Recombinant lentiviral vector for stem cell- based gene therapy of sickle cell disorder
12139720 · 2024-11-12
Assignee
- Institut National De La Sante Et De La Recherche Medicale (Inserm) (Paris, FR)
- Universite Paris Descartes (Paris, FR)
- ASSISTANCE PUBLIQUE-HOPITAUX DE PARIS (Paris, FR)
- IMAGINE—INSTITUT DES MALADIES GENETIQUES NECKER ENFANTS MALADES (Paris, FR)
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
C12N5/0607
CHEMISTRY; METALLURGY
C12N2830/48
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
This invention relates to recombinant lentiviral vectors, compositions thereof, the use of the vectors or the compositions thereof, kits of parts comprising said vectors or compositions thereof and a catalytically active Cas9 or Cpf1 protein, methods for modifying the genome of a hematopoietic stem/progenitor cell (HSPC), and the HSPC obtainable by such methods.
Claims
1. A recombinant lentiviral vector comprising in its genome: (i) a nucleotide sequence encoding a protein that has a therapeutic effect, said protein being selected from the group consisting of delta-globin and gamma globin; and (ii) a nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence being: a. within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene being selected from beta-globin gene and BCL11A gene, or b. within the promoter region of a target gene, wherein said target gene is a gamma-globin gene when the nucleotide sequence (i) encoding the protein that has the therapeutic effect is delta-globin.
2. The recombinant lentiviral vector according to claim 1, wherein the protein that has a therapeutic effect is selected from the group consisting of human delta-globin and human gamma-globin.
3. A recombinant lentiviral vector comprising in its genome: (i) a nucleotide sequence encoding a protein that has a therapeutic effect, said protein being human beta AS3 globin; and (ii) a nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence being: a. within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene being BCL11A gene, or b. within the promoter region of a target gene, said target gene being gamma-globin gene.
4. The recombinant lentiviral vector according to claim 1, wherein the beta-globin gene, gamma-globin gene or BCL11A gene is human.
5. A composition comprising the recombinant lentiviral vector according to claim 1 or a plurality of said recombinant lentiviral vectors.
6. A kit comprising: the recombinant lentiviral vector according to claim 1; and a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein.
7. The recombinant lentiviral vector according to claim 1 for introducing into a hematopoietic stem/progenitor cell (HSPC) (i) the nucleotide sequence encoding a protein that has a therapeutic effect, said protein being selected from the group consisting of delta-globin and gamma globin, and (ii) the nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence is: a. within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene is selected from beta-globin gene and BCL11A gene, or b. within the promoter region of a target gene, wherein said target gene is a gamma-globin gene when the nucleotide sequence (i) encoding the protein that has the therapeutic effect is delta-globin.
8. A method for modifying the genome of a hematopoietic stem/progenitor cell (HSPC), in vitro or ex vivo, comprising the steps of: a) contacting a HSPC with a recombinant lentiviral vector of claim 1 to obtain a transduced HSPC, wherein the lentiviral vector is integrated into the genome of said HSPC; and b) introducing into the transduced HSPC a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein, said catalytically active Cas9 or Cpf1 protein disrupts the expression and/or the function of the target gene when introduced or expressed into the transduced HSPC.
9. A method for preparing a genetically modified hematopoietic stem/progenitor cell (HSPC), in vitro or ex vivo, comprising the steps of: a) contacting a HSPC with a recombinant lentiviral vector of claim 1 to obtain a transduced HSPC, wherein the lentiviral vector is integrated into the genome of said HSPC; and b) introducing into the transduced HSPC a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein, said catalytically active Cas9 or Cpf1 protein disrupts the expression and/or the function of the target gene when introduced or expressed into the transduced HSPC.
10. A kit comprising: a composition according to claim 5; and a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein.
11. The composition according to claim 5 for introducing into a hematopoietic stem/progenitor cell (HSPC) (i) the nucleotide sequence encoding a protein that has a therapeutic effect, said protein being selected from the group consisting of delta-globin and gamma globin, and (ii) the nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence is: a. within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene being selected from beta-globin gene and BCL11A gene, or b. within the promoter region of a target gene, wherein said target gene is a gamma-globin gene when the nucleotide sequence (i) encoding the protein that has the therapeutic effect is delta-globin.
12. The kit according to claim 6 for use in introducing into a hematopoietic stem/progenitor cell (HSPC) (i) the nucleotide sequence encoding a protein that has a therapeutic effect, said protein being selected from the group consisting of delta-globin and gamma globin, and (ii) the nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence is: a. within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene being selected from beta-globin gene and BCL11A gene, or b. within the promoter region of a target gene, wherein said target gene is a gamma-globin gene when the nucleotide sequence (i) encoding the protein that has the therapeutic effect is delta-globin.
13. A method for modifying the genome of a hematopoietic stem/progenitor cell (HSPC), in vitro or ex vivo, comprising the steps of: a) contacting a HSPC with a composition according to claim 5 to obtain a transduced HSPC, wherein the lentiviral vector is integrated into the genome of said HSPC; and b) introducing into the transduced HSPC a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein, wherein said catalytically active Cas9 or Cpf1 protein disrupts the expression and/or the function of the target gene when introduced or expressed into the transduced HSPC.
14. A method for preparing a genetically modified hematopoietic stem/progenitor cell (HSPC), in vitro or ex vivo, comprising the steps of: a) contacting a HSPC with a composition according to claim 5 to obtain a transduced HSPC, wherein the lentiviral vector is integrated into the genome of said HSPC; and b) introducing into the transduced HSPC a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein, wherein said catalytically active Cas9 or Cpf1 protein disrupts the expression and/or the function of the target gene when introduced or expressed into the transduced HSPC.
15. A composition comprising a recombinant lentiviral vector according to claim 3 or a plurality of said recombinant lentiviral vectors.
16. A kit comprising: the recombinant lentiviral vector according to claim 3; and a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein.
17. A recombinant lentiviral vector comprising in its genome: (i) a nucleotide sequence encoding a protein that has a therapeutic effect, said protein being selected from the group consisting of beta-globin, gamma-globin, and delta-globin; and (ii) a nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence being: a. within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene being BCL11A gene, or b. within the promoter region of a target gene, wherein said target gene is a gamma-globin gene when the nucleotide sequence (i) encoding the protein that has the therapeutic effect is selected from the group consisting of delta-globin and beta-globin.
18. A composition comprising a recombinant lentiviral vector according to claim 17 or a plurality of said recombinant lentiviral vectors.
19. A kit comprising the recombinant lentiviral vector according to claim 17; and a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein.
20. A recombinant lentiviral integrative vector comprising in its genome: (i) a nucleotide sequence encoding a protein that has a therapeutic effect, said protein being selected from the group consisting of beta-globin, gamma-globin, and delta-globin; and (ii) a nucleotide sequence encoding a guide RNA (gRNA) that comprises a spacer adapted to bind to a target nucleotide sequence, said target nucleotide sequence is: (a) within the coding sequence or within a transcribed non-coding sequence of a target gene, said target gene being selected from beta-globin gene and BCL11A gene, or (b) within the promoter region of a target gene, wherein said target gene is a gamma-globin gene when the nucleotide sequence (i) encoding the protein that has the therapeutic effect is selected from the group consisting of delta-globin and beta-globin.
21. A composition comprising a recombinant lentiviral vector according to claim 20 or a plurality of said recombinant lentiviral vectors.
22. A kit comprising: the recombinant lentiviral integrative vector according to claim 20; and a catalytically active Cas9 or Cpf1 protein or a nucleotide sequence encoding a catalytically active Cas9 or Cpf1 protein.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
EXAMPLES
Example 1: Construction of a Recombinant Lentiviral Vector Encoding a Beta-Like Globin Gene
(22) A recombinant lentiviral vector able to express at high levels a beta-like globin gene has been produced using the GLOBE lentiviral vector (Miccio et al., Proc Natl Acad Sci USA, 2008, 105(30):10547-52, Roselli et al., EMBO Mol Med, 2010, 2(8):315-28). The GLOBE lentiviral vector in its proviral form contains LTRs deleted of 400 bp in the HIV U3 region (A), rev-responsive element (RRE), splicing donor (SD) and splicing acceptor (SA) sites, human beta-globin gene (exons and introns), beta-globin promoter (?p), and DNase I-hypersensitive sites HS2 and HS3 from beta-globin LCR (
Example 2: Evaluation of Genome Editing Efficiency in Hematopoietic Cells Using the CRISPR-Cas9 System
(23) One million K562 hematopoietic cells were transfected with: (i) 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234) and 0.8 ?g of a unrelated gRNA-expressing plasmid (MLM3636, Addgene plasmid #43860), (ii) 20 ?g of Cas9 mRNA modified with pseudouridine and 5-methylcytidine to reduce immune stimulation (Trilink, #L-6125) and 15 ?g of chemically modified gRNAs (MD gRNA, 2 O-Methyl unrelated gRNA, resistant to general base hydrolysis, Trilink); or (iii) lentiviral vectors expressing Cas9 (Addgene, #52962) and an unrelated gRNA under the control of the human U6 promoter (
(24) The above mentioned gRNAs were unrelated gRNAs, i.e. gRNAs binding regions which are not related to beta-globin gene or gamma-globin gene. In fact, the gRNA targets the gamma-delta intergenic region in the beta-globin locus (e.g. SEQ ID NO: 48).
(25) K562 cells were transfected in a 100 ?l volume using Nucleofector I (Lonza), the AMAXA Cell Line Nucleofector Kit V (Lonza, VCA-1003) and the T16 program.
(26) After transfection, K562 cells were maintained in RPMI 1640 medium (Lonza) containing 2 mM glutamine and supplemented with 10% fetal bovine serum (FBS, BioWhittaker, Lonza), HEPES (20 mM, LifeTechnologies), sodium pyruvate (1 mM, LifeTechnologies) and penicillin and streptomycin (100 U/ml each, LifeTechnologies).
(27) One week after transfection, DNA was extracted using PURE LINK Genomic DNA Mini kit (LifeTechnologies) following manufacturer's instructions. The genomic region encompassing the gRNA target site was amplified by PCR and subjected to Sanger sequencing. The genome editing efficiency (% InDels, frequency of small insertions and deletions), evaluated using TIDE (Tracking of In/Dels by Decomposition; (Brinkman et al., Nucleic Acids Res, 2014, 42(22):e168)) was higher than 50% for all the delivery systems (
(28) These results showed that the use of DNA, RNA and lentiviral (LV) delivery systems for gRNA and Cas9 leads to a good editing efficiency in K562 hematopoietic cells.
Example 3: Construction and Screening of a gRNA for Beta-Globin Gene Inactivation
(29) 1. Selection of gRNAs Targeting the Beta-Globin Gene
(30) To reduce the expression of the sickle beta-globin gene (i.e. BetaS-globin gene), we selected 4 publicly available gRNAs targeting the exon 1 of the beta-globin gene (Cradick et al., Nucleic Acids Res, 2013, 41(20):9584-92; Liang et al., Protein Cell, 2015, 6(5):363-72) (gRNA spacer-encoding sequences A, B, D and E,
(31) Bioinformatic prediction using COSMID (CRISPR Off-target Sites with Mismatches, Insertions, and Deletions; crispr.bme.gatech.edu; Cradick et al, MolTher Nucleic Acids, 2014, 3(12):e214) showed a low number of predicted off-targets, all of them harboring ?2 mismatches with the delta-globin target sequence (
(32) Importantly, HBG1/2 genes (coding for gamma-globins) were not included in the list of potential off-targets, the selected gRNAs displaying low similarity with the sequence of gamma-globin genes. Amongst the 4 gRNA spacers, only gRNA spacer E displays less than 3 mismatches with the sequence of exon 1 of the delta-globin gene. Bioinformatic prediction of off-target activity indicates this gene as a potential off-target of gRNA E.
(33) The gRNA-encoding sequences A, B, D and E were cloned in MLM3636 plasmids (MLM3636, Addgene plasmid #43860), generating the following plasmids: MLM3636 gRNA A coding for gRNA A MLM3636 gRNA B coding for gRNA B MLM3636 gRNA D coding for gRNA D MLM3636 gRNA E coding for gRNA E
(34) For the generation of MLM3636 plasmids carrying the gRNA-encoding sequences A, B, D and E, the following protocol was applied:
(35) a. Annealing RNA Oligos
(36) Oligonucleotide Sequences:
(37) TABLE-US-00001 SEQ OligoName Sequence5to3(*) IDNO: OligoFOR-gRNAA ACACCGCTTGCCCCACAGGGC 37 AGTAAG OligoREV-gRNAA AAAACTTACTGCCCTGTGGGG 38 CAAGCG OligoFOR-gRNAB ACACCGTAACGGCAGACTTCT 39 CCTCG OligoREV-gRNAB AAAACGAGGAGAAGTCTGCCG 40 TTACG OligoFOR-gRNAD ACACCGTCTGCCGTTACTGCC 41 CTGTG OligoREV-gRNAD AAAACACAGGGCAGTAACGGC 42 AGACG OligoFOR-gRNAE ACACCGAAGGTGAACGTGGAT 43 GAAGTG OligoREV-gRNAE AAAACACTTCATCCACGTTCA 44 CCTTCG (*) In bold: nucleotide sequence encoding the gRNA spacer
(38) Preparation of 10? annealing Buffer [400 ?l 1M Tris HCl pH8, 200 ?l 1M MgCl2, 100 ?l 5M NaCl, 20 ?l 0.5M EDTA pH8, 280 ?l DEPC-water]. Preparation of MIX 1 for gRNA oligo annealing [1 ?l 100 ?M gRNA oligo FOR, 1 ?l 100 ?M gRNA oligo REV, 5 ?l 10? annealing Buffer, 43 ?l DEPC-water]. Annealing reaction in PCR machine with gradient annealing temperature: from 95? C. to 4? C. in 60 minutes, thus decreasing the annealing temperature of ?1.5? C. each minute.
(39) b. Digestion of MLM3636 Plasmid
(40) Incubate the digestion mix reaction [x ?l (2.5 ?g) of MLM3636 plasmid (Addgene plasmid #43860), 5 ?l of BSMB I enzyme (50 U), 5 ?l of enzyme buffer 10?, (50-x) ?l of DEPC-water] over-night at 55? C. Purify from low melting agarose (0.8%) gel the linearized MLM3636 plasmid (size: 2265 bp) with QIAquick Gel Extraction Kit (QIAGEN).
(41) c. Insertion of gRNA within MLM3636 plasmid
(42) Incubation of ligation mix [x ?l (10 ng) linearized MLM3636 plasmid, 1.1 ?l of annealed gRNA-encoding sequence (diluted 1:10), 5 ?l of 2? Ligase Buffer, 1 ?l of Ligase (QUICK LIGASE NEB-Biolabs-M22OO), (10-x) ?l of DEPC-water] for 15 minutes at room temperature.
(43) d. Transformation of Bacteria and Amplification of Plasmid
(44) Chemical competent E. coli bacteria (One Shot TOP10 Chemically competent E. coli-Invitrogen-C4040) are transformed with 5 ?l of ligation products, following manufacture's instruction, and plated in LB AGAR+100 ?g/ml Ampicillin over-night at 37? C.
(45) Single-colonies of transformed E. coli bacteria are picked from LB AGAR plate and grown in 3 ml of LB medium+100 ?g/ml Ampicillin (inoculation culture) over-night at 37? C. For maxiprep cultures, 0.5 ml of inoculation culture is grown in 250 ml of LB medium+100 ?g/ml Ampicillin.
(46) e. Purification of Plasmid DNA
(47) Plasmid DNA is isolated from 250 ml of maxiprep culture of transformed E. coli bacteria by using PureLink HiPure Plasmid DNA Purification Kit (InvitrogenK2100) applying manufacter's instruction.
(48) 2. Selection of gRNAs Targeting ?-Globin Gene: Design of Novel gRNAs
(49) Novel gRNAs spacer-encoding sequences (F, G, H, I, J, K, L, M, N and Orespectively SEQ ID NOs: 27 to 36) were designed by using CRISPOR tool (crispor.tefor.net). The genomic DNA sequence of the target region (e.g. exon 1 or exon 2 of HBB gene) was selected (
(50) 3. Cleavage Efficiency of gRNAs A, B, D and E in K562 and HUDEP-2 Erythroid Cell Lines
(51) Fetal K562 and adult HUDEP-2 erythroid cells are known to naturally comprise the beta-globin gene in their genome. Therefore, we tested the gRNAs targeting the beta-globin gene in these cell lines.
(52) One million cells were transfected with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234) and 0.8 ?g of each gRNA-containing plasmid (MLM3636 gRNA A, MLM3636 gRNA B, MLM3636 gRNA D and MLM3636 gRNA E) in a 100 ?l volume using Nucleofector I (Lonza). Control cells were treated with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234). We used AMAXA Cell Line Nucleofector Kit V (VCA-1003) for K562 and HUDEP-2 (T16 and L-29 programs). After transfection, K562 were maintained in RPMI 1640 medium (Lonza) containing 2 mM glutamine and supplemented with 10% fetal bovine serum (FBS, BioWhittaker, Lonza), HEPES (20 mM, LifeTechnologies), sodium pyruvate (1 mM, LifeTechnologies) and penicillin and streptomycin (100 U/ml each, LifeTechnologies) and HUDEP-2 were maintained as described in Canver et al., Nature, 2015,527(7577):192-7. One week after transfection, DNA was extracted using PURE LINK Genomic DNA Mini kit (LifeTechnologies) following manufacturer's instructions.
(53) The genomic region of fetal K562 and adult HUDEP-2 erythroid cells encompassing the gRNA target sites was amplified by PCR. PCR was performed using primers HBBex1 F (5-CAGCATCAGGAGTGGACAGA-3, SEQ ID NO: 9) and HBBex1 R (5-AGTCAGGGCAGAGCCATCTA-3, SEQ ID NO: 10). We performed Sanger sequencing and TIDE analysis to evaluate the frequency of InDels and frameshift mutations. All the screened gRNAs (i.e. A, B, D, E) were able to cut at >35% of the genomic loci in transfected K562 and HUDEP-2 cells (
(54) 4. Down-Regulation of Beta-Globin Expression in HUDEP-2
(55) The efficiency of beta-globin knock-down was evaluated in HUDEP2 cells, which express high levels of the beta-globin chain (Kurita et al., PLoS One, 2013, 8(3):e59890). HUDEP-2 cells were transfected with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234) and 0.8 ?g of each gRNA-containing plasmid (MLM3636 gRNAA, MLM3636 gRNA B, MLM3636 gRNA C and MLM3636 gRNA D), as described above (Example 3). Control cells were treated with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234). After one week, total RNA was extracted using RNeasy micro kit (QIAGEN) following manufacturer's instructions. Mature transcripts were reverse-transcribed using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) with oligo(dT) primers. qRT-PCR was performed using SYBR green (Applied Biosystems). Primers HBB F (5-GCAAGGTGAACGTGGATGAAGT-3, SEQ ID NO: 11) and HBB R (5-TAACAGCATCAGGAGTGGACAGA-3, SEQ ID NO: 12) were used to amplify the beta-globin transcripts. Primers HBA1 F (5-CGGTCAACTTCAAGCTCCTAA-3, SEQ ID NO: 13) and HBA1 R (5-ACAGAAGCCAGGAACTTGTC 3, SEQ ID NO: 14) were used to amplify the alpha-globin transcripts. Beta-globin expression results were normalized to alpha-globin. In parallel, total proteins were extracted in lysis buffer [PBS 1?, 50 mM, TriS-HCl PH 7.4-7.5, 150 mM NaCl, 0.5% DOC, 0.1% SDS, 2 mM EDTA, 1% Triton, protease inhibitor 7? (EDTA-Free Protease Inhibitor Cocktail, Roche) and phosphatase inhibitor 10? (PhosphoSTOP, Roche)], subjected to 3 rounds of sonication (three cycles of 10 pulses, Amplitude 0.7, 0.5 s oscillation) and to 3 freeze/thaw cycles (3 min each). Lysates were centrifuged at 12.000?g for 12 min at 4? C., and supernatants were used for western blot analysis. We measured protein content using the Bradford Protein Assay kit with bovine serum albumin (BSA) as reference standard. After boiling for 5 min in loading buffer (30% glycerol, 5% SDS, 9.25% Dithiothreitol, 1 ?l of Bromophenol Blue, Tris-HCl 0.5 M, pH 6.8). samples containing 20-50 g protein were separated using a 15% acrylamide gel SDS-PAGE electrophoresis. The transfer was performed at 250 mA for 2 hour at 4? C. or room temperature (RT). The PDVF membranes were dried and then incubated in blocking solution TBS-Tween 0.1% (Tris-Buffered Saline+Tween 20; TBS-T; Sigma Aldrich) 5% milk over-night at 4? C., and stained for 1-2 hours at RT with primary antibodies diluted in TBS-Tween 5% milk solution. The primary antibodies are specific for beta-globin (dilution 1:200; hemoglobin beta (37-8), sc-21757, Santa Cruz Biotechnology) and alpha-globin (dilution 1:200; hemoglobin alpha (D-16), sc-31110, Santa Cruz Biotechnology). After 3 washes (10 minutes each) in TBS-Tween, antibody staining was revealed using HRP-conjugated anti-mouse (1:5.000; Thermo Scientific) and HRP-conjugated anti-goat (1:5.000; Thermo Scientific) for 1 hour at RT in TBS-T 5% milk solution. Blots were developed with ECL system (Immobilon Western, Millipore) and were exposed to x-ray films (different exposure times according to the intensity of signals). Membranes were stripped for 15 with Stripping Buffer (Thermo Scientific). The bands corresponding to beta-globin were quantified by using ImageJ software and/or Gel Pro software and the values (in pixels) obtained were normalized to those of the alpha-globin bands. Both qRT-PCR (
(56) These results showed that gRNA A, B, D and E are particularly efficient to disrupt the expression of beta-globin in HUDEP-2 cells.
(57) 5. Cleavage Efficiency of Selected gRNAs in HSPCs
(58) 5.1 Transfection of Primary HSPCs with gRNA B, D and E: Editing Efficiency gRNAs allowing the highest frequency of frameshift mutations (B, D and E) were tested in adult HSPC from a healthy donor. HSPC were cultured in expansion medium: StemSpan SFEM medium (StemCell Technologies), containing 2 mM glutamine, penicillin and streptomycin (100 U/ml each, Gibco, LifeTechnologies), Flt3-Ligand (300 ng/ml, Peprotech), SCF (300 ng/ml, Peprotech), TPO (100 ng/ml, Peprotech) and IL3 (60 ng/ml, Peprotech). 48 hours after thawing, one million cells were transfected with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234) and 1.6 ?l of each gRNA-containing plasmid (MLM3636 gRNA B, MLM3636 gRNA C and MLM3636 gRNA D) in a 100 ?l volume using Nucleofector I (Lonza). Control cells were treated with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234). We used AMAXA Human CD34 Cell Nucleofector Kit (VPA-1003) for HSPC (U-08 program). After transfection, HSPC were maintained in the same medium supplemented with Z-VAD-FMK (120 uM, InvivoGen) and StemRegenin 1 (750 uM, Stem Cell Technologies). On day 5 after transfection, DNA was extracted to evaluate the editing efficiency, as described above for K562 and HUDEP-2 cells (Example 3). Genome editing efficiency was higher for gRNA B (
(59) These results showed that gRNA B, D and E are particularly efficient to generate frameshift mutations of beta-globin gene in HSPC.
(60) 5.2 Transfection of Primary HSPC Cells: Off Target Analysis
(61) To evaluate off-target activity in primary HSPCs, plasmids encoding the selected gRNAs were individually delivered together with a Cas9-GFP-expressing plasmid to cord blood-derived CD34+ HSPCs. Protocol is slightly different from 5.1. Cells were transfected with 4 ?g of Cas9-GFP expressing plasmid and 3.2 ?g of each gRNA-containing vector using Nucleofector I (Lonza), AMAXA Human CD34 Cell Nucleofector Kit (VPA-1003) and U08 program. Transfection efficiency was verified by flow cytometry analyses 18 hours after electroporation (30-50% of GFP+ Cas9-expressing cells).
(62) TIDE (Tracking of Indels by Decomposition) analysis (Brinkman E K et al., 2014) of the genomic region containing HBB exon 1 and amplified from genomic DNA extracted 4 days after transfection showed that gRNA D and E display a cleavage efficiency of ?35% and ?25%, respectively, with a frequency of frameshift mutations of 90-95% for both the gRNAs (not shown). Conversely, gRNA B displays an editing efficiency of ?60% with a lower frequency of frameshift mutations in comparison with gRNA D and E (not shown). TIDE analysis the genomic region containing HBD exon 1 showed absence of InDels in samples treated with gRNA D, whereas ?3% of HBD alleles are edited (off-target) upon treatment with gRNA E (
(63) 6. Down-Regulation of Beta-Globin Expression in HSPC-Derived Erythroid Cells
(64) Cas9 and gRNA D were delivered by plasmid transfection in adult HSPC derived from a healthy donor (plasmids pMJ920 Cas9-GFP and MLM3636 gRNA D) as described above (Example 5). Control cells were electroporated in the presence of the plasmid pMJ920. One day after, GFP-positive HSPC were sorted by FACS 2 days after transfection, HSPC were differentiated towards the erythroid lineage in liquid culture as previously described (Sankaran, Science, 2008, 322(5909):1839-42). After 11 days, RNA was extracted from mature erythroid cells to evaluate the beta-globin expression levels. Total RNA was extracted using RNeasy micro kit (QIAGEN) following manufacturer's instructions. Mature transcripts were reverse-transcribed using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) with oligo(dT) primers. qRT-PCR was performed using SYBR green (Applied Biosystems). Primers HBB F (5-GCAAGGTGAACGTGGATGAAGT-3, SEQ ID NO: 11) and HBB R (5-TAACAGCATCAGGAGTGGACAGA-3, SEQ ID NO: 12) were used to amplify the beta-globin transcripts. Primers HBA1 F (5-CGGTCAACTTCAAGCTCCTAA-3, SEQ ID NO: 13) and HBA1 R (5-ACAGAAGCCAGGAACTTGTC 3, SEQ ID NO: 14) were used to amplify the alpha-globin transcripts. Beta-globin expression results were normalized to alpha-globin. In parallel, reverse phase HPLC (RP-HPLC) analysis of globin chains was performed using a NexeraX2 SIL-30AC chromatograph (Shimadzu) and the LC Solution software. Globin chains from in vitro differentiated mature erythroblasts were separated by HPLC using a 250?4.6 mm, 3.6 ?m Aeris Widepore column (Phenomenex). Samples were eluted with a gradient mixture of solution A (water/acetonitrile/trifluoroacetic acid, 95:5:0.1) and solution B (water/acetonitrile/trifluoroacetic acid, 5:95:0.1). The absorbance was measured at 220 nm. Both qRT-PCR and RP-HPLC analyses showed a dramatic down-regulation of beta-globin expression in mature erythroblasts electroporated with plasmid MLM3636 gRNA D (
(65) These results showed that gRNA D is particularly efficient to disrupt the expression of beta-globin in HSPC-derived erythroblasts.
Example 4: Optimization of gRNA Activity
(66) The original gRNA scaffold developed by Cong et al., Science, 2013,339(6121):819-23 was recently optimized by Dang et al., Genome Biol, 2015, 16:280 to increase knock-out efficiency.
(67) The gRNA spacer-encoding sequences B, D and E (respectively SEQ ID NOs: 24, 25 and 26) were cloned in Dang p.hU6 gRNA plasmids (Addgene #53188), generating the following plasmids: Dang p.hU6 gRNA B coding for gRNA B Dang p.hU6 gRNA D coding for gRNA D Dang p.hU6 gRNA E coding for gRNA E
(68) For the generation of Dang p.hU6 plasmids (Addgene #53188) carrying gRNA B, D and E, the following protocol was applied:
(69) a. Annealing gRNA Oligos
(70) Oligonucleotide Sequences:
(71) TABLE-US-00002 SEQ OligoName Sequence5to3(*) IDNo: OligoFOR-Opt_gRNAB CACCGTAACGGCAGACTTCTC 15 CTC OligoREV-Opt_gRNAB AAACGAGGAGAAGTCTGCCGT 16 TAC OligoFOR-Opt_gRNAD CACCGTCTGCCGTTACTGCCC 17 TGT OligoREV-Opt_gRNAD AAACACAGGGCAGTAACGGCA 18 GAC OligoFOR-Opt_gRNAE CACCGAAGGTGAACGTGGATG 19 AAGT OligoREV-Opt_gRNAE AAACACTTCATCCACGTTCAC 20 CTTC (*) In bold: nucleotide sequence encoding the gRNA spacer
(72) Preparation of MIX 1 for gRNA oligo annealing [8 ?l 10 ?M gRNA oligo FOR-Opt, 8 ?l 10 ?M gRNA oligo REV-Opt, 2 ?l 10?NEB Ligase buffer (BiolabsM22OO), 2 ?l DEPC-water]. Annealing reaction in PCR machine, following this PCR program: from 96? C. 300 seconds, 85? C. 20 seconds, 75? C. 20 seconds, 65? C. 20 seconds, 55? C. 20 seconds, 45? C. 20 seconds, 35? C. 20 seconds, 25? C. 20 seconds
(73) b. Digestion of Dang p.hU6 Plasmid
(74) Incubate the digestion mix reaction [x ?l (20 ?g) of Dang p.hU6 plasmid (Addgene #53188), 10 ?l of BbsI enzyme (100 U), 10 ?l of enzyme buffer 10?, (100-x) ?l of DEPC-water] over-night at 37? C. Purify from low melting agarose (0.8%) gel the linearized Dang p.hU6 plasmid (size: 3515 bp) with QIAquick Gel Extraction Kit (QIAGEN).
(75) c. Insertion of gRNA within Dang p.hU6 Plasmid
(76) Incubation of ligation mix [x ?l (50 ng) linearized MA128.hU6 plasmid, 1 ?l of annealed gRNA oligos, 1 ?l of 10? Ligase Buffer, 1 ?l of Ligase (QUICK LIGASE NEBM22OO), (10-x) ?l of DEPC-water] for 15 minutes at room temperature.
(77) d. Transformation of Bacteria and Amplification of Plasmid
(78) Chemical competent E. coli bacteria (One Shot TOP10 Chemically competent E. coliInvitrogenC4040) are transformed with 5 ?l of ligation products, following manufacter's instruction, and plated in LB AGAR+100 ?g/ml Ampicillin over-night at 37? C.
(79) Single-colonies of transformed E. coli bacteria are picked from LB AGAR plate and grown in 3 ml of LB medium+100 ?g/ml Ampicillin (inoculation culture) over-night at 37? C. For maxiprep cultures, 0.5 ml of inoculation culture is grown in 250 ml of LB medium+100 ?g/ml Ampicillin.
(80) e. Purification of Plasmid DNA
(81) Plasmid DNA is isolated from 250 ml of maxiprep culture of transformed E. coli bacteria by using PureLink HiPure Plasmid DNA Purification Kit (InvitrogenK2100) applying manufacter's instruction.
(82) One million of K562 cells were transfected with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234) and 0.8 of each gRNA-containing plasmid (MLM3636 gRNA B, MLM3636 gRNA C and MLM3636 gRNA D, Dang p.hU6 gRNA B, Dang p.hU6 gRNA C and Dang p.hU6 gRNA D) in a 100 ?l volume using Nucleofector I (Lonza). Control cells were treated with 4 ?g of a Cas9-GFP expressing plasmid (pMJ920, Addgene plasmid #42234). We used AMAXA Cell Line Nucleofector Kit V (VCA-1003) for K562 cells (T16 program). After transfection, K562 were maintained in RPMI 1640 medium (Lonza) containing 2 mM glutamine and supplemented with 10% fetal bovine serum (FBS, BioWhittaker, Lonza), HEPES (20 mM, LifeTechnologies), sodium pyruvate (1 mM, LifeTechnologies) and penicillin and streptomycin (100 U/ml each, LifeTechnologies). One week after transfection, DNA was extracted using PURE LINK Genomic DNA Mini kit (LifeTechnologies) following manufacturer's instructions. All the gRNAs with the optimized structure (Dang p.hU6 gRNA B, Dang p.hU6 gRNA C and Dang p.hU6 gRNA D; Dang et al., Genome Biol, 2015, 16:280) show higher InDels efficiency (
(83) These results showed that the modification of the scaffold in the gRNAs targeting the beta-globin gene (see Example 3) can further increase their frequency of gene disruption.
Example 5: Construction of a Recombinant Viral Vector (i.e. Lentivector) According to the Invention
(84) The LV.GLOBE.betaAS3-globin.gRNA D-OPTIMIZED lentiviral construct (
(85) In
Example 6: Transduction of HSPC with a Recombinant Lentiviral Vector According to the Invention and Introduction of Cas9 into the Transduced Cell
(86) (A) In the classical gene therapy approach the lentiviral vector expressing an anti-sickling gene (e.g. LV.GLOBE.beta-globin and LV.AS3 (Romero et al., JCI, 2016)) does not strongly reduce the sickle beta-globin expression in the erythroid progeny of SCD HSPC and allows the correction of only 10% to 30% of mature Red Blood Cells (
(87) (B) SCD HSPC are transduced with the gamma-beta hybrid globin and gRNA expressing lentiviral vector (e.g. LV.GLOBE.gamma-beta-globin.gRNA) and Cas9 is delivered transiently. This approach allows the expression of an anti-sickling transgene and the concomitant reduction of the sickle beta-globin levels, which will lead to an increase frequency of corrected Red Blood Cells Importantly, Cas9-mediated disruption of the sickle beta-globin gene will be observed only in transduced SCD cells where the knock out of the sickle beta-globin is compensated by the expression of the anti-sickling gene, thus avoiding an absence of Beta like chain leading to the risk of alpha-chain precipitation, leading to cell death and anemia, as observed in beta-thalassemia (
Example 7: Genetic Modification of Patient SCD HSPC In Vitro
(88) SCD CD34.sup.+ HSPC are transduced with lentiviral vectors expressing an anti-sickling gene and a gRNA targeting the beta-globin gene (e.g. LV.GLOBE.betaAS3-globin.gRNAD-OPTIMIZED, SEQ ID NO: 47 or LV.GLOBE-AS3modified.gRNAD, SEQ ID NO: 94) or the intronic erythroid-specific BCL11A enhancer (e.g. LV.GLOBE-AS3modified.gRNA-BCL11Aenhancer, SEQ ID NO: 75) or the gamma-globin promoters (e.g. LV.GLOBE-AS3modified.gRNA-13 bp-del, SEQ ID NO: 76) and Cas9 is delivered transiently (DNA-, RNA-, protein- or lentiviral-delivery).
(89) HSPC derived from bone marrow or mobilized peripheral blood of SCD patients are cultured in RetroNectin (20 ?g/ml, Takara Shuzo Co.)-coated plates in expansion medium (pre-activation step): StemSpan SFEM medium (StemCell Technologies), containing 2 mM glutamine, penicillin and streptomycin (100 U/ml each, Gibco, LifeTechnologies), Flt3-Ligand (300 ng/ml, Peprotech), SCF (300 ng/ml, Peprotech), TPO (100 ng/ml, Peprotech) and IL3 (60 ng/ml, Peprotech). 24 hours after thawing (day1), 200.000 cells are transduced with LV.GLOBE.betaAS3-globin.gRNAD-OPTIMIZED (SEQ ID NO: 47) (MOI 20-100) in expansion medium+protein sulfate (4 ?g/ml) and plated in RetroNectin (20 ?g/ml, Takara Shuzo Co.)-coated 96-well plates. Control cells are transduced with LV.GLOBE. betaAS3-globin. (SalI) (SEQ ID NO: 46) (MOI 20-100) or LV.GLOBE.gRNAD (MOI 20-100) (LV.GLOBE vector carrying gRNA expression cassette without beta AS3 globin transgene). Medium is change 24 hours after transduction (day2) and 1-3*10.sup.6 cells are transfected with 20 ?g of Cas9 mRNA modified with pseudouridine and 5-methylcytidine to reduce immune stimulation (Trilink, #L-6125) in a 100 ?l volume using Nucleofector 4D (Lonza). Alternatively, 1-3*10.sup.5 cells are transfected with 30-180 Cas9 pmol in a 20 ?l volume using Nucleofector 4D (Lonza). We use AMAXA Human CD34 Cell Nucleofector Kit (VPA-1003) for HSPC (CA137 program). After transfection, HSPC were maintained in the same medium supplemented with Z-VAD-FMK (120 uM, InvivoGen) and StemRegenin 1 (750 uM, Stem Cell Technologies). The day after (day3), treated HSPC are either in vitro differentiated towards the erythroid lineage using a 3-phase liquid erythroid culture system (Giarratana et al., Blood, 2011, 118(19):5071-9) or plated in a semi-solid medium containing cytokines supporting the growth of erythroid and myeloid hematopoietic progenitors (Clonal progenitor assay; medium GFH4435, Stem Cell Technologies). On day 13 of liquid culture and clonal progenitor assay, samples are collected for DNA extraction to evaluate the editing efficiency, as described above for K562 and HUDEP-2 cells (example 3), and the frequency of transduced cells in bulk (erythroid) and clonal culture by PCR followed by Tracking of In/Dels by Decomposition (Brinkman E K, Chen T, Amendola M, and van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic acids research. 2014; 42(22):e168.) also called TIDE analysis (as described in example 3) and qPCR (using primers recognizing specifically the lentiviral vector; Miccio et al., Proc Natl Acad Sci USA, 2008, 105(30):10547-52), respectively.
(90) A genome-wide analysis of Double Strand Breaks using Genome-wide, unbiased identification of DSBs enabled by sequencing, also called GUIDE-seq (Tsai et al., Nat Biotechnol, 2015, 33(2):187-97) is performed to detect and quantify off-target cleavage sites in HSPC and their differentiated progeny (DNA extracted from samples collected at day13 of clonal progenitor assay). LV integration sites in SCD HSPC are analyzed in order to evaluate the potential genotoxic risk of globin-expressing LV vectors. Integration sites are amplified by ligation-mediated PCR, sequenced and mapped to the human genome, as previously described (Romano et al., Sci Rep, 2016, 6:24724). The anti-sickling globin and betaS-globin expression are evaluated by qRT-PCR in samples collected upon 13, 16, 18 and 21 days of liquid culture differentiation. Total RNA is extracted using RNeasy micro kit (QIAGEN) following manufacturer's instructions. Mature transcripts are reverse-transcribed using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) with oligo(dT) primers. qRT-PCR was performed using SYBR green (Applied Biosystems). Primers HBB F (5-GCAAGGTGAACGTGGATGAAGT-3, SEQ ID NO: 11) and HBB R (5-TAACAGCATCAGGAGTGGACAGA-3, SEQ ID NO: 12) are used to amplify the beta-globin transcripts and primers HBB-AS3 F (5-AAGGGCACCTTTGCCCAG-3, SEQ ID NO: 21) and HBB-AS3 R (5-GCCACCACTTTCTGATAGGCAG-3, SEQ ID NO: 22) are used to amplify the beta AS3 globin transcripts. Primers HBA1 F (5-CGGTCAACTTCAAGCTCCTAA-3, SEQ ID NO: 13) and HBA1 R (5-ACAGAAGCCAGGAACTTGTC 3, SEQ ID NO: 14) are used to amplify the alpha-globin transcripts. Beta-globin expression results are normalized to alpha-globin. In parallel, reverse phase HPLC (RP-HPLC) analysis is performed (as described above in Example 6) in genetically modified HSPC differentiated in vitro into fully mature, enucleated Red Blood Cells (day 21 of liquid culture differentiation). The recovery of functional RBC properties is assessed enucleated Red Blood Cells (day 21 of liquid culture differentiation) by evaluating the reversion of the sickling and the correction of the increased adhesiveness and rigidity of SCD cells, features involved in the pathological occurrence of vaso-occlusive events (Picot et al., Am J Hematol, 2015, 90(4):339-45). Sickling dynamics is evaluated in enucleated Red Blood Cells (day 21 of liquid culture differentiation) exposing the cells to an oxygen-deprived atmosphere (0% O.sub.2). Time-course of sickling is monitored in real-time by video microscopy for 1 hour, capturing images every 5 minutes using the AxioObserver Z1 microscope (Zeiss) and a 40? objective.
(91) This process is illustrated in
(92) Such method is applied mutatis mutandis when using any of lentiral vectors of the invention.
Example 8: Genetic Modification of Patient SCD HSC In Vivo
(93) The engraftment capability of genetically modified patient SCD HSC and the efficacy of the therapeutic approach in Red Blood Cells derived from engrafting SCD HSC are assessed in in vivo mouse experiments. The in vivo frequency of modified HSC and the efficacy of the therapeutic strategy have to be similar to the same parameters measured in vitro in HSPC to exclude any HSC impairment due to our treatment.
(94) HSPC derived from bone marrow or mobilized peripheral blood of SCD patients are cultured in RetroNectin (20 ?g/ml, Takara Shuzo Co.)-coated plates in expansion medium (pre-activation step): StemSpan SFEM medium (StemCell Technologies), containing 2 mM glutamine, penicillin and streptomycin (100 U/ml each, Gibco, LifeTechnologies), Flt3-Ligand (300 ng/ml, Peprotech), SCF (300 ng/ml, Peprotech), TPO (100 ng/ml, Peprotech) and IL3 (60 ng/ml, Peprotech). 24 hours after thawing (day1), 1-2*10.sup.6 cells are transduced with a lentiviral vector expressing an anti-sickling gene and a gRNA targeting the beta-globin gene (e.g. LV.GLOBE.betaAS3-globin.gRNAD-OPTIMIZED, SEQ ID NO: 47 or LV.GLOBE-AS3modified.gRNAD, SEQ ID NO: 94) or a gRNA targeting the intronic erythroid-specific BCL11A enhancer (LV.GLOBE-AS3modified.gRNA-BCL11Aenhancer, SEQ ID NO: 75) or a gRNA targeting the gamma-globin promoters (LV.GLOBE-AS3modified.gRNA-13 bp-del, SEQ ID NO: 76) (MOI 20-100) in expansion medium+protein sulfate (4 ?g/ml) and plated in RetroNectin (20 ?g/ml, Takara Shuzo Co.)-coated 96-well plates. Control cells are transduced with LV.GLOBE.gamma-beta-globin(SalI) (MOI 20-100) and LV.GLOBE.gRNAD (MOI 20-100) (LV.GLOBE vector carrying gRNA expression cassette without beta AS3 globin transgene). Medium is change 24 hours after transduction (day2) and 1-3*10.sup.6 cells are transfected with 20 ?g of Cas9 mRNA modified with pseudouridine and 5-methylcytidine to reduce immune stimulation (Trilink, #L-6125) in a 100 ?l volume using Nucleofector 4D (Lonza). Alternatively, 1-3*10.sup.5 cells are transfected with 30-180 Cas9 pmol in a 20 ?l volume using Nucleofector 4D (Lonza). We use AMAXA Human CD34 Cell Nucleofector Kit (VPA-1003) for HSPC (CA137 program). After transfection, HSPC were maintained in the same medium supplemented with Z-VAD-FMK (120 uM, InvivoGen) and StemRegenin 1 (750 uM, Stem Cell Technologies). The day after (day3), cells are injected (0.5-1*10.sup.6 cells per mouse) i.v. in 9 to 10-week-old partially myeloablated immunodeficient NSG (NOD SCID GAMMA; NOD.Cg-Prkdc.sup.scid 112Il2.sup.tm1WjI/SzJ) mice. After 16 weeks, mice are euthanized and bone marrow, thymus and spleen are analyzed for engraftment of human cells by flow cytometry using anti-human CD45 vs. anti-murine CD45 antibodies. The percentage of engrafted human cells is defined as follows: % huCD45+/(% huCD45++% muCD45+). Analysis of the different hematopoietic cell types present was performed by cell-specific staining for human CD34, human CD45, human CD19, human CD33, human CD71, human CD36 and human CD235a. Transduction efficiency and genome editing efficiency is determined in the purified HSPC and lymphoid and myeloid progeny, as described above in example 7.
(95) Human CD34+ HSPC is isolated from bone marrow of engrafted mice using immunomagnetic separation (CD34 MicroBeads kit human; Miltenyi Biotech). The hCD34-positive fraction is cultured in 3-phase liquid erythroid culture system (Giarratana et al., Blood, 2011,118(19):5071-9) or plated in a semi-solid medium containing cytokines supporting the growth of erythroid and myeloid hematopoietic progenitors (Clonal progenitor assay; medium GFH4435, Stem Cell Technologies). Given the low number of erythroid cells obtained in vivo in NSG mice, the expression of the anti-sickling transgene, the down-regulation of sickle beta-globin expression and the functional correction of the SCD phenotype are assessed ex vivo in the erythroid progeny of modified SCID-Repopulating cells, as describe above (example 7).
(96) This process is illustrated in
Example 9: Evaluation of Transgene Expression, Genome Editing Efficiency and (i) Beta-Globin Down-Regulation (gRNA D) or (ii) Gamma-Globin Re-Activation (gRNA-13 bp-Del and gRNA-BCL11Aenhancer)
(97) Protocols
(98) Lentiviral Vectors Used
(99) LV.GLOBE-AS3modified (LV.GLOBE.betaAS3-globin plasmid (SEQ ID NO: 45): lentiviral vector harboring only a Beta-AS3 transgene modified by inserting silent mutations in the sequence of exon 1 targeted by gRNA-D (AS3modified transgene), does not express gRNAD
(100) LV.GLOBE-AS3modified.gRNAD (LV.GLOBE-AS3modified.gRNAD, SEQ ID NO: 94): lentiviral vector expressing AS3modified transgene and optimized gRNA D.
(101) LV.GLOBE-AS3modified.gRNA-luciferase (SEQ ID NO: 93): lentiviral vector expressing AS3modified transgene and optimized gRNA targeting the luciferase gene, which is not present in the human genome.
(102) LV.GLOBE-AS3modified.gRNA-BCL11Aenhancer (SEQ ID NO: 75): lentiviral vector expressing AS3modified transgene and optimized BCL11A gRNA (5-CACAGGCTCCAGGAAGGGTT-3SEQ ID NO: 74) targeting the intronic erythroid-specific enhancer of BCL11A gene. To evaluate the editing efficiency of BCL11A gRNA by TIDE the following primers were used:
(103) TABLE-US-00003 BCL11A-TIDEFORWARD: (SEQIDNO:77) 5-TGGACAGCCCGACAGATGAA-3 BCL11A-TIDEREVERSE: (SEQIDNO:78) 5-AAAAGCGATACAGGGCTGGC-3
(104) LV.GLOBE-AS3modified.gRNA-13 bp-del (SEQ ID NO: 76): lentiviral vector expressing AS3modified transgene and optimized 13 bp-del gRNA (SEQ ID NO: 71) designed to reproduce the 13 bp small HPFH deletion within the promoters of HBG1 and HBG2 genes. To evaluate the editing efficiency of 13 bp-del gRNA by TIDE the following primers were used:
(105) TABLE-US-00004 13bp-del-TIDEFORWARD: (SEQIDNO:79) 5-AAAAACGGCTGACAAAAGAAGTCCTGGTAT-3 13bp-del-TIDEREVERSE: (SEQIDNO:80) 5-ATAACCTCAGACGTTCCAGAAGCGAGTGTG-3
Transduction of HUDEP-2 Cells
(106) HUDEP-2 WT cells were transduced at MOI 50 with LVs LV.GLOBE-AS3modified.gRNAD (D, SEQ ID NO: 94), LV.GLOBE-AS3modified.gRNA-BCL11Aenhancer (BCL11A, SEQ ID NO: 75) and LV.GLOBE-AS3modified.gRNA-13 bp-del (13bpdel, SEQ ID NO: 76). Untransduced (UT) samples or cells transduced with LV.GLOBE-AS3modified (AS3, SEQ ID NO: 45) and LV.GLOBE-AS3modified.gRNA-luciferase (Luc) LVs were used as controls.
(107) 10 days after transduction, transduced cells were transfected using 4 ?g GFP-Cas9 plasmid (pMJ920, Addgene plasmid #42234). After 18 hours plasmid-transfected Cas9-GFP+ cells (29%-45%, not shown) were sorted by FACS.
(108) In parallel, an LVs LV.GLOBE-AS3modified.gRNAD-transduced sample was electroporated using 10 ?g (60 pmol) of Cas9-GFP protein by using Nucleofector 4D (CA-137 program), achieving ?90% of GFP+ Cas9-expressing cells (not shown).
(109) Sorted plasmid-transfected and unsorted Cas9-protein-transfected D samples, as well as non-transduced and non-transfected cells (UT) and transduced but non-transfected samples used as controls were then differentiated in mature erythroblasts.
(110) mRNAs Quantification
(111) Globin mRNA expression in mature erythroblasts (day 9 of differentiation) is presented in
(112) Globin expression was evaluated by qRT-PCR in samples collected at day 9 of differentiation. Total RNA was extracted using RNeasy micro kit (QIAGEN) following manufacturer's instructions. Mature transcripts were reverse-transcribed using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) with oligo(dT) primers. qRT-PCR was performed using SYBR green (Applied Biosystems).
(113) Primers HBG1+HBG2 FORWARD: 5-CCTGTCCTCTGCCTCTGCC-3 (SEQ ID NO: 81) and HBG1+HBG2 REVERSE: 5-GGATTGCCAAAACGGTCAC-3 (SEQ ID NO: 82) were used to amplify the ?-globin transcripts. Primers HBB-AS3 FORWARD 5-AAGGGCACCTTTGCCCAG-3, (SEQ ID NO: 21) and HBB-AS3 REVERSE 5-GCCACCACTTTCTGATAGGCAG-3 (SEQ ID NO: 22) were used to amplify exclusively the beta AS3 globin transcripts. Primers HBB FORWARD: 5-AAGGGCACCTTTGCCACA-3, (SEQ ID NO: 81) and HBB REVERSE: 5-gccaccactttctgataggcag-3 (SEQ ID NO: 82) were used to amplify the endogenous ?-globin transcripts. Primers HBD FORWARD: 5-CAAGGGCACTTTTTTCTCAG-3 (SEQ ID NO: 85) and HBD REVERSE: 5-AATTCCTTGCCAAAGTTGC-3 (SEQ ID NO: 86) were used to amplify the ?-globin transcripts. Primers HBA1 F (5-CGGTCAACTTCAAGCTCCTAA-3, SEQ ID NO: 13) and HBA1 R (5-ACAGAAGCCAGGAACTTGTC 3, SEQ ID NO: 14) were used to amplify the alpha-globin transcripts. Endogenous beta-globin, AS3 beta-globin, gamma-globin and delta-globin results were normalized to alpha-globin.
(114) BCL11A mRNA expression in undifferentiated (day0) HUDEP WT cells and in differentiated erythroblasts at different days of differentiation (day5, day7 and day9) was evaluated by qRT-PCR (as described above) in samples transduced with LV.GLOBE-AS3modified.gRNA-BCL11Aenhancer with or without transfection with Cas9-GFP plasmids followed by flow cytometry-based selection of GFP+ cells. Time-course analysis of the total BCL11A mRNA isoforms and of the BCL11A isoform XL, mainly involved in the regulation of gamma-globin expression, was performed by using qRT-PCR with the following primers:
(115) TABLE-US-00005 BCL11AFORWARD: (SEQIDNO:87) 5-AACCCCAGCACTTAAGCAAA-3 BCL11AREVERSE: (SEQIDNO:88) 5-GGAGGTCATGATCCCCTTCT-3 BCL11AXLFORWARD: (SEQIDNO:89) 5-ATGCGAGCTGTGCAACTATG-3 BCL11AXLREVERSE: (SEQIDNO:90) 5-GTAAACGTCCTTCCCCACCT-3 GAPDHFORWARD: (SEQIDNO:91) 5-CTTCATTGACCTCAACTACATGGTTT-3 GAPDHREVERSE: (SEQIDNO:92) 5-TGGGATTTCCATTGATGACAAG-3
HPLC Analyses of Globin Chains and Hemoglobin Tetramers
(116) Globin chain profiles obtained using reverse phase HPLC in mature erythroblasts derived from control or genetically modified HUDEP cells (day 9 of differentiation) are presented in
(117) Briefly, reverse phase HPLC (RP-HPLC) analysis of globin chains was performed using a NexeraX2 SIL-30AC chromatograph (Shimadzu) and the LC Solution software. Globin chains from in vitro differentiated mature erythroblasts were separated by HPLC using a 250?4.6 mm, 3.6 ?m Aeris Widepore column (Phenomenex). Samples were eluted with a gradient mixture of solution A (water/acetonitrile/trifluoroacetic acid, 95:5:0.1) and solution B (water/acetonitrile/trifluoroacetic acid, 5:95:0.1). The absorbance was measured at 220 nm.
(118) Hemoglobin profiles obtained using cation-exchange HPLC in mature erythroblasts derived from unmodified or genetically modified HUDEP cells (day 9 of differentiation) are presented in
(119) Analysis of hemoglobin tetramers was performed by cation-exchange HPLC using a NexeraX2 SIL-30AC chromatograph (Shimadzu) and the LC Solution software. Hemoglobin tetramers from mature erythroblasts were separated using a 2 cation-exchange column (PolyCAT A, PolyLC, Columbia, MD). Samples were eluted with a gradient mixture of solution A (20 mM bis Tris, 2 mM KCN, pH=6.5) and solution B (20 mM bis Tris, 2 mM KCN, 250 mM NaCl, pH=6.8). The absorbance was measured at 415 nm.
(120) Results:
(121) A) Globin (
(122) 1) Cells not Transfected (not Transfected)
(123) AS3mod (not shown in the figures): higher expression level of ?-AS3 associated with the higher VCN compared to other samples.
(124) Luc transduced cells: Similar expression level of endogenous HBB mRNA compared to controls (UT) and lower expression of AS3 beta-globin mRNA transgene compared to AS3mod due to lower VCN (
(125) D transduced cells: no inactivation of endogenous ?-globin gene (i.e. HBB), due to the absence of Cas9 delivery. Similar expression level of endogenous HBB mRNA compared to controls (UT and luc). D also expresses AS3 beta-globin mRNA transgene at similar level compared to control (luc) with similar VCN (
(126) BCL11A and 13 bp del transduced cells: no inactivation of endogenous ?-globin gene (i.e. HBB), because of the expression of gRNAs that do not target HBB. Similar expression level of endogenous HBB mRNA in the BCL11A and 13 bp del samples compared to controls (UT and luc). Similar levels of expression of AS3 beta-globin mRNA transgene for both BCL11A and 13 bp del samples in comparison with control (luc) with similar VCN (
(127) Note that BCL11A/BCL11AXL mRNA expression levels are increased over-time with a peak at days 5 and 7 of differentiation in non-transfected BCL11A sample (used as control in
(128) 2) Cells Transfected with GFP-Cas9 Plasmid (GFP+(Cas9 Plasmid)) or with Cas9-GFP Protein (Cas9 Protein)
(129) AS3mod and Luc transduced cells: no genome editing in the exon 1 of endogenous HBB gene, as well as in the gamma-globin promoters or in the intronic enhancer of BCL11A gene, due to the absence of gRNAs in the LV vector (AS3mod) or the presence of a gRNA targeting the luciferase gene (Luc). Similar expression levels of endogenous beta-, AS3 beta-, gamma- and delta-globin chains compared to samples transduced with the same LV but ?not transfected? with Cas9-GFP plasmid.
(130) D transduced cells: down-regulation of endogenous ?-globin gene expression in comparison with D ?not transfected? sample and controls samples, due to the targeting of endogenous HBB gene by gRNA D and plasmid or protein delivery of Cas9. The expression of ?-AS3 transgene and gamma-globin chains (A?+G?) tend to increase maybe as a consequence of HBB downregulation.
(131) BCL11A and 13 bp del transduced cells: an up-regulation of gamma-globin chains (A?+G?) expression is observed in comparison with BCL11A and 13 bp del ?not transfected? samples and controls, due to the disruption of the erythroid-specific BCL11A enhancer (BCL11A sample) or to the deletion of the 13-bp region in gamma-globin promoters (13 bp del sample) as a consequence of gRNA expression and plasmid delivery of Cas9. Indeed, the treatment with Cas9 strongly downregulated the expression of BCL11A, including XL isoform, in mature erythroblasts derived from Cas9-GFP+ BCL11A sample demonstrating that gRNA targeting the BCL11A enhancer is effective in decreasing BCL11A expression in erythroid cells and consequently implying a deregulation of ?-globin gene expression (see for example
(132) B) Protein Expression
(133) HPLC analyses showed a dramatic down-regulation of endogenous beta-globin expression (?) and HbA tetramers (
(134) In particular mature erythroblasts derived from HUDEP-2 cells transduced with LV.AS3-beta-globin.gRNA-D and transfected with Cas9-GFP plasmid or Cas9 protein showed almost a complete knock-down of endogenous beta-globin chain expression (?) and HbA tetramers compensated by the expression of exogenous ?-AS3-globin expression and HbAS3 tetramers as demonstrated by the alpha/not-alpha ratio that is similar in control samples (
(135) In mature erythroblasts derived from HUDEP-2 cells transduced with LV.AS3-beta-globin.gRNA-BCL11Aenhancer or LV.AS3-beta-globin.gRNA-13bpdel and transfected with Cas9-GFP plasmid, gamma-globin expression and HbF levels were significantly increased (
(136) Conclusions
(137) Transgene expression at mRNA and protein levels (
(138) In Cas9-GFP+D samples the knock-down of endogenous ?-globin gene at mRNA level (
(139) The ratio between the expression of alpha-globin and non-alpha-globins (alpha/non-alpha ratio) is similar between all samples. The concomitant increase of anti-sickling globin expression (
(140) Cas9 protein-mediated genome editing in D samples resulted in a clinically relevant switching between endogenous HbA tetramer (16%) and anti-sickling tetramers (HbAS3, HbF and HbA2; 84%) (
(141) In mature erythroblasts derived from Cas9-GFP+13bpdel and BCL11A samples, a robust increase in ?-globin expression at both mRNA (
(142) Relative amounts of HbA, HbA2, HbF and HbAS3 tetramers are shown in
(143) All together these results showed the effectiveness of the integrative system as set up by the inventors in: inactivating mutant beta-globin gene involved in SCD pathophysiology when gRNA D is used; and expressing HbAS3 and, when gRNA BCL11A or gRNA 13bpdel are used instead of gRNAD, increasing expression of ?-globin chains, resulting in the production of an amount of antisickling hemoglobin tetramers sufficient to correct sickle cell disease and avoid alpha-globin precipitations.