CRISP-seq, an integrated method for massively parallel single cell RNA-seq and CRISPR pooled screens
11485971 · 2022-11-01
Assignee
Inventors
- Ido Amit (Rehovot, IL)
- Diego Jaitin (Rehovot, IL)
- David Lara-Astiaso (Rehovot, IL)
- Assaf WEINER (Rehovot, IL)
- Ido Yofe (Rehovot, IL)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C40B40/02
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12N15/79
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
An expression construct is disclosed which comprises: (i) a DNA sequence which encodes at least one guide RNA (gRNA) operatively linked to a transcriptional regulatory sequence so as to allow expression of the gRNA in a target cell; (ii) a barcode sequence for identification of the at least one gRNA operatively linked to a transcriptional regulatory sequence so as to allow expression of the barcode sequence in the target cell.
Claims
1. An expression construct comprising: (i) a DNA sequence which encodes at least one guide RNA (gRNA) operatively linked to a first promoter sequence so as to allow expression of said gRNA in a target cell; and (ii) a barcode sequence being between 6-10 nucleotides for identification of said at least one gRNA, said barcode sequence being operatively linked to a second promoter sequence so as to allow expression of said barcode sequence in said target cell wherein said first promoter sequence is distinct from said second promoter sequence.
2. The expression construct of claim 1, further comprising a DNA sequence which encodes a detectable or selectable moiety.
3. The expression construct of claim 1, comprising a plurality of gRNAs and a plurality of barcodes, wherein the expression construct comprises the same number of barcodes as there are encoded gRNAs.
4. The expression construct of claim 1, wherein said barcode sequence is positioned 3′ to said DNA encoding said gRNA.
5. The expression construct of claim 1, further comprising a polyadenylation signal which is between 300-500 base pairs downstream of said barcode sequence.
6. The expression construct of claim 5, being a viral expression construct.
7. A kit comprising: (i) the expression construct of claim 1; and (ii) an expression construct which comprises DNA encoding a CRISPR endonuclease.
8. The kit of claim 7, wherein said expression construct which comprises DNA encoding said CRISPR endonuclease further comprises DNA encoding a detectable or selectable moiety.
9. The expression construct of claim 1, further comprising a DNA sequence which encodes a CRISPR endonuclease.
10. An expression construct comprising: (i) a DNA sequence which encodes a plurality of gRNAs; (ii) a plurality of barcode sequences being between 6-10 nucleotides for identification of each of said gRNAs, wherein the number of barcode sequences is identical to the number of gRNAs; and (iii) at least one promoter sequence operatively linked to said DNA sequence and said barcode sequences so as to allow expression of said gRNAs and said barcode sequences.
Description
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
(1) The present invention, in some embodiments thereof, relates to a method of analyzing cells using Clustered regularly interspaced short palindromic repeats (CRISPR) based technology.
(2) Gene regulatory networks function as decision-making circuits of the cell. Functional characterization of the regulatory pathways controlling cell fate and response is critical for development of the next generation of targeted and combinatorial therapies. CRISPR-based technologies have dramatically aided these efforts; however, they are either used for individual perturbations assuming homogeneity in the population, or measure such interactions in particular loci. Despite these important efforts, a robust technology that would systematically decipher the function of genetic elements at single-cell and genome-wide resolution is still lacking. Most importantly, analysis of complex, hidden phenotypes is not possible by simple phenotypic assays, and may only be resolved by genomic techniques.
(3) The present inventors have now conceived of a new and versatile method, named CRISP-seq, which identifies in the same cell the specific perturbation and cell state. By generating a scalable lentiviral backbone that contains, in addition to the guide RNA module, a fluorescent marker and sensitive transcribed unique guide index (UGI), the present inventors show that CRISP-seq uncovers in a single experiment the function of multiple factors and their combinations (
(4) The approach is not limited to coding genes, but can be used to perturb other genetic elements such as non-coding RNA as well as promoters, enhancers and any other DNA elements. CRISP-seq can also be naturally scaled in terms of the function of different circuit components under different environmental conditions. The present inventors have exemplified two conditions, namely unstimulated and LPS-stimulated cells. However, the pool of gRNA-perturbed cells can be stimulated by different conditions, or treated with various small molecules, with considerably greater flexibility and scalability than other approaches.
(5) The technology described in the present invention may be used in researching a myriad of medical diseases including neurodegeneration, autoimmune disease, cancer, and other immune related diseases.
(6) Thus, according to a first aspect of the present invention there is provided an expression construct comprising:
(7) (i) a DNA sequence which encodes at least one guide RNA (gRNA) operatively linked to a transcriptional regulatory sequence so as to allow expression (i.e. RNA expression) of the gRNA in a target cell;
(8) (ii) a barcode sequence for identification of said at least one gRNA operatively linked to a transcriptional regulatory sequence so as to allow expression of the barcode sequence in the target cell.
(9) At its minimum, the expression construct of this aspect of the present invention is designed to express two sequences:
(10) 1. at least one guide RNA (gRNA); and
(11) 2. a barcode sequence.
(12) Each of these will be discussed in detail herein below.
(13) 1. gRNA
(14) gRNA is one of two distinct components of the CRIPSR/Cas system for genome editing. The other component necessary for bringing about genome editing is an endonuclease e.g. Cas9.
(15) As used herein, the term “guide RNA” (gRNA) generally refers to an RNA molecule (or a group of RNA molecules collectively) that can bind to a CRISPR endonuclease (e.g. Cas protein) and aid in targeting the endonuclease to a specific location within a target polynucleotide (e.g., a DNA).
(16) A guide RNA can comprise a crRNA segment and a tracrRNA segment.
(17) As used herein, the term “crRNA” or “crRNA segment” refers to an RNA molecule or portion thereof that includes a polynucleotide-targeting guide sequence, a stem sequence, and, optionally, a 5′-overhang sequence.
(18) As used herein, the term “tracrRNA” or “tracrRNA segment” refers to an RNA molecule or portion thereof that includes a protein-binding segment (e.g., the protein-binding segment is capable of interacting with a CRISPR-associated protein, such as a Cas9). In one embodiment, the guide RNA encompasses a single guide RNA (sgRNA), where the crRNA segment and the tracrRNA segment are located in the same RNA molecule. In another embodiment, the “guide RNA” is comprised of two or more RNA molecules, where the crRNA segment and the tracrRNA segment are located in separate RNA molecules.
(19) Preferably, the gRNA encodes a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the CRISPR endonuclease (tracrRNA) in a single chimeric transcript i.e. sgRNA.
(20) A single-molecule guide RNA comprises two stretches of nucleotides (a targeter-RNA and an activator-RNA) that are complementary to one another, are covalently linked (directly, or by intervening nucleotides referred to as “linkers” or “linker nucleotides”), and hybridize to form the double stranded RNA duplex (dsRNA duplex) of the protein-binding segment, thus resulting in a stem-loop structure. The targeter-RNA and the activator-RNA can be covalently linked via the 3′ end of the targeter-RNA and the 5′ end of the activator-RNA. Alternatively, targeter-RNA and the activator-RNA can be covalently linked via the 5′ end of the targeter-RNA and the 3′ end of the activator-RNA.
(21) The gRNA/CRISPR endonuclease complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of the CRISPR endonuclease, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/CRISPR endonuclease complex localizes the CRISPR endonuclease to the genomic target sequence so that the CRISPR endonuclease can cleave one or both strands of the DNA or in the case of Cas9 mutants (dCas9), can bind DNA and allow regulatory perturbation (e.g. enhanced/reduced transcription if linked to transcription factors).
(22) Full complementarity of the gRNA with its target sequence is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. Thus, according to some embodiments, global homology to the target sequence may be of 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or 99%.
(23) A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In one embodiment, the gRNA of this aspect of the present invention targets protein-coding DNA.
(24) In another embodiment, the gRNA of this aspect of the present invention targets non-protein coding DNA.
(25) In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell.
(26) The constructs of this aspect of the present invention may comprise a single gRNA or a plurality of gRNAs. In the latter case, the gRNAs may target the same gene or different genes. The constructs may comprise one, two, three, four, five or more gRNA sequences.
(27) There are a number of publically available tools available to help choose and/or design target sequences as well as lists of bioinformatically determined unique gRNAs for different genes in different species such as the Feng Zhang lab's Target Finder, the Michael Boutros lab's Target Finder (E-CRISP), the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes and the CRISPR Optimal Target Finder.
(28) 2. Barcode Sequence
(29) The barcode sequence of this aspect of the present invention serves to identify the gRNA encoded in the construct.
(30) In one embodiment, one barcode sequence identifies one gRNA sequence. Thus, if more than one gRNA sequence is encoded in the construct, the construct will comprise that number of barcode sequences as well.
(31) In another embodiment, one barcode sequence identifies a pair or triplet of gRNA sequences encoded in that construct.
(32) The barcode sequence may be between 3-400 nucleotides, more preferably between 3-200 and even more preferably between 3-100 nucleotides. Thus, for example, the barcode sequence may be 6 nucleotides, 7 nucleotides, 8, nucleotides, nine nucleotides or ten nucleotides.
(33) In order to ensure that both the gRNA and the barcode sequence are expressed following infection or transfection into a cell, both the gRNA and the barcode sequence are operatively linked to cis-acting transcriptional regulatory elements. Such elements may include promoter sequences, polyA signals and enhancer elements.
(34) The term “promoter” as used herein refers to a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A “promoter” contains core elements required for basic interaction of RNA polymerase and transcription factors and can contain upstream elements and response elements.
(35) According to a particular embodiment, the gRNA and the barcode sequence are positioned such that they are under the control of different promoter sequences. This is especially relevant if the barcode sequence is positioned 3′ to the gRNA sequence since the present inventors have found that the tertiary structure of the gRNA terminates transcription.
(36) Constitutive promoters suitable for use with this embodiment of the present invention include sequences which are functional (i.e., capable of directing transcription) under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).
(37) In one embodiment, the promoter for expressing the barcode sequence is the promoter from the eukaryotic transcription elongation factor 1 alpha gene.
(38) In another embodiment, the promoter for expressing the gRNA is a U6 or H1 promoter.
(39) The nucleic acid constructs of the present invention may also include one or more enhancers.
(40) Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
(41) According to a specific embodiment, the construct comprises the WPRE element from the Woodchuck hepatitis virus or the CTE element from Mason-Pfizer monkey virus.
(42) The construct of this aspect of the present invention typically also comprises at least one polyadenylation signal sequence at a position such that the barcode sequence transcript is polyadenylated. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA (SEQ ID NO: 13), located 11-30 nucleotides upstream.
(43) The identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
(44) Typically, the polyA signal sequence is no more than 2000 bases downstream of the barcode sequence (typically between 300-500 bases downstream).
(45) The present invention contemplates that the barcode sequence is positioned up- or down-stream to the gRNA sequence, although in a preferred embodiment, the barcode sequence is positioned 3′ to the gRNA sequence.
(46) Furthermore, the barcode sequence is preferably 5′ to the polyA site so it can be sequenced.
(47) As well as encoding the above described two elements, the expression constructs of this aspect of the present invention may also encode a detectable or selectable moiety. These moieties serve to provide information regarding which cells have been successfully infected/transfected and express the gRNA.
(48) The detectable moiety can be a reporter polypeptide which is directly visualized or a member of a binding pair, which is identifiable via its interaction with an additional member of the binding pair.
(49) According to a particular embodiment, the reporter polypeptide is a fluorescent protein. Exemplary fluorescent proteins include, but are not limited to green fluorescent protein (Genbank Accession No. AAL33912), Fluorescein isothiocyanate (Genbank Accession No. AAF22695), orange fluorescent protein (Genbank Accession No. AAL33917) and blue fluorescent protein (e.g. Uniprot No. D6NKF4).
(50) Additional reporter polypeptides include products of bacterial luciferase genes, e.g., the luciferase genes encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase gene FFlux, and the like.
(51) In another example, the detectable moiety is an enzyme producing a colorimetric reaction.), alkaline phosphatase (Genbank Accession No. AAK73766), peroxidase (Genbank Accession No. NP_568674), histidine tag (Genbank Accession No. AAK09208), Myc tag (Genbank Accession No. AF329457), biotin ligase tag (Genbank Accession No. NP_561589), beta galactosidase (Genbank Accession No. NM_125776), and strepavidin (Genbank Accession No. S11540).
(52) Methods of measuring the reporter polypeptide are known to those of skill in the art and the selection of the particular method is dependent upon the detectable moiety which is used in the system. For example, the reporter polypeptide may be detected using standard techniques (e.g., radioimmunoassay, radio-labeling, immunoassay, assay for enzymatic activity, absorbance, fluorescence, luminescence, and Western blot). More preferably, the level of the reporter protein is easily quantifiable using standard techniques even at low levels.
(53) In a particular embodiment, the reporter polypeptide is measured using a fluorescence-activated cell sorter (FACS).
(54) A Flow Cytometer typically consists of a laser light source, flow measurement chamber, and an optical system consisting of lenses, filters, and light detectors. Two photo-multiplier tubes (light detectors), one at 180 degrees and one at 90 degrees to the laser, are used to measure forward (FSC) and right-angle scatter (SSC), respectively. Three fluorescence detectors, each consisting of a filter and photomultiplier tube, are used to detect fluorescence. The three detectors sense green (FL1—530 nm), orange (FL2—585 nm), and red fluorescence (FL3—650 nm). Cells may be identified by sort logic applied to all five of the detector signals (FSC, SSC, FL1, FL2, FL3) using a computer.
(55) Exemplary Flow Cytometers that may be used in this aspect of the present invention are manufactured by companies such as Becton Dickinson (USA), Backman Coulter (USA), Partec (Germany).
(56) As mentioned, the constructs of this aspect of the present invention may comprise a selectable moiety. Examples of suitable selectable moieties for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. When such selectable moieties are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. Two examples are: CHO.sup.DHFR-cells and mouse.sup.LTK-cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
(57) The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., J. Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R. C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al., Mol. Cell. Biol. 5: 410-413 (1985)). The three examples employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Others include the neomycin analog G418 and puramycin.
(58) According to a particular embodiment, the DNA encoding the detectable/selectable moiety is operatively linked to the same promoter as for the gRNA.
(59) According to another embodiment, the DNA encoding the detectable/selectable moiety is operatively linked to the same promoter as for the barcode sequence.
(60) According to yet another embodiment, the DNA encoding the detectable/selectable moiety is operatively linked to a promoter that is different than that used for the gRNA and further different to that used for the barcode sequence.
(61) An exemplary order of components on the construct from the 5′ end to the 3′ end is as shown in
(62) In addition to the elements already described, the expression construct of the present invention may contain other specialized elements intended to increase the level of expression of cloned polynucleotides or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
(63) The expression constructs may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the construct does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired polynucleotide.
(64) The expression constructs of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide. For example a single expression construct can be designed and co-express two distinct polypeptides one the polypeptide of interest, and one a processing enzyme as further described herein below.
(65) Examples of mammalian expression constructs include, but are not limited to, pcDNA3, pcDNA3.1(+/−), pGL3, pZeoSV2(+/−), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
(66) Expression constructs containing regulatory elements from eukaryotic viruses such as retroviruses can also be used by the present invention. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009/A.sup.+, pMT010/A.sup.+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
(67) Viruses are specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
(68) Recombinant viral vectors are useful for in vivo expression of transgenic polynucleotides since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
(69) According to one embodiment, the constructs of the present invention are incorporated into lentiviruses. These viruses are advantageous because of their ability to integrate their DNA into the genome of mammalian non-dividing cells.
(70) Sequences of exemplary constructs with BFP or mCherry are set forth in SEQ ID NOs: 15-17.
(71) Libraries
(72) The present inventors contemplate generating a library of the expression constructs described herein, each member encoding a unique gRNA sequence (being identified by its own bar-code sequence). It will be appreciated that the library comprises multiple copies of each member.
(73) An individual member of a library differs from other members of that library in the DNA nucleotide sequence of the targeting segment (the guide RNA) and further comprises a different barcode associated therewith. Thus, for example, each individual member of a library can comprise the same or substantially the same nucleotide sequence of the protein-binding segment as all other members of the library; and can comprise the same or substantially the same nucleotide sequence of the transcriptional termination segment as all other members of the library; but differs from other members of the library in the nucleotide sequence of the DNA targeting segment of the guide RNA. In this way, the library can comprise members that bind to different target nucleic acids.
(74) In another embodiment, each member of the library targets a different gene.
(75) It is further contemplated that members of the library differ from other members of the library in the detectable moiety (e.g. color of fluorescent protein) encoded thereon. For instance the present inventors contemplate that some members of the library will encode a green fluorescent protein, while other members encode a blue fluorescent protein etc.
(76) The library can comprise from about 3 individual members to about 10.sup.10 individual members; e.g., a library can comprise from about 10 individual members to about 10.sup.2 individual members, from about 10.sup.2 individual members to about 10.sup.3 individual members.
(77) Uses
(78) In order to use the CRISPR system, both gRNA and the CRISPR enzyme (e.g. Cas9) should be expressed in a target cell.
(79) Methods of introducing the construct(s) into a host cell are known in the art, and any known method can be used to introduce a nucleic acid (e.g., an expression construct) into a cell. Suitable methods include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery (see, e.g., Panyam et., al Adv Drug Deliv Rev. 2012 Sep. 13. pii: 50169-409X(12)00283-9. doi: 10.1016/j.addr.2012.09.023), and the like. The Cas protein can also be inserted as a purified protein.
(80) The CRISPR endonuclease enzyme may be encoded in the same constructs which encode the gRNA (i.e. combined in a single expression construct) or may be expressed from a different expression construct. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5′ with respect to (“upstream” of) or 3′ with respect to (“downstream” of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. A single promoter may drive expression of a transcript encoding a CRISPR enzyme and the gRNA sequence.
(81) Examples of CRISPR endonucleases include but are not limited to Cas9, dCas9, CPF1 and Cas13a. In one embodiment, the CRISPR endonuclease is coupled to a chromatin modifying protein, such as a methylating protein or a demethylating protein. Cas9 polypeptide sequences are provided in US Patent Application No. 20160298096, the contents of which are incorporated herein by reference.
(82) The constructs described herein are introduced into cell populations under conditions that allow the CRISPR enzyme (e.g. Cas9) to be targeted to DNA of the cells causing cleavage of the DNA at sites dictated by the gRNA.
(83) It will be appreciated that the present inventors contemplate introducing into cell populations a plurality of the gRNA constructs of the present invention, wherein each gRNA construct is targeted towards a unique target sequence. In this way it is possible to follow the effect of downregulating multiple factors in a single cell.
(84) In some embodiments, a genetically modified host cell has been genetically modified with an exogenous nucleic acid comprising a nucleotide sequence encoding a CRISPR enzyme (e.g., a naturally occurring Cas9; a modified, i.e., mutated or variant, Cas9; a chimeric Cas9; etc.). If such a cell is a eukaryotic single-cell organism, then the modified cell can be considered a genetically modified organism. In some embodiments, the non-human genetically modified organism is a Cas9 transgenic multicellular organism.
(85) In some embodiments, a genetically modified non-human host cell (e.g., a cell that has been genetically modified with an exogenous nucleic acid comprising a nucleotide sequence encoding a site-directed modifying polypeptide, e.g., a naturally occurring Cas9; a modified, i.e., mutated or variant, Cas9; a chimeric Cas9; etc.) can generate a genetically modified nonhuman organism (e.g., a mouse, a fish, a frog, a fly, a worm, etc.). For example, if the genetically modified host cell is a pluripotent stem cell (i.e., PSC) or a germ cell (e.g., sperm, oocyte, etc.), an entire genetically modified organism can be derived from the genetically modified host cell. In some embodiments, the genetically modified host cell is a pluripotent stem cell (e.g., ESC, iPSC, pluripotent plant stem cell, etc.) or a germ cell (e.g., primordial germ cell, sperm cell, oocyte, etc.), either in vivo or in vitro, that can give rise to a genetically modified organism. In some embodiments the genetically modified host cell is a vertebrate PSC (e.g., ESC, iPSC, etc.) and is used to generate a genetically modified organism (e.g. by injecting a PSC into a blastocyst to produce a chimeric/mosaic animal, which could then be mated to generate non-chimeric/non-mosaic genetically modified organisms; grafting in the case of plants; etc.). Any convenient method/protocol for producing a genetically modified organism, including the methods described herein, is suitable for producing a genetically modified host cell comprising an exogenous nucleic acid comprising a nucleotide sequence encoding a CRISPR enzymer (e.g., a naturally occurring Cas9; a modified, i.e., mutated or variant, Cas9; a chimeric Cas9; etc.). Methods of producing genetically modified organisms are known in the art. For example, see Cho et al., Curr Protoc Cell Biol. 2009 March; Chapter 19:Unit 19.11: Generation of transgenic mice; Gama et al., Brain Struct Funct. 2010 March; 214(2-3):91-109. Epub 2009 Nov. 25: Animal transgenesis: an overview; Husaini et al., GM Crops. 2011 June-December; 2(3):150-62. Epub 2011 Jun. 1: Approaches for gene targeting and targeted gene expression in plants.
(86) The constructs of the present invention are particularly useful for analyzing the transcriptome of individual cells.
(87) Thus, the present inventors contemplate generation of RNA samples from the individual cells. The RNA may be amplified in vitro using methods known in the art and as further described in US Application No. 20150307874 the contents of which being incorporated in its entirety.
(88) Optionally, if the constructs of the present invention encode a reporter polypeptide, the cells for analysis may be sorted by selecting cells which express said reporter polypeptide. When the reporter polypeptide is a fluorescent polypeptide (e.g. BFP or GFP), the cells may be selected using a FACS machine, or visualized by microscopy. When more than one gRNA construct is introduced into the cell, the present inventors contemplate that the different constructs will further express differently colored fluorescent polypeptides and cells which express each of these fluorescent polypeptides may be selected.
(89) According to a particular embodiment, when the gRNA is not encoded on the same expression construct as the CRISPR endonuclease protein, cells may be selected according to two reporter polypeptides a first reporter polypeptide encoded on the gRNA construct and a second reporter polypeptide encoded on the CRISPR endonuclease construct.
(90) For synthesis of cDNA, template mRNA may be obtained directly from lysed cells or may be purified from a total RNA sample. The total RNA sample may be subjected to a force to encourage shearing of the RNA molecules such that the average size of each of the RNA molecules is between 100-300 nucleotides, e.g. about 200 nucleotides. A reverse transcriptase reaction may be carried out to convert mRNA of the sample to cDNA. For this reaction a primer is used which comprises a polydT oligonucleotide sequence.
(91) Preferably the polydT primer sequence comprises at least 5 nucleotides. According to another is between about 5 to 50 nucleotides, more preferably between about 5-25 nucleotides, and even more preferably between about 12 to 14 nucleotides. The present inventors also contemplate using a random hexamer or octamer instead of the polydT primer.
(92) The present invention further contemplates that the primer comprises a RNA polymerase promoter sequence at its terminal 5′ end so as to be able to amplify the amount of RNA.
(93) RNA polymerase promoter sequences are known in the art and include for example T7 RNA polymerase promoter sequence—e.g. SEQ ID NO: 14 (CGATTGAGGCCGGTAATACGACTCACTATAGGGGC).
(94) Preferably, the primer also contains a barcode sequence which identifies the cell source.
(95) The primer may also comprise adaptor sequences to enable use of a next-generation sequencing platform (e.g. high throughput sequencer adapter).
(96) The term “next-generation sequencing platform” as used herein, refers to any nucleic acid sequencing device that utilizes massively parallel technology. For example, such a platform may include, but is not limited to, Illumina sequencing platforms.
(97) The term “high throughput sequencer adapter pair” refers to a specific nucleic acid pair that provides compatibility with a massively parallel sequencing platform (i.e., for example, Illumina sequencer adapter pairs). For example, an adapter pair may comprise the hybridization between a high throughput sequencing primer that is complementary to a high throughput sequencing primer binding site.
(98) Exemplary methods for preparing RNA samples from cell populations and single cells in particular for whole transcriptome analysis are provided in US Application No. 20150307874.
(99) Kits
(100) The constructs described herein may be provided in kits together with additional reagents for carrying out the above described methods.
(101) Thus, according to one embodiment, the kit comprises and an expression construct which comprises DNA encoding CRISPR endonuclease and the following expression construct:
(102) (i) a DNA sequence which encodes at least one guide RNA (gRNA) operatively linked to a transcriptional regulatory sequence so as to allow expression of said gRNA;
(103) (ii) a barcode sequence for identification of said at least one gRNA operatively linked to a transcriptional regulatory sequence so as to allow expression of said barcode sequence.
(104) Alternatively, the kit may comprise reagents which are necessary to carry out whole cell transcriptome analysis together with the expression constructs of the present invention. Such reagents include for example an oligonucleotide comprising a polydT sequence at its terminal 3′ end, a RNA polymerase promoter sequence at its terminal 5′ end and a barcode sequence positioned between said polydT sequence and the RNA polymerase promoter sequence.
(105) Preferably, each of these components are packaged in separate packaging.
(106) Additional reagents which may be included in the kit for whole transcriptome analysis include T4 RNA ligase, RNAseH, DNase, sequencing adaptors and/or a reverse transcriptase.
(107) The containers of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other containers, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a container.
(108) When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution. However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent.
(109) A kit will preferably include instructions for employing, the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
(110) Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
(111) Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
(112) Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Md. (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Culture of Animal Cells—A Manual of Basic Technique” by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; “Oligonucleotide Synthesis” Gait, M. J., ed. (1984); “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., eds. (1985); “Transcription and Translation” Hames, B. D., and Higgins S. J., eds. (1984); “Animal Cell Culture” Freshney, R. I., ed. (1986); “Immobilized Cells and Enzymes” IRL Press, (1986); “A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, Calif. (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Materials and Methods
(113) Mice:
(114) Cas9-GFP transgenic mice were previously described (Platt et al., 2014). A founding breeding pair was purchased from The Jackson Laboratory. These mice were bred in the Weizmann Institute animal facility and backcrossed with wild-type black (C57Bl/6); their progeny was crossed to produce Cas9-GFP homozygotes on a cleaner C57Bl/6 background. In all experiments, wild-type black or Cas9-GFP young adult (7-11 weeks old) females were used. Mice were provided with food and water ad libitum and housed under a strict 12-hour light-dark cycle. All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC).
(115) Single Guide RNA and Unique gRNA Index (UGI):
(116) For targeted loss-of-function screening using cell cytometry, the lentiviral vector lentiGuide-Puro (Platt et al., 2014) (plasmid #52963, Addgene) was used and the puromycin resistance marker coding sequence (CDS) was replaced with either fluorophore EBFP or mCherry CDS. The gRNA cannot be identified during single-cell gene expression library construction, due to its short size and lack of a polyadenylation tail. Therefore, to detect the gRNA in single cells in experiments where a mix of lentiGuide vectors with different gRNA are used, a unique gRNA identifier (UGI) barcode was expressed at the 3′ end of the fluorophore transcript, immediately downstream to the Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (Zufferey et al., 1999) and upstream to the polyadenylation signal in the lentiviral construct (
(117) Lentivirus Production:
(118) LentiGuide-UGI lentiviral particles were produced by transfecting 293T cells together with packaging plasmids, using the jetPEI transfection reagent (Polyplus-transfection) according to the manufacturer's instructions and following the standard lentivirus production protocol (Klages et al., 2000). Transfection efficiency was assessed by microscopic inspection of cell fluorescence one day later. Media was replaced with RPMI medium without additives 18 h post transfection, and media containing virus particles were collected 48 and 72 h post transfection. Virus particles were concentrated using Amicon 100 KDa 15 mL columns (Millipore) in a cold centrifuge at 2000×g to a final concentration of 200-250 μl per virus, aliquoted and stored at −80° C. until use.
(119) Isolation and Culture of Bone Marrow-Derived Myeloid Cells:
(120) Mice were sacrificed by cervical dislocation. To isolate the bone marrow, femora and tibiae from one leg were removed, cleaned from flesh, and flushed with C10 culture medium (RPMI supplemented with 15% serum, 1%×100 non-essential amino acids, 10 mM Hepes buffer, 1 mM sodium pyruvate, 2 mM L-glutamine, 1% L-glutaine and 50 μM b-mercaptoethanol) using a G21 needle syringe. The bone marrow was filtered through a 70-μm cell strainer and spun down in a cold centrifuge at 300×g for 5 min. Cells were resuspended in 250 μl red blood cell lysis solution (Sigma) per leg and incubated for 5 min at room temperature, washed, and resuspended in C10 medium. Cultures were set by plating 6×10.sup.5 cells in 1 ml C10 supplemented with 15 ng/ml GM-CSF in a 6-well non-tissue culture plate, and incubated under standard culture conditions (37° C., 5% CO.sub.2). Cells were infected on culture day 2 by adding lentivirus and 8 μg/ml polybrene, and plates were centrifuged 1000×g at 37° C. for 45 min to enhance infection. At the end, 1 ml C10+GM-CSF was added. Cells were fed with 200 μl C10 supplemented with 30 ng/ml GM-CSF every second day.
(121) Flow Cytometry and Single-Cell Capture:
(122) On day 7, cells were either treated with 100 ng/ml lipopolysaccharide (LPS) for 4 h or left untreated as control. To obtain cell suspension, cells were scraped from the well, washed and resuspended in cold FACS buffer (0.5% BSA and 2 mM EDTA in phosphate-buffered saline), stained with fluorophore-conjugated anti-mouse CD11c (and CD11b where indicated) antibody (BioLegend), and filtered through a 40-μm strainer. Cell sorting was performed using a BD FACSAria Fusion flow cytometer (BD Biosciences), gating for GFP (Cas9), and relatively high BFP or mCherry fluorescence (
(123) In Vivo CRISP-Seq Assay:
(124) Hematopoietic stem cells (HSCs) and multiple pluripotent progenitors (MPPs) were isolated from the bone marrow of Cas9-GFP donor mice, infected with a pool of CRISP-seq lentivirus containing the BFP fluorophore gene and different gRNAs, and injected into wild-type recipient mice (
(125) CRISP-Seq Library Preparation:
(126) Libraries of single-cell gene expression (MARS-seq) and single-cell gRNA detection (UGI-seq) together with CRISP-seq, were prepared in parallel. For automated library production, Bravo robot station was used in combination with Nanodrop Express (BioNex, San Jose, Calif.). MARS-seq libraries were prepared as previously described (Jaitin et al., 2014). Briefly, mRNA from sorted cells was simultaneously barcoded, converted into cDNA and pooled using an automated pipeline. The pooled samples were then linearly amplified by T7 in vitro transcription (IVT). After DNase treatment, the samples were cleaned up with 1.2×SPRI beads and the amplified RNA (aRNA). Half of the aRNA was fragmented and converted into a sequencing-ready library by tagging the samples with pool barcodes and Illumina sequences during ligation, RT, and PCR. For the corresponding gRNA information in each cell, a UGI-seq library was obtained from 10-12% of the aRNA material, and processed in parallel as follows: Fragmentation was skipped and ligation was done together with MARS-seq samples, using the UGI ligation primer (Table 1; pool barcode was added at a later step). Ligation cleanup and the subsequent reverse transcription (RT) reaction were the same as for MARS-seq samples, except for the use of a different RT primer (Table 1). Then, an intermediate 10-cycle PCR step was done to amplify and add pool barcodes, using a barcoded forward primer and the reverse primer used in MARS-seq final step (Table 1); PCR conditions were the same as in MARS-seq. Finally, another PCR reaction, as in MARS-seq, was done to complete and enrich the UGI-seq library. The resulting CRISP-seq product is a MARS-seq library and a corresponding UGI-seq library. Library quality assessment and concentration measurements were performed as previously described (Jaitin et al., 2014).
(127) TABLE-US-00001 TABLE 1 Primers used for UGI-seq library construction Primer name Sequence UGI ligation ATGATCAAGCGACCACCGAG (SEQ ID NO: 2), adapter modified with a phosphate group at the 5′ end, and a C3 spacer (blocker) at the 3′ end Second RT CTCGGTGGTCGCTTGATCAT (SEQ ID NO: 3) UGI primer Barcoded PCR CTACACGACGCTCTTCCGATCTNNNNNXXXXTCCCC forward GCGTCGACGGATC (SEQ ID NO: 4), N = random base and XXXX = 4-bases plate barcode P7_Rd2 PCR CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTT reverse CAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 5)
(128) Sequencing and Low-Level Processing:
(129) CRISP-seq libraries, pooled at equimolar concentrations, were sequenced using an Illumina NextSeq 500 sequencer, at a sequencing depth of 60K-80K reads per cell for MARS-seq and about 4K reads per cell for UGI-seq. Reads are condensed into original molecules by counting same random molecular tags (RMT, a.k.a. unique molecular identifier or UMI). Statistics on empty-well spurious RMT detection was used to ensure that the batches we used for analysis showed a low level of cross-single-cell contamination (less than 1%).
(130) CRISP-seq reads were processed as previously described (Gury-BenAri et al., 2016). Mapping of reads was done using HISAT (version 0.1.6); reads with multiple mapping positions were excluded. Reads were associated with genes if they were mapped to an exon, using the UCSC genome browser for reference. Exons of different genes that shared genomic position on the same strand were considered a single gene with a concatenated gene symbol. Cells with less than 1500 UMIs were discarded from the analysis. Genes with mean expression smaller than 0.005 RMTs/cell or with above average expression and low coefficient of variance (<1.2) were also discarded.
(131) UGI-Seq Low-Level Processing:
(132) Sequenced reads containing the UGI-seq 5′ primer (TCCCCGCGTCGACGGATCC—SEQ ID NO: 6) up to 2 bp mismatches were extracted for further UGI-seq processing. Plate barcode, cell-specific barcode (7 bp), Random Molecular Tags (RMT—8 bp) and Unique Guide Identifier (UGI—8 bp) was extracted for each read. Reads with low quality (Phred<27) or without a valid UGI sequence (up 1 bp mismatch), cell barcode (up 1 bp mismatch), or plate barcode (exact match) were discarded. Sequencing errors within a RMT may undermine the UGI counts by creating spuriously identified molecules from real molecules; this number is expected to increase linearly with sequencing depth. As UGI molecules were over-sequenced, these ‘satellite’ reads were easily detectable, and real molecule reads (in log scale) were normally distributed with an average of 2.sup.10 duplicated triplets (cell barcode, RMT, UGI) and a standard deviation of 2. Triplets with less than 30 reads were discarded as errors (p<0.01, see
(133) Graph-Based Clustering Analysis:
(134) In order to assess the heterogeneity of cells in the samples, the PhenoGraph clustering algorithm was used (Levine et al., 2015). Briefly, low-level processing of CRISP-seq reads results in a matrix U with n rows and m columns, where rows represent genes and columns represent cells. Entry Uij contains the number of unique molecular identifiers (UMIs) from gene i that were found in cell j. The first step of the algorithm is to build a graph structure from this expression matrix. PhenoGraph first builds a k-Nearest Neighbors (kNN) graph using the Euclidean distance (we chose k=30 and tested k=15, 20, 25, 30, 40, 50, and got very similar results, not shown) and then refines this graph with the Jaccard similarity coefficient, where the edge weight between each two nodes is the number of neighbors they share divided by the total number of neighbors they have (Levine et al., 2015). To partition the graph into modules/communities PhenoGraph uses the Louvain Method (Blondel et al., 2008).
(135) The graph is constructed and partitioned into modules based on the expression profile of the cells. The genotype information obtained from UGI-seq can now be overlayed to calculate the enrichment of gRNA within clusters. The UGI enrichment p-value within each cluster can be calculated using the hyper geometric distribution, where N is the total number of cells, K is the number cells with UGI.sub.A, n is the size of cluster c.sub.i and k is the number of cells with UGI.sub.A in cluster c.sub.i. The probability of drawing k or more cells with UGI.sub.A is:
(136)
(137) Graph Based Label Refinement Algorithm:
(138) UGI-seq provides information on the expression of the reporter gene introduced in our lentivirus construct. This information is translated to a specific gRNA which was integrated together with the reporter gene. This gRNA will target Cas9 to a specific gene locus, but only in 70-80% will generate true loss-of-function of the targeted gene (Sternberg and Doudna, 2015). In other cases, Cas9 may generate a non-harmful mutation (such as in-frame deletion) or no mutation at all. This implies that in 20-30% of the cells with a unique guide index, the gene can be active or partially active and show a wild-type phenotype (false positive). On the other hand, as single-cell data is sparse by nature, cells with true edited gene loss-of-function can remain undetected by UGI-seq, becoming false negative events. The single-cell RNA detection error is quantified as 20% by comparing UGI-seq to FACS-based detection of the BFP fluorophore. In order to overcome the noisy and missing genotype label problem, a label refinement algorithm was used that can modify the labels themselves. This algorithm is based on the assumption that the labels (=genotype) of the cells are consistent with their nearest neighborhoods, i.e. that cells sharing the same knockout mutation will have similar phenotype and this phenotype is distinct from the wild-type phenotype. The input data dataset S=(X, Y). The expression matrix is denoted as X, where X={x.sub.1, x.sub.2, . . . , x.sub.N} each cell expression x∈.sup.M is an M-dimensional vector. Their corresponding UGI labels are Y={y.sub.1, y.sub.2, . . . , y.sub.N}, where y∈{0,1}.sup.K is a binary vector representing the UGIs detected in each cell. Our algorithm refines each UGI label separately. Based on the expression matrix we first build a Jaccard graph, similar to a PhenoGraph construction of the graph. An initial kNN graph in constructed based on the Euclidean distance between cells and the Jaccard index is calculated for every pair of nodes. The weight between nodes i and j, is given by:
(139)
where v(i) is the k-neighborhood of cell i. Our two step algorithm first remove labels which disagree with their neighborhood and then assign labels to cells with significant neighbor's enrichment. For each cell, we define a neighborhood score for each UGI u as the sum of the Jaccard coefficients with all other labeled nodes in the graph:
(140)
(most coefficients will be zero as most cells do not share common neighbors in the kNN graph). To calculate the p-value of observing this score at random, we used bootstrapping, shuffling the labels randomly 100K times and counting the number of times s(i) is bigger than the score obtained in each shuffled graph. Labels were removed from cells with p-value >0.05. In the next step, we repeated this process with the new filtered labels and added labels for cells with p-value <0.001. Changing the bounds within a reasonable range (0.01-0.2 for filtering out labels and 0.01-1e-5 for adding labels) modified the total number of labeled cells, but they still remained in the same neighborhood.
(141) Perturbation Fold Change Analysis:
(142) The present inventors calculated the perturbation effect for each gene knockout by comparing perturbed cells with the corresponding control group. Groups were selected either by label refined cells vs. all control cells (
(143) CRISPR/Cas9 Editing Assessment (Indel-Seq Analysis)
(144) Cell Sorting:
(145) About 4,000 cells per sample were sorted into a microfuge tube already containing 500 μl of cold FACS buffer. Tubes were gently vortexed and cells were pelleted in a cold centrifuge, at 1,500×g for 15 min at 4° C., to aspirate most of the supernatant, leaving about 50 μl, and stored at −80° C. until further processing.
(146) Genomic DNA Extraction:
(147) Cells were lysed by three cycles of freeze/thaw by 37° C. and dry ice incubation of 3 min each. Then SDS was added to a final concentration of 0.5% and the samples were incubated for 5 min at room temperature. Then, samples were incubated in RNase, DNase-free (Roche), 0.5 μl per 50 μl sample, for 30 min at 37° C. Next, two units of proteinase K (NEB) and 5 nM EDTA were added and samples were incubated at 37° C. for 2 h, followed by incubation at 65° C. overnight. Alternatively, samples were incubated at 37° C. for 30 min and then at 95° C. for 10 min. Genomic DNA was cleaned up using 2.5 volumes of SPRI beads, and mass concentration was measured in a Qubit fluorometer with high-sensitivity DNA reagents (ThermoFisher Scientific).
(148) Indel-Seq Library Construction:
(149) Libraries were constructed around each exon-specific region in two PCR reactions, using target-specific primers with Illumina partial tags as overhangs for PCR1, and a second PCR to amplify and add the missing parts for Illumina sequencing (Table 2). PCR1 protocol: To 5 ng of genomic DNA add 2 μl primer mix at 10 μM each primer, 25 μl 2×KAPA high-fidelity PCR mix (KAPA Biosystems, Roche), 50 μl reaction volume, 28 cycles. PCR program: 2 min at 98° C., 2 min, 28×[20 sec. at 98° C., 30 sec. at 60° C., 40 sec. at 72° C.], 5 min at 72° C., 4° C. end. Clean up the PCR1 product with 40 μl of SPRI beads (0.8 volumes). Measure concentration and assess expected size in a TapeStation instrument using high-sensitivity DNA reagents (Agilent Technologies) before PCR2. PCR2 protocol: To 5 ng of PCR1 product, add 1 μl of 10 μM P5_Rd1 primer, 1 μl of 10 μM indexed reverse primer, choosing specific barcodes for each sample, 10 μl 2×KAPA high-fidelity PCR mix, 20 μl reaction volume, 5 cycles. PCR program: 2 min at 98° C., 2 min, 2 cycles×[20 sec. at 98° C., 30 sec. at 58° C., 45 sec. at 72° C.], 3 cycles×[20 sec. at 98° C., 30 sec. at 65° C., 45 sec. at 72° C.], 5 min at 72° C., 4° C. end. Clean up the PCR2 product with one volume of SPRI beads. Measure molar concentration with Qubit and TapeStation. Indel-seq libraries were sequenced using a Miseq Illumina sequencer and the primers listed in Table 2.
(150) TABLE-US-00002 TABLE 2 Primers used for Indel-seq library construction Primer name Sequence Cebpb Indel- ACACGACGCTCTTCCGATCTCCTGGTAGCCCAGGTA seq pRd1 GGC (SEQ ID NO: 7) Cebpb Indel- CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTCCG seq pRd2 ACCTCTTCGCCG (SEQ ID NO: 8) Itgam Indel- ACACGACGCTCTTCCGATCTTGTCTGGTTAACAGCC seq pRd1 TTTG (SEQ ID NO: 9) Itgam Indel- CTGGAGTTCAGACGTGTGCTCTTCCGATCTCCATTT seq pRd2 CCCATCCTAACTTC (SEQ ID NO: 10) P5-Rd1 AATGATACGGCGACCACCGAGATCTACACTCTTTCC forward CTACACGACGCTCTTCCGATCT (SEQ ID NO: 11) P7-i7-pRd2 CAAGCAGAAGACGGCATACGAGATXXXXXXXGTGAC reverse TGGAGTTCAGACGTGTGCT, XXXXXXX = 7 bases index (SEQ ID NO: 12)
Example 1
CRISP-Seq: An Integrated Method for Single-Cell RNA-Seq and CRISPR Pooled Screens
(151) To elucidate the function of multiple regulatory factors at single-cell and genome-wide resolution, CRISP-seq was developed, an integrated method for pooled CRISPR/Cas genome editing followed by massively parallel single-cell RNA-seq. For this protocol, a scalable lentiviral backbone (CRISP-seq vector) was engineered that takes full advantage of the combination of massively parallel single-cell RNA-seq with FACS index sorting. In addition to a gRNA expression cassette, the lentivirus includes a unique gRNA index (UGI), which is transcribed and allows the identification of the gRNA from single-cell RNA-seq data (
(152) The CRISP-seq protocol is highly reproducible for identifying the transcriptome in combination with the gRNA (
(153) To evaluate the potential of applying CRISP-seq for multiplexed genome editing, the accuracy of detecting individual gRNAs and their combinations was assessed. For this purpose, an mCherry fluorescent marker was cloned together with a gRNA targeting the Cebpb gene, and bone marrow cells were infected with a combination of mCherry/Cebpb-gRNA and BFP/Itgam-gRNA. Myeloid cells were sorted for massively parallel single-cell RNA-seq analysis and indexed for BFP, mCherry, and CD11b intensities. Successful Cas9 editing cleaves the gRNA complementary seed sequence in the DNA, creating mutations and small insertions and deletion (indels), but do not necessarily impact RNA expression directly. Because transcription factors are often regulated through auto-regulatory loops, their mRNA expression can potentially serve as a proxy for gRNA activity. The comparison of Cebpb mRNA expression vs. mCherry intensities (Cebpb-gRNA.sup.+) in single cells showed a strong correlation between the mCherry signal and Cebpb expression (
(154) Together, these results demonstrate the robustness of combining massively parallel single-cell RNA-seq and a unique guide index strategy for accurate identification of gRNA or combinations of gRNAs in single cells.
Example 2
CRISP-Seq Analysis Identifies a Major Role for Cebpb in Monocyte Development
(155) Next, the effectiveness of CRISP-seq was assessed in deciphering the function of genetic elements in a multiplexed experiment. The myeloid compartment is composed of environmental plastic cells with functional diversity in both cell state and response (Ginhoux and Jung, 2014; Glass and Natoli, 2016; Gosselin et al., 2014; Lavin et al., 2015; Lavin et al., 2014). To better understand the pathways regulating this complexity, bone marrow cells were infected with a combination of response (mCherry/Rela-gRNA) and developmental (BFP/Cebpb-gRNA) regulators, and CD11c±myeloid cells were sorted for CRISP-seq with index for BFP and mCherry intensities. Unsupervised graph-based clustering analysis (PhenoGraph (Levine et al., 2015)) identified three major myeloid cell types in the culture (
(156) To further characterize these populations and their response to pathogens bone marrow cells were infected with the same combination of Cebpb and Rela gRNAs and the myeloid culture was stimulated with the toll-like receptor 4 (TLR4) agonist lipopolysaccharide (LPS), a purified component from gram-negative bacteria, for 4 hours prior to sorting. Clustering analysis identified the same three cell types (i.e., monocytes, immature and mature DCs), which exhibited highly diverse responses to LPS (
Example 3
Decoupling of Antiviral and Inflammatory Pathways by Multiplexed Perturbations
(157) To better characterize the genotype-to-phenotype relation in single cells by CRISP-seq and to identify multiplexed perturbations, the present inventors developed an algorithm that would most accurately detect perturbed single cells with distinct phenotypes. Their framework relies on the assumption that cells with similar genotypes will be in closer proximity in the phenotypic space; hence, a cell with a true loss-of-function hit will generate a similar phenotype that is different from in-frame mutations or non-targeted cells. Using this assumption, they sought to overcome two sources of potential outliers in their data, namely false positives and false negative cells. Regarding the former, targeting of Cas9 to specific gene locus generates loss-of-function mutation/indels in up to 80% of the loci (Sternberg and Doudna, 2015). This implies that for any single cell for which a UGI was detected, there is at least a 20% chance that the targeted gene is fully or partially active. Conversely, with the current CRISP-seq/UGI strategy, up to 20% of the cells will remain undetected, but can potentially carry the knockout. In order to overcome the noisy and missing genotype labeling, the present inventors developed a label refinement algorithm based on k-Nearest Neighbors (kNN) graph (Blondel et al., 2008; Girvan and Newman, 2002; Levine et al., 2015) to correct the genotype labeling based on the genotype of neighboring cells (
(158) To evaluate the effect of monocytic cells perturbed for multiplexed inflammatory and antiviral pathways, the present inventors infected bone marrow cultures with a pool of gRNAs targeting Rela and Irf9, known regulators of the two pathways, respectively. Then, they stimulated the culture with LPS for 4 hours and sorted cells (GFP.sup.+CD11c.sup.+) for CRISP-seq analysis (
Example 4
Perturbations of Developmental and Signaling-Dependent TFs Reveal the Rewiring of Regulatory Circuits in Myeloid Cells
(159) In order to extend the analysis to a larger group of TFs regulating the inflammatory and antiviral circuits as well as probe for the role of these pathways in other cell types, the present inventors infected bone marrow cells with mixtures of Cebpb, Irf9, Irf8, Irf4, Stat1, Stat2, Rela and Nfkb1 gRNAs, and performed CRISP-seq on 6749 cells. Clustering analysis identified similar cell states as in previous perturbations, including two DC states enriched for Cebpb, and monocyte cells that are perturbed in the antiviral response module (Stat1, Stat2, Irf8 and Irf9) and in the inflammatory module (Rela and Nfkb1) (
(160) The present inventors next addressed the rewiring of the same inflammatory and antiviral circuits in other myeloid cell types. They analyzed only factors perturbed in more than 30 cells, namely Rela and Stat2. Knockout of Stat2 in DC mimicked to a large degree the effects observed in monocytes, namely perturbation of a large set of antiviral genes (
Example 5
In Vivo CRISP-Seq Analysis Uncover the Complexity of Myeloid Regulatory Circuits in Immune Niches
(161) In vitro models identify many aspects of gene regulation and cellular function, but do not recapitulate the full complexity of physiological interactions of diverse cell types within specific tissues (Chen et al., 2015). Immune niches within the spleen, lymph node, brain or tumor represent a highly complex and dynamic network of interactions of various immune and non-immune cell types. Understanding the precise function of different regulatory circuits in these niches is important for both basic and clinical research. To study the regulatory function of developmental and signaling-dependent factors in immune niches, Lin− Sca1+ c-kit+ (LSK) hematopoietic progenitors were sorted from GFP-labeled Cas9 knockin mice, and infected with a pool of Cebpb, Irf8, Rela, Stat1, Stat2, and two control gRNAs (
(162) To focus on the regulation of myeloid cell response to pathogens in the splenic niche, four hours following LPS stimulation 2768 splenic myeloid cells (CD11b.sup.+ or CD11c.sup.+) positive for GFP and BFP were sorted for CRISP-seq analysis. Unsupervised analysis of the single myeloid cells identified nine myeloid cell types and states (
(163) Focusing on the perturbations of Stat1 or Stat2 resulted in largely overlapping phenotypes enriched for different activation states of monocytes, pDCs and cDCs (
Discussion
(164) Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
(165) All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.