takara Bio Inc.) according to the manufacturer's instructions. Virus titers were respectively 7.8810.sup.11 and 2.2310.sup.12 genome copies ml.sup.1 for CaMKII promoter-containing OptoSTIM1 and monSTIM1 viruses and 6.8110.sup.11 and 8.4210.sup.11 genome copies ml.sup.1 for GfABC1 D promoter-containing monSTIM1 and OptoSTIM1 (CRY2.sup.D387A).

(60) Stereotactic Injection and in vivo Photomagnetic Light Stimulation Conditions

(61) 8 week-old male C57BL/6J mice were used for stereotactic virus injection. A surgical procedure was performed according to the stereotactic guidelines. Before the surgery, surgical instruments were sterilized at 240 C. in a hot bead sterilizer. All mice maintained at 37 C. using a temperature controller (Live Cell Instrument) were anesthetized with 0.022 ml/g of Avertin and placed in a stereotactic apparatus (Neurostar GmbH, Germany). The following coordinates (for Bregma) were used for optical stimulation: somatosensory cortex (S1): 1.0 mm anteroposterior (AP), 2.2 mm medial (ML) and 1.2 to 0.7 mm dorsal germ (DV); ACC: 1.0 mm AP, 0.3 mm ML and 1.0 mm DV; Dorsal hippocampus (HPC): 2.0 mm AP, 1.3 mm ML and 1.8 mm DV; and Sagittal (TH): 1.0 mm AP, 1.3 mm ML and 3.4 mm DV. The lentivirus was injected at 0.075 l/min by using a 10 l Hamilton microsyringe (Hamilton Avertin Company, USA) and a 33-gauge injection needle (NanoFil Needle Assortment, blunt; World Precision Instruments, USA). After the injection, the needle was kept in place for 10 minutes before withdrawn stepwise (0.2 mm per step, 1 s each). Four weeks after the injection, an optogenetic stimulation experiment was performed using light of 473 nm transmitted by a solid LED excitation system (Live Cell Instrument). A duration of the light illumination for observational fear learning and immunohistochemistry experiments was 30 minutes.

(62) Histological Treatment and Immunohistochemistry

(63) One hour after the light illumination (except for experiments conducted under dark conditions), mice were anesthetized with 0.022 ml/g of Avertin and then perfused transcardially with phosphate buffered saline (PBS), and subsequently, 10 ml of 4% paraformaldehyde in PBS. Brains of the mice were extracted and incubated overnight at 4 C. in 4% PFA. The brains were transferred to PBS, and 60-m coronal slices were prepared therefrom by using Vibratome (Leica Biosystems). For immunostaining, the slices were placed in PBS containing 0.2% Triton X-100 and 5% normal goat serum for 1 hour, and the solution was replaced with a primary antibody diluted in PBS containing 0.1% Triton X-100 and 2% normal goat serum. After incubation at 4 C. overnight, the slices were rinsed 5 times with PBS containing 0.2% Tween 20 (10 minutes each) and incubated with a secondary antibody for 1 hour. Subsequently, tissue sections were washed with PBS containing 0.2% Tween 20, and then mounted on a microscope slide by using a medium mounted with a Vectashield anti-fade containing DAPI (Vector Laboratories). A Nikon A1R confocal microscope (Nikon Instruments) was used to capture a fluorescence image with 10 and 60 objective lenses. All 60 images were acquired as z-stacks by binning a 3 m depth per image plane. Antibodies used in immunohistochemistry are as follows:

(64) A chicken anti-GFP primary antibody (1:2000, Thermo Fisher Scientific Inc.) and an Alexa 488-conjugated anti-chicken secondary body (1:2000, Thermo Fisher Scientific Inc.) variant were used to stain EGFP-CRY2 (variant)-STIM1, and a rabbit polyclonal anti-c-Fos primary antibody (1:1000; Abcam plc) and an Alexa 594-conjugated anti-rabbit secondary antibody (1:2000; Thermo Fisher Scientific Inc.) were used. In order to analyze c-Fos.sup.+ cells, the present inventors measured at least 5 coronal brain sections from each mouse sample to calculate the number of c-Fos.sup.+ cells containing DAPI.sup.+ and enclosed EGFP signals. Statistical significance thereof was evaluated by using Sidak's Multiple Comparison Test.

(65) Fear of Observation

(66) An observational fear-conditioning test was performed in a chamber consisting of two identical chambers (18 cm17.5 cm38 cm) separated in the middle of the two chambers by a transparent Plexiglas glass dispenser. A cage was constructed to have a bottom made of 5 mm stainless steel rods with 1 cm spacing, which is similar to that of a passive feature cage (Coulbourn Instruments, LLC). A space under the rods was allowed to share sounds and smells during the experiment. Before starting the observational fear learning experiment, mice were treated for 10 minutes over 3 days. On the test day, the mice were habituated to a behavioral chamber for 1 hour right before the test. For transcranial light stimulation, observer mice were illuminated with blue light (1 mW cm.sup.2) for 30 minutes, and then transferred from the chamber to another device chamber housing other mice (demonstrator mice). As the demonstrator mice, equally-stained (C57BL/6J) 10 to 12 week-old mice were used. In all experiments, the observer and demonstrator mice were not biologically related and were housed in separate cages. After acclimating the observer and demonstrator mice to a device for 5 minutes, a programmed animal shocker (Coulbourn Instruments LLC.) was used to deliver a 2 second-foot shock (1 mA) to the demonstrator mice alone at 10 second intervals for 4 minutes. On the second day (24 hours after the training), the observer mice were placed in the same chamber used for the observational fear learning to access a context memory test and then observed for 4 minutes. Fear reactions of the mice were video-recorded and quantified. The data were not blindly obtained, but reliability of the results was confirmed by two other blinded investigators. Statistical significance thereof was evaluated by using a Tukey's test.

(67) Open Field Test

(68) Immediately before a test session, all mice were habituated to the laboratory for 30 minutes. The mice were illuminated with blue light (473 nm) for 1 hour at power density of 1 mW cm.sup.2 to activate OptoSTIM1 transcranially, and then sequentially transferred to an open-field box during the 30 minutes' test session. A total distance traveled from the center, a speed, and a time were quantified by using an automatic infrared ray (IR) detection system (Optimousel). Statistical significance thereof was assessed by using a Tukey's multiple comparisons test.

(69) Quantification and Statistical Analysis

(70) Images were captured and analyzed by using laboratory imaging software, NIS-Elements AR 64 bit version 3.21, provided by Nikon Corp. R-GECO1 intensity changes were quantified by using a time-measuring tool. Initial intensity of R-GECO1 was set to 100 and 500 (A.U.), which was previously used. Critical density of light required for activation of an OptoSTIM1 variant was determined based on at least 2 changes of fluorescence intensity of R-GECO1.

(71) A maximum standard deviation of the R-GECO1 intensity in cells expressing the OptoSTIM1 variant within 1 minute of imaging without light stimulation was 0.187973. Accordingly, the maximum standard deviation may be less than a probability of 10.sup.6 of a Type I error in detecting the activation, when at least 2 changes are taken as an activation limit, which corresponds to a detection limit in the previous study, and basal R-GECO1 fluorescence intensity, which is greater than 50, is also taken. Statistical significance was evaluated by a two-tailed Student's t-test.

(72) Experiment Results

(73) Measurement of Ca.sup.2+ Basal Concentration

(74) FIG. 4 is a graph showing a correlation between light stimulation [Ca.sup.2+].sub.i (x-axis, dark state) and [Ca.sup.2+].sub.i (y-axis, light stimulation) measured using Fura-2 in a Ca.sup.2+ modulator including a CRY2 variant.

(75) Referring to the result of FIG. 4, compared with wild-type CRY2 and E297A variant, G280W, E281A, A9 (SEQ ID NO: 2), (E281A, E490G), and (E281A-A9) exhibited a low concentration of basal [Ca.sup.2+].sub.i but a high concentration of maximum [Ca.sup.2+].sub.i due to the light stimulation, and accordingly, the activation of STIM1 by a light-based dimer turned out to work properly.

(76) Measurement of Activation and Deactivation Rate

(77) FIG. 5 is a plot showing the correlation between the half-maximal time point (x-axis) for reaching saturated R-GECO1 levels upon light stimulation and basal R-GECO1 levels in the dark (y-axis) for each indicated strain (n 100 for each strain).

(78) Referring to FIG. 5, E281A produced higher maximum [Ca.sup.2+].sub.i after the stimulation, compared with other variants, but exhibited similar dynamics of activation (Tai/2=62 s) and inactivation (Td.sub.1/2=7 min) to those of original CRY2. E281A-A9 exhibited the longest inactivation time.

(79) Photosensitivity Measurement

(80) FIGS. 6 to 9 are diagrams showing results of measuring photosensitivity.

(81) FIG. 6 is a graph showing the maximum R-GECO1 fluorescence intensity based on various light densities (1 to 50 W mm.sup.2). In FIG. 6, blue light was delivered at 5 second intervals for one minute by using a 488 nm laser (n100 for each strain at each optical density) at each indicated power density.

(82) FIG. 7 is a heat plot showing the degree of responsive cell population upon light stimulation at each indicated light density. FIG. 8 is a graph showing the efficiency of Ca.sup.2+ introduction induced upon stimulation with different light densities. FIG. 9 is a graph showing the average maximum R-GECO1 fluorescence level at various light densities.

(83) Referring to the results of FIGS. 6 to 9, in a N.sub.277SEGE.sub.281 sequence, when E279 or E281 was mutated, the variant effectively reacted even to low light density and remained and thus exhibited higher photosensitivity, compared with wild CRY2. Among them, monSTIM1 (CRY2.sup.E281A-A9) exhibited much higher sensitivity to light in that about 47% of expression cells effectively responded to light intensity of 1 W mm.sup.2 and remained, which is about 55 times higher sensitivity than that of CRY2.

(84) Non-Invasive Light Stimulation

(85) In order to examine whether monSTIM1 may respond to non-invasive light illumination to induce Ca.sup.2+-dependent molecular activation in intact brain neurons, a light illumination cage was designed to have an LED solid state array attached on the cage lid capable of delivering about 1 mW cm.sup.2 of blue light to a mouse's head (FIG. 10). Through video reading, light itself turned out to not cause abnormal behavior or movement of mice in the cage.

(86) Subsequently, as shown in FIG. 11, expression and activation of Ca.sup.2+ modulators were performed by the non-invasive light stimulation. Four weeks after injecting lentivirus packaged with different OptoSTIM1 variants expressed under the control of a CaMKII promoter (exciting neurons) or a GfABC1 D promoter (astrosites) targeting an S1 cortical region, the mice were illuminated with LED light in a home cage and then sacrificed. Subsequently, the exciting neurons in the somatosensory cortex (S1) were transduced into lentiviral constructs of OptoSTIM1 (CRY2), monSTIM1 (CRY2.sup.E281A-A9), or OptoSTIM1 (CRY2.sup.D387A), which are insensitive to light. After 4 weeks, the mice were exposed to blue light for 30 minutes without removing or shaving the skin, and one hour later they were sacrificed, and then evaluated with respect to an expression level of c-Fos, a Ca.sup.2+-dependent immediate initial gene, and the results are shown in FIGS. 12 and 13. Referring to FIGS. 12 and 13, mice expressing monSTIM1 exhibited significant induction of c-Fos expression, compared with the control group, and c-Fos signals were predominantly localized in cells expressing monSTIM1. Subsequently, functionality of monSTIM1 in astrocytes, another major cell type of a brain, was verified. Activation of monSTIM1 expressed under a control of the GfABC1 D promoter efficiently induced expression of c-Fos. Specifically, c-Fos was detected in 74% of the astrocyte population expressing monSTIM1, but in the control group, c-Fos was not noticeably induced.

(87) In order to evaluate suitability of monSTIM1 as a deep brain modulator, c-Fos expression in monSTIM1 expressing astrocytes in hippocampus (HPC) and thalamus (TH) regions was examined. The results are shown in FIGS. 14 and 15. Referring to the results of FIGS. 14 and 15, 57% and 44% of the cell populations respectively expressing monSTIM1 in the HPC and TH regions exhibited c-Fos expression by using the light stimulation, and accordingly, a Ca.sup.2+ introduction and a downstream signal transmission were effectively induced through the non-invasive activation of monSTIM1.

(88) Observation of Behavioral Characteristics

(89) Finally, whether the induction of Ca.sup.2+ signals through the non-invasive light transmission affects specific behaviors in awake mice was examined. In an anterior cingulate cortex (ACC), activity of voltage-dependent L-type Ca.sup.2+ channels (Cav1.2, Cacna1c) was involved in social fear learning (e.g.: observational fear reaction). Mice having ACC-restricted deletion of Cav1.2 genes exhibited reduced observational fear due to impaired synaptic transmission or neuronal excitability

(90) However, a causal relationship between direct activation of the Ca.sup.2+ signals and the observational fear was not tested. Accordingly, the present inventors used monSTIM1 or photo-insensitive OptoSTIM1 (CRY2.sup.D387A) and targeted excitatory pyramidal neurons in ACC to examine socially transmitted fear responses.

(91) FIG. 16 is a schematic view for explaining the observational fear learning paradigm. In these experiments, observer mice alone were illuminated for 30 minutes in a home cage, and both the observer mice and demonstrator mice were moved into observational fear behavior chambers separated by a transparent plexiglass partition. The mice were habituated to a device for 5 minutes, but repetitive foot shocks were applied to demonstrator mice alone at 10 second intervals for 4 minutes in order to induce vicarious freezing responses of feelings and experiences in the observer mice. In particular, the monSTIM1 activated mice showed significantly higher freezing levels during the training period (4 minutes).

(92) After 24 hours, the data results of the observer mice exposed to the same conditioning chamber again are shown in FIGS. 17 and 18. Referring to the results of FIGS. 17 and 18, the observer mice exposed in the same conditioning chamber exhibited increased contextual fear memory compared with the control group mice, and accordingly, the Ca.sup.2+ signals contributed to short-term and long-term social fear responses in ACC. Considering that the activation of monSTIM1 in ACC did not trigger motor skills or fear-like behaviors in the open field test, monSTIM1-mediated Ca.sup.2+ induction in ACC selectively enhanced socially-transmitted fear response in the mice.

(93) From these experiments, a Ca.sup.2+ modulator to which the CRY2 variant was applied exhibited excellent photosensitivity and minimum changes of basal [Ca.sup.2+]. Accordingly, monSTIM1 was sufficiently activated as a non-invasive light delivery system to induce subsequent Ca.sup.2+ signal transmission in neurons and astrocytes in the brain region and thereby enabled regulation of specific brain functions and corresponding animal behaviors.

(94) Although the experimental example has been described above, the scope of the invention is not limited thereto. The embodiments may be implemented in various ways within the scope of the detailed description of the invention and the accompanying drawings, and this also belongs to the scope of the invention.

INDUSTRIAL APPLICABILITY

(95) It may be used in the field of non-invasive optogenetics technology for controlling cellular functions in vivo.