DISRUPTIONS OF PDCD1, ADORA2A, AND CTLA4 GENES AND USES THEREOF
20240366667 ยท 2024-11-07
Inventors
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N15/87
CHEMISTRY; METALLURGY
C12N2310/51
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N15/1068
CHEMISTRY; METALLURGY
C12N15/1096
CHEMISTRY; METALLURGY
A61K2239/38
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
C12N15/1096
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C12N2310/20
CHEMISTRY; METALLURGY
A61K39/4611
HUMAN NECESSITIES
C12N2740/16043
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K2239/00
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
International classification
A61K35/17
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Provided are methods for disrupting Pdcd1, Adora2a, and Ctla4 genes using a Cas and guide RNAs targeting the three genes. Also provided are methods for treatment of cancers and/tumors by administering to subjects in need thereof engineered immune cells wherein the Pdcd1, Adora2a, and Ctla4 genes are disrupted in the engineered immune cells and wherein the engineered immune cells optionally further comprise a chimeric antigen receptor for targeting cancer or tumor cells.
Claims
1. A method for disrupting a Pdcd1 gene, an Adora2a gene, and an Ctla4 gene in a cell, comprising: introducing into a cell a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting the Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting the Adora2a gene, and a third gRNA comprising a third spacer sequence targeting the Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
2. The method of claim 1, wherein the method comprises introducing into the cell one or more polynucleotides encoding the Cas and the first, second, and third gRNAs.
3. The method of claim 1, wherein the Cas is pre-complexed with one or more of the first, second, and third gRNAs.
4. The method of claim 1, wherein the Cas pre-complexed with one or more of the first, second, and third gRNAs are introduced into the cell via electroporation.
5. The method of claim 1, wherein the first, second, and third gRNAs are single-molecule guide RNAs (sgRNAs).
6. The method of claim 1, wherein the first, second, and third gRNAs comprises SEQ ID NOs: 1, 2, and 3, respectively.
7. The method of claim 1, wherein the cell is an immune cell.
8. The method of claim 1, wherein the cell is a lymphocyte cell.
9. The method of claim 1, wherein the cell is a T cell.
10. The method of claim 1, wherein the Cas is a wild-type Cas9 or variant thereof.
11. The method of claim 1, further comprising: introducing into the cell a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
12. The method of claim 1, further comprising: introducing into the cell a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
13. The method of claim 11, wherein the cytoplasmic domain comprises a CD247 cytoplasmic domain.
14. The method of claim 11, wherein the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
15. A method of treating cancer or tumor in a subject in need thereof, comprising administering to the subject an engineered immune cell comprising: a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
16. The method of claim 15, wherein the method comprises administering to the subject an engineered immune cell comprising one or more polynucleotides encoding the Cas and the first, second, and third gRNAs.
17. The method of claim 15, wherein the first, second, and third gRNAs are single-molecule guide RNAs (sgRNAs).
18. The method of claim 15, wherein the first, second, and third gRNAs comprises SEQ ID NOs: 1, 2, and 3, respectively.
19. The method of claim 15, wherein the engineered immune cell is an engineered lymphocyte.
20. The method of claim 15, wherein the engineered immune cell is an engineered T cell.
21. The method of claim 15, wherein the Cas is a wild-type Cas9 or variant thereof.
22. The method of claim 15, wherein the engineered immune cell comprises a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
23. The method of claim 15, wherein the engineered immune cell comprises a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
24. The method of claim 22, wherein the cytoplasmic domain comprises a CD247 cytoplasmic domain.
25. The method of claim 22, wherein the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
26. A vector comprising one or more of nucleotide sequences wherein the nucleotide sequences are selected from: (a) a first nucleotide sequence encoding a first gRNA comprising a spacer sequence complementary with a first target domain of the Pdcd1 gene; (b) a second nucleotide sequence encoding a second gRNA comprising a second spacer sequence complementary with a second target domain of the Adora2a gene; (c) a third nucleotide sequence encoding a third gRNA comprising a third spacer sequence complementary with a third target domain of the Ctla4 gene; and (c) a fourth nucleotide sequence encoding a Cas.
27. The vector of claim 26, further comprising a fifth nucleotide sequence encoding a CAR and a promoter.
28. The vector of claim 26, wherein the vector is selected from an AAV vector, an adenovirus vector, retrovirus, a vaccinia virus vector, a herpes simplex virus vector, and a lentiviral vector.
29. A cell comprising: a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting an Ctla4 gene; or comprising: one or more polynucleotides encoding a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene.
30. (canceled)
31. The cell of claim 29, further comprising a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
32. The cell of claim 29, further comprising: a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
33. The cell of claim 29, wherein the cell is a T cell from a human subject.
34. The cell of claim 29, wherein the cell is a T cell from a human subject having cancer or tumor.
35. A pharmaceutical composition comprising a population of the T cell of claim 3.
36. A kit comprising a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene; or comprising one or more vectors comprising one or more nucleotide sequences encoding a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, and a CAR.
37.-39. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION
[0030] All publications cited in this specification are herein incorporated by reference as though fully set forth. If certain content of a reference cited herein contradicts or is inconsistent with the present disclosure, the present disclosure controls.
[0031] Any one embodiment of the disclosure described herein, including those described only in one section of the specification describing a specific aspect of the disclosure, and those described only in the examples or drawings, can be combined with any other one or more embodiment(s), unless explicitly disclaimed or improper.
[0032] Although any methods and materials similar or equivalent to those described herein may be used in the practice for testing of the present disclosure, exemplary materials and methods are described herein.
Definitions
[0033] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.
[0034] As used in this specification and the appended claims, the singular forms a, an, and the include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to a cell includes one, two, or more cells, and the like.
[0035] The terms polynucleotide and nucleic acid are used interchangeably herein to refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. A polynucleotide disclosed herein may be modified, e.g., with a labeling group such as a fluorophore, with a biotin, or with a phosphorothioate.
[0036] The terms peptide, polypeptide, and protein are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The terms also include polypeptides that have co-translational (e.g., signal peptide cleavage) and post-translational modifications of the polypeptide, such as, for example, disulfide-bond formation, glycosylation, acetylation, phosphorylation, proteolytic cleavage, and the like. A peptide disclosed herein may be modified, e.g., with a labeling group such as a fluorophore, a biotin, a His tag, or phosphorothioate.
[0037] Furthermore, as used herein, a polypeptide refers to a protein that includes modifications, such as deletions, additions, and substitutions (generally conservative in nature as would be known to a person in the art) to the native sequence, as long as the protein maintains the desired activity. These modifications can be deliberate, as through site-directed mutagenesis, or can be accidental, such as through mutations of hosts that produce the proteins, or errors due to PCR amplification or other recombinant DNA methods.
[0038] The term subject means any animal such as a mammal, e.g., a human.
[0039] The term cancer antigen or tumor antigen refers to any antigen that expresses specifically on a cancer or tumor cell. For example, cancer or tumor antigens include those antigens that have high, homogeneous expressions in cancers or tumors but not in healthy tissues. For instance, cancer or tumor antigens include Her 2, Claudine 18.2, CD19, BCMA, CD20, NYESO-1, MAGE-1, Tyrosinase, MUC1, CEA, Mam-A, hTERT, Sialyl-Tn, WT1,-FetoProtein, CA-125, gp-100, p53, Rax, Src, AFP, PSA, and the like.
[0040] The term chimeric antigen receptor (CAR, also known as chimeric immunoreceptor, chimeric T cell receptor or artificial T cell receptor) refers to a cell-surface receptor comprising an extracellular antigen binding domain, a transmembrane domain, and one or more cytoplasmic co-stimulatory signaling domains not naturally found together on a single receptor protein. A CAR may comprise an extracellular hinge region (e.g., a flexible spacer) between the extracellular antigen binding domain and the transmembrane domain. A CAR may combine an antigen-binding domain, a hinge domain, a transmembrane domain, a co-stimulatory domain, and CD247 into a single receptor.
[0041] The term immune cells refers to cells of the immune system in animals, including neutrophils, eosinophils, basophils, mast cells, monocytes, macrophages, dendritic cells, natural killer cells, and lymphocytes (e.g., B cells and T cells). T cells comprise CD4 cells, CD8+ cells, gamma delta T cells (T cells), NK T cells and/or regulatory T cells (Treg).
[0042] The term engineered cells refer to cells that are genetically engineered, including the cells in which one or more genes are disrupted, and optionally engineered to express a CAR.
[0043] The term engineered immune cells refer to immune cells that are genetically engineered, including the cells in which one or more genes are disrupted, and optionally engineered to express a CAR.
[0044] Vector refers to a polynucleotide capable of being duplicated within a biological system or that can be moved between such systems. Vector polynucleotides typically contain elements, such as origins of replication, polyadenylation signal or selection markers, that function to facilitate the duplication or maintenance of these polynucleotides in a biological system, such as a cell, virus, animal, plant, and reconstituted biological systems utilizing biological components capable of duplicating a vector. The vector polynucleotide may be DNA or RNA molecules, cDNA, or a hybrid of these, single stranded or double stranded.
[0045] As used herein, affinity refers to the strength of the sum total of noncovalent interactions between a molecule or a molecular structure (e.g., a ligand) and its binding partner (e.g., a receptor). The affinity of a molecule for its partner can generally be represented by the equilibrium dissociation constant (K.sub.D) (or its inverse equilibrium association constant, K.sub.A). Affinity can be measured by common methods known in the art, including those described herein. See, for example, Pope M. E., Soste M. V., Eyford B. A., Anderson N. L., Pearson T. W., (2009) J. Immunol. Methods. 341 (1-2): 86-96 and methods described therein.
[0046] As used herein, the term specifically bind or bind to, or recognizes refers to binding that is measurably different from a non-specific interaction. For example, in some embodiments, a binding molecule, such as a single domain antibody, specifically binds to a target molecule, such as an antigen, when the binding molecule reacts or associates more frequently, more rapidly, with greater duration, and/or with greater affinity with the particular target molecule than it does with alternative molecules. A binding molecule specifically binds to an antigen if it binds with greater affinity, avidity, more readily, and/or with greater duration than it binds to other molecules. It is understood that a binding molecule that specifically binds to a first target may or may not specifically bind to a second target. As such, specific binding does not necessarily require (although it can include) exclusive binding. In some embodiments, specific binding can be determined, for example, by comparing binding of a particular antibody to binding of an antibody that does not bind to a particular antigen. Specific binding for a particular antigen can be shown, for example, when a binder partner has a K.sub.D for an antigen of at least about 10.sup.4 M, at least about 10.sup.5 M, at least about 10.sup.6 M, at least about 10.sup.7 M, at least about 10.sup.8 M, at least about 10.sup.9 M, at least about 10.sup.10 M, at least about 10.sup.11 M, at least about 10.sup.12 M, or greater, where Kp refers to a dissociation rate of the a binder partner/antigen interaction. In some embodiments, a binder partner that specifically binds an antigen will have a K.sub.D that is 20, 50, 100, 500, 1000, 5,000, 10,000 or more times greater than the K.sub.D of a binder partner that does not bind to the same antigen. In some embodiments, the binding between a binder partner and a particular antigen can be shown by an EC50 value, determined using suitable methods known in the art, including, for example, flow cytometry assay.
[0047] As used herein, a composition refers to any mixture of two or more products, substances, or compounds, including but not limited to, proteins, antibodies, polynucleotides, vectors, or cells. It may be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous, or any combination thereof.
[0048] As used herein, a pharmaceutical composition refers to an active pharmaceutical agent formulated in pharmaceutically acceptable or physiologically acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will also be understood that, if desired, the compositions of the disclosure may be administered in combination with other agents, such as, e.g., cytokines, growth factors, hormones, small molecules, chemotherapeutics, pro-drugs, drugs, antibodies, or other various pharmaceutically active agents. There is virtually no limit to other components that may also be included in the compositions, provided that the additional agents do not adversely affect the ability of the composition to deliver the intended therapy. Some non-limiting examples of the components that could be included in the composition are carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, and/or excipients. The pharmaceutical composition facilitates administration of the engineered cells described herein to a subject. Multiple techniques of administration exist in the art including, but not limited to, intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary, and topical administration.
[0049] As used herein, the term pharmaceutically acceptable refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of a therapeutic compound, and is relatively nontoxic, i.e., the material may be administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. Pharmaceutically acceptable components include those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0050] As used herein, an effective amount or therapeutically effective amount refers to an amount of a pharmaceutical composition which is sufficient to significantly and positively modify the symptoms and/or conditions to be treated (e.g., provide a positive clinical response). The effective amount of a pharmaceutical composition will vary with the particular condition being treated, the severity of the condition, the duration of treatment, the nature of concurrent therapy, the particular composition being employed, the particular pharmaceutically-acceptable excipient(s) and/or carrier(s) utilized, and like factors with the knowledge and expertise of the attending physician.
[0051] As used herein, the term treat, treating, or treatment refers to ameliorating a disease or disorder, e.g., slowing or arresting or reducing the development of the disease or disorder or reducing at least one of the clinical symptoms thereof. For example, in some embodiments, ameliorating a disease or disorder can include obtaining a beneficial or desired clinical result that includes, but is not limited to, any one or more of: alleviation of one or more symptoms, diminishment of extent of disease, preventing or delaying spread of disease, preventing or delaying recurrence of disease, delay or slowing of disease progression, amelioration of the disease state, inhibiting or eliminating the disease or progression of the disease, inhibiting or slowing the disease or its progression, arresting its development, and remission (whether partial or total).
[0052] As used herein, the term disrupting, disrupted, disruption, perturbing, perturbation, perturbed, knockout, or knocked out in the context of manipulating a gene, means that the gene is genetically engineered to be inoperative, inactive, or removed, or at least partially inoperative, inactive, or removed.
Screening of Combinatory Gene Disruptions
[0053] The present disclosure provides a multiplexed gRNA library for in vivo screening of effective combinations of gene perturbations, e.g., for screening of boosted tumor-infiltrating T cells (TILs). For example, to investigate synergistic or additive anti-tumor efficacy, immune cells, such as T cells, can be genetically engineered with a combination of gRNAs targeting multiple genes simultaneously, e.g., with one, two, three, and four gRNAs simultaneously. The engineered immune cells, such as engineered T cells, can be screened for activities such as antitumor activity in a tumor environment.
[0054] In some embodiments, an in vivo screening library of gRNAs is provided to target multiple genes, such as six checkpoint genes, in T cells. In one embodiment, the in vivo screen library includes fifty-six combinations of gRNAs, including fifteen 4-gRNA combinations, twenty 3-gRNA combinations, fifteen 2-gRNA combinations, and six single-gRNA combinations, targeting 4 checkpoint genes, three checkpoint genes, 2 checkpoint genes, and one checkpoint gene, respectively. The gRNA combinations can be ranked according to their enrichment levels in tumor tissues. In one embodiment, T cells engineered with a 3-gRNA combination that simultaneously targets Pdcd1, Adora2a, and Ctla4 (denoted as PAC herein) are more enriched in a tumor environment than other gRNA combinations.
[0055] Validation experiments can be further performed to confirm the results from an in vivo screening. In one embodiment, T cells engineered with a candidate combination of gRNAs and a control combination of gRNAs may be administered to mice with a tumor. In one embodiment, T cells knocked out only at the Pdcd1 loci (denoted as PNN), at Pdcd1 and Ctla4 loci (denoted as PCN), as well as Pdcd1, Ctla4, and Adora2a loci (PAC) are obtained. For example, the T cells engineered with the PNN, PCN, and PAC gRNA combinations, respectively, are injected into the recipient mice inoculated with Hepa1-6 cancer cells expressing H2Kb-OVA.sub.257-264. After the T cell therapy, the weight loss of the mice and the tumor size are monitored, and the efficacy of the gene perturbations is confirmed.
Disruptions of Pdcd1, Adora2a, and Ctla4 Genes
[0056] In some embodiments, the present disclosure provides a method for disrupting a Pdcd1 gene, an Adora2a gene, and a Ctla4 gene (collectively referenced as PAC) in a cell, comprising: introducing into the cell a Cas (e.g., Cas9), a first gRNA comprising a first spacer sequence targeting the Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting the Adora2a gene, and a third gRNA comprising a third spacer sequence targeting the Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0057] In some embodiments, the present disclosure provides a genetically engineered immune cell for treating a disease such as cancer or tumor in a subject in need thereof, wherein the immune cell comprises a Cas (e.g., Cas9), a first gRNA comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, and a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0058] In some embodiments, the present disclosure provides use of a genetically engineered immune cell for the manufacture of a medicament for treating a cancer, wherein the immune cell comprises a Cas (e.g., Cas9), a first gRNA comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, and a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0059] A Cas can be introduced into a cell in the form of a polynucleotide sequence (e.g., in a plasmid or mRNA) encoding the Cas protein or in the form of RNP. The gRNAs can be introduced into a cell in the form of a polynucleotide sequence encoding the gRNA or in the form of RNP.
[0060] In some embodiments, a Cas and a gRNA may be introduced into a cell via one or more vectors expressing the Cas and gRNA. In some embodiments, a gRNA can be delivered into cells in other forms, e.g., in the form of ribonucleoprotein (RNP), where a guide RNA is mixed with a Cas enzyme protein. RNPs can be delivered into cells via electroporation.
[0061] In some embodiments, the method for disrupting PAC comprises introducing into the cell one or more polynucleotides encoding the Cas, the first, second, and third gRNAs. For example, a single vector can be introduced into a cell, wherein the vector comprises a nucleotide sequence encoding the Cas, a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, and a nucleotide sequence encoding the third gRNA. As another example, two vectors can be introduced into a cell, wherein one of the vectors comprises a nucleotide sequence encoding the Cas, and the other one of the vectors comprises a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, and a nucleotide sequence encoding the third gRNA. As understood by a person of ordinary skill in the art, the Cas, the first gRNA, the second gRNA, and the third gRNA, can be encoded by a single vector, or encoded by two vectors or three vectors in any combination, or encoded by four vectors individually.
[0062] In some embodiments, the first, second, and third gRNAs are single-molecule guide RNAs (sgRNAs).
[0063] In some embodiments, the method for disrupting PAC is conducted in vitro. In some embodiments, the method for disrupting PAC is conducted in vivo, e.g., in a subject with cancer.
[0064] In some embodiments, the cell is an immune cell. In some embodiments, the cell is a lymphocyte cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a cell expressing a Pdcd1 gene, an Adora2a gene, and a Ctla4 gene, which function as immune repressors.
[0065] In some embodiments, the Cas is Cas9 or its variant. In some embodiments, the Cas is selected from a wild-type Cas9, a Cas9 nickase (Cas9n), dCas9, Cpf1, Sniper-Cas9, LZ3 Cas9, HiFi Cas9, eSpCas9, SpCas9-HF1, HypaCas9, xCas9, evoCas9, and SuperFi-Cas9.
[0066] In some embodiments, the Cas is in a form of a fusion protein with an effector protein, e.g., another enzyme. For example, a Cas, e.g., dCas9, can be fused with a Krppel-associated box (Krab) effector domain.
[0067] In some embodiments, the Cas is pre-complexed with the first, second, and third gRNAs, e.g., in a form of an RNP.
[0068] In some embodiments, the method for disrupting PAC optionally comprises: introducing into the cell a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0069] In some embodiments, the method for disrupting PAC optionally comprises: introducing into the cell a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0070] In some embodiments, the cytoplasmic domain comprises a CD247 cytoplasmic domain.
[0071] In some embodiments, the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
[0072] In some embodiments, the PAC disruption is introduced into a cell via a CRISPR method, while the CAR was introduced into cells via lentivirus-based genome integration. In some embodiments, one or more vectors encoding a Cas (e.g., Cas9), the first gRNA, second gRNA, third gRNA, and a CAR may be introduced into a cell.
[0073] In some embodiments, a nucleotide sequence encoding a Cas (e.g., Cas9), a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, a nucleotide sequence encoding the third gRNA, and a nucleotide sequence encoding a CAR may be present in one vector or multiple vectors, such as in two, three, four, or five vectors.
Methods of Treatment and Uses
[0074] In some embodiments, the present disclosure provides a method of treating a disease in a subject in need thereof, comprising administering to the subject an engineered immune cell comprising: a Cas, a first gRNA comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, and a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0075] In some embodiments, the disease is selected from cancers and tumors. In some embodiments, the cancer is selected from bladder cancer, breast cancer, cervical cancer, gynecologic cancers, head and neck cancers, kidney cancers, liver cancer, lung cancer, lymphoma, mesothelioma, myeloma, ovarian cancer, prostate cancer, skin cancer, thyroid cancer, uterine cancer, and vaginal and vulvar cancers. In some embodiments, the tumor is selected from benign tumors, premalignant tumors, and malignant tumors.
[0076] A Cas can be introduced into an immune cell in the form of a polynucleotide sequence (e.g., in a plasmid or as mRNA encoding the Cas protein) or in the form of RNP. The gRNAs can be introduced into an immune cell in the form of a polynucleotide sequence encoding the gRNA or in the form of RNP.
[0077] In some embodiments, a Cas, a first gRNA, a second gRNA, and a third gRNA may be introduced into an immune cell via one or more vectors expressing the Cas9 and gRNA as described herein. In some embodiments, a Cas, a first gRNA, a second gRNA, and a third gRNA can be delivered into immune cells in other forms, e.g., in the form of ribonucleoprotein (RNP), where the guide RNAs are mixed with a Cas (e.g., Cas 9) enzyme protein. RNPs can be delivered into cells via electroporation.
[0078] In some embodiments, the method of treating the disease comprises administering to the subject an engineered immune cell comprising one or more polynucleotides encoding the Cas and the first, second, and third gRNAs. In some embodiments, a nucleotide sequence encoding the Cas, a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, and a nucleotide sequence encoding the third gRNA can be included in a single vector or in multiple vectors, such as 2, 3, or 4 vectors.
[0079] In some embodiments, the first, second, and third gRNAs are single-molecule guide RNAs (sgRNAs).
[0080] In some embodiments, the engineered immune cell is an engineered T cell.
[0081] In some embodiments, the Cas enzyme is Cas9 or its variant. In some embodiments, the Cas is selected from a wild-type Cas9, a Cas9 nickase (Cas9n), dCas9, Cpf1, Sniper-Cas9, LZ3 Cas9, HiFi Cas9, eSpCas9, SpCas9-HF1, HypaCas9, xCas9, evoCas9, and SuperFi-Cas9.
[0082] In some embodiments, the engineered immune cell engineered with PAC disruption optionally comprises a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0083] In some embodiments, the PAC disruption is introduced into an immune cell via a CRISPR method, while the CAR was introduced into the immune cell via lentivirus-based genome integration. In some embodiments, one or more vectors encoding a Cas (e.g., Cas 9), the first gRNA, second gRNA, third gRNA, and a CAR may be introduced into a cell.
[0084] In some embodiments, the immune cell engineered with PAC disruption optionally comprises a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0085] In some embodiments, the cytoplasmic domain comprises a CD247 cytoplasmic domain.
[0086] In some embodiments, the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
[0087] In some embodiments, the engineered immune cell optionally further comprises additional gene knockout. For example, in allogeneic CAR-T (also known as the off-the-shelf CAR-T) cells, additional genes (e.g., TCR and CD52) are knocked out compared to the autologous CAR-T to eliminate the individual-specific immunogenicity. Such allogeneic CAR-T may be further engineered as disclosed herein to disrupt the PAC genes and used in a method described herein.
[0088] In some embodiments, a nucleotide sequence encoding a Cas (e.g., Cas 9), a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, a nucleotide sequence encoding the third gRNA, and a nucleotide sequence encoding a CAR may be present in one vector or multiple vectors, e.g., two, three, four, or five vectors.
[0089] The therapeutically effective amount of the engineered immune cells, e.g., engineered T cells, can be determined based on factors of a particular subject, including size, age, sex, weight, and condition of the subject. Dosages can be ascertained and adjusted by those skilled in the art from this disclosure and the knowledge in the art.
[0090] In some embodiments, the engineered immune cells, e.g., engineered T cells, can be administered in any pharmaceutically acceptable vehicle. In some embodiments, a therapeutically effective amount of about 110.sup.5 to 110.sup.12, 110.sup.6 to 110.sup.11, 110.sup.6 to 110.sup.10, 110.sup.6 to 110.sup.9, 110.sup.7 to 110.sup.11, 110.sup.7 to 110.sup.10, 110.sup.7 to 110.sup.9, or 110.sup.8 to 110.sup.9 cells are administered. In some embodiments, a dose of about 110.sup.6, 110.sup.7, 110.sup.8, 110.sup.9, 110.sup.10 or 110.sup.11 cells are administered to a subject having cancer or tumor.
[0091] In some embodiments, the purity in populations comprising the engineered immune cells, e.g., engineered T cells, ranges from about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, preferably about 85% to about 90%, about 90% to about 95%, and about 95% to about 100%.
[0092] The engineered immune cells, e.g., engineered T cells, can be administered by, for example, injection or catheter. The engineered immune cells, e.g., engineered T cells, may also be administered by minimally invasive surgical techniques.
Nucleic Acids and Engineered Cells
[0093] In some embodiments, the present disclosure provides a vector comprising one or more of nucleotide sequences wherein the nucleotide sequences are selected from: (a) a first nucleotide sequence encoding a first gRNA comprising a spacer sequence complementary with a first target domain of a Pdcd1 gene; (b) a second nucleotide sequence encoding a second gRNA comprising a second spacer sequence complementary with a second target domain of an Adora2a gene; and (c) a third nucleotide sequence encoding a third gRNA comprising a third spacer sequence complementary with a third target domain of a Ctla4 gene; and (d) a fourth nucleotide sequence encoding a Cas (e.g., Cas 9).
[0094] In some embodiments, a nucleotide sequence encoding the Cas (e.g., Cas 9), a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, and a nucleotide sequence encoding the third gRNA can be present in a single vector or in multiple vectors, such as two, three, or four vectors.
[0095] In some embodiments, the vector is selected from an AAV vector, an adenovirus vector, a vaccinia virus vector, retrovirus, and a herpes simplex virus vector. In some embodiments, the vector is or comprises a lentiviral vector.
[0096] In some embodiments, the present disclosure provides an engineered cell comprising: a Cas (e.g., Cas 9), a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, and a third gRNA comprising a third spacer sequence targeting a Ctla4 gene.
[0097] In some embodiments, the present disclosure provides an engineered cell comprising: one or more polynucleotides encoding a Cas (e.g., Cas 9), a first gRNA comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, and a third gRNA comprising a third spacer sequence targeting a Ctla4 gene. As described herein, the polynucleotides the Cas (e.g., Cas 9), the first, second, and third gRNAs may be delivered in one, two, three, or four vectors.
[0098] In some embodiments, the engineered cell optionally further comprises a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0099] In some embodiments, the engineered cell optionally further comprises a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0100] In some embodiments, the vector further comprises a nucleotide sequence encoding a CAR as well as a promoter, such as U6.
[0101] In some embodiments, the present disclosure provides a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory signaling region, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer antigen.
[0102] In some embodiments, the cytoplasmic domain comprises a CD247 cytoplasmic domain.
[0103] In some embodiments, the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
[0104] In some embodiments, a chimeric antigen receptor further comprises one or more extracellular leader domains and/or one or more extracellular hinge domains. In some embodiments, one or more extracellular hinge domains comprise a CD28 extracellular hinge domain, CD8a extracellular hinge domain, or an IgG4 extracellular hinge domain.
[0105] In some embodiments, a transmembrane domain comprises a CD28, CD8a, CD64, CD32a, CD32c, CD16a, TRLI, TLR2, TLR3, TRL4, TLR5, TLR6, TLR7, TLRS, or TLR9 transmembrane domain.
[0106] In some embodiments, the antigen binding domain is a scFv that is capable of binding a cancer antigen.
[0107] In some embodiments, a nucleotide sequence encoding a Cas (e.g., Cas 9), a nucleotide sequence encoding the first gRNA, a nucleotide sequence encoding the second gRNA, a nucleotide sequence encoding the third gRNA, and a nucleotide sequence encoding a CAR may be in delivered in one vector or multiple vectors, e.g., two, three, four, or five vectors.
[0108] In some embodiments, the engineered cell optionally further comprises additional gene knockout. In some embodiments, in an engineered cell disclosed herein, additional genes (e.g., TCR and CD52) may optionally further be knocked out. For example, in allogeneic CAR-T (also known as the off-the-shelf CAR-T) cells, additional genes (e.g., TCR and CD52) are knocked out compared to the autologous CAR-T to eliminate the individual-specific immunogenicity. Such allogeneic CAR-T may be further engineered as disclosed herein to disrupt the PAC genes.
[0109] In some embodiments, a cell is engineered with a PAC disruption using a CRISPR method, e.g., delivery of RNPs via electroporation, and the cell is engineered with a CAR via lentivirus-based genome integration.
[0110] In some embodiments, the immune cells are selected from a macrophage, monocyte, dendritic cell, T cells, B cells and/or NK cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are selected from CD4+ cells, CD8+ cells, Gamma delta T cells (T cells), NK T cells and/or regulatory T cells (Treg). In some embodiments, the immune cells are TIL (Tumor infiltrated lymphocyte). For example, TILs can be isolated from tumors, expanded, genetically engineered as disclosed herein, and then injected back to patients.
[0111] In some embodiments, immune cells are harvested from a human subject, e.g., a donor subject who is a heathy human, or a subject in need of treatment, and then genetically engineered as described herein. For example, when iPSC is used to make an immune cell such as T cell or NK cell, the donor subject can be a healthy human.
[0112] In some embodiments, T cells are harvested from a human subject having cancer or tumor and then genetically engineered as described herein. The engineered T cells are then administrated to the subject for treatment of cancer or tumor.
[0113] For example, white blood cells from a subject diagnosed with a cancer or tumor are harvested, T cells are isolated and cultured, and the T cells are engineered as described herein, e.g., to comprise a PAC triple knock out and comprise a CAR. The engineered T cells prepared for administration to a subject can comprise a purified population of cells, for example CD4+ T cells. Those having ordinary skill in the art can readily determine the percentage of genetically modified immune cells in a population using various well-known methods, such as fluorescence activated cell sorting (FACS).
Guide RNAs
[0114] In a CRISPR/Cas system, a guide RNA (gRNA) is a synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-defined nucleotide spacer that defines the gene target to be modified. The strand of genomic DNA that is bound by the spacer is typically referred to as the complementary strand or a target domain of a gene. And the other strand of DNA is typically referred to as the non-complementary strand.
[0115] Any suitable stretch of a nucleotide sequence on a Pdcd1 gene, an Adora2a gene, or Ctla4 gene can be used as a target domain for designing the respective gRNAs. For example, target domains on the respective genes may be selected close to the 5 end of the CDS, avoiding secondary structures. The GC content of an gRNA is preferably within 40-60%. One can use a gRNA designing tool, which provides scores indicating gRNA editing efficiency and/or gRNA off-targeting specificity for selection of appropriate gRNAs.
[0116] In some embodiments, the present disclosure provides a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene. Any stretch of a nucleotide sequence on a Pdcd1 gene can be used as a target domain for designing a first guide RNA. In some embodiments, the first guide RNA comprises a sequence as set forth in SEQ ID NO: 1: CAGCTTGTCCAACTGGTCGG
[0117] In some embodiments, the present disclosure provides a second gRNA comprising a second spacer sequence targeting an Adora2a gene. Any stretch of a nucleotide sequence on an Adora2a gene can be used as a target domain for designing a first guide RNA. In some embodiments, the second guide RNA comprises a sequence as set forth in SEQ ID NO: 2: AGCACACAAGCACGTTACCC
[0118] In some embodiments, the present disclosure provides a third gRNA comprising a third spacer sequence targeting a Ctla4 gene. Any stretch of a nucleotide sequence on a Ctla4 gene can be used as a target domain for designing a first guide RNA. In some embodiments, the third guide RNA comprises a sequence as set forth in SEQ ID NO: 3:GGACTGAGAGCTGTTGACAC
CRISPR-Cas Proteins
[0119] In various embodiments, the present disclosure involves a Cas protein or a variant or a mutant of any of the variants thereof. For example, all variants and mutants of Cas proteins, such as those described in Koonin et al., Curr Opin Microbiol. 2017 June; 37:67-78, can be used in a method, composition, or kit disclosed herein. For example, Cas9 proteins, either wild type or genetically modified, can be used in a method, composition, or kit disclosed herein. The Cas enzymes used in Base Editing and Prime Editing can also be used here.
[0120] For instance, Cas9 has many variants. By introducing mutations into amino acid sequences, those variants have different characteristics in terms of their specificity and efficiency. The Cas9 protein that can be used herein can be selected from SpCas9 (Cas9 isolated from Streptococcus pyogenes), SaCas9 (Cas9 isolated from Staphylococcus aureus), StCas9 (Cas9 isolated from Streptococcus thermophilus), NmCas9 (Cas9 isolated from Neisseria meningitidis), FnCas9 (Cas9 isolated from Francisella novicida), CjCas9 (Cas9 isolated from Campylobacter jejuni), ScCas9 (Cas9 isolated from Streptococcus canis), Sniper-Cas9, LZ3 Cas9, HiFi Cas9, eSpCas9 (Slaymaker, et al., Science, Vol. 351, Issue 6268, 84-88, 2016), SpCas9-HF1 (Kleinstiver, et al., Nature, 529, 490-495, 2016), HypaCas9, xCas9, evoCas9, SuperFi-Cas9 (Bravo et al., Nature, 603 (7900): 343-347), and any variants or mutant forms of these Cas proteins listed above. This list is only to provide some exemplary options and is not exclusive.
[0121] In various embodiments, a Cas protein can be fused with an effector protein, e.g., another enzyme. For example, a Cas, e.g., dCas9, can be fused with a Krppel-associated box (Krab) effector domain, as used in a CRISPRi system. CRISPRi downregulates the expression of a target gene by repressive gene regulation, instead of disrupting the expression of a target gene by editing a genomic sequence directly. In the CRISPRi system, a Cas9 mutant, dCas9, is fused with another effector protein (e.g., Krab). The dCas9/gRNA guides the Krab effector protein to a specific location in the genome, and then the Krab effector protein downregulates the expression of the targeting gene by interacting with cis-regulatory elements. Such fusions of a Cas and an effector protein can be used in the methods, compositions, and kits disclosed herein.
Pharmaceutical Compositions
[0122] In some embodiments, the disclosure provides pharmaceutical compositions comprising a population of engineered cells, e.g., engineered immune cells, e.g., engineered T cells, described herein. In some embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable carrier.
[0123] In some embodiments, pharmaceutical compositions comprising engineered immune cells, e.g., engineered T cells, are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH. In some embodiments, pharmaceutically acceptable carrier is selected from water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof.
[0124] In some embodiments, the disclosure provides pharmaceutical compositions comprising a nucleic acid or a vector described herein. In some embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable carrier.
Kits
[0125] In some embodiments, the present disclosure provides a kit comprising a Cas (e.g., Cas9), a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene.
[0126] In some embodiments, the present disclosure provides a kit comprising a Cas (e.g., Cas9) pre-complexed with one or more (e.g., 2 or 3) of a first gRNA comprising a first spacer sequence targeting the Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting the Adora2a gene, and a third gRNA comprising a third spacer sequence targeting the Ctla4 gene. In some embodiments, the Cas (e.g., Cas9) and the one or more of the gRNAs are precomplexed to form an RNP (ribonucleoprotein).
[0127] In some embodiments, the present disclosure provides a kit comprising one or more vectors comprising one or more (e.g., e.g., two, three, four, or five) nucleotide sequences encoding a Cas (e.g., Cas9), a first guide RNA (gRNA) comprising a first spacer sequence targeting the Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting the Adora2a gene, a third gRNA comprising a third spacer sequence targeting the Ctla4 gene, and a CAR.
EXAMPLES
[0128] The following examples are provided to describe the disclosure in greater detail. They are intended to illustrate, not to limit, the disclosure.
Example 1: In Vivo Screen for Combinatorial Checkpoint Blockades to Boost T Cells
[0129] To identify potential candidates for a combined immunotherapy, we applied a 4-gRNA multiplexed library in an in vivo screen for boosted tumor-infiltrating T cells (TILs). Following a multiplexed CRISPR library construction strategy, as further detailed below, we genetically engineered CD8+ T cells collected from OT-I mice. To investigate synergistic or additive anti-tumor efficacies of multiple gene knockouts, we engineered the T cells with a library of four gRNAs simultaneously.
[0130] The engineered T cells were screened for activation capability in a tumor environment. The engineered T cells were injected into recipient mice inoculated with Hepa1-6 cells with stable H2Kb-OVA.sub.257-264 expression (
[0131] More specifically, the in vivo screening library was designed to target six checkpoint genes (Btla, Pdcd1, Tigit, Ctla4, Havcr2 and Adora2a) and included all fifty-six possible combinations, composed of fifteen 4-gRNA combinations, twenty 3-gRNA combinations, fifteen 2-gRNA combinations and six single-gRNA combinations (denoted as CP group herein). Moreover, for each combination, we used non-targeting control gRNAs to fill the unoccupied positions if the number of the targeting gRNAs is less than 4. For example, for the six single-gRNA combinations, each of them contains three non-targeting control gRNAs to fill the unoccupied positions. For comparison, we also included combinations targeting two other groups of genes: one included four genes (Lat, Zap70, Cd3e, and CD247) involved in the first signaling of T cell activation (fifteen combinations, denoted as TCR group herein), the other included five co-stimulatory molecules (Il2ra, Tnfrsf9, Tnfrsf4, Tnfrsf18 and CD28) involved in the secondary signaling of T cell (thirty combinations, denoted as CS group herein). T cells engineered by combinations from the TCR group and CS group should be incapable of T cell activation. All together, we included 101 distinct combinations targeting one to four genes of the CP group, the TCR group, and the CS group. For each distinct combination, we designed a group of six gRNA-combos in the library to eliminate biases of individual guide RNA. Another eighty-four combinations included only non-targeting control gRNAs, which served as negative controls (denoted as NT group herein). The sequences of the gRNA combinations are listed in SEQ ID NOs: 14-703. The screening was conducted in three independent batches.
[0132] We calculated log2 transformed fold-change (log2FC) values to show the relative abundance of each gRNA combination in the tumor infiltrated lymphocytes (TIL) relative to the engineered T cells before being injected into the recipient mice (SR, representing starting reference) (further described below). It was contemplated that the T cells enriched in the tumors gained functions relevant to anti-tumor immunity, which were reflected by the gRNA combinations with high log2FC values. As shown in
[0133] We ranked all gRNA combinations based on the corresponding T cell enrichments in the tumors from three screening batches and identified a top candidate of 3-gRNA combination that simultaneously targets Pdcd1 , Adora2a and Ctla4 (denoted as PAC herein) (
[0134] Next, we performed validation experiments to confirm the screen results. We prepared T cells knocked out only at the Pdcd1 loci (denoted as PNN), at Pdcd1 and Ctla4 loci (denoted as PCN), as well as Pdcd1 , Ctla4, and Adora2a loci (PAC). The knockout efficiencies of the gRNAs were confirmed (
[0135] The engineered T cells were injected intravenously into the recipient mice inoculated with Hepa1-6 cancer cells expressing H2Kb-OVA.sub.257-264. After the T cell therapy, the weight loss of the mice and the tumor size was monitored for eight weeks. We found that the growth of tumor size of the other two groups (PNN and PCN) was all controlled at different levels. T cells engineered by the PAC combination showed the best anti-tumor immune responses compared to T cells engineered by PCN or PNN, which were reflected by the tumor size and the survival rate of the mice (
[0136] These results indicated that the multiplexed CRISPR screen is an effective way to look for candidates for potential combinatorial immune checkpoint blockades, and for other potential combinatoral pathway blockades.
Example 2: Screen Library and Vector Design
[0137] A screen library was designed and constructed via in-library ligation and plasmid library construction (
[0138] As shown in
[0139] As shown in
[0140] As noted above, for the check point blockade screening library, we included a group of six immune checkpoint genes (CP group), a group of four genes involved in the first signaling of T cell activation (TCR group) and a group of five co-stimulatory molecules involved in the secondary signaling (CS group). Within each group, all possible 4 gRNA combinations, 3 gRNA combinations, 2 gRNA combinations, and single gRNA construct were designed. For each construct, the unoccupied position was placed with non-targeting control gRNA if the number of the targeting gRNAs is less than four. Further, all combinations were represented by six groups of gRNAs that are distinct from each other. Additionally, 84 combinations containing only the non-targeting control gRNAs (NT group) were included and served as negative control. This screen library composed a total of 101 gene combinations represented by 606 gRNA groups and 84 negative control combinations including on non-targeting gRNAs.
[0141] For the screening part, a multiplexed CRISPR knockout vector that contained a 4-sgRNA tandem cassette (as illustrated in
[0142] For the validation part, a multiplexed CRISPR knockout vector that contained a Pdcd1-Adora2a-Ctla4 gRNA tandem cassette and a mKate2 reporter was generated (SEQ ID NO: 704). A vector that contained a Pdcd1-NTC-NTC gRNA tandem cassette and a BFP reporter were created as control, in which one NTC gRNAs replaced the Adora2a gRNA, one NTC gRNA replaced the Ctla4 gRNA, and a BFP reporter replaced the mKate2 reporter. A vector that contained a Pdcd1-Ctla4-NTC sgRNA tandem cassette and a BFP reporter was created as a control, in which one NTC gRNAs replaced the Adora2a gRNA and a BFP reporter replaced the mKate2 reporter.
TABLE-US-00001 TABLE1 SpacerofPdcd1 SEQIDNO:1:CAGCTTGTCCAACTGGTCGG SpacerofAdora2a SEQIDNO:2:AGCACACAAGCACGTTACCC SpacerofCtla4 SEQIDNO:3:GGACTGAGAGCTGTTGACAC F-BsrDI-1 SEQIDNO:4:GACCGCGTCTCACACCG R-BsrDI-1-biotin SEQIDNO:5:CTGCGCTCCACGAGCCCGACGCAATG F-BsrDI-2-biotin SEQIDNO:6:CTGGCGTGGTCGCGTGCTCGGCAATG F-BsrDI-2 SEQIDNO:7:GATCAGGGCCGTCTCGAAAC Murinenest-F SEQIDNO:8:GGACTATCATATGCTTACCG Murinenest-R SEQIDNO:9:GCCCAGAattcTCGCATTC Fwd-Libseq-G12 SEQIDNO:10: AATGATACGGCGACCACCGAgatctACACTATAGCCTACAC TCTTTCCCTACACGACGCTCTTCCGATCTTGTGGAAAGGAC GAAACAC Rev-Libseq-G12 SEQIDNO:11: CAAGCAGAAGACGGCATACGAGATGGAGATGAGTGACTGGA GTTCAGACGTGTGCTCTTCCGATCTTGCTAGGACCGGCCTT AAAG Fwd-Libseq-G23 SEQIDNO:12: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACA CGACGCTCTTCCGATCTGCTGGTTCCATGGTGTA Rev-Libseq-G23 SEQIDNO:13: CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGA GTTCAGACGTGTGCTCTTCCGATCTCCTTAGCCGCTAATAG GTGAGC
Example 3: Screen and Validation Experiments
Tumor Cells
[0143] Hepa1-6 cells were transduced with H-2Kb-OVA.sub.257-264-expressing lentivirus. And the H-2Kb-OVA.sub.257.-264 expression in a mono-clone was validated via flow cytometry. The resulted cell line was named as Hepa1-6-H-2Kb-OVA.sub.257.264. The established Hepa1-6-H-2K.sup.b-OVA.sub.257-264 cells were further transduced with a lentiviral vector (lenti-EF-1a-luciferase-T2A-BSD) for luciferase stable expression.
Mice Models
[0144] Primary T cells were isolated from OT-I or Cas9+OT-I mice, which were bred from OT-I and Cas9 mouse obtained from the Jackson Laboratory. The tumor was inoculated to the NOD-Prkdc.sup.scid Il2rg.sup.null/Shjh mice purchased from Shanghai Jihui Laboratory Animal Care. The T cell donor mice were 1012 weeks old. The tumor recipient mice were 68 weeks old. All mice were housed in standard individually ventilated and pathogen-free conditions in the laboratory facility of the Westlake University, under that animal protocol (AP #21-016-MLJ). All mice were used in accordance with Institutional Animal Care and Use Committee (IACUC) guidelines for Westlake University.
T Cell Isolation and Culture
[0145] Spleens were isolated from the Cas9+OT-I mice, followed by mashing through 40 m filter and RBCs lysis (BD Pharm Lyse). CD8+ T cells were purified by negative selection via CD8a+ T cell isolation Kit (Milteny). Cells were stimulated with 100U/ml recombinant human IL-2 (Peprotech), 1 g/ml anti-mouse CD3(Ultraleaf, Clone 145-2C11, Biolegend) and 0.5 g/ml anti-mouse CD28 (Ultraleaf, Clone 37.51, Biolegend) and cultured in RPMI-1640 with 10% FBS, 10 mM HEPES (Gibco), 100 M non-essential amino acids (Gibco), 1 mM Sodium Pyruvate (Gibco), 50 M -mercaptoethanol (Sigma), 50 U/ml penicillin, and 50 g/ml streptomycin (Gibco).
T Cell Transduction, Transduction Efficiency Test, and Gene Editing Efficiency Test
[0146] After ex vivo stimulation for 24 h, CD8+ T cells were transduced with lentivirus in the presence of polybrene at 8 g/ml during spinfection at 2,000 g for 2 h at 32 C. At 48 h after transduction, T cells were collected for transduction efficiency test via flow cytometry and adoptive transfer.
[0147] In a validation experiment, CD8+ T cells were transduced with lentivirus for 2 times at 24 h and 48 h after isolation. At 24 h after second transduction, T cells were collected for transduction efficiency test via flow cytometry and adoptive transfer after sorting via FACS. The gene editing efficiency was tested in T cells with a Pdcd1 -Adora2a-Ctla4 combined disruption. At 48 h after second transduction, mKate2+ T cells were sorted via FACS and pelleted for gDNA extraction. Then, the sgRNA target sequences of each gene were amplified by 2-step PCR for NGS sequencing. The list of oligos used in gene editing efficiency test were included in Table 1.
Antigen Specificity Test for OT-I T Cells
[0148] OT-I CD8+ T cells were co-cultured with either Hepa1-6 cells or Hepa1-6 expressing H-2Kb-OVA.sub.257-264 cells for 2 h and 48 h. In the 2 h test, cells were co-cultured at the presence of anti-CD107 (Biolegend). After 2 h, all cells were collected and stained with anti-CD8a (Biolegend) for degranulation analysis via flow cytometry (Cytoflex, Beckman). After 48 h, all cells were collected and stained with anti-CD8a, PI and Annexin V (Biolegend) for target cell apoptosis analysis via flow cytometry (Cytoflex, Beckman). All FCM Data were analyzed by Flowjo.
Screening Experiment
[0149] Hepa1-6 cells expressing H-2K.sup.b-OVA.sub.257-264 were mixed with matrigel (1:1 volume) and injected subcutaneously into the right flank of NPSG mice at 110.sup.6/recipient. At d12 after tumor cell inoculation, 110.sup.7 CD8+ T cells with screening library transduction (5%10% mKate2+ cells in total cells) were adoptively transferred into each recipient via i.v. injection. Meanwhile, 2310.sup.6 CD8+ T cells with screening library transduction were frozen as a starting reference (SR). Weight loss and tumor size was measured at d0 and d7 after T cell injection. On d7 after injection, the tumor was collected and cut into small fragments. After consecutively mashing through 100 m and 40 m filters, RBCs in the cell suspension were lysed. Then, the tumor infiltrating CD8+ T cells were enriched by density gradient centrifugation via Lymphprep (StenCell). Cells at the interface were carefully collected and washed by PBS. Then, the cells were re-suspended into PBS and stained with anti-mouse CD8a for 30 mins on ice. Finally, CD8+mKate2+ TILs were sorted via FACS (BD Fusion). A total of 20,000-40,000 CD8+mKate2+ TIL could be collected per tumor. TIL from 3-4 recipient mice were mixed together and pelleted with carrier cells (Raji cell) at 1:50 (CD8+ T cells: carrier cells) for genomic DNA extraction.
Genomic DNA Extraction and sgRNA Library PCR Amplification
[0150] Genomic DNA extraction was performed using TIANamp Genomic DNA kit (TIANGEN) and finally resuspended in 50 l nuclease free water. To prepare the gRNA NGS library for the SR sample, all gDNA were amplified on thermocycling with parameters of 98 C. for 30 sec, 2022 cycles of (98 C. for 10 sec, 64 C. for 30 sec, 72 C. for 20 sec), 72 C. for 2 min. One NGS library generated amplicons covering the 1st and the 2nd gRNAs (G12 library), and another NGS library generated amplicons covering the 2nd and the 3rd gRNAs (G23 library). Primers of SEQ ID NO: 10 and SEQ ID NO: 11 were used as a pair of primers to amplify the G12 library. Primers of SEQ ID NO: 12 and SEQ ID NO: 13 were used as a pair of primers to amplify the G23 library. To prepare the gRNA NGS library for the TIL sample, two-step amplification was applied. In the 1st step, PCR reaction (400800 ng DNA input per reaction, 24 reactions per sample) was performed using Ultra II Q5 Master Mix (NEB) with thermocycling parameters as 98 C. for 30 sec, 2830 cycles of (98 C. for 10 sec, 60 C. for 30 sec, 72 C. for 20 sec), 72 C. for 2 min. Primers of SEQ ID NO: 8 was used as the forward primer and SEQ ID NO: 9 was used as the reverse primer. And the PCR condition and primers of the 2nd step follows the condition of the SR library preparation, but with 810 cycles.
[0151] The list of primers used in gene editing efficiency test were included in Table 1.
Validation of Candidates
[0152] Hepa1-6 cells expressing H-2Kb-OVA257-264 with luciferase were mixed with matrigel (1:1 volume) and injected subcutaneously into the right flank of NPSG mice at 1106/recipient. On d11-d12 after tumor cell inoculation, 110.sup.6 mKate2+ or BFP+ CD8+ T cells were sorted via FACS and adoptively transferred into each recipient via intravenous injection. Weight loss and tumor size were measured every 3 days after T cell injection. Meanwhile, the biological signal of tumor was monitored weekly by in vivo imaging via PHOTON IMAGERTM OPTIMA, in which luciferin was administered intraperitoneally 5 minutes prior to signal collection.
Example 4: Data Analysis
[0153] In order to find the effective 4-gRNA combinations that enhance the capacity of the CD8+ T cell-mediated tumor elimination in vivo, the normalized read counts of each combination were used to compare their representatives between the TIL and SR libraries. Normalizations were conducted according to the depth of sequencing libraries. We calculated both the fold-change and the p-value for each 4-gRNA combination. The TIL and SR libraries were treated as two samples, and G12 library and G23 library of each sample were treated as technical replicates. We used the log2 fold-change of G12 and G23 between the TIL and SR libraries to pick out combinations for validations, which can be explained as Log2((Mean of TIL three batches g12+1)/(Mean of SR three batches g12+1)) and Log2((Mean of TIL three batches g23+1)/(Mean of SR three batches g23+1)).
[0154] Further embodiments are illustrated below.
[0155] Embodiment 1. A method for disrupting a Pdcd1 gene, an Adora2a gene, and an Ctla4 gene in a cell, comprising: introducing into a cell a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting the Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting the Adora2a gene, and a third gRNA comprising a third spacer sequence targeting the Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0156] Embodiment 2. The method of Embodiment 1, wherein the method comprises introducing into the cell one or more polynucleotides encoding the Cas and the first, second, and third gRNAs.
[0157] Embodiment 3. The method of Embodiment 1, wherein the Cas is pre-complexed with one or more of the first, second, and third gRNAs.
[0158] Embodiment 4. The method of any one of Embodiments 1 and 3, wherein the Cas pre-complexed with one or more of the first, second, and third gRNAs are introduced into the cell via electroporation.
[0159] Embodiment 5. The method of any one of Embodiments 1-4, wherein the first, second, and third gRNAs are single-molecule guide RNAs (sgRNAs).
[0160] Embodiment 6. The method of any one of Embodiments 1-5, wherein the first, second, and third gRNAs comprises SEQ ID NOs: 1, 2, and 3, respectively.
[0161] Embodiment 7. The method of any one of Embodiments 1-6, wherein the cell is an immune cell.
[0162] Embodiment 8. The method of any one of Embodiments 1-7, wherein the cell is a lymphocyte cell.
[0163] Embodiment 9. The method of any one of Embodiments 1-7, wherein the cell is a T cell.
[0164] Embodiment 10. The method of any one of Embodiments 1-9, wherein the Cas is a wild-type Cas9 or variant thereof.
[0165] Embodiment 11. The method of any one of Embodiments 1-10, further comprising: introducing into the cell a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0166] Embodiment 12. The method of any one of Embodiments 1-11, further comprising: introducing into the cell a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0167] Embodiment 13. The method of any one of Embodiments 11-12, wherein the cytoplasmic domain comprises a CD247 cytoplasmic domain.
[0168] Embodiment 14. The method of any one of Embodiments 11-13, wherein the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
[0169] Embodiment 15. A method of treating cancer or tumor in a subject in need thereof, comprising administering to the subject an engineered immune cell comprising: a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0170] Embodiment 16. The method of Embodiment 15, wherein the method comprises administering to the subject an engineered immune cell comprising one or more polynucleotides encoding the Cas and the first, second, and third gRNAs.
[0171] Embodiment 17. The method of any one of Embodiments 15-16, wherein the first, second, and third gRNAs are single-molecule guide RNAs (sgRNAs).
[0172] Embodiment 18. The method of any one of Embodiments 15-17, wherein the first, second, and third gRNAs comprises SEQ ID NOs: 1, 2, and 3, respectively.
[0173] Embodiment 19. The method of any one of Embodiments 15-18, wherein the engineered immune cell is an engineered lymphocyte.
[0174] Embodiment 20. The method of any one of Embodiments 15-19, wherein the engineered immune cell is an engineered T cell.
[0175] Embodiment 21. The method of any one of Embodiments 15-20, wherein the Cas is a wild-type Cas9 or variant thereof.
[0176] Embodiment 22. The method of any one of Embodiments 15-21, wherein the engineered immune cell comprises a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0177] Embodiment 23. The method of any one of Embodiments 15-21, wherein the engineered immune cell comprises a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0178] Embodiment 24. The method of any one of Embodiments 22-23, wherein the cytoplasmic domain comprises a CD247 cytoplasmic domain.
[0179] Embodiment 25. The method of any one of Embodiments 22-24, wherein the one or more costimulatory signaling regions are selected from CD28, CD27, CD134 (OX40), and CD137 (4-1BB).
[0180] Embodiment 26. A vector comprising one or more of nucleotide sequences wherein the nucleotide sequences are selected from: [0181] (a) a first nucleotide sequence encoding a first gRNA comprising a spacer sequence complementary with a first target domain of the Pdcd1 gene; [0182] (b) a second nucleotide sequence encoding a second gRNA comprising a second spacer sequence complementary with a second target domain of the Adora2a gene; [0183] (c) a third nucleotide sequence encoding a third gRNA comprising a third spacer sequence complementary with a third target domain of the Ctla4 gene; and [0184] (c) a fourth nucleotide sequence encoding a Cas.
[0185] Embodiment 27. The vector of Embodiment 26, further comprising [0186] a fifth nucleotide sequence encoding a CAR and p1 a promoter.
[0187] Embodiment 28. The vector of any one of Embodiments 26-27, wherein the vector is selected from an AAV vector, an adenovirus vector, retrovirus, a vaccinia virus vector, a herpes simplex virus vector, and a lentiviral vector.
[0188] Embodiment 29. A cell comprising: a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting an Ctla4 gene.
[0189] Embodiment 30. A cell comprising: one or more polynucleotides encoding a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene.
[0190] Embodiment 31. The cell of any one of Embodiments 29-30, further comprising a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0191] Embodiment 32. The cell of any one of Embodiments 29-30, further comprising: a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain, and a cytoplasmic domain comprising an immunoreceptor tyrosine-based activation motif (ITAM), wherein the antigen binding domain is capable of binding a cancer or tumor antigen.
[0192] Embodiment 33. The cell of any one of Embodiments 29-32, wherein the cell is a T cell from a human subject.
[0193] Embodiment 34. The cell of any one of Embodiments 29-32, wherein the cell is a T cell from a human subject having cancer or tumor.
[0194] Embodiment 35. A pharmaceutical composition comprising a population of the cell of Embodiment 33 or the T cell of Embodiment 34.
[0195] Embodiment 36. A kit comprising a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene.
[0196] Embodiment 37. A kit comprising one or more vectors comprising one or more nucleotide sequences encoding a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, and a CAR.
[0197] Embodiment 38. An engineered immune cell for treating cancer or tumor in a subject in need thereof, wherein the engineered immune cell comprises a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0198] Embodiment 39. Use of an engineered immune cell for the manufacture of a medicament for treating cancer or tumor, wherein the engineered immune cell comprises a Cas, a first guide RNA (gRNA) comprising a first spacer sequence targeting a Pdcd1 gene, a second gRNA comprising a second spacer sequence targeting an Adora2a gene, a third gRNA comprising a third spacer sequence targeting a Ctla4 gene, wherein the Pdcd1 gene, the Adora2a gene, and the Ctla4 are disrupted.
[0199] While the disclosure has been particularly shown and described with reference to specific embodiments, it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.