SARM1 ENZYME ACTIVITY INHIBITOR AND APPLICATION THEREOF
20240368168 ยท 2024-11-07
Assignee
Inventors
- Deqiang NIU (Wuxi, Jiangsu, CN)
- Zhendong ZHU (Wuxi, Jiangsu, CN)
- Ming FAN (Wuxi, Jiangsu, CN)
- Xuke LI (Wuxi, Jiangsu, CN)
Cpc classification
A61K31/4545
HUMAN NECESSITIES
A61K31/4353
HUMAN NECESSITIES
A61K31/501
HUMAN NECESSITIES
A61K31/437
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
A61K31/4709
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K31/5383
HUMAN NECESSITIES
A61K31/444
HUMAN NECESSITIES
A61K31/5025
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
A61K31/4985
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
International classification
A61K31/5025
HUMAN NECESSITIES
A61K31/437
HUMAN NECESSITIES
A61K31/444
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
A61K31/4545
HUMAN NECESSITIES
C07D519/00
CHEMISTRY; METALLURGY
A61K31/5383
HUMAN NECESSITIES
A61K31/501
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61K31/4709
HUMAN NECESSITIES
Abstract
The present invention provides an application of an SARM1 enzyme activity inhibitor in the treatment of neurodegenerative diseases or neurological diseases or conditions. The present invention particularly provides a compound of formula I as an SARM1 enzyme activity inhibitor and a pharmaceutical composition thereof.
##STR00001##
Claims
1. A compound represented by formula I: ##STR00552## or a pharmaceutically acceptable salt or stereoisomer thereof, wherein, A represents CH or N; E represents CH or N; R.sub.1 is independently selected from the group consisting of hydrogen, halogen, CF.sub.3, CN, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, amino, CF.sub.3C(O)NH, CF.sub.3C(O)N(CH.sub.3), C.sub.1-C.sub.6 alkylamino, C.sub.3-C.sub.6 cycloalkylamino, C.sub.6-C.sub.14 aryl, C.sub.5-C.sub.14 heteroaryl, C.sub.6-C.sub.14 arylamino, C.sub.6-C.sub.14 heteroarylamino, OH, C.sub.6-C.sub.14 aryloxy, CONH.sub.2, SO.sub.2NH.sub.2, C.sub.1-C.sub.6 alkyl-C(O)NR.sub.5, C.sub.3-C.sub.6 cycloalkyl-C(O)NR.sub.5, C.sub.3-C.sub.6 heterocycloalkyl-C(O)NR.sub.5, C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5, C.sub.3-C.sub.6 cycloalkyl-OC(O)NR.sub.5, C.sub.3-C.sub.6 heterocycloalkyl-OC(O)NR.sub.5, C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.1-C.sub.6 alkyl-C(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.3-C.sub.6 cycloalkyl-OC(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.3-C.sub.6 cycloalkyl-C(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, (C.sub.6-C.sub.14 aryl)-(C.sub.1-C.sub.6 alkyl)-CON(R.sub.5)(C.sub.6-C.sub.14 aryl)-(C.sub.3-C.sub.6 alkyl)-N(R.sub.5), and (C.sub.6-C.sub.14 aryl)-(C.sub.3-C.sub.6 alkenyl)-N(R.sub.5); wherein, in the above C.sub.1-C.sub.6 alkyl, one carbon atom can be replaced by a heteroatom selected from the group consisting of N, O and S atoms; preferably, R.sub.1 is independently selected from the group consisting of C.sub.1-C.sub.6 alkylamino, C.sub.3-C.sub.6 heterocycloalkylamino, C.sub.1-C.sub.6 alkylacylamino, 1-morpholinyl, and C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5; X represents a cyclic structure, selected from the group consisting of C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 cycloalkenyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, or X is absent; preferably, X is selected from the group consisting of phenyl, pyridyl, methoxy-substituted pyridyl, thiazolyl, cyclohexyl and cyclohexenyl, wherein the phenyl can be substituted by the following substituents: SO.sub.2NH.sub.2, NHCOCH.sub.3, NH.sub.2, CONH.sub.2, OCH.sub.3, halogen, C.sub.1-C.sub.4 alkyl, SO.sub.2N(BoC)CH.sub.3 or C.sub.1-C.sub.4 alkyl-NHSO.sub.2; R.sub.2 is independently selected from the group consisting of hydrogen, halogen, NH.sub.2, N(R.sub.5)COR, CON(R.sub.5)R, N(R.sub.5)SO.sub.2R, SO.sub.2N(R.sub.5)R, COOR, COR, (C.sub.1-C.sub.4 alkyl)-OR, (C.sub.1-C.sub.4 alkyl)-N(CH.sub.3).sub.2, NH(C.sub.1-C.sub.4 alkyl)R, N(R.sub.5)R, NHCO(C.sub.3-C.sub.6 cycloalkyl)-(C.sub.3-C.sub.6 heterocycloalkyl), OR, O(C.sub.1-C.sub.4 alkyl)-R and R; R is selected from the group consisting of C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.12 alkyl, CONH.sub.2, SO.sub.2NH.sub.2, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, (C.sub.1-C.sub.12 alkyl)-(C.sub.6-C.sub.14) aryl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, wherein the C.sub.1-C.sub.12 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl are optionally substituted by 1, 2 or 3 halogens, and 1 to 4 CH.sub.2 units in the C.sub.1-C.sub.12 alkyl are optionally replaced by O atom, S atom, CO or NH; R.sub.5 is selected from the group consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.1-C.sub.4 alkoxy, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl; R.sub.3 is independently selected from the group consisting of hydrogen, C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 alkoxycarbonyl; wherein the above C.sub.3-C.sub.6 heterocycloalkyl and C.sub.5-C.sub.14 heteroaryl contain 1 or 2 heteroatoms selected from the group consisting of N, O and S atoms; R.sub.1 and R.sub.2 can be connected through a carbon-carbon bond or an ether bond to form a 14- to 16-membered ring, which contains 1-4 heteroatoms selected from the group consisting of N, O and S, preferably, the ring contains 3-4 N atoms and 1-2 O or S atoms; m and n are positive integers selected from the group consisting of 1, 2 and 3.
2. The compound represented by formula I or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the compound represented by formula I has the following structure of formula II: ##STR00553## wherein E, R.sub.1, R.sub.2 and X are defined as in claim 1.
3. The compound represented by formula I or pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the compound represented by formula I has the following structure of formula III: ##STR00554## wherein E, R.sub.1 and R.sub.2 are defined as in claim 1; Y.sub.1 and Y.sub.1 are independently CH or N.
4. The compound represented by formula I or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the compound represented by formula I has the following structure of formula IV: ##STR00555## wherein E and R.sub.2 are defined as in claim 1; Y.sub.1 and Y.sub.1 are independently CH or N; Y.sub.2 is selected from the group consisting of O, NH, NR.sub.5, NR.sub.5(C.sub.1-C.sub.4 alkyl)- and NR.sub.5 (C.sub.3-C.sub.6 cycloalkyl)-, or Y.sub.2 is absent; R.sub.1 is selected from the group consisting of R, C(O)R, SO.sub.2R, C(O)OR and SO.sub.2NHR; wherein R.sub.5 and R are defined as in claim 1.
5. The compound represented by formula I or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 4, wherein the compound represented by formula I has the following structure of formula V: ##STR00556## wherein, E, R.sub.1 and Y.sub.2 are defined as in claim 4; Y.sub.3 is selected from the group consisting of N(R.sub.5)CO, CON(R.sub.5), N(R.sub.5)SO.sub.2, SO.sub.2N(R.sub.5), CO.sub.2, CO, NH(C.sub.1-C.sub.4 alkyl)-, N(R.sub.5), O(C.sub.1-C.sub.4 alkyl)- and O, or Y.sub.3 is absent; R.sub.4 is selected from the group consisting of C.sub.1-C.sub.12 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, wherein the C.sub.1-C.sub.12 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl are optionally substituted by 1, 2 or 3 halogens; the C.sub.3-C.sub.6 heterocycloalkyl and C.sub.5-C.sub.14 heteroaryl contain 1 or 2 heteroatoms selected from the group consisting of N, O and S atoms; and 1 to 4 CH.sub.2 units in the C.sub.1-C.sub.12 alkyl are optionally replaced by O atom, S atom, CO or NH.
6. A compound represented by formula VI, or a pharmaceutically acceptable salt or stereoisomer thereof: ##STR00557## wherein, E, R.sub.1, R.sub.2, Y.sub.1, Y.sub.1, Y.sub.2, Y.sub.3 and R.sub.4 are defined as in claim 5; L is C.sub.2-C.sub.12 alkylene, wherein 1, 2, 3 or 4 CH.sub.2 units in the C.sub.2-C.sub.12 alkylene are optionally replaced by 1, 2, 3 or 4 O atom, N atom, CO, CONH or NHCO; Q is an E3 ligase ligand, preferably a VHL ligand ##STR00558## or Q is a structural unit selected from the group consisting of: ##STR00559## wherein A represents CH or N; E represents CH or N; R.sub.1 is independently selected from the group consisting of hydrogen, halogen, CF.sub.3, CN, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, amino, CF.sub.3C(O)NH, CF.sub.3C(O)N(CH.sub.3), C.sub.1-C.sub.6 alkylamino, C.sub.3-C.sub.6 cycloalkylamino, C.sub.6-C.sub.14 aryl, C.sub.5-C.sub.14 heteroaryl, C.sub.6-C.sub.14 arylamino, C.sub.6-C.sub.14 heteroarylamino, OH, C.sub.6-C.sub.14 aryloxy, CONH.sub.2, SO.sub.2NH.sub.2, C.sub.1-C.sub.6 alkyl-C(O)NR.sub.5, C.sub.3-C.sub.6 cycloalkyl-C(O)NR.sub.5, C.sub.3-C.sub.6 heterocycloalkyl-C(O)NR.sub.5, C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5, C.sub.3-C.sub.6 cycloalkyl-OC(O)NR.sub.5, C.sub.3-C.sub.6 heterocycloalkyl-OC(O)NR.sub.5, C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.1-C.sub.6 alkyl-C(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.3-C.sub.6 cycloalkyl-OC(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.3-C.sub.6 cycloalkyl-C(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, (C.sub.6-C.sub.14 aryl)-(C.sub.1-C.sub.6 alkyl)-CON(R.sub.5), (C.sub.6-C.sub.14 aryl)-(C.sub.3-C.sub.6 alkyl)-N(R.sub.5), and (C.sub.6-C.sub.14 aryl)-(C.sub.3-C.sub.6 alkenyl)-N(R.sub.5); wherein, in the above C.sub.1-C.sub.6 alkyl, one carbon atom can be replaced by a heteroatom selected from the group consisting of N, O and S atoms; preferably, R.sub.1 is independently selected from the group consisting of C.sub.1-C.sub.6 alkylamino, C.sub.3-C.sub.6 heterocycloalkylamino, C.sub.1-C.sub.6 alkylacylamino, 1-morpholinyl, and C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5; X represents a cyclic structure, selected from the group consisting of C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 cycloalkenyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, or X is absent; preferably, X is selected from the group consisting of phenyl, pyridyl, methoxy-substituted pyridyl, thiazolyl, cyclohexyl and cyclohexenyl, wherein the phenyl can be substituted by the following substituents: SO.sub.2NH.sub.2, NHCOCH.sub.3, NH.sub.2, CONH.sub.2, OCH.sub.3, halogen, C.sub.1-C.sub.4 alkyl, SO.sub.2N(BoC)CH.sub.3 or C.sub.1-C.sub.4 alkyl-NHSO.sub.2; R.sub.2 is independently selected from the group consisting of hydrogen, halogen, NH.sub.2, N(R.sub.5)COR, CON(R.sub.5)R, N(R.sub.5)SO.sub.2R, SO.sub.2N(R.sub.5)R, COOR, COR, (C.sub.1-C.sub.4 alkyl)-OR, (C.sub.1-C.sub.4 alkyl)-N(CH.sub.3).sub.2, NH(C.sub.1-C.sub.4 alkyl)R, N(R.sub.5)R, NHCO(C.sub.3-C.sub.6 cycloalkyl)-(C.sub.3-C.sub.6 heterocycloalkyl), OR, O(C.sub.1-C.sub.4 alkyl)-R and R; R is selected from the group consisting of C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.12 alkyl, CONH.sub.2, SO.sub.2NH.sub.2, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, (C.sub.1-C.sub.12 alkyl)-(C.sub.6-C.sub.14)aryl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, wherein the C.sub.1-C.sub.12 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl are optionally substituted by 1, 2 or 3 halogens, and 1 to 4 CH.sub.2 units in the C.sub.1-C.sub.12 alkyl are optionally replaced by O atom, S atom, CO or NH: R.sub.5 is selected from the group consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.1-C.sub.4 alkoxy, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl; or Q is ##STR00560##
7. A compound represented by formula VII, or a pharmaceutically acceptable salt or stereoisomer thereof: ##STR00561## wherein, E, R.sub.1, R.sub.2, R.sub.1, Y.sub.1, Y.sub.1 and Y.sub.2 are defined as in claim 5; Y.sub.3 is selected from the group consisting of N(R.sub.5)CO, CON(R.sub.5), N(R.sub.5)SO.sub.2, SO.sub.2N(R.sub.5), CO.sub.2, CO, NH(C.sub.1-C.sub.4 alkyl)-, N(R.sub.5), O(C.sub.1-C.sub.4 alkyl)-, and O, or Y.sub.3 is absent; L is C.sub.2-C.sub.12 alkylene, wherein 1, 2, 3 or 4 CH.sub.2 units in the C.sub.2-C.sub.12 alkylene are optionally replaced by 1, 2, 3 or 4 O atoms, N atoms, CO, CONH or NHCO; Q is an E3 ligase ligand, preferably a VHL ligand ##STR00562## or Q is a structural unit selected from the group consisting of: ##STR00563## wherein, A represents CH or N; E represents CH or N; R.sub.1 is independently selected from the group consisting of hydrogen, halogen, CF.sub.3, CN, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, amino, CF.sub.3C(O)NH, CF.sub.3C(O)N(CH.sub.3), C.sub.1-C.sub.6 alkylamino, C.sub.3-C.sub.6 cycloalkylamino, C.sub.6-C.sub.14 aryl, C.sub.5-C.sub.14 heteroaryl, C.sub.6-C.sub.14 arylamino, C.sub.6-C.sub.14 heteroarylamino, OH, C.sub.6-C.sub.14 aryloxy, CONH.sub.2, SO.sub.2NH.sub.2, C.sub.1-C.sub.6 alkyl-C(O)NR.sub.5, C.sub.3-C.sub.6 cycloalkyl-C(O)NR.sub.5, C.sub.3-C.sub.6 heterocycloalkyl-C(O)NR.sub.5, C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5, C.sub.3-C.sub.6 cycloalkyl-OC(O)NR.sub.5, C.sub.3-C.sub.6 heterocycloalkyl-OC(O)NR.sub.5, C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.1-C.sub.6 alkyl-C(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.3-C.sub.6 cycloalkyl-OC(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, C.sub.3-C.sub.6 cycloalkyl-C(O)NR.sub.5(C.sub.1-C.sub.4 alkyl)-, (C.sub.6-C.sub.14 aryl)- (C.sub.1-C.sub.6 alkyl)-CON(R.sub.5), (C.sub.6-C.sub.14 aryl)-(C.sub.3-C.sub.6 alkyl)-N(R.sub.5), and (C.sub.6-C.sub.14 aryl)-(C.sub.3-C.sub.6 alkenyl)-N(R.sub.5); wherein, in the above C.sub.1-C.sub.6 alkyl, one carbon atom can be replaced by a heteroatom selected from the group consisting of N, O and S atoms; preferably, R.sub.1 is independently selected from the group consisting of C.sub.1-C.sub.6 alkylamino, C.sub.3-C.sub.6 heterocycloalkylamino, C.sub.1-C.sub.6 alkylacylamino, 1-morpholinyl, and C.sub.1-C.sub.6 alkyl-OC(O)NR.sub.5; X represents a cyclic structure, selected from the group consisting of C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 cycloalkenyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, or X is absent; preferably, X is selected from the group consisting of phenyl, pyridyl, methoxy-substituted pyridyl, thiazolyl, cyclohexyl and cyclohexenyl, wherein the phenyl can be substituted by the following substituents: SO.sub.2NH.sub.2, NHCOCH.sub.3, NH.sub.2, CONH.sub.2, OCH.sub.3, halogen, C.sub.1-C.sub.4 alkyl, SO.sub.2N(BoC)CH.sub.3 or C.sub.1-C.sub.4 alkyl-NHSO.sub.2; R.sub.2 is independently selected from the group consisting of hydrogen, halogen, NH.sub.2, N(R.sub.5)COR, CON(R.sub.5)R, N(R.sub.5)SO.sub.2R, SO.sub.2N(R.sub.5)R, COOR, COR, (C.sub.1-C.sub.4 alkyl)-OR, (C.sub.1-C.sub.4 alkyl)-N(CH.sub.3).sub.2, NH(C.sub.1-C.sub.4 alkyl)R, N(R.sub.5)R, NHCO(C.sub.3-C.sub.6 cycloalkyl)-(C.sub.3-C.sub.6 heterocycloalkyl), OR, O(C.sub.1-C.sub.4 alkyl)-R and R; R is selected from the group consisting of C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.12 alkyl, CONH.sub.2, SO.sub.2NH.sub.2, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, (C.sub.1-C.sub.12 alkyl)-(C.sub.6-C.sub.14)aryl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl, wherein the C.sub.1-C.sub.12 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl are optionally substituted by 1, 2 or 3 halogens, and 1 to 4 CH.sub.2 units in the C.sub.1-C.sub.12 alkyl are optionally replaced by O atom, S atom, CO or NH; R.sub.5 is selected from the group consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.3-C.sub.6 heterocycloalkyl, C.sub.1-C.sub.4 alkoxy, C.sub.6-C.sub.14 aryl and C.sub.5-C.sub.14 heteroaryl; or Q is ##STR00564##
8. The compound or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the compound is selected from the group consisting of: ##STR00565## ##STR00566## ##STR00567## ##STR00568## ##STR00569## ##STR00570## ##STR00571## ##STR00572## ##STR00573## ##STR00574## ##STR00575## ##STR00576## ##STR00577## ##STR00578## ##STR00579## ##STR00580## ##STR00581## ##STR00582## ##STR00583## ##STR00584## ##STR00585## ##STR00586##
9. A method of treating or preventing a neurodegenerative disease or neurological disease or condition, comprising administering the compound or pharmaceutically acceptable salt or stereoisomer thereof according to claim 1 to a subject in need thereof.
10. A method of inhibiting SARM1 enzymatic activity, comprising administering the compound or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1 to a subject in need thereof.
11. A method of treating or preventing an axonal degeneration-related disease or condition, comprising administering the compound or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1 to a subject in need thereof.
12. The method according to claim 9, wherein the neurodegenerative disease or neurological disease or condition is selected from the group consisting of Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis and peripheral neuropathy.
13. The method according to claim 11, wherein the axonal degeneration-related disease or condition is selected from the group consisting of Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis and peripheral neuropathy.
Description
DETAILED DESCRIPTION
Terms
[0067] As used herein, reference to a compound having a particular structural formula generally also encompasses pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, racemic mixtures and isotope derivatives thereof.
[0068] It is known to those skilled in the art that in addition to the salts of compounds, solvates and hydrates are alternative forms of compounds, which can all be converted into the compounds under certain conditions. Therefore, when referring to a compound herein, the solvate and hydrate thereof are generally included.
[0069] The pharmaceutically acceptable salt of the present disclosure may be formed using, for example, the following inorganic or organic acids. Pharmaceutically acceptable salts refer to salts which, within the scope of reasonable medical judgment, are suitable for contact with humans and mammals tissue without undue toxicity, irritation, allergic reactions, etc., and have a reasonable benefit/risk ratio. The salts may be prepared in situ during the final isolation and purification of the compounds of the present disclosure, or prepared separately by reacting a free base or free acid with a suitable reagent. For example, a free base can be reacted with a suitable acid. Examples of pharmaceutically acceptable acid addition salts are salts formed by amino (amine) with inorganic acids (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or organic acids (such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid), or salts formed by using other methods in the art such as ion exchange. Other pharmaceutically acceptable salts include sodium alginate, ascorbate, benzenesulfonate, adipate, camphorsulfonate, aspartate, benzoate, bisulfate, borate, butyrate, camphorate, citrate, lauryl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerol phosphate, gluconate, enanthate, hexanoate, hydroiodide, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, niacinate, nitrate, oleate, oxalate, palmitate, pamate, pectate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc.
[0070] The pharmaceutically acceptable salt of the present disclosure can be prepared by conventional methods, for example, by dissolving the compound of the present disclosure in a water-miscible organic solvent (such as methanol, ethanol, acetone, and acetonitrile), adding an excess amount of organic acid or inorganic acid aqueous solution thereto, to precipitate salt from the resulting mixture, removing the solvent and the remaining free acid therefrom, and isolating the precipitated salt.
[0071] Solvate as used herein refers to a physical association of the compound of the present disclosure with one or more solvent molecules, whether organic or inorganic. This physical association includes a hydrogen bond. In certain circumstances, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid, the solvate will be able to be isolated. The solvent molecules in a solvate may exist in regular and/or disordered arrangements. A solvate may contain stoichiometric or non-stoichiometric amounts of solvent molecules. Solvate encompasses both solution phase and isolable solvate. Exemplary solvates include, but are not limited to, hydrates, ethanolates, metholates, and isopropolates. Solvation methods are well known in the art.
[0072] Stereoisomerism as used herein is divided into conformational isomerism and configurational isomerism. Configurational isomerism can further be divided into cis-trans isomerism and optical isomerism. Conformational isomerism refers to a stereoisomerism phenomenon in which each atom or group of atoms of an organic molecule with a certain configuration are arranged differently in space due to the rotation or distortion of carbon-carbon single bonds. Common structures include alkanes and cycloalkanes, such as the chair conformation and boat conformation that appear in the cyclohexane structure. Stereoisomer means that the compound of the present disclosure contains one or more asymmetric centers, which is thus available to be a racemate and racemic mixture, single enantiomer, diastereomeric mixture and single diastereomer. The compound of the present disclosure can have an asymmetric center, and each asymmetric center will produce two optical isomers. The scope of the present disclosure includes all possible optical isomers and diastereomeric mixtures and pure or partially pure compounds.
[0073] In particular, the compound described in the present disclosure may exist as a tautomer having different points of attachment of hydrogens by displacement of one or more double bonds. For example, a ketone and its enol form are keto-enol tautomers. Each tautomer and mixtures thereof are included in the compound of the present disclosure. All enantiomers, diastereomers, racemates, mesomers, cis-trans isomers, tautomers, geometric isomers, epimers, mixtures thereof, etc. are included in the scope of the present disclosure.
[0074] Isotopic derivative as used herein refers to a molecule in which the compound of the present disclosure is isotopically labeled. Isotopes commonly used as isotope labels include hydrogen isotopes: 2H and 3H; carbon isotopes: 11C, 13C and 14C; chlorine isotopes: 35Cl and 37Cl; fluorine isotope: 18F; iodine isotopes: 123I and 125I; nitrogen isotopes: 13N and 15N; oxygen isotopes: 15O, 17O and 18O, and sulfur isotope: 35S. The isotopically labeled compounds can be used to study the distribution of pharmaceutical molecules in tissues. Substitution by certain heavy isotopes, such as deuterium (2H), can enhance metabolic stability and extend half-life, thereby reducing administration amount and providing therapeutic advantages. Isotopically labeled compounds are generally synthesized starting from labeled starting materials using known synthetic techniques as for non-isotopically labeled compounds.
[0075] The compound of the present disclosure may be used in combination with an additional SARM1 enzymatic activity inhibitor for treating or preventing a neurodegenerative disease or related neurological disease or condition, or may be used in combination with an additional active drug for treating or preventing a neurodegenerative disease or related neurodegenerative disease or condition, for treating or preventing a neurodegenerative disease or related neurodegenerative disease or condition.
[0076] The compound of the present disclosure or pharmaceutically acceptable salt thereof can be administered orally or parenterally as an active ingredient, at an effective amount ranging from 0.1 to 2000 mg/kg body weight/day, preferably, 0.1 to 100 mg/kg body weight/day in the case of mammals including humans (body weight about 70 kg), in single or divided doses per day, or with/without following a predetermined time. The administration amount of the active ingredient may be adjusted based on a number of relevant factors such as the condition of the subject to be treated, the type and severity of the disease, the rate of administration and physician opinion. In some cases, amounts less than the above amounts may be appropriate.
[0077] The pharmaceutical composition of the present disclosure can be formulated into a dosage form for oral administration or parenteral administration (including intramuscular administration, intravenous and subcutaneous administration, and intratumoral injection) according to any of conventional methods, such as tablets, granules, powders, capsules, syrups, emulsions, microemulsions, solutions or suspensions.
[0078] The pharmaceutical composition of the present disclosure for oral administration can be prepared by mixing the active ingredient with a carrier, for example, selected from the group consisting of cellulose, calcium silicate, magnesium stearate, calcium stearate, corn starch, lactose, sucrose, dextrose, calcium phosphate, stearic acid, surfactants, suspending agents, gelatin, talc, emulsifiers and diluents. Examples of carriers used in the injectable compositions of the present disclosure include water, glycerides, salt solutions, alcohols, glycols, glucose solutions, ethers (such as polyethylene glycol 400), oils, fatty acids, fatty acid esters, surfactants, suspending agents and emulsifiers.
[0079] Unless otherwise stated, mass spectrometry, nuclear magnetic resonance, HPLC, protein chemistry, biochemistry, recombinant DNA technology, and pharmacological conventional methods are used. In the present disclosure, or or and are used to mean and/or unless stated otherwise.
[0080] In the description and claims, a given chemical formula or name will cover all stereo and optical isomers as well as racemates in which the above isomers are present. Unless otherwise indicated, all chiral (enantiomeric and diastereomeric) and racemic forms are within the scope of the present disclosure. Many geometric isomers of CC double bonds, CN double bonds, ring systems, etc. may also exist in the compounds, and all the above stable isomers are encompassed by the present disclosure. The present disclosure describes cis- and trans- (or E- and Z-) geometric isomers of the compounds of the present disclosure, which may be isolated into mixtures of isomers or separate isomeric forms.
[0081] The compounds of the present disclosure can be isolated in optically active or racemic forms. All methods for preparing the compounds of the present disclosure and the intermediates prepared therein are considered to be part of the present disclosure. In the preparation of enantiomeric or diastereomeric products, they can be isolated by conventional methods, for example by chromatography or fractional crystallization. It should be understood that all tautomeric forms which may exist are included in the present disclosure. The compounds of the present disclosure are commercially available as they are known in the art.
[0082] Unless otherwise defined, when a substituent is designated as optionally substituted, the substituent is selected from, for example, substituents such as alkyl, cycloalkyl, aryl, heterocyclyl, halogen, hydroxyl, alkoxy, nitro, cyano, oxo, alkanoyl, aryloxy, alkanoyloxy, amino, alkylamino, arylamino, and alkylthio.
[0083] The term alkyl or alkylene as used herein is intended to include both branched and straight chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. The alkyl in the present disclosure is preferably C.sub.1-C.sub.12 alkyl, C.sub.1-C.sub.10 alkyl, C.sub.1-C.sub.8 alkyl, more preferably C.sub.1-C.sub.6 alkyl, particularly preferably C.sub.1-C.sub.4 alkyl, particularly C.sub.1-C.sub.3 alkyl. For example, C.sub.1-C.sub.6 alkyl represents an alkyl having 1 to 6 carbon atoms. Examples of alkyl include, but are not limited to, methyl (Me), ethyl (Et), propyl (such as n-propyl and isopropyl), butyl (such as n-butyl, isobutyl, tert-butyl), and pentyl (such as n-pentyl, isopentyl, neopentyl). In the C.sub.1-C.sub.12 alkyl in the present disclosure, 1 to 4 CH.sub.2 units are optionally replaced by O atoms, S atoms or NH.
[0084] The term alkoxy or alkyloxy refers to O-alkyl. For example, C.sub.1-C.sub.6 alkoxy (or alkyloxy) is intended to include C.sub.1, C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6 alkoxy. Preferred alkoxy includes C.sub.1-C.sub.10 alkoxy, C.sub.1-C.sub.8 alkoxy, more preferably C.sub.1-C.sub.6 alkoxy, particularly preferably C.sub.1-C.sub.4 alkoxy, particularly C.sub.1-C.sub.3 alkoxy. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, propoxy (such as n-propoxy and isopropoxy), and tert-butoxy. Similarly, alkylthio or thioalkoxy represents a sulfur-bridged alkyl defined as above having the specified number of carbon atoms; for example, methyl-S and ethyl-S. Similarly, preferred alkylthio includes C.sub.1-C.sub.10 alkylthio, C.sub.1-C.sub.8 alkylthio, more preferably C.sub.1-C.sub.6 alkylthio, particularly preferably C.sub.1-C.sub.4 alkylthio, particularly C.sub.1-C.sub.3 alkylthio.
[0085] The term carbonyl refers to an organic functional group consisting of two atoms of carbon and oxygen connected by a double bond (CO or C(O)).
[0086] The term aryl, alone or as part of a large moiety such as aralkyl, aralkoxy or aryloxyalkyl, refers to a monocyclic, bicyclic or tricyclic ring system having a total of 6 to 14 ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members. In certain embodiments of the present disclosure, aryl refers to an aromatic ring system including, but not limited to, phenyl, naphthyl, biphenyl, indanyl, 1-naphthyl, 2-naphthyl, and tetrahydronaphthyl. The aryl of the present disclosure is preferably C.sub.6-C.sub.10 aryl. The term aralkyl or arylalkyl refers to an alkyl residue attached to an aryl ring. Non-limiting examples include benzyl and phenethyl.
[0087] The term cycloalkyl refers to cyclic alkyl, which may be monocyclic or bicyclic. The cycloalkyl of the present disclosure is preferably C.sub.3-C.sub.8 cycloalkyl, including but not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and norbornyl.
[0088] Halo or halogen includes fluorine, chlorine, bromine and iodine. Haloalkyl is intended to include branched and straight chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms substituted with one or more halogens. Examples of haloalkyl include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, pentachloroethyl, 2,2,2-trifluoroethyl, heptafluoropropyl and heptachloropropyl. Examples of haloalkyl further include fluoroalkyl intended to include branched and straight chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms substituted with one or more fluorine atoms, particularly preferably trifluoromethyl.
[0089] Haloalkoxy represents haloalkyl defined as above having the specified number of carbon atoms linked via an oxygen bridge. For example, C.sub.1-C.sub.6 haloalkoxy is intended to include C.sub.1, C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6 haloalkoxy. Examples of haloalkoxy include, but are not limited to, trifluoromethoxy, 2,2,2-trifluoroethoxy and pentafluoroethoxy. Similarly, haloalkylthio or thiohaloalkoxy represents a sulfur-bridged haloalkyl defined as above having the specified number of carbon atoms; for example, trifluoromethyl-S and pentafluoroethyl S.
[0090] In the present disclosure, one or more halogens may be each independently selected from the group consisting of fluorine, chlorine, bromine and iodine.
[0091] The term heteroaryl refers to a stable 3-membered, 4-membered, 5-membered, 6-membered, or 7-membered aromatic monocyclic ring or a 7-membered, 8-membered, 9-membered, or 10-membered aromatic bicyclic ring or aromatic polycyclic heterocyclic ring, which is fully unsaturated or partially unsaturated, and contains carbon atoms and 1, 2, 3 or 4 heteroatoms independently selected from the group consisting of N, O and S. Nitrogen and sulfur heteroatoms may optionally be oxidized. Nitrogen atoms are substituted or unsubstituted (i.e., N or NR, where R is H or another substituent if defined). Heterocycles can be attached to their pendant groups at any heteroatom or carbon atom that results in a stable structure. If the resulting compound is stable, the heterocyclyl described herein may be substituted on the carbon or nitrogen atom. The nitrogen in the heterocycle may optionally be quaternized. Preferably, when the total number of S and O atoms in the heterocycle exceeds 1, then these heteroatoms are not adjacent to each other. Preferably, the total number of S and O atoms in the heterocycle is not greater than 1. When the term heterocycle is used, it is intended to include heteroaryl. Examples of heteroaryl include, but are not limited to, acridinyl, azetidinyl, azecinyl, benzimidazolyl, benzofuryl, benzothiofuranyl, benzothienyl, benzoxazolyl, benzoxazolinyl, benzothiazolyl, benzotriazolyl, benzotetrazolyl, benzisoxazolyl, benzisothiazolyl, benzimidazolinyl, carbazolyl, 4aH-carbazolyl, carbolinyl, chromanyl, chromenyl, cinnolinyl, decahydroquinolyl, 2H,6H-1,5,2-dithiazinyl, dihydrofuro[2,3-b]tetrahydrofuranyl, furanyl, furoxanyl, imidazolidinyl, imidazolinyl, imidazolyl, 1H-indazolyl, imidazopyridyl, indolenyl, dihydroindolyl, indolizinyl, indolyl, 3H-indolyl, isatinoyl, isobenzofuranyl, isochromanyl, isoindazolyl, isodihydroindolyl, isoindolyl, isoquinolinyl, isothiazolyl, isothiazopyridyl, isoxazolyl, isoxazolopyridyl, methylenedioxyphenyl, morpholinyl, diazanaphthyl, octahydroisoquinolinyl, oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl, oxazolyl, oxazolopyridyl, oxazolidinyl, perimidyl, oxindolyl, pyrimidinyl, phenanthridinyl, phenanthrolinyl, phenazinyl, phenothiazinyl, phenoxathiyl, phenoxazinyl, phthalazinyl, piperazinyl, piperidinyl, piperidinonyl, 4-piperidinonyl, piperonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazopyridyl, pyrazolyl, pyridazinyl, pyridoxazolyl, pyridimidazolyl, pyridothiazolyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, 2-pyrrolidonyl, 2H-pyrrolyl, pyrrolyl, quinazolinyl, quinolinyl, 4H-quinolizinyl, quinoxalinyl, quinuclidinyl, tetrazolyl, tetrahydrofuryl, tetrahydroisoquinolyl, tetrahydroquinolyl, 6H-1,2,5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thianthrenyl, thiazolyl, thienyl, thiazolopyridyl, thienothiazolyl, thienoxazolyl, thienoimidazolyl, thienyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, 1,3,4-triazolyl and xanthyl, quinolyl, isoquinolyl, phthalazinyl, quinazolinyl, indolyl, isoindolyl, dihydroindolyl, 1H-indazolyl, benzimidazolyl, 1,2,3,4-tetrahydroquinolyl, 1,2,3,4-tetrahydroisoquinolyl, 5,6,7,8-tetrahydro-quinolyl, 2,3-dihydro-benzofuryl, chromanyl, 1,2,3,4-tetrahydro-quinoxalinyl and 1,2,3,4-tetrahydro-quinazolinyl. The term heteroaryl may further include a biaryl structure formed by the above-defined aryl and a monocyclic heteroaryl, such as but not limited to -phenylbipyridyl-, -phenylbipyrimidinyl, -pyridylbiphenyl, -pyridylbipyrimidinyl-, -pyrimidinylbiphenyl-; wherein the present disclosure further includes fused-ring and spirocyclic compounds containing, for example, the above heterocycles.
[0092] The term substituted/substitution as used herein means that at least one hydrogen atom is replaced by a non-hydrogen group, provided that normal valency is maintained and that the substitution results in a stable compound. As used herein, a cyclic double bond is a double bond formed between two adjacent ring atoms (such as CC, CN, or NN).
[0093] When any variable occurs more than once in any composition or formula of a compound, its definition on each occurrence is independent of its definition on every other occurrence. Thus, for example, if a group is shown substituted with 0-3 R, then the group may be optionally substituted with up to three R groups, with R on each occurrence being independently selected from the definition of R. Furthermore, combinations of substituents and/or variables are permitted only if such combinations result in stable compounds.
[0094] As used herein, the term effective amount refers to an amount of a drug or agent (i.e., the compound of the present disclosure) that will elicit the biological or medical response in a tissue, system, animal, or human, for example, that is sought by a researcher or clinician. Furthermore, the term therapeutically effective amount refers to an amount that results in improved treatment, cure, prevention, or alleviation of a disease, condition, or side effect, or reduction in rate at which the disease or condition progresses, compared to a corresponding subject that does not receive such amount. An effective amount may be administered in one or more administrations, applications or doses and is not intended to be limited by a particular formulation or route of administration. The term further includes an amount effective to enhance normal physiological functions within its scope.
[0095] The term treatment as used herein includes any effect resulting in amelioration of a condition, disease, disorder, etc., such as alleviation, reduction, regulation, amelioration or elimination, or compromise of symptoms thereof.
[0096] The term pharmaceutically acceptable is used herein to refer to those compounds, substances, compositions and/or dosage forms which, within the scope of reasonable medical judgment, are suitable for use in contact with human and animal tissue without excessive toxicity, irritation, allergic reactions and/or other problems or complications, and proportionate to a reasonable benefit/risk ratio.
[0097] The phrase pharmaceutically acceptable carrier as used herein refers to a pharmaceutical substance, composition or vehicle such as a liquid or solid filler, diluent, excipient, manufacturing auxiliary (e.g., lubricant, talc, magnesium stearate, calcium stearate or zinc stearate or stearic acid) or a solvent encapsulated substance, which involves carrying or transporting the subject compound from one organ or part of the body to another. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and harmless to the patient.
[0098] The term pharmaceutical composition refers to a composition comprising a compound of the present disclosure and at least one other pharmaceutically acceptable carrier. Pharmaceutically acceptable carrier refers to a medium generally accepted in the art for the delivery of biologically active agents to animals, particularly mammals, including (i.e.) adjuvants, excipients or vehicles such as diluents, preservatives, fillers, flow regulators, disintegrants, wetting agents, emulsifiers, suspending agents, sweeteners, flavoring agents, aromatics, antibacterial agents, antifungal agents, lubricants and dispersants, depending on the mode of administration and characteristics of dosage form.
[0099] As used herein, a compound or pharmaceutical composition, when administered, can ameliorate a disease, symptom or condition, especially the severity thereof, delay the onset of the disease, slow down the progression of the disease, or reduce the duration of the disease. Whether the administration is fixed or temporary, continuous or intermittent may be attributed to or related to the administration circumstances.
Route of Administration
[0100] Suitable routes of administration include, but are not limited to, oral, intravenous, rectal, aerosol, parenteral, ocular, pulmonary, transdermal, vaginal, ear canal, nasal and topical administration. In addition, by way of example only, parenteral administration includes intramuscular injection, subcutaneous injection, intravenous injection, intramedullary injection, ventricular injection, intraperitoneal injection, intralymphatic injection, and intranasal injection.
[0101] In an aspect, the compounds described herein are administered locally rather than systemically. In a certain embodiment, a long-acting formulation is administered by implantation (e.g., subcutaneously or intramuscularly) or by intramuscular injection. Furthermore, in another particular embodiment, the drug is administered via a targeted drug delivery system, for example, a liposome coated with organ-specific antibodies. In this particular embodiment, the liposome is selectively targeted to specific organs for uptake.
[0102] In the pharmaceutical composition of the present disclosure, pharmaceutical carriers can be formulated according to many factors within the scope of knowledge of those skilled in the art. These factors include, but are not limited to, the type and characteristics of the active agent formulated; the subject to whom the composition containing the active agent is to be administered; the intended route of administration of the composition; and the targeted therapeutic indication. Pharmaceutical carriers include aqueous and non-aqueous liquid media and various solid and semi-solid dosage forms.
[0103] The carriers described above may include many other different ingredients and additives in addition to the active agent. The other ingredients are included in the formulation for various reasons known to those skilled in the art, such as an activity-stabilizing agent and a binding agent. Descriptions of suitable pharmaceutical carriers and factors involved in carrier selection can be found in several readily available sources, such as Allen L. V Jr. et al. Remington: The Science and Practice of Pharmacy (2 Volumes), 22.sup.nd Edition (2012), Pharmaceutical Press.
[0104] The compound is typically administered in the form of a mixture formulated with a suitable pharmaceutical diluent, excipient or carrier (herein, collectively referred to as pharmaceutical carriers), which is appropriately selected in accordance with the intended mode of administration (such as oral tablets, capsules, elixirs, and syrups) and consistent with conventional pharmacy practice.
[0105] Although the compound of the present disclosure can be administered alone, it is preferred to be administered in the form of a pharmaceutical formulation (composition).
Kit/Product Packaging
[0106] For use in the treatment of the above indications, the kit/product packaging is also described herein. These kits can be composed of a conveyor, a drug pack or a container box, wherein the container box can be divided into multiple compartments to accommodate one or more containers, such as a vial, a test tube and the like, and each container contains a single ingredient in the method described. Suitable containers include bottles, vials, syringes and test tubes. Containers are made of acceptable materials such as glass or plastic.
[0107] For example, a container may contain one or more compounds described herein, where the compound exits either as a pharmaceutical component or in a mixture with other ingredients described herein. The container may have a sterile outlet (for example, the container may be an IV bag or bottle, and the stopper may be pierced by a hypodermic needle). Such kit may contain a compound and an instruction for the use method as described herein, a label, or an operation instruction.
[0108] A typical kit may include one or more containers. Each container contains one or more materials (such as a reagent, or a concentrated stock solution, and/or equipment) to accommodate commercial promotion and demand of users for the use of the compound. These materials include, but are not limited to, a buffer, a diluent, a filter, a needle, a syringe, a delivery device, a bag, a container, a bottle and/or a test tube, accompanied by a list of contents and/or an instruction for use, as may the built-in packaging. The entire set of instruction must be included.
[0109] The above features described in the present disclosure or the features described in the embodiments may be combined in any combination. All features disclosed in the specification of the present disclosure may be used in conjunction with any combination form. Each feature disclosed in the specification may be replaced by any alternative feature that serves the same, equivalent or similar purpose. Therefore, unless otherwise stated, the features disclosed are only general examples of equivalent or similar features.
[0110] The present disclosure will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. In the following examples, experimental methods without specifying specific conditions are usually conducted under conventional conditions or conditions recommended by the manufacturer. Unless otherwise stated, all percentages, ratios, proportions, or parts are by weight.
[0111] The unit of weight-volume percentage in the present disclosure is well known to those skilled in the art, for example, referring to the weight of the solute in 100 ml of solution. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be used in the method of the present disclosure. The preferred implementation methods and materials described herein are for demonstration purposes only.
[0112] In the terms used in the present disclosure, neurodegenerative disease and neural degenerative disease have the same meaning; axonal degeneration and axon degeneration have the same meaning. Those skilled in the art will understand that the terms have commonly understood meanings.
EXAMPLES
[0113] The present teachings include the description provided in the examples, which is not intended to limit the scope of any claim. The following non-limiting examples are provided to further illustrate the present disclosure. In light of the present disclosure, those skilled in the art will appreciate that many changes can be made to the specific embodiments disclosed and the same or similar results can still be obtained without departing from the spirit and scope of the present teachings.
[0114] Unless otherwise stated, all materials/reagents were obtained from commercial suppliers and used without further purification. Reactions were monitored during the experiments by LC-MS and/or thin layer chromatography (TLC) on silica 60 F254 (0.2 mm) precoated glass backings and visualized using UV light. The structures of the compounds in the following examples were characterized by nuclear magnetic resonance (NMR) and/or mass spectrometry (MS).
[0115] .sup.1HNMR (400 MHz) spectra were recorded on Bruker spectrometer at room temperature with TMS or residual solvent peaks as internal standards. Chemical shift values or peak shape multiples are given in (6), and the coupling constant (J) is given as an absolute value in Hertz (Hz). The abbreviations for multiplicity in .sup.1HNMR spectra are as follows: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br or broadt (broadened).
[0116] Preparative HPLC purification was performed on Shimadzu LC-6AD. All purification work was performed using Shim-pack PREP-DDS(H)KIT columns. The mobile phase was water (containing 0.1% HCO2H) and acetonitrile; all reagents used were HPLC grade. The flow rate was 10 ml/min.
[0117] LC-MS was performed on Agilent 1260 infinityII under the following conditions: mobile phase: A: water (0.1% trifluoroacetic acid), B: ACN; 3.5 min of running program; column: YMC-Triart C18, 50*3 mm, 3 m; flow rate: 1.8 ml/min; oven temperature: 40 C.; gradient: 5-100 (ACN %).
[0118] Preparative TLC was performed on a Whatman LK6F Silica Gel 60A plate with a size of 2020 cm and a thickness of 500 m.
[0119] The following examples are intended to illustrate embodiments of the present disclosure without limiting it in any way.
Synthesis of Intermediates
Synthesis of Intermediate BB1
[0120] ##STR00042##
Step 1: Compound BB1-B bis-tert-butylimidazo[1,2-b]pyridazin-6-yl aminodicarboxylate
[0121] ##STR00043##
[0122] A dichloromethane solution containing compound BB1-A imidazo[1,2-b]pyridazin-6-amine (50 mg, 0.373 mmol), di-tert-butyl dicarbonate (89.55 mg, 0.41 mmol), 4-dimethylaminopyridine (9.1 mg, 0.0745 mmol) and triethylamine (75.49 mg, 0.746 mmol) was stirred at room temperature for 14 hours. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with water (10 ml) and dichloromethane (10 ml2). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain compound BB1-B bis-tert-butylimidazo[1,2-b]pyridazin-6-ylaminodicarboxylate (85 mg) as a white solid.
[0123] LC_MS: (ES.sup.+): m/z 335.1 [M+H].sup.+
Step 2: Compound BB1 Tert-butyl (3-bromoimidazo [1,2-b]pyridazin-6-yl)aminodicarboxylate
[0124] ##STR00044##
[0125] A dichloromethane solution (2.5 ml) containing the compound BB1-B bis-tert-butylimidazo[1,2-b]pyridazin-6-ylaminodicarboxylate (60 mg, 0.256 mmol) and N-bromosuccinimide (50.17 mg, 0.282 mmol) was stirred at room temperature for 5 hours. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with water (10 ml) and dichloromethane (10 ml2). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was separated and purified by preparative TLC (eluted with dichloromethane containing 2.38% methanol) to obtain compound BB1 tert-butyl (3-bromoimidazo [1,2-b]pyridazin-6-yl)aminodicarboxylate (55 mg) as a white solid.
[0126] LC_MS: (ES.sup.+): m/z 335.1 [M+H].sup.+
Synthesis of Intermediate BB2
[0127] ##STR00045##
Step 1: Compound BB2 4-methoxy-5-nitropyridin-2-amine
[0128] ##STR00046##
[0129] A methanol solution (20 mL) containing compound BB2-A (500 mg, 2.88 mmol) was added with sodium methoxide (1.56 g, 8.64 mmol). The mixture was stirred at 20 C. for 12 hours of reaction, and then heated to 60 C. and stirred for 1 hour of reaction. The compound BB2-A (Rf=0.7) was monitored to be completely consumed by TLC (DCM:MeOH=10:1), and a new spot (Rf=0.5) was generated. The reaction solution was concentrated. The residue was diluted with water (20 mL) and extracted with ethyl acetate (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was subjected to silica gel column chromatography (eluted with dichloromethane containing 8% methanol, Rf=0.5) to obtain compound BB2 4-methoxy-5-nitropyridin-2-amine (420 mg) as a yellow solid.
[0130] LC_MS: (ES.sup.+): m/z 170.1 [M+H].sup.+.
Synthesis of Intermediate BB3
[0131] ##STR00047##
Step 1: Compound BB3 3-bromo-7-chloroimidazole[1,2-a]pyridin-6-amine
[0132] ##STR00048##
[0133] Ammonium chloride (19.4 mg) and iron powder (20.2 mg) were added to a mixed solution of ethanol (2 mL) and water (0.2 mL) containing compound BB3-A (20 mg, 72.34 mol). The reaction solution was stirred at 80 C. for 3 hours of reaction. Compound BB3-A (Rf=0.7) was monitored by TLC (PE:EtOAc=1:2) to be completely consumed, and two new spots (Rf=0.5, 0.4) were generated. The reaction solution was filtered, and the mother liquor was concentrated. The residue was diluted with water (10 mL) and extracted with ethyl acetate (10 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was used directly in the next step without further purification. Thus, a yellow solid crude compound BB-3 3-bromo-7-chloroimidazole[1,2-a]pyridin-6-amine (17.8 mg) was obtained.
[0134] LC_MS: (ES.sup.+): m/z 245.9 [M+H].sup.+.
Synthesis of Intermediate BB4
[0135] ##STR00049##
Step 1: Intermediate BB4 N-(3-bromoimidazo[1,2-a]pyridin-6-yl)-N-methylacetamide
[0136] ##STR00050##
[0137] A dichloromethane (4 ml) solution containing compound BB4-A 3-bromo-N-methylimidazo[1,2-a]pyridin-6-amine (80 mg, 0.354 mmol) and triethylamine (35.75 mg, 0.354 mmol) was added with compound BB4-B acetyl chloride (33.3 mg, 0.425 mmol) under nitrogen at 0 C. The reaction solution was stirred at 0 C. for 5 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was added with water and extracted with dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was subjected to preparative TLC (eluted with dichloromethane containing 2.4% methanol) to obtain brown solid compound BB4 N-(3-bromoimidazo[1,2-a]pyridin-6-yl)-N-methylacetamide (43 mg).
[0138] LC_MS: (ES.sup.+): m/z 269.9 [M+H].sup.+.
Synthesis of Intermediates BB5 and BB6
[0139] ##STR00051##
Step 1: Compound BB5-C tert-butyl (6-nitropyridin-3-yl)carbamate
[0140] ##STR00052##
[0141] A toluene solution containing compound BB5-A 5-bromo-2-nitropyridine (500 mg, 2.46 mmol) and compound BB5-B (577.1 mg, 4.93 mmol) was added with palladium acetate (55.3 mg, 246.31 mol), Xant-Phos (142.5 mg, 246.31 mol) and cesium carbonate (2.41 g, 7.39 mmol). The reaction solution was stirred under a nitrogen atmosphere at 100 C. for 12 hours of reaction. The reaction was monitored by TLC to be completed (PE:EtOAc=2:1). The reaction solution was diluted with water (20 mL), and extracted with ethyl acetate (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated and purified by silica gel column chromatography (eluted with a petroleum ether solution containing 33% ethyl acetate) to obtain a yellow oil compound BB5-C tert-butyl (6-nitropyridin-3-yl)carbamate (580 mg).
[0142] LC_MS: (ES.sup.+): m/z 240.1 [M+H].sup.+.
Step 2: Compound BB5-D tert-butyl (6-aminopyridin-3-yl)carbamate
[0143] ##STR00053##
[0144] A methanol (10 mL) solution containing compound BB5-C (580 mg, 2.42 mmol) was added with Pd/C. The reaction solution was stirred under a hydrogen atmosphere at 20 C. for 12 hours of reaction. Compound 3 (Rf=0.9) was monitored by TLC (DCM:MeOH=10:1) to be completely consumed, and a new spot (Rf=0.3) was generated. The reaction solution was filtered through diatomite, and the mother liquor was concentrated. The residue was used directly in the next step without further purification. Thus, a yellow solid compound BB5-D tert-butyl (6-aminopyridin-3-yl)carbamate (540 mg) was obtained.
[0145] LC_MS: (ES.sup.+): m/z 210.1 [M+H].sup.+.
Step 3: Compound BB5-F tert-butylimidazo[1,2-a]pyridin-6-yl carbamate
[0146] ##STR00054##
[0147] Compound BB5-E (1.01 g, 5.16 mmol, 40% mass fraction in water) was added to the ethanol solution containing compound BB5-D (540 mg, 2.58 mmol). The reaction solution was stirred and reacted at 80 C. for 3 hours. TLC (DCM:MeOH=10:1) monitoring showed that the reaction was complete. The reaction solution was concentrated, then added with saturated sodium bicarbonate solution (20 mL), and extracted with dichloromethane (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was subjected to silica gel column chromatography (eluted with a dichloromethane solution containing 10% methanol) to obtain a yellow solid compound BB5-F tert-butylimidazo[1,2-a]pyridin-6-yl carbamate (400 mg).
[0148] LC_MS: (ES.sup.+): m/z 234.1 [M+H].sup.+.
Step 4: Compound BB5 tert-butyl (3-bromoimidazo[1,2-a]pyridin-6-yl)carbamate
[0149] ##STR00055##
[0150] A dichloromethane (5 ml) solution containing compound BB5-F (300 mg, 1.29 mmol) was added with N-bromosuccinimide (229 mg, 1.29 mmol). The reaction solution was stirred at room temperature for 2 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was concentrated under reduced pressure, and the resulting residue was subjected to silica gel column chromatography (eluted with petroleum ether containing 0%-50% ethyl acetate) to obtain yellow solid compound BB5 tert-butyl (3-bromoimidazo[1,2-a]pyridin-6-yl)carbamate (370 mg).
[0151] LC_MS: (ES.sup.+): m/z 311.9 [M+H].sup.+.
Step 5: Compound BB6 tert-butyl (3-bromoimidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0152] ##STR00056##
[0153] A DMF (10 ml) solution containing compound BB5 (800 mg, 2.563 mmol) was added with sodium hydride (102.51 mg, 2.563 mmol, 60%) and methyl iodide (727.58 mg, 5.126 mmol) under a nitrogen atmosphere at 0 C. The reaction solution was stirred at 0 C. for 1 hour of reaction. The reaction was monitored by TLC to be completed. The reaction solution was poured into saturated ammonium chloride solution (30 mL), and extracted with ethyl acetate (25 mL2).
[0154] The organic phases were combined, washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluent: a dichloromethane solution containing 0.024%-0.062% methanol) to obtain white solid compound BB6 tert-butyl (3-bromoimidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (840 mg).
[0155] LC_MS: (ES.sup.+): m/z 327.9 [M+H].sup.+.
Synthesis of Intermediate BB7
[0156] ##STR00057##
Step 1: Compound BB7-C di-tert-butyl (4,11-dioxo-6,9-dioxin-3,12-diazatetradecane-1,14-diyl)dicarbamate
[0157] ##STR00058##
[0158] A DMF solution containing compound BB7-A 2,2-(ethane-1,2-diylbis(oxy))diacetic acid (300 mg, 1.7 mmol), compound BB7-B tert-butyl (2-aminoethyl)carbamate (546 mg, 3.4 mmol) and N,N-diisopropylethylamine (1.1 g, 8.5 mmol) was added with HATU (1.94 g, 5.1 mmol) at 0 C. The reaction solution was warmed to room temperature and stirred for 2 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was partitioned between ethyl acetate (30 ml) and water (50 ml). The organic layer was collected, washed with saturated brine (30 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 1.5% methanol) to obtain white solid compound BB7-C di-tert-butyl (4,11-dioxo-6,9-dioxin-3,12-diazatetradecane-1,14-diyl)dicarbamate (480 mg, 61%).
[0159] .sup.1H NMR (400 MHz, CDCl.sub.3): 1.43 (s, 18H), 3.26-3.32 (m, 4H), 3.41-3.45 (m, 4H), 3.70 (s, 4H), 4.02 (s, 4H).sup.1H NMR (400 MHz, CDCl.sub.3): 1.43 (s, 18H), 3.26-3.32 (m, 4H), 3.41-3.45 (m, 4H), 3.70 (s, 4H), 4.02 (s, 4H).
Step 2: Compound BB7 2,2-(ethane-1,2-diylbis(oxy))bis(N-(2-aminoethyl)acetamide
[0160] ##STR00059##
[0161] A methanol (2 ml) solution containing compound BB7-C di-tert-butyl (4,11-dioxo-6,9-dioxin-3,12-diazatetradecane-1,14-diyl)dicarbamate (100 mg) was added with 4M hydrogen chloride-dioxane solution (5 ml). The reaction solution was stirred at room temperature for 3 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was concentrated under reduced pressure to obtain crude compound BB7 2,2-(ethane-1,2-diylbis(oxy))bis(N-(2-aminoethyl)acetamide (80 mg) as a black oil, which was used directly in the next step without further purification.
[0162] .sup.1H NMR (400 MHz, DMSO-d6): 2.86-2.91 (m, 4H), 3.36-3.41 (m, 4H), 3.66 (s, 4H), 3.94 (s, 4H), 8.08-8.11 (m, 6H).
Example 1: Synthesis of Compound 1
[0163] ##STR00060##
Step 1: Compound 1 3-bromo-N-methylimidazo[1,2-b]pyridazin-6-amine
[0164] ##STR00061##
[0165] A N-methylpyrrolidone (1 ml) solution containing compound 1-A 3-bromo-6-chloroimidazo[1,2-b]pyridazine (40 mg, 0.172 mmol), compound 1-B methylamine hydrochloride (34.84 mg, 0.516 mmol) and potassium carbonate (83.07 mg, 0.602 mmol) was stirred at 100 C. for 18 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain compound 1 3-bromo-N-methylimidazo[1,2-b]pyridazin-6-amine (30 mg) as a white solid.
[0166] LC_MS: (ES.sup.+): m/z 227.0 [M+H].sup.+.
Example 2: Synthesis of Compound 2
[0167] ##STR00062##
Step 1: Compound 2 tert-butyl 3-(3-aminophenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0168] ##STR00063##
[0169] A 1,4-dioxane solution containing compound BB-6 (530 mg, 1.625 mmol), compound 2-A (244.75 mg, 1.787 mmol) and saturated aqueous sodium carbonate solution (3 ml) was added with Pd(dppf)Cl.sub.2CH.sub.2Cl.sub.2 (132.3 mg, 0.162 mmol) at room temperature under nitrogen atmosphere. The reaction solution was stirred at 90 C. for 12 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was cooled to room temperature, and extracted with water (20 mL) and ethyl acetate (30 ml2). The organic layers were combined, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was subjected to silica gel column chromatography (eluted with a petroleum ether solution containing 0%-90% ethyl acetate) to obtain compound 2 tert-butyl 3-(3-aminophenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate as a yellow solid (432 mg).
[0170] LC_MS: (ES.sup.+): m/z 339.2 [M+H].sup.+.
[0171] .sup.1H NMR (400 MHz, DMSO) 8.42 (d, J=1.2 Hz, 1H), 7.66 (s, 2H), 7.30 (d, J=9.2 Hz, 1H), 7.17 (t, J=7.8 Hz, 1H), 6.76 (dd, J=18.1, 4.7 Hz, 2H), 6.62 (dd, J=8.0, 1.4 Hz, 1H), 5.30 (d, J=4.9 Hz, 2H), 3.18 (s, 3H), 1.35 (s, 9H).
[0172] The synthesis of the following compounds referred to the synthesis of compound 2 and intermediate BB5 or BB6:
##STR00064##
Synthesis of Compound 3
[0173] ##STR00065##
[0174] Step 1: The synthesis of compound 3-C was performed referring to the third step of the synthesis method of intermediate BB5.
[0175] Step 2: The synthesis of compound 3-D was performed referring to the fourth step of the synthesis method of intermediate BB5.
[0176] Step 3: The synthesis of compound 3 was performed referring to the first step of the synthesis method of compound 2.
##STR00066##
[0177] LC_MS: (ES.sup.+): m/z 369.8 [M+H].sup.+.
Synthesis of Compound 4
[0178] ##STR00067##
[0179] Step 1: The synthesis of compound 4-B using compound 4-A and NIS as raw materials, was performed referring to the fourth step of the synthesis method of intermediate BB5.
[0180] Step 2: The synthesis of compound 4 was performed referring to the first step of the synthesis method of compound 2.
##STR00068##
[0181] LC_MS: (ES.sup.+): m/z 369.8 [M+H].sup.+.
Synthesis of Compound 5
[0182] ##STR00069##
[0183] Step 1: The synthesis of compound 5 was performed referring to the first step of the synthesis method of compound 2.
##STR00070##
[0184] LC_MS: (ES.sup.+): m/z 303.9 [M+H].sup.+.
[0185] .sup.1H NMR (400 MHz, DMSO) 8.09 (s, 1H), 8.00 (d, J=1.5 Hz, 1H), 7.95 (d, J=7.7 Hz, 1H), 7.85 (d, J=7.9 Hz, 1H), 7.80-7.73 (m, 2H), 7.73-7.67 (m, 1H), 7.47 (s, 2H), 7.21 (d, J=9.6 Hz, 1H), 3.79 (s, 3H).
Synthesis of Compound 6
[0186] ##STR00071##
[0187] Step 1: The synthesis of compound 6 was performed referring to the first step of the synthesis method of compound 2.
##STR00072##
[0188] LC_MS: (ES.sup.+): m/z 403.0 [M+H].sup.+.
Synthesis of Compound 7
[0189] ##STR00073##
[0190] Step 1: The synthesis of compound 7 was performed referring to the first step of the synthesis method of compound 2.
##STR00074##
[0191] LC_MS: (ES.sup.+): m/z 367.0 [M+H].sup.+.
Synthesis of Compound 8
[0192] ##STR00075##
[0193] Step 1: The synthesis of compound 8 was performed referring to the first step of the synthesis method of compound 2.
##STR00076##
[0194] LC_MS: (ES.sup.+): m/z 324.0 [M+H].sup.+.
Synthesis of Compound 9
[0195] ##STR00077##
[0196] Step 1: The synthesis of compound 9 was performed referring to the first step of the synthesis method of compound 2.
##STR00078##
[0197] LC_MS: (ES.sup.+): m/z 273.9 [M+H].sup.+.
[0198] .sup.1H NMR (400 MHz, DMSO) 8.60-8.56 (m, 1H), 8.06 (t, J=1.6 Hz, 1H), 7.93-7.89 (m, 1H), 7.87-7.83 (m, 2H), 7.72 (dd, J=16.4, 8.5 Hz, 2H), 7.44 (s, 2H), 7.35 (ddd, J=9.0, 6.7, 1.0 Hz, 1H), 7.03 (td, J=6.8, 1.1 Hz, 1H).
Synthesis of Compound 10
[0199] ##STR00079##
[0200] Step 1: The synthesis of compound 10 was performed referring to the first step of the synthesis method of compound 2.
##STR00080##
[0201] LC_MS: (ES.sup.+): m/z 338.0 [M+H].sup.+.
Synthesis of Compound 11
[0202] ##STR00081##
[0203] Step 1: The synthesis of compound 11 was performed referring to the first step of the synthesis method of compound 2.
##STR00082##
[0204] LC_MS: (ES.sup.+): m/z 358.0 [M+H].sup.+.
Synthesis of Compound 12
[0205] ##STR00083##
[0206] Step 1: The synthesis of compound 12 was performed referring to the first step of the synthesis method of compound 2.
##STR00084##
[0207] LC_MS: (ES.sup.+): m/z 330.0 [M+H].sup.+.
Synthesis of Compound 13
[0208] ##STR00085##
[0209] Step 1: The synthesis of compound 13 was performed referring to the first step of the synthesis method of compound 2.
##STR00086##
[0210] LC_MS: (ES.sup.+): m/z 354.0 [M+H].sup.+.
Synthesis of Compound 14
[0211] ##STR00087##
[0212] Step 1: The synthesis of compound 14 was performed referring to the first step of the synthesis method of compound 2.
##STR00088##
[0213] LC_MS: (ES.sup.+): m/z 354.0 [M+H].sup.+.
Synthesis of Compound 15
[0214] ##STR00089##
[0215] Step 1: The synthesis of compound 15 was performed referring to the first step of the synthesis method of compound 2.
##STR00090##
[0216] LC_MS: (ES.sup.+): m/z 325.0 [M+H].sup.+.
Synthesis of Compound 16
[0217] ##STR00091##
[0218] Step 1: The synthesis of compound 16 was performed referring to the first step of the synthesis method of compound 2.
##STR00092##
[0219] LC_MS: (ES.sup.+): m/z 355.0 [M+H].sup.+.
Synthesis of Compound 17
[0220] ##STR00093##
[0221] Step 1: The synthesis of compound 17 was performed referring to the first step of the synthesis method of compound 2.
##STR00094##
[0222] LC_MS: (ES.sup.+): m/z 325.0 [M+H].sup.+.
Synthesis of Compound 18
[0223] ##STR00095##
[0224] Step 1: The synthesis of compound 18 was performed referring to the first step of the synthesis method of compound 2.
##STR00096##
[0225] LC_MS: (ES.sup.+): m/z 325.0 [M+H].sup.+.
Synthesis of Compound 19
[0226] ##STR00097##
[0227] Step 1: The synthesis of compound 19 was performed referring to the first step of the synthesis method of compound 2.
##STR00098##
[0228] LC_MS: (ES.sup.+): m/z 244.0 [M+H].sup.+.
Synthesis of Compound 20
[0229] ##STR00099##
[0230] Step 1: The synthesis of compound 20 was performed referring to the first step of the synthesis method of compound 2.
##STR00100##
[0231] LC_MS: (ES.sup.+): m/z 225.0 [M+H].sup.+.
[0232] .sup.1H NMR (500 MHz, DMSO) 8.20 (dd, J=8.4, 1.1 Hz, 2H), 7.87 (s, 1H), 7.77 (d, J=9.7 Hz, 1H), 7.47 (dd, J=10.7, 4.9 Hz, 2H), 7.31 (dd, J=10.5, 4.3 Hz, 1H), 7.11 (d, J=4.7 Hz, 1H), 6.71 (d, J=9.7 Hz, 1H), 2.85 (d, J=4.8 Hz, 3H).
Synthesis of Compound 21
[0233] ##STR00101##
[0234] Step 1: The synthesis of compound 21 was performed referring to the first step of the synthesis method of compound 2.
##STR00102##
[0235] LC_MS: (ES.sup.+): m/z 281.1 [M+H].sup.+.
[0236] .sup.1H NMR (400 MHz, DMSO) 8.12 (d, J=7.4 Hz, 2H), 7.99-7.93 (m, 2H), 7.47 (t, J=7.8 Hz, 2H), 7.32 (t, J=7.4 Hz, 1H), 7.23 (d, J=9.9 Hz, 1H), 3.77-3.72 (m, 4H), 3.50-3.45 (m, 4H).
Synthesis of Compound 22
[0237] ##STR00103##
[0238] Step 1: The synthesis of compound 22 was performed referring to the first step of the synthesis method of compound 2.
##STR00104##
[0239] LC_MS: (ES.sup.+): m/z 311.1 [M+H].sup.+.
[0240] .sup.1H NMR (500 MHz, DMSO) 10.37 (s, 1H), 8.29 (dd, J=8.4, 1.1 Hz, 2H), 8.19 (s, 1H), 8.11 (d, J=9.8 Hz, 1H), 7.78-7.75 (m, 1H), 7.69 (d, J=9.8 Hz, 1H), 7.47 (dd, J=10.7, 4.9 Hz, 2H), 1.50 (s, 9H).
Synthesis of Compound 23
[0241] ##STR00105##
[0242] Step 1: The synthesis of compound 23 was performed referring to the first step of the synthesis method of compound 2.
##STR00106##
[0243] LC_MS: (ES.sup.+): m/z 253.0 [M+H].sup.+.
Synthesis of Compound 24
[0244] ##STR00107##
[0245] Step 1: The synthesis of compound 24 was performed referring to the first step of the synthesis method of compound 2.
##STR00108##
[0246] LC_MS: (ES.sup.+): m/z 267.1 [M+H].sup.+.
Synthesis of Compound 25
[0247] ##STR00109##
[0248] Step 1: The synthesis of compound 25 was performed referring to the first step of the synthesis method of compound 2.
##STR00110##
[0249] LC_MS: (ES.sup.+): m/z 263.0 [M+H].sup.+.
[0250] .sup.1H NMR (500 MHz, DMSO) 8.78 (s, 1H), 8.03 (s, 1H), 7.88 (d, J=9.5 Hz, 1H), 7.77 (dd, J=8.0, 1.4 Hz, 1H), 7.72 (dd, J=8.2, 1.1 Hz, 2H), 7.59 (d, J=7.5 Hz, 2H), 7.55-7.53 (m, 1H).
Synthesis of Compound 26
[0251] ##STR00111##
[0252] Step 1: The synthesis of compound 26 was performed referring to the first step of the synthesis method of compound 2.
##STR00112##
[0253] LC_MS: (ES.sup.+): m/z 225.1 [M+H].sup.+.
[0254] .sup.1H NMR (500 MHz, DMSO) 8.42 (d, J=7.6 Hz, 1H), 7.63-7.60 (m, 3H), 7.55-7.50 (m, 2H), 7.43-7.39 (m, 1H), 7.10 (s, 1H), 6.71 (dd, J=7.5, 2.4 Hz, 1H), 3.85 (s, 3H).
Synthesis of Compound 27
[0255] ##STR00113##
[0256] Step 1: The synthesis of compound 27 was performed referring to the first step of the synthesis method of compound 2.
##STR00114##
[0257] LC_MS: (ES.sup.+): m/z 225.0 [M+H].sup.+.
[0258] .sup.1H NMR (500 MHz, DMSO) 8.42 (d, J=7.6 Hz, 1H), 7.63-7.60 (m, 3H), 7.55-7.50 (m, 2H), 7.43-7.39 (m, 1H), 7.10 (s, 1H), 6.71 (dd, J=7.5, 2.4 Hz, 1H), 3.85 (s, 3H).
Synthesis of Compound 28
[0259] ##STR00115##
[0260] Step 1: The synthesis of compound 28-C was performed referring to the third step of the synthesis method of intermediate BB5.
[0261] Step 2: The synthesis of compound 28 was performed referring to the fourth step of the synthesis method of intermediate BB5.
##STR00116##
[0262] LC_MS: (ES.sup.+): m/z 370.9 [M+H].sup.+.
[0263] .sup.1H NMR (500 MHz, DMSO) 7.72 (s, 1H), 7.66 (dd, J=8.9, 1.2 Hz, 1H), 7.50 (dd, J=7.1, 1.1 Hz, 1H), 6.92 (dd, J=8.9, 7.1 Hz, 1H).
Synthesis of Compound 29
[0264] ##STR00117##
[0265] Step 1: The synthesis of compound 29-C was performed referring to the third step of the synthesis method of intermediate BB5.
[0266] Step 2: The synthesis of compound 29-D was performed referring to the fourth step of the synthesis method of intermediate BB5.
[0267] Step 3: The synthesis of compound 29 was performed referring to the first step of the synthesis method of compound 2.
##STR00118##
[0268] LC_MS: (ES.sup.+): m/z 321.0 [M+H].sup.+.
Synthesis of Compound 30
[0269] ##STR00119##
[0270] Step 1: The synthesis of compound 30-C was performed referring to the third step of the synthesis method of intermediate BB5.
[0271] Step 2: The synthesis of compound 30-D was performed referring to the fourth step of the synthesis method of intermediate BB5.
[0272] Step 3: The synthesis of compound 30 was performed referring to the first step of the synthesis method of compound 2.
##STR00120##
[0273] LC_MS: (ES.sup.+): m/z 321.0 [M+H].sup.+.
Synthesis of Compound 31
[0274] ##STR00121##
[0275] Step 1: The synthesis of compound 31 was performed referring to the first step of the synthesis method of compound 2.
##STR00122##
[0276] LC_MS: (ES.sup.+): m/z 320.9 [M+H].sup.+.
Synthesis of Compound 32
[0277] ##STR00123##
[0278] Step 1: The synthesis of compound 32 was performed referring to the third step of the synthesis method of intermediate BB5.
##STR00124##
[0279] LC_MS: (ES.sup.+): m/z 204.1 [M+H].sup.+.
Synthesis of Compound 33
[0280] ##STR00125##
[0281] Step 1: The synthesis of compound 32 was performed referring to the fourth step of the synthesis method of intermediate BB5.
##STR00126##
[0282] LC_MS: (ES.sup.+): m/z 283.0 [M+H].sup.+.
[0283] .sup.1H NMR (500 MHz, DMSO) 7.62 (s, 1H), 7.58 (d, J=9.8 Hz, 1H), 7.49 (d, J=1.9 Hz, 1H), 7.41 (dd, J=9.8, 2.2 Hz, 1H), 3.77-3.74 (m, 4H), 3.12-3.07 (m, 4H).
Synthesis of Compound 34
[0284] ##STR00127##
[0285] Step 1: The synthesis of compound 34 was performed referring to the first step of the synthesis method of compound 2.
##STR00128##
[0286] LC_MS: (ES.sup.+): m/z 280.1 [M+H].sup.+.
[0287] .sup.1H NMR (500 MHz, DMSO) 8.02 (s, 1H), 7.76 (d, J=1.3 Hz, 1H), 7.69 (d, J=7.1 Hz, 2H), 7.67 (s, 1H), 7.55 (t, J=7.7 Hz, 2H), 7.45 (t, J=7.4 Hz, 2H), 3.80-3.69 (m, 4H), 3.10-2.99 (m, 4H).
Synthesis of Compound 35
[0288] ##STR00129##
[0289] Step 1: The synthesis of compound 35 was performed referring to the third step of the synthesis method of intermediate BB5.
##STR00130##
[0290] LC_MS: (ES.sup.+): m/z 217.1 [M+H].sup.+.
Synthesis of Compound 36
[0291] ##STR00131##
[0292] Step 1: The synthesis of compound 36 was performed referring to the fourth step of the synthesis method of intermediate BB5.
##STR00132##
[0293] LC_MS: (ES.sup.+): m/z 295.0 [M+H].sup.+.
[0294] .sup.1H NMR (500 MHz, DMSO) 7.59 (s, 1H), 7.51 (d, J=9.8 Hz, 1H), 7.45 (d, J=1.8 Hz, 1H), 7.35 (dd, J=9.8, 2.2 Hz, 1H), 3.13-3.06 (m, 4H), 2.48 (d, J=5.9 Hz, 4H), 2.23 (s, 3H).
Synthesis of Compound 37
[0295] ##STR00133##
[0296] Step 1: The synthesis of compound 37 was performed referring to the first step of the synthesis method of compound 2.
##STR00134##
[0297] LC_MS: (ES.sup.+): m/z 293.1 [M+H].sup.+.
[0298] .sup.1H NMR (500 MHz, DMSO) 7.75 (d, J=1.7 Hz, 1H), 7.67 (d, J=7.2 Hz, 2H), 7.64 (s, 1H), 7.56 (dd, J=17.8, 10.2 Hz, 3H), 7.43 (t, J=7.4 Hz, 1H), 7.36 (d, J=8.5 Hz, 1H), 3.08 (s, 4H), 2.58 (s, 4H), 2.29 (s, 3H).
Synthesis of Compound 38
[0299] ##STR00135##
[0300] Step 1: The synthesis of compound 38 was performed referring to the fourth step of the synthesis method of intermediate BB5.
##STR00136##
[0301] LC_MS: (ES.sup.+): m/z 297.0 [M+H].sup.+.
[0302] .sup.1H NMR (500 MHz, DMSO) 7.95 (s, 1H), 7.67 (d, J=1.2 Hz, 1H), 7.62 (d, J=9.5 Hz, 1H), 7.40 (d, J=9.5 Hz, 1H), 2.94 (t, J=4.7 Hz, 4H), 2.51 (d, J=8.9 Hz, 4H), 2.25 (s, 3H).
Synthesis of Compound 39
[0303] ##STR00137##
[0304] Step 1: The synthesis of compound 39 was performed referring to the first step of the synthesis method of compound 2.
##STR00138##
[0305] LC_MS: (ES.sup.+): m/z 293.1 [M+H].sup.+.
Synthesis of Compound 40
[0306] ##STR00139##
[0307] Step 1: The synthesis of compound 40 was performed referring to the first step of the synthesis method of compound 2.
##STR00140##
[0308] LC_MS: (ES.sup.+): m/z 339.1 [M+H].sup.+.
Synthesis of Compound 41
[0309] ##STR00141##
[0310] Step 1: The synthesis of compound 41 was performed referring to the first step of the synthesis method of compound 2.
##STR00142##
[0311] LC_MS: (ES.sup.+): m/z 340.1 [M+H].sup.+.
Synthesis of Compound 42
[0312] ##STR00143##
[0313] Step 1: The synthesis of compound 42 was performed referring to the first step of the synthesis method of compound 2.
##STR00144##
[0314] LC_MS: (ES.sup.+): m/z 266.0 [M+H].sup.+.
[0315] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.27 (s, 1H), 7.83 (s, 1H), 7.60-7.47 (m, 6H), 7.18 (d, J=8.0 Hz, 1H), 3.27 (s, 3H), 1.95 (s, 3H).
Synthesis of Compound 43
[0316] ##STR00145##
[0317] Step 1: The synthesis of compound 43 was performed referring to the first step of the synthesis method of compound 2.
##STR00146##
[0318] LC_MS: (ES.sup.+): m/z 271.9 [M+H].sup.+.
[0319] .sup.1H NMR (500 MHz, DMSO) 8.68 (s, 1H), 7.86 (s, 1H), 7.74 (d, J=9.2 Hz, 1H), 7.70 (d, J=5.1 Hz, 1H), 7.60 (s, 1H), 7.36 (d, J=9.3 Hz, 1H), 7.27 (dd, J=5.1, 3.6 Hz, 1H), 3.16 (s, 3H), 1.83 (s, 3H).
Synthesis of Compound 44
[0320] ##STR00147##
[0321] Step 1: The synthesis of compound 44 using BB5-F and NIS as raw materials, was performed referring to the first step of the synthesis method of compound 2.
##STR00148##
[0322] LC_MS: (ES.sup.+): m/z 360.0 [M+H].sup.+.
[0323] .sup.1H NMR (500 MHz, DMSO) 9.63 (s, 1H), 8.80 (s, 1H), 7.63 (s, 1H), 7.58-7.45 (m, 1H), 7.23 (dd, J=9.6, 1.9 Hz, 1H), 1.50 (s, 9H).
Synthesis of Compound 45
[0324] ##STR00149##
[0325] Step 1: The synthesis of compound 45 was performed referring to the first step of the synthesis method of compound 2.
##STR00150##
[0326] LC_MS: (ES.sup.+): m/z 295.2 [M+H].sup.+.
Synthesis of Compound 46
[0327] ##STR00151##
[0328] Step 1: The synthesis of compound 46 was performed referring to the first step of the synthesis method of compound 2.
##STR00152##
[0329] LC_MS: (ES.sup.+): m/z 339.1 [M+H].sup.+.
Example 3: Synthesis of Compound 47
[0330] ##STR00153##
Step 1: Compound 47 tert-butyl (3-(3-(2-(2-methoxyethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl) carbamate
[0331] ##STR00154##
[0332] A solution of compound 47 (40 mg, 0.118 mmol), compound 47-A (15.85 mg, 0.118 mmol), HATU (44.84 mg, 0.118 mmol) and DIPEA (30.44 mg, 0.236 mmol) in DMF (2 mL) was stirred at room temperature for 12 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with water (20 ml) and ethyl acetate (30 ml3). The organic layers were combined, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product obtained was separated and purified by prep-TLC (eluted with dichloromethane containing 4.76% methanol) to obtain yellow solid compound 47 tert-butyl (3-(3-(2-(2-methoxyethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl) carbamate (30 mg).
[0333] LC_MS: (ES.sup.+): m/z 455.2 [M+H].sup.+.
[0334] .sup.1H NMR (400 MHz, CDCl.sub.3) 9.08 (s, 1H), 8.33 (s, 1H), 7.85 (d, J=33.6 Hz, 3H), 7.60 (d, J=8.0 Hz, 1H), 7.49 (t, J=7.7 Hz, 1H), 7.29 (s, 1H), 4.12 (s, 2H), 3.78 (s, 2H), 3.63 (s, 2H), 3.47 (s, 3H), 3.27 (s, 3H), 1.42 (s, 9H).
[0335] The following compounds were synthesized using the corresponding carboxylic acid, referring to the synthesis of compound 47:
Synthesis of Compound 48
[0336] ##STR00155##
[0337] Step 1: The synthesis of compound 48 was performed referring to the first step of the synthesis method of compound 47.
##STR00156##
[0338] LC_MS: (ES.sup.+): m/z 464.2 [M+H].sup.+.
[0339] .sup.1H NMR (500 MHz, DMSO) 10.22 (s, 1H), 8.47 (d, J=1.3 Hz, 1H), 7.92 (s, 1H), 7.75 (s, 1H), 7.62 (t, J=9.3 Hz, 2H), 7.48 (t, J=7.9 Hz, 1H), 7.35-7.28 (m, 2H), 3.43 (s, 4H), 3.20 (s, 3H), 2.64-2.57 (m, 3H), 1.98 (s, 1H), 1.95 (d, J=11.4 Hz, 2H), 1.83 (s, 2H), 1.36 (s, 9H).
Synthesis of Compound 49
[0340] ##STR00157##
[0341] Step 1: The synthesis of compound 49 was performed referring to the first step of the synthesis method of compound 47.
##STR00158##
[0342] LC_MS: (ES.sup.+): m/z 451.2 [M+H].sup.+.
[0343] .sup.1H NMR (500 MHz, DMSO) 10.07 (s, 1H), 8.47 (d, J=1.2 Hz, 1H), 7.91 (s, 1H), 7.75 (s, 1H), 7.63 (dd, J=11.8, 9.0 Hz, 2H), 7.47 (s, 1H), 7.31 (d, J=6.6 Hz, 2H), 3.92-3.88 (m, 2H), 3.20 (s, 3H), 3.16 (d, J=4.9 Hz, 2H), 2.63-2.58 (m, 1H), 1.73-1.64 (m, 4H), 1.36 (s, 9H).
Synthesis of Compound 50
[0344] ##STR00159##
[0345] Step 1: The synthesis of compound 50 was performed referring to the first step of the synthesis method of compound 47.
##STR00160##
[0346] LC_MS: (ES.sup.+): m/z 455.2 [M+H].sup.+.
Synthesis of Compound 51
[0347] ##STR00161##
[0348] Step 1: The synthesis of compound 51 was performed using compound 41 and compound 51-A as raw materials, referring to the first step of the synthesis method of compound 47
##STR00162##
[0349] LC_MS: (ES.sup.+): m/z 456.2 [M+H].sup.+.
Synthesis of Compound 52
[0350] ##STR00163##
[0351] Step 1: The synthesis of compound 52 was performed referring to the first step of the synthesis method of compound 47.
##STR00164##
[0352] LC_MS: (ES.sup.+): m/z 550.3 [M+H].sup.+.
Synthesis of Compound 53
[0353] ##STR00165##
[0354] Step 1: The synthesis of compound 53-C was performed referring to the third step of the synthesis method of intermediate BB5.
[0355] Step 2: The synthesis of compound 53-D was performed referring to the fourth step of the synthesis method of intermediate BB5.
[0356] Step 3: The synthesis of compound 53-F was performed referring to the first step of the synthesis method of compound 2.
[0357] Step 4: The synthesis of compound 53 using compound 53-F and compound 53-G as raw materials, was performed referring to the first step of the synthesis method of compound 47
##STR00166##
[0358] LC_MS: (ES.sup.+): m/z 340.1 [M+H].sup.+.
Synthesis of Compound 54
[0359] ##STR00167##
[0360] Step 1: The synthesis of compound 54 using compound 53-F and compound 54-A as raw materials, was performed referring to the first step of the synthesis method of compound 47.
##STR00168##
[0361] LC_MS: (ES.sup.+): m/z 336.4 [M+H].sup.+.
Synthesis of Compound 55
[0362] ##STR00169##
Step 1: Compound 55-A 5-(tert-butoxy)-2-nitropyridine
[0363] ##STR00170##
[0364] A tetrahydrofuran solution containing compound 55-A (450 mg, 3.17 mmol) was added with potassium tert-butoxide (426.5 mg, 3.80 mmol) under a nitrogen atmosphere at 0 C. The reaction solution was stirred at 20 C. for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was diluted with water (20 mL), and extracted with ethyl acetate (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was separated and purified by silica gel column chromatography (eluted with ethyl acetate solution containing 10% petroleum ether) to obtain compound 55-A (253 mg) as a colorless oil.
[0365] LC_MS: (ES.sup.+): m/z 197.1 [M+H].sup.+.
[0366] Step 2: The synthesis of compound 55-C was performed referring to the second step of the synthesis method of intermediate BB5.
[0367] Step 3: The synthesis of compound 55-E was performed referring to the third step of the synthesis method of intermediate BB5.
[0368] Step 4: The synthesis of compound 55-F was performed referring to the fourth step of the synthesis method of intermediate BB5.
[0369] Step 5: The synthesis of compound 55-H was performed referring to the first step of the synthesis method of compound 2.
[0370] Step 6: The synthesis of compound 55 using compound 55-H and compound 55-I as raw materials, was performed referring to the first step of the synthesis method of compound 47
##STR00171##
[0371] LC_MS: (ES.sup.+): m/z 394.2 [M+H].sup.+.
Synthesis of Compound 56
[0372] ##STR00172##
[0373] Step 1: The synthesis of compound 56 was performed using compound 45 and compound 56-A as raw materials, referring to the first step of the synthesis method of compound 47.
##STR00173##
[0374] LC_MS: (ES.sup.+): m/z 411.1 [M+H].sup.+.
Synthesis of Compound 57
[0375] ##STR00174##
[0376] Step 1: The synthesis of compound 57 was performed using compound 45 and compound 57-A as raw materials, referring to the first step of the synthesis method of compound 47.
##STR00175##
[0377] LC_MS: (ES.sup.+): m/z 407.1 [M+H].sup.+.
Synthesis of Compound 58
[0378] ##STR00176##
[0379] Step 1: The synthesis of compound 58 was performed using compound 46 and compound 58-A as raw materials, referring to the first step of the synthesis method of compound 47.
##STR00177##
[0380] LC_MS: (ES.sup.+): m/z 441.2 [M+H].sup.+.
Example 4: Synthesis of Compound 59 and Compound 60
[0381] ##STR00178##
[0382] Step 1: The synthesis of compound 59-C was performed referring to the first step of the synthesis method of compound 2.
Step 2: Compound 59-D tert-butyl ((3-(6-bromoimidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl)carbamate
[0383] ##STR00179##
[0384] A solution of compound 59-C (400 mg, 1.14 mmol), triethylamine (230.3 mg, 1.37 mmol) and 4-dimethylaminopyridine (55.6 mg, 0.45 mmol) in tetrahydrofuran (6 ml) was added with di-tert-butyl succinate (298.1 mg, 1.37 mmol). The reaction solution was stirred at room temperature for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 2.4%-4.7% methanol) to obtain compound 59-D tert-butyl ((3-(6-bromoimidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl) carbamate (370 mg) as a yellow solid.
[0385] LC_MS: (ES.sup.+): m/z 453.9 [M+H].sup.+
Step 3: Compound 59-E tert-butyl ((3-(6-bromoimidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl)(methyl)carbamate
[0386] ##STR00180##
[0387] A N,N-dimethylformamide solution containing sodium hydride (25.7 mg, 0.643 mmol, 60% dispersed in mineral oil) was added with compound 59-D (290 mg, 0.643 mmol) and methyl iodide (182.55 mg, 1.29 mmol) at 0 C. under nitrogen. The reaction solution was stirred at 0 C. for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 1.9%-4.7% methanol) to obtain a yellow solid compound 59-E tert-butyl ((3-(6-bromoimidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl)(methyl)carbamate (220 mg).
[0388] LC_MS: (ES.sup.+): m/z 465.9 [M+H].sup.+.
Step 4: Compound 59 tert-butyl methyl ((3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl)carbamate
[0389] ##STR00181##
[0390] A solution of compound 59-E (140 mg, 0.3 mmol), compound 59-F methylamine hydrochloride (101.28 mg, 1.5 mmol), and cesium carbonate (688.8 mg, 2.1 mmol) in 1,4-dioxane (4 ml) was added with BrettPhos-Pd-G3 (54.39 mg, 0.2 mmol) at room temperature under nitrogen atmosphere. The reaction mixture was replaced with nitrogen three times, and stirred at 110 C. for 48 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain a brown solid compound 59 tert-butyl methyl ((3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl)carbamate (15 mg).
[0391] LC_MS: (ES.sup.+): m/z 417.0 [M+H].sup.+.
Step 5: Compound 60 N-methyl-3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide
[0392] ##STR00182##
[0393] A solution of compound 59 tert-butyl methyl ((3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)sulfonyl)carbamate (15 mg, 0.036 mmol) in methanol (250 l) was added with hydrochloric acid/dioxane (1 ml, 4.0 mol/L) solution. The reaction mixture was stirred at room temperature for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was concentrated under reduced pressure to obtain a brown solid compound 60 N-methyl-3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide (8 mg).
[0394] LC_MS: (ES.sup.+): m/z 317.0 [M+H].sup.+.
Example 5: Synthesis of Compound 61 and Compound 62
[0395] ##STR00183##
Step 1: Compound 61-B 3 iodo-6-nitroimidazo[1,2-a]pyridine
[0396] ##STR00184##
[0397] A solution of compound 61-A (4.85 g, 29.73 mmol) in N,N-dimethylformamide (30 ml) was added with N-iodosuccinimide (8 g, 35.67 mmol). The reaction mixture was stirred at room temperature for 14 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was added with water (30 ml) while being stirred at room temperature. A large amount of white solid was generated, which was then filtered, collected, and dried to obtain white solid compound 61-B 3-iodo-6-nitroimidazo[1,2-a]pyridine (8 g, crude product).
[0398] Step 2: Compound 61-C 3-iodoimidazo[1,2-a]pyridin-6-amine
##STR00185##
[0399] A solution containing compound 61-B (500 mg, 1.55 mmol) and ammonium chloride (1.85 g, 34.6 mmol) in ethanol (35 ml) and water (10 ml) was added with iron powder (1.93 g, 34.6 mmol) under nitrogen at room temperature. The reaction mixture was stirred at room temperature for 1 hour of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was filtered through diatomite, and the filtrate was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with ethyl acetate containing 9% dichloromethane) to obtain brown solid compound 61-C 3-iodoimidazo[1,2-a]pyridin-6-amine (1 g).
[0400] LC_MS: (ES.sup.+): m/z 259.8.0 [M+H].sup.+.
Step 3: Compound 61-D tert-butyl (3-iodoimidazo[1,2-a]pyridin-6-yl)carbamate
[0401] ##STR00186##
[0402] A solution containing compound 61-C (1 g, 3.86 mmol), N,N-diisopropylethylamine (1.49 g, 11.58 mmol) and 4-dimethylaminopyridine (47.1 mg, 0.39 mmol) in dichloromethane (15 ml) and N,N-dimethylformamide (4 ml) was added with di-tert-butyl succinate (925.6 mg, 4.25 mmol). The reaction mixture was stirred at room temperature for 18 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with petroleum ether containing 50%-100% ethyl acetate) to obtain brown solid compound 61-D tert-butyl (3-iodoimidazo[1,2-a]pyridin-6-yl)carbamate (330 mg).
[0403] LC_MS: (ES.sup.+): m/z 359.9 [M+H].sup.+.
Step 4: Compound 61-E tert-butyl (3-iodoimidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0404] ##STR00187##
[0405] A solution of sodium hydride (36.76 mg, 0.92 mmol, 60% dispersed in mineral oil) in N,N-dimethylformamide (2 ml) was added with compound 61-D (330 mg, 0.92 mmol) and methyl iodide (260.94 mg, 1.84 mmol) at 0 C. under nitrogen. The reaction mixture was stirred at 0 C. for 3 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 2.4%-7.7% methanol) to obtain a brown solid compound 61-E tert-butyl (3-iodoimidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (270 mg).
[0406] LC_MS: (ES.sup.+): m/z 373.9 [M+H].sup.+.
Step 4: Compound 61 tert-butyl methyl (3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0407] ##STR00188##
[0408] A solution containing compound 61-E (50 mg, 0.134 mmol), compound 61-F (94.83 mg, 0.335 mmol), and sodium carbonate (42.61 mg, 0.402 mmol) in 1,4-dioxane (2 ml) and water (600 l) was added with Pd(PPh.sub.3).sub.4 (10.84 mg, 0.01 mmol) at room temperature under nitrogen atmosphere. The reaction mixture was replaced with nitrogen three times, and stirred at 90 C. for 18 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 8.3% methanol) to obtain a white solid compound 61 tert-butyl methyl (3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)carbamate (27 mg).
[0409] LC_MS: (ES.sup.+): m/z 403.0 [M+H].sup.+.
Step 5: Compound 62 3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl) benzenesulfonamide
[0410] ##STR00189##
[0411] A solution of compound 61 (24 mg, 0.035 mmol) in methanol (250 l) and hydrochloric acid/dioxane (1 ml, 4.0 mol/L) was stirred at room temperature for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was concentrated under reduced pressure to obtain compound 62 3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide (16.7 mg) as a yellow solid.
[0412] LC_MS: (ES.sup.+): m/z 302.9 [M+H].sup.+.
[0413] .sup.1H NMR (400 MHz, MeOD) 8.23 (t, J=1.6 Hz, 1H), 8.12 (ddd, J=7.9, 1.8, 1.1 Hz, 1H), 8.04 (s, 1H), 7.94 (dd, J=5.3, 4.1 Hz, 1H), 7.83 (t, J=7.8 Hz, 1H), 7.74 (d, J=9.7 Hz, 1H), 7.56 (dd, J=9.7, 2.0 Hz, 1H), 7.49 (d, J=1.9 Hz, 1H), 2.76 (s, 3H).
Example 6: Synthetic Route of Compound 63
[0414] ##STR00190##
Step 1: Compound 63 4-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide
[0415] ##STR00191##
[0416] A solution of compound 6 (40 mg, 0.099 mmol) in methanol (0.5 ml) and hydrochloric acid/dioxane (1 ml, 4.0 mol/L) was stirred at room temperature for 2 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was concentrated under reduced pressure to obtain compound 63 (30 mg) as a yellow solid.
[0417] LC_MS: (ES.sup.+): m/z 303.0 [M+H].sup.+.
[0418] .sup.1H NMR (500 MHz, MeOD) 8.16 (d, J=7.4 Hz, 2H), 8.09 (s, 1H), 7.94 (d, J=7.8 Hz, 2H), 7.78 (d, J=9.3 Hz, 1H), 7.62 (d, J=10.2 Hz, 2H), 2.80 (s, 3H).
[0419] The following compounds were synthesized referring to the synthesis of compound 63:
Synthetic Route of Compound 64
[0420] ##STR00192##
[0421] Step 1: The synthesis of compound 64 was performed referring to the first step of the synthesis method of compound 63.
##STR00193##
[0422] LC_MS: (ES.sup.+): m/z 267.0 [M+H].sup.+.
[0423] .sup.1H NMR (500 MHz, MeOD) 8.22 (s, 1H), 8.13-8.09 (m, 1H), 8.04 (s, 1H), 7.93 (d, J=7.7 Hz, 1H), 7.82-7.75 (m, 2H), 7.70-7.57 (m, 2H), 2.80 (s, 3H).
Synthesis of Compound 65
[0424] ##STR00194##
[0425] Step 1: The synthesis of compound 65 was performed referring to the first step of the synthesis method of compound 63.
##STR00195##
[0426] LC_MS: (ES.sup.+): m/z 224.0 [M+H].sup.+.
[0427] .sup.1H NMR (500 MHz, MeOD) 7.98 (s, 1H), 7.79 (d, J=9.6 Hz, 1H), 7.73 (d, J=7.2 Hz, 1H), 7.68-7.65 (m, 1H), 7.64 (d, J=4.0 Hz, 1H), 7.62 (d, J=2.7 Hz, 1H), 2.80 (s, 1H).
Synthesis of Compound 66
[0428] ##STR00196##
[0429] Step 1: The synthesis of compound 66 was performed referring to the first step of the synthesis method of compound 63.
##STR00197##
[0430] LC_MS: (ES.sup.+): m/z 255.0 [M+H].sup.+.
[0431] .sup.1H NMR (400 MHz, DMSO) 9.09 (d, J=1.9 Hz, 1H), 8.79 (s, 1H), 7.93-7.87 (m, 1H), 7.80 (d, J=9.6 Hz, 1H), 7.65 (d, J=7.4 Hz, 1H), 7.51 (d, J=2.9 Hz, 1H), 6.90 (d, J=8.2 Hz, 1H), 4.04 (s, 3H), 2.74 (s, 3H).
Synthesis of Compound 67
[0432] ##STR00198##
[0433] Step 1: The synthesis of compound 67 was performed referring to the first step of the synthesis method of compound 63.
##STR00199##
[0434] LC_MS: (ES.sup.+): m/z 238.0 [M+H].sup.+.
[0435] .sup.1H NMR (500 MHz, DMSO) 8.15 (s, 1H), 7.82 (d, J=9.6 Hz, 1H), 7.54 (d, J=2.1 Hz, 1H), 7.52-7.48 (m, 3H), 7.43 (d, J=7.3 Hz, 1H), 6.87 (d, J=1.9 Hz, 1H), 2.58 (s, 3H), 2.18 (s, 3H).
Synthesis of Compound 68
[0436] ##STR00200##
[0437] Step 1: The synthesis of compound 68 was performed referring to the first step of the synthesis method of compound 63.
##STR00201##
[0438] LC_MS: (ES.sup.+): m/z 257.9 [M+H].sup.+.
[0439] .sup.1H NMR (500 MHz, DMSO) 8.25 (s, 1H), 7.83 (d, J=9.6 Hz, 1H), 7.78 (d, J=8.1 Hz, 1H), 7.69 (t, J=7.3 Hz, 2H), 7.61 (t, J=7.4 Hz, 1H), 7.55 (dd, J=9.7, 1.9 Hz, 1H), 6.97 (s, 1H), 2.60 (s, 3H).
Synthesis of Compound 69
[0440] ##STR00202##
[0441] Step 1: The synthesis of compound 69 was performed referring to the first step of the synthesis method of compound 63.
##STR00203##
[0442] LC_MS: (ES.sup.+): m/z 229.9 [M+H].sup.+.
[0443] .sup.1H NMR (400 MHz, DMSO) 8.30 (s, 1H), 7.89 (dd, J=5.1, 1.1 Hz, 1H), 7.79 (dd, J=9.6, 0.4 Hz, 1H), 7.67 (dd, J=3.6, 1.1 Hz, 1H), 7.54 (dd, J=9.6, 2.1 Hz, 1H), 7.50 (d, J=1.8 Hz, 1H), 7.34 (dd, J=5.1, 3.6 Hz, 1H), 2.68 (s, 3H).
Synthesis of Compound 70
[0444] ##STR00204##
[0445] Step 1: The synthesis of compound 70 was performed referring to the first step of the synthesis method of compound 63.
##STR00205##
[0446] LC_MS: (ES.sup.+): m/z 254.0 [M+H].sup.+.
[0447] .sup.1H NMR (400 MHz, DMSO) 8.20 (s, 1H), 7.78 (d, J=9.6 Hz, 1H), 7.56-7.49 (m, 2H), 7.47 (d, J=1.6 Hz, 1H), 7.31-7.26 (m, 2H), 7.17-7.12 (m, 1H), 3.83 (s, 3H), 2.66 (s, 3H).
Synthesis of Compound 72
[0448] ##STR00206##
[0449] Step 1: The synthesis of compound 72 was performed referring to the first step of the synthesis method of compound 63.
##STR00207##
[0450] LC_MS: (ES.sup.+): m/z 254.0 [M+H].sup.+.
[0451] .sup.1H NMR (400 MHz, DMSO) 8.11 (s, 1H), 7.78 (d, J=9.6 Hz, 1H), 7.65-7.62 (m, 1H), 7.52-7.51 (m, 1H), 7.36 (d, J=1.8 Hz, 1H), 7.19-7.14 (m, 2H), 3.84 (s, 3H), 2.64 (s, 3H).
Synthesis of Compound 73
[0452] ##STR00208##
[0453] Step 1: The synthesis of compound 73 was performed referring to the first step of the synthesis method of compound 63.
##STR00209##
[0454] LC_MS: (ES.sup.+): m/z 225.0 [M+H].sup.+.
[0455] .sup.1H NMR (500 MHz, DMSO) 9.11 (s, 1H), 8.93 (d, J=4.3 Hz, 1H), 8.54 (d, J=7.9 Hz, 1H), 8.38 (s, 1H), 7.95 (dd, J=7.8, 5.3 Hz, 1H), 7.86 (d, J=9.6 Hz, 1H), 7.59 (dd, J=9.7, 2.0 Hz, 1H), 7.53 (d, J=1.6 Hz, 1H), 2.70 (s, 3H).
Synthesis of Compound 74
[0456] ##STR00210##
[0457] Step 1: The synthesis of compound 74 was performed referring to the first step of the synthesis method of compound 63.
##STR00211##
[0458] LC_MS: (ES.sup.+): m/z 225.0 [M+H].sup.+.
[0459] .sup.1H NMR (400 MHz, DMSO) 8.98 (d, J=6.6 Hz, 2H), 8.64 (s, 1H), 8.26 (d, J=6.6 Hz, 2H), 7.85 (d, J=9.7 Hz, 1H), 7.74 (d, J=1.7 Hz, 1H), 7.59 (dd, J=9.7, 2.0 Hz, 1H), 2.72 (s, 3H).
Synthesis of Compound 75
[0460] ##STR00212##
[0461] Step 1: The synthesis of compound 75 was performed referring to the first step of the synthesis method of compound 63.
##STR00213##
[0462] LC_MS: (ES.sup.+): m/z 286.1 [M+H].sup.+.
Synthesis of Compound 76
[0463] ##STR00214##
[0464] Step 1: the synthesis of compound 76 was performed referring to the first step of the synthesis method of compound 63.
##STR00215##
[0465] LC_MS: (ES.sup.+): m/z 225.0 [M+H].sup.+.
[0466] .sup.1H NMR (400 MHz, DMSO) 9.21 (d, J=1.9 Hz, 1H), 8.83 (s, 1H), 8.77 (d, J=4.7 Hz, 1H), 8.06 (d, J=8.0 Hz, 1H), 8.03-7.98 (m, 1H), 7.82 (d, J=9.6 Hz, 1H), 7.57 (dd, J=9.6, 2.1 Hz, 1H), 7.49-7.43 (m, 1H), 2.74 (s, 3H).
Synthesis of Compound 77
[0467] ##STR00216##
[0468] Step 1: The synthesis of compound 77 was performed referring to the first step of the synthesis method of compound 63.
##STR00217##
[0469] LC_MS: (ES.sup.+): m/z 355.1 [M+H].sup.+.
Synthesis of Compound 78
[0470] ##STR00218##
[0471] Step 1: The synthesis of compound 78 was performed referring to the first step of the synthesis method of compound 63.
##STR00219##
[0472] LC_MS: (ES.sup.+): m/z 619.2 [M+H].sup.+.
Synthesis of Compound 79
[0473] ##STR00220##
[0474] Step 1: The synthesis of compound 79 was performed referring to the first step of the synthesis method of compound 63.
##STR00221##
[0475] LC_MS: (ES.sup.+): m/z 663.1 [M+H].sup.+.
Example 7: Synthesis of Compound 80 and Compound 81
[0476] ##STR00222##
Step 1: Compound 80-B tert-butyl (3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0477] ##STR00223##
[0478] A solution containing compound BB5 (100 mg, 320.34 mol) and compound 80-A (272 mg, 961.02 mol) in 1,4-dioxane (3 mL)/water (1 mL) was added with Pd(PPh.sub.3).sub.4 (18.51 mg, 16.02 mol) and sodium carbonate (102 mg, 961.02 mol). The reaction solution was stirred under nitrogen at 90 C. for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was diluted with water (20 mL), and extracted with ethyl acetate (10 mL2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was separated and purified by preparative TLC (dichloromethane:methanol=10:1, Rf=0.5) to obtain yellow solid compound 80-B tert-butyl (3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)carbamate tert-butyl (3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)carbamate (100 mg).
[0479] LC_MS: (ES.sup.+): m/z 389.0 [M+H].sup.+.
Step 2: Compound 80-C tert-butyl 3-(3-(N-(tert-butoxycarbonyl)sulfamoyl)phenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0480] ##STR00224##
[0481] A solution of compound 80-B (100 mg, 257.44 mol) in dichloromethane (5 mL) was added with triethylamine (78.15 mg, 772.32 mol), 4-dimethylaminopyridine (3.2 mg, 25.74 mol) and di-tert-butyl dicarbonate (56.2 mg, 257.44 mol). The reaction solution was stirred at 20 C. for 12 hours of reaction. Compound 80-B (Rf=0.5) was monitored by TLC (dichloromethane:methanol=10:1) to be reacted completely, and a new spot (Rf=0.6) was generated. The reaction solution was diluted with water (20 mL), and extracted with dichloromethane (10 mL2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was separated and purified by preparative TLC (dichloromethane:methanol=10:1, Rf=0.6) to obtain compound 80-C tert-butyl 3-(3-(N-(tert-butoxycarbonyl)sulfamoyl)phenyl)imidazo[1,2-a]pyridin-6-yl)carbamate as a colorless oil (54 mg).
[0482] LC_MS: (ES.sup.+): m/z 489.0 [M+H].sup.+.
Step 3: Compound 80 di-tert-butyl(E)-7-oxa-3-thio-4,10-diaza-1(3,6)-imidazol[1,2-a]pyridin-2(1,3)-phenylcyclodecane-4,10-dicarboxylate 3,3-dioxide
[0483] ##STR00225##
[0484] A solution containing compound 80-C (44 mg, 90.06 mol) and potassium carbonate (62 mg, 450.60 mol) in acetonitrile (20 mL) was added with compound 80-D (147 mg, 633.84 mol). The reaction solution was stirred at 80 C. for 12 hours of reaction. Most product was detected by LCMS. The reaction solution was diluted with water (30 mL), and extracted with ethyl acetate (30 mL2). The combined organic layers were washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The resulting crude product was separated and purified by preparative TLC (petroleum ether:ethyl acetate=0:1, Rf=0.8) to obtain yellow solid compound 80 di-tert-butyl(E)-7-oxa-3-thio-4,10-diaza-1(3,6)-imidazol[1,2-a]pyridin-2(1,3)-phenylcyclodecane-4,10-dicarboxylate 3,3-dioxide (34 mg).
[0485] LC_MS: (ES.sup.+): m/z 559.1 [M+H].sup.+.
Step 4: Compound 81 (E)-7-oxa-3-thia-4,10-diaza-1(3,6)-imidazo[1,2-a]pyridine-2(1,3)-benzocyclodecane 3,3-dioxide
[0486] ##STR00226##
[0487] A solution of compound 80 (28 mg, 50.12 mol) in methanol (1.5 mL) was added with hydrochloric acid/dioxane (1.5 mL). The reaction solution was stirred at 20 C. for 1 hour of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was concentrated to obtain compound 81 (10.3 mg) as a yellow solid.
[0488] LC_MS: (ES.sup.+): m/z 359.0 [M+H].sup.+.
[0489] .sup.1H NMR (500 MHz, DMSO) 8.31 (d, J=9.0 Hz, 2H), 8.03-7.91 (m, 3H), 7.85 (d, J=25.9 Hz, 4H), 7.53 (d, J=9.6 Hz, 1H), 7.37-7.04 (m, 1H), 3.78-3.59 (m, 4H), 3.29-3.19 (m, 4H).
Example 8: Synthesis of Compound 82
[0490] ##STR00227##
Step 1: Compound 82-C isocyanobenzene
[0491] ##STR00228##
[0492] A solution of compound 82-A (400 mg, 3.30 mmol) and triethylamine (2 mL) in dichloromethane (5 mL) was added with compound 82-B (454.2 mg, 1.65 mmol). The reaction solution was stirred at 0 C. for 3 hours of reaction. A new spot (Rf=0.6) was generated by TLC (petroleum ether:ethyl acetate=2:1) monitoring. The reaction mixture was poured into ice water and extracted with dichloromethane (30 mL2). The combined organic layers were dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (SiO.sub.2, petroleum ether:ethyl acetate=5:1-1:1, Rf=0.6) to obtain compound 82-C (38 mg) as a yellow oil.
Step 2: Compound 82 6-methoxy-N-phenylimidazo[1,2-a]pyridin-3-amine
[0493] ##STR00229##
[0494] A solution containing compound 82-D (38 mg, 306.10 mol) and compound 82-E (34 mg, 367.21 mol) in 1,2-dichloroethane (2 ml)/methanol (1 ml) was stirred at 20 C. for 30 minutes of reaction. Then compound 82-C (38 mg, 367.32 mol) was added to the reaction solution, and the mixed reaction solution was stirred at 20 C. for 12 hours of reaction. Finally, the mixed reaction solution was added with dichloromethane and sodium bicarbonate solid, and stirred at 20 C. for 15 minutes. The generation of the product was monitored by LCMS. The reaction mixture was filtered through diatomite, and the filtrate was concentrated, diluted with water (10 mL), and extracted with ethyl acetate (20 mL2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was separated and purified by preparative TLC (dichloromethane:methanol=10:1, Rf=0.5) and preparative TLC (petroleum ether:ethyl acetate=1:2.5, Rf=0.3) to obtain compound 82 6-methoxy-N-phenylimidazo[1,2-a]pyridin-3-amine (34 mg, 367.21 mol) as a brown oil.
[0495] LC_MS: (ES.sup.+): m/z 240.0 [M+H].sup.+.
[0496] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.49 (d, J=10.3 Hz, 1H), 7.40 (d, J=1.9 Hz, 1H), 7.27 (s, 1H), 7.21 (dd, J=8.4, 7.5 Hz, 2H), 7.06 (s, 1H), 6.99 (d, J=9.8 Hz, 1H), 6.87 (d, J=7.3 Hz, 1H), 6.68-6.50 (m, 2H), 3.74 (s, 3H).
Example 9: Synthesis of Compound 83, Compound 84 and Compound 85
[0497] ##STR00230##
Step 1: Compound 83 tert-butyl 3-(cyclohex-1-en-1-yl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0498] ##STR00231##
[0499] A solution containing intermediate BB6 (90 mg, 275.94 mol) and compound 83-A (244.75 mg, 1.787 mmol) in 1,4-dioxane (6 ml) and water (1 mL) was added with Pd(PPh.sub.3).sub.4 (16 mg, 13.80 mol) and sodium carbonate (87.7 mg, 827.73 mol) under nitrogen atmosphere. The reaction solution was heated to 90 C. under nitrogen protection and stirred for 12 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with water (10 ml) and ethyl acetate (10 ml2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by silica gel column chromatography (eluted with petroleum ether containing 0%-90% ethyl acetate) to obtain compound 83 tert-butyl 3-(cyclohex-1-en-1-yl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (108 mg) as a yellow solid.
[0500] LC_MS: (ES.sup.+): m/z 328.1 [M+H].sup.+.
Step 2: Compound 84 tert-butyl (3-cyclohexylimidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0501] ##STR00232##
[0502] Compound 83 (88 mg, 268.8 mol) was dissolved in methanol (5 mL), and then added with palladium carbon (10 mg). The reaction solution was stirred at 20 C. under a hydrogen atmosphere for 48 hours. The reaction was monitored by TLC to be completed. The reaction solution was filtered through diatomite, and the filtrate was concentrated under reduced pressure. The resulting residue was separated and purified by preparative TLC (eluted with petroleum ether containing 50% ethyl acetate) to obtain compound 84 tert-butyl (3-cyclohexylimidazo [1,2-a]pyridin-6-yl)(methyl)carbamate (25 mg).
[0503] LC_MS: (ES.sup.+): m/z 330.1 [M+H].sup.+.
Step 3: Compound 85 3-cyclohexyl-N-methylimidazo[1,2-a]pyridin-6-amine
[0504] ##STR00233##
[0505] Compound 84 (20 mg, 60.71 mol) was dissolved in methanol (1 mL), and added with hydrochloric acid in dioxane (1 mL, 4M). The reaction solution was stirred at room temperature for 1 hour. The reaction was monitored by LC-MS to be completed. The reaction solution was concentrated under reduced pressure to obtain brown solid compound 85 3-cyclohexyl-N-methylimidazo[1,2-a]pyridin-6-amine (9.9 mg).
[0506] LC_MS: (ES.sup.+): m/z 230.0 [M+H].sup.+.
[0507] .sup.1H NMR (400 MHz, DMSO) 7.80 (d, J=5.6 Hz, 1H), 7.68 (t, J=6.6 Hz, 1H), 7.62 (s, 1H), 7.47-7.44 (m, 1H), 7.44-7.40 (m, 1H), 3.11 (d, J=11.4 Hz, 1H), 2.74 (s, 2H), 2.01 (t, J=10.1 Hz, 2H), 1.84-1.70 (m, 3H), 1.50 (dd, J=25.1, 12.4 Hz, 2H), 1.41-1.29 (m, 3H).
Example 10: Synthesis of Compound 86 and Compound 87
[0508] ##STR00234##
Step 1: Compound 86-A 3-bromoimidazo[1,2-a]pyridin-6-amine
[0509] ##STR00235##
[0510] Intermediate BB5 (100 mg, 320.34 mol) was dissolved in a solution of hydrochloric acid in dioxane (5 mL, 4M). The reaction solution was stirred at room temperature for 1 hour. The reaction was monitored by LC-MS to be completed. The reaction solution was concentrated under reduced pressure to obtain compound 86-A (80 mg) as a white solid.
[0511] LC_MS: (ES.sup.+): m/z 211.9 [M+H].sup.+.
Step 2: Compound 86 3-bromo-N-(tetrahydrofuran-3-yl)imidazo[1,2-a]pyridin-6-amine
[0512] ##STR00236##
[0513] Compound 86-A (48 mg, 226.36 mol) and compound 86-B (29.2 mg, 339.54 mol) and a drop of acetic acid were dissolved in methanol (1 mL), and added with NaBH.sub.3CN (28.5 mg, 452.72 mol) and 4A molecular sieve (50 mg). The reaction solution was stirred at 20 C. for 12 hours. The reaction was monitored by TLC to be completed. The reaction solution was filtered, concentrated, and extracted with water (10 ml) and dichloromethane (10 ml2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The resulting crude product was separated and purified by silica gel column chromatography (eluted with a dichloromethane solution containing 10% methanol) to obtain compound 86 3-bromo-N-(tetrahydrofuran-3-yl)imidazo[1,2-a]pyridin-6-amine (45 mg) as a yellow oil.
[0514] LC_MS: (ES.sup.+): m/z 281.9 [M+H].sup.+.
Step 3: Compound 87 3-phenyl-N-(tetrahydrofuran-3-yl)imidazo[1,2-a]pyridin-6-amine
[0515] ##STR00237##
[0516] A solution containing compound 86 (36 mg, 127.60 mol) and compound 87-A (31.1 mg, 255.19 mol) in 1,4-dioxane (3 ml) and water (1 mL) was added with Pd(PPh.sub.3).sub.4 (6.1 mg, 6.38 mol) and sodium carbonate (40.6 mg, 382.79 mol) under nitrogen atmosphere. The reaction solution was heated to 90 C. under nitrogen protection and stirred for 30 minutes of reaction. The reaction was monitored by LCMS to be not completed. The reaction solution was subsequently added with compound 87-A phenylboronic acid (31.1 mg, 255.19 mol), tetrakis(triphenylphosphine)palladium (6.1 mg, 6.38 mol) and sodium carbonate (40.6 mg, 382.79 mol), heated to 100 C. under nitrogen protection and stirred for 1.5 hours of reaction. The reaction mixture was extracted with water (10 ml) and ethyl acetate (10 ml2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The resulting crude product was separated and purified by silica gel column chromatography (eluted with a dichloromethane solution containing 10% methanol) to obtain compound 87 3-phenyl-N-(tetrahydrofuran-3-yl)imidazo[1,2-a]pyridin-6-amine (11.6 mg) as a yellow oil.
[0517] LC_MS: (ES.sup.+): m/z 280.0 [M+H].sup.+.
[0518] .sup.1H NMR (500 MHz, MeOD) 7.72-7.39 (m, 9H), 7.18 (dd, J=38.7, 9.3 Hz, 1H), 4.06-3.53 (m, 5H), 2.31-2.06 (m, 1H), 1.90 (s, 1H).
Example 11: Synthesis of Compound 88 and Compound 89
[0519] ##STR00238## ##STR00239##
Step 1: Compound 88-C tert-butyl (R)-3-((6-nitropyridin-3-yl)amino)piperidin-1-carboxylate
[0520] ##STR00240##
[0521] A solution containing compound 88-A (1.0 g, 4.93 mmol) and compound 88-B (986.6 mg, 4.93 mmol) in toluene (20 mL) was added with Pd(OAc).sub.2 (110.6 mg, 492.62 mol), XantPhos (285 mg, 492.62 mol), and cesium carbonate (4.82 g, 14.78 mmol). The reaction solution was stirred under nitrogen at 100 C. for 4 hours of reaction. Compound 88-A (Rf=0.8) was monitored by TLC (PE:EtOAc=1:1) to be completely reacted, and a new spot (Rf=0.3) was generated. The reaction solution was diluted with water (50 mL), and extracted with ethyl acetate (50 mL2). The combined organic layers were washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The obtained residue was separated and purified by silica gel column chromatography (SiO.sub.2, petroleum ether:ethyl acetate=2:1-1:2, Rf=0.3) to obtain yellow solid compound 88-C tert-butyl (R)-3-((6-nitrogen) pyridin-3-yl)amino)piperidin-1-carboxylate (1.37 g).
[0522] LC_MS: (ES.sup.+): m/z 323.0 [M+Na].sup.+.
Step 2: Compound 88-D tert-butyl (R)-3-(((tert-butoxycarbonyl)(6-nitropyridin-3-yl)amino)piperidin-1-formate
[0523] ##STR00241##
[0524] A solution of compound 88-C (1.32 g, 4.09 mmol) and di-tert-butyl dicarbonate (1.07 g, 4.91 mmol) in dichloromethane (20 mL) was added with N,N-diisopropylethylamine (1.59 g, 12.28 mmol) and 4-dimethylaminopyridine (50 mg, 409.47 mol). The reaction solution was stirred at 40 C. for 12 hours of reaction. TLC (petroleum ether:ethyl acetate=2:1) showed that most of the compound 88-C(Rf=0.2) was completely reacted, and a new spot (Rf=0.6) was generated. The reaction solution was diluted with water (50 mL), and extracted with dichloromethane (50 mL2). The combined organic layers were washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated and purified by silica gel column chromatography (SiO.sub.2, petroleum ether:ethyl acetate=4:1-2:1) to obtain yellow solid compound 88-D tert-butyl (R)-3-(((tert-butoxycarbonyl)(6-nitropyridin-3-yl)amino)piperidin-1-formate (1.4 g).
[0525] LC_MS: (ES.sup.+): m/z 445.0 [M+Na].sup.+.
[0526] .sup.1H NMR (400 MHz, MeOD) 8.43 (d, J=2.3 Hz, 1H), 8.34 (dd, J=8.6, 0.4 Hz, 1H), 8.01 (dd, J=8.6, 2.5 Hz, 1H), 4.36-4.23 (m, 1H), 4.04 (t, J=11.1 Hz, 1H), 3.94 (d, J=13.1 Hz, 1H), 2.81 (s, 1H), 2.56 (s, 1H), 2.06-1.85 (m, 1H), 1.81-1.62 (m, 1H), 1.53 (ddd, J=16.8, 8.5, 4.0 Hz, 1H), 1.46 (s, 8H), 1.41 (s, 9H).
Step 3: Compound 88-E tert-butyl (R)-3-((6-aminopyridin-3-yl)(tert-butoxycarbonyl)amino)piperidin-1-formate
[0527] ##STR00242##
[0528] A solution of compound 88-D (1.3 g, 3.08 mmol) in tetrahydrofuran (20 mL) was added with Pd/C (130 mg). The reaction solution was stirred under a hydrogen balloon at 20 C. for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was filtered through diatomite. The filtrate was concentrated. The residue was used directly in the next reaction without purification. A brown solid compound 88-E tert-butyl (R)-3-((6-aminopyridin-3-yl)(tert-butoxycarbonyl)amino)piperidin-1-formate (1.2 g) was obtained.
[0529] LC_MS: (ES.sup.+): m/z 393.1 [M+H].sup.+.
Step 4: Compound 88-G tert-butyl (R)-3-(((tert-butoxycarbonyl)(imidazo[1,2-a]pyridin-6-yl)amino)amino)piperidin-1-carboxylate
[0530] ##STR00243##
[0531] A solution containing compound 88-E (300 mg, 764.33 mol) and compound 88-F (300 mg, 1.53 mmol, 40% wt aqueous solution) in ethanol (10 mL) was stirred at 80 C. for 15 hours of reaction. TLC (petroleum ether:ethyl acetate=1:1) monitoring showed that compound 88-E (Rf=0.6) was reacted completely, and a new spot (Rf=0.3) was generated. The reaction solution was concentrated, then diluted with ethyl acetate (30 mL), and adjusted to pH=9 with sodium bicarbonate solution. The organic layer was collected, washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated and purified by silica gel column chromatography (SiO.sub.2, petroleum ether:ethyl acetate=1:1-0:1, Rf=0.3) to obtain a brown oil compound 88-G tert-butyl (R)-3-((tert-butoxycarbonyl)(imidazo[1,2-a]pyridin-6-yl)amino)amino)piperidin-1-carboxylate (230 mg).
[0532] LC_MS: (ES): m/z 417.1 [M+H].sup.+.
Step 5: Compound 88-H tert-butyl(R)-3-((3-bromoimidazo[1,2-a]pyridin-6-yl)(tert-butoxycarbonyl)amino)piperidin-1-formate
[0533] ##STR00244##
[0534] A solution of compound 88-G tert-butyl (R)-3-((tert-butoxycarbonyl)(imidazo[1,2-a]pyridin-6-yl)amino)amino)piperidin-1-carboxylate (200 mg, 0.48 mmol) in dichloromethane (6 ml) was added with N-bromosuccinimide (85.57 mg, 0.48 mmol). The reaction solution was stirred at room temperature for 1 hour of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was concentrated under reduced pressure, and the resulting residue was subjected to silica gel column chromatography (eluted with petroleum ether containing 0%-50% ethyl acetate) to obtain yellow solid compound 88-H tert-butyl(R)-3-((3-bromoimidazo[1,2-a]pyridin-6-yl) (tert-butoxycarbonyl)amino)piperidin-1-formate (200 mg).
[0535] LC_MS: (ES.sup.+): m/z 495.0 [M+H].sup.+.
Step 6: Compound 88 tert-butyl (R)-3-((tert-butoxycarbonyl)(3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)amino)piperidin-1-formate
[0536] ##STR00245##
[0537] A solution containing compound 88-H (100 mg, 0.202 mmol), compound 88-I (142.88 mg, 0.504 mmol) and sodium carbonate (64.23 mg, 0.606 mmol) in 1,4-dioxane (3 ml) and water (1 ml) was added with Pd(PPh.sub.3).sub.4 (16.34 mg, 0.0141 mmol) under nitrogen at room temperature. The reaction mixture was replaced with nitrogen three times, and stirred at 90 C. for 6 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with water and ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain yellow solid compound 88 tert-butyl (R)-3-((tert-butoxycarbonyl)(3-(3-sulfamoylphenyl)imidazo[1,2-a]pyridin-6-yl)amino)piperidin-1-formate (51 mg).
[0538] LC_MS: (ES.sup.+): m/z 572.1 [M+H].sup.+.
Step 7: Compound 89 (R)-3-(6-(piperidin-3-ylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide
[0539] ##STR00246##
[0540] A solution of compound 88 (50 mg, 0.0848 mmol) in methanol (2 ml) was added with a hydrochloric acid/dioxane (2 ml, 4.0 mol/L) solution. The reaction mixture was stirred at room temperature for 6 hours. The reaction was monitored by TLC to be completed. The reaction solution was concentrated under reduced pressure to obtain yellow solid compound 89 (R)-3-(6-(piperidin-3-ylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide (39.5 mg).
[0541] LC_MS: (ES.sup.+): m/z 372.0 [M+H].sup.+.
[0542] .sup.1H NMR (400 MHz, DMSO) 8.98 (s, 2H), 8.29 (s, 1H), 8.13 (s, 1H), 7.97 (dd, J=17.8, 7.9 Hz, 2H), 7.83 (dd, J=15.6, 8.5 Hz, 2H), 7.74 (s, 1H), 7.58 (d, J=5.0 Hz, 3H), 6.62 (s, 1H), 3.66 (dd, J=13.7, 5.3 Hz, 2H), 3.14 (s, 1H), 2.87 (s, 1H), 2.69 (d, J=9.8 Hz, 1H), 1.94-1.81 (m, 2H), 1.72 (d, J=10.4 Hz, 1H), 1.52 (d, J=10.1 Hz, 1H).
[0543] The following compounds were synthesized referring to the synthesis of compound 89:
Synthetic Route of Compound 90
[0544] ##STR00247## ##STR00248##
[0545] Step 1: The synthesis of compound 90-C was performed referring to the first step of the synthesis method of compound 89.
[0546] Step 2: The synthesis of compound 90-D was performed referring to the second step of the synthesis method of compound 89.
[0547] Step 3: The synthesis of compound 90-E was performed referring to the third step of the synthesis method of compound 89.
[0548] Step 4: The synthesis of compound 90-G was performed referring to the fourth step of the synthesis method of compound 89.
[0549] Step 5: The synthesis of compound 90-H was performed referring to the fifth step of the synthesis method of compound 89.
[0550] Step 6: The synthesis of compound 90 was performed referring to the sixth step of the synthesis method of compound 89.
##STR00249##
[0551] LC_MS: (ES.sup.+): m/z 386.2 [M+H].sup.+.
Example 12: Synthesis of Compound 91
[0552] ##STR00250##
Step 1: Compound 91 N-methyl-N-(3-phenylimidazo[1,2-a]pyridin-6-yl)methanesulfonamide
[0553] ##STR00251##
[0554] A solution containing compound 65 N-methyl-3-phenylimidazo[1,2-a]pyridin-6-amine (65 mg, 0.291 mmol) and triethylamine (32.32 mg, 0.32 mmol) in dichloromethane (4 ml) was added with compound 91-A methylsulfonyl chloride (36.65 mg, 0.32 mmol) under nitrogen at 0 C. The reaction mixture was warmed from 0 C. to room temperature and stirred for 14 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC to obtain white solid compound 91 N-methyl-N-(3-phenylimidazo[1,2-a]pyridin-6-yl)methanesulfonamide (15 mg).
[0555] LC_MS: (ES.sup.+): m/z 302.0 [M+H].sup.+.
[0556] .sup.1H NMR (500 MHz, DMSO) 8.62 (s, 1H), 7.94 (s, 1H), 7.78 (s, 3H), 7.68 (s, 2H), 7.56 (s, 2H), 3.38 (s, 3H), 3.15 (s, 3H).
Example 13: Synthesis of Compound 92
[0557] ##STR00252##
Step 1: Compound 92 N-(3-(2-chlorophenyl)imidazo[1,2-a]pyridin-6-yl)-N-methylacetamide
[0558] ##STR00253##
[0559] A solution containing compound 68 3-(2-chlorophenyl)-N-methylimidazo[1,2-a]pyridin-6-amine (70 mg, 0.271 mmol) and triethylamine (30.3 mg, 0.3 mmol) in dichloromethane (4 ml) was added with compound 92-A acetyl chloride (24.45 mg, 0.3 mmol) under nitrogen at 0 C. The reaction mixture was warmed from 0 C. to room temperature and stirred for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC to obtain brown solid compound 92 N-(3-(2-chlorophenyl)imidazo[1,2-a]pyridin-6-yl)-N-methylacetamide (30 mg).
[0560] LC_MS: (ES.sup.+): m/z 300.0 [M+H].sup.+.
[0561] .sup.1H NMR (500 MHz, DMSO) 8.24 (s, 1H), 7.79-7.74 (m, 2H), 7.69 (dd, J=7.9, 1.2 Hz, 1H), 7.61 (d, J=7.3 Hz, 1H), 7.57 (dd, J=7.5, 1.9 Hz, 1H), 7.54 (dd, J=5.3, 1.8 Hz, 1H), 7.51 (dd, J=7.4, 1.4 Hz, 1H), 7.38 (d, J=9.7 Hz, 1H), 3.10 (s, 3H), 1.81 (s, 3H).
[0562] The following compounds were synthesized referring to the synthesis of compound 92:
Synthesis of Compound 93
[0563] ##STR00254##
[0564] Step 1: The synthesis of compound 93 was performed referring to the first step of the synthesis method of compound 92.
##STR00255##
[0565] LC_MS: (ES.sup.+): m/z 286.0 [M+H].sup.+.
Example 14: Synthesis of Compound 94
[0566] ##STR00256##
Step 1: Compound 94-C 3-bromo-N,N-dimethylimidazo[1,2-b]pyridazin-6-amine
[0567] ##STR00257##
[0568] A solution containing compound 94-A (40 mg, 0.172 mmol), compound 94-B methylamine hydrochloride (17.42 mg, 0.258 mmol) and triethylamine (52.21 mg, 0.516 mmol) in N,N-dimethylformamide (2 ml) was stirred at 110 C. for 48 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 3.22% methanol) to obtain brown solid compound 94-C 3-bromo-N,N-dimethylimidazo[1,2-b]pyridazin-6-amine (14 mg).
[0569] LC_MS: (ES.sup.+): m/z 240.9 [M+H].sup.+.
Step 2: Compound 94 N,N-dimethyl-3-phenylimidazo[1,2-b]pyridazin-6-amine
[0570] ##STR00258##
[0571] A solution containing compound 94-C 3-bromo-N,N-dimethylimidazo[1,2-b]pyridazin-6-amine (14 mg, 0.058 mmol), compound 94-D phenylboronic acid (7.79 mg, 0.069 mmol), and saturated sodium carbonate solution (0.5 ml) in 1,4-dioxane (1 ml) was added with Pd(dppf)Cl.sub.2CH.sub.2Cl.sub.2 (4.74 mg, 0.0058 mmol) under a nitrogen atmosphere at room temperature. The reaction mixture was replaced with nitrogen three times, and stirred at 80 C. for 14 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was cooled to room temperature, and extracted with water and ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain white solid compound 94 N,N-dimethyl-3-phenylimidazo[1,2-b]pyridazin-6-amine (6 mg).
[0572] LC_MS: (ES.sup.+): m/z 239.1 [M+H].sup.+.
[0573] .sup.1H NMR (400 MHz, DMSO) 8.18 (dd, J=8.4, 1.1 Hz, 2H), 7.94 (s, 1H), 7.89 (d, J=10.0 Hz, 1H), 7.46 (dd, J=10.7, 4.8 Hz, 2H), 7.31 (d, J=7.4 Hz, 1H), 7.11 (d, J=10.0 Hz, 1H), 3.09 (s, 6H).
Example 15: Synthesis of Compound 95
[0574] ##STR00259##
Step 1: Compound 95 tert-butyl methyl(3-phenylimidazo[1,2-b]pyridazin-6-yl) carbamate
[0575] ##STR00260##
[0576] A solution of compound 22 (18.5 mg, 0.0597 mmol) in N,N-dimethylformamide (1 ml) was added with sodium hydride (2.39 mg, 0.0597 mmol, 60% dispersed in mineral oil) and methyl iodide (16.89 mg, 0.119 mmol) at 0 C. under nitrogen. The mixed reactants were heated from 0 C. to room temperature and stirred for 14 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain light yellow solid compound 95 tert-butyl methyl (3-phenylimidazo[1,2-b]pyridazin-6-yl) carbamate (7 mg).
[0577] LC_MS: (ES.sup.+): m/z 325.1 [M+H].sup.+.
Example 16: Synthesis of Compound 96
[0578] ##STR00261##
Step 1: Compound 96 tert-butyl (3-(3-acetylaminophenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0579] ##STR00262##
[0580] A solution containing compound 2 (20 mg, 0.0591 mmol) and pyridine (9.35 mg, 0.118 mmol) in dichloromethane (4 ml) was added with compound 96-A acetyl chloride (4.64 mg, 0.0591 mmol) under nitrogen at 0 C. The reaction mixture was heated from 0 C. to room temperature and stirred for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain compound 96 tert-butyl 3-(3-acetylaminophenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (19 mg) as a yellow solid.
[0581] LC_MS: (ES.sup.+): m/z 339.2 [M+H].sup.+.
[0582] .sup.1H NMR (400 MHz, DMSO) 10.11 (s, 1H), 8.48 (s, 1H), 7.88 (s, 1H), 7.75 (s, 1H), 7.68 (d, J=9.2 Hz, 1H), 7.57 (d, J=7.8 Hz, 1H), 7.46 (t, J=7.8 Hz, 1H), 7.36 (d, J=9.5 Hz, 1H), 7.30 (d, J=7.5 Hz, 1H), 3.19 (s, 3H), 2.05 (s, 3H), 1.35 (s, 9H).
Example 17: Synthesis of Compound 97
[0583] ##STR00263##
Step 1: Compound 97-A N-(3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)piperidin-4-carboxamide
[0584] ##STR00264##
[0585] Compound 52 (70 mg, 0.127 mmol) and hydrochloric acid/dioxane (1 ml) were added to a methanol (1 ml) solution. The reaction solution was stirred at room temperature for 6 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was concentrated under reduced pressure to obtain a brown solid crude compound 97-A N-(3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)piperidin-4-carboxamide (50 mg).
[0586] LC_MS: (ES.sup.+): m/z 350.2 [M+H].sup.+.
Step 2: Compound 97 1-(2-methoxyethyl)-N-(3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)piperidin-4-carboxamide
[0587] ##STR00265##
[0588] A solution containing compound 97-A (20 mg, 0.0573 mmol), compound 97-B (7.96 mg, 0.0573 mmol) and potassium carbonate (31.63 mg, 0.23 mmol) in N,N-dimethylformamide (1 ml) was stirred at 70 C. for 16 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was extracted with ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 11.1% methanol) to obtain a brown gum compound 97 1-(2-methoxyethyl)-N-(3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)piperidin-4-carboxamide (3.2 mg).
[0589] LC_MS: (ES.sup.+): m/z 408.2 [M+H].sup.+.
Example 18: Synthesis of Compound 98
[0590] ##STR00266##
Step 1: Compound 98 2-(2-(2-(2-((3-(6-((tert-butoxycarbonyl))(methyl)amino)imidazo[1,2-a]pyridin-3-yl)phenyl)amino)-2-oxoethoxy)ethoxy)ethoxy)acetic acid
[0591] ##STR00267##
[0592] A solution of compound 98-A (100 mg, 0.45 mmol) in thionyl chloride (3 ml) was stirred at 60 C. for 3.5 hours of reaction. The reaction solution was concentrated under reduced pressure, and the residue was dissolved in dichloromethane (2 mL). The above reaction solution was added with a dichloromethane (1 mL) solution containing compound 2 (50.76 mg, 0.15 mmol) and triethylamine (75.89 mg, 0.75 mmol) at 0 C., stirred at 0 C. for 3 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water (10 ml) and dichloromethane (10 ml3). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The crude product obtained was subjected to Prep-TLC (eluted with dichloromethane containing 12.5% methanol) to obtain yellow solid compound 98 2-(2-(2-(2-((3-(6-((tert-butoxycarbonyl))(methyl)amino)imidazo[1,2-a]pyridin-3-yl)phenyl)amino)-2-oxoethoxy)ethoxy)ethoxy)acetic acid (60 mg).
[0593] LC_MS: (ES.sup.+): m/z 543.3 [M+H].sup.+.
[0594] .sup.1H NMR (400 MHz, DMSO) 10.21 (s, 1H), 8.49 (s, 1H), 7.95 (s, 1H), 7.79-7.70 (m, 2H), 7.63 (d, J=9.4 Hz, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.31 (dd, J=17.5, 7.8 Hz, 2H), 4.15 (s, 2H), 3.65 (d, J=6.2 Hz, 4H), 3.62-3.57 (m, 2H), 3.53 (s, 4H), 3.19 (s, 3H), 1.34 (s, 9H).
Example 19: Synthesis of Compound 99
[0595] ##STR00268##
Step 1: Compound 99 tert-butyl (3-(3-(2-(2-(2-(2-amino-2-oxoethoxy)ethoxy)ethoxy) acetamido)phenyl)imidazolin[1,2-a]pyridin-6-yl)(methyl)carbamate
[0596] ##STR00269##
[0597] A solution of compound 99-A (49.28 mg, 0.222 mmol) in thionyl chloride (1 ml) was stirred at 60 C. for 5 hours of reaction. The reaction solution was concentrated under reduced pressure, and the residue was dissolved in dichloromethane (2 mL). The above reaction solution was added with a dichloromethane (1 mL) solution containing compound 2 (25 mg, 0.074 mmol) and triethylamine (37.38 mg, 0.369 mmol) at 0 C., and stirred at 0 C. for 3 hours of reaction. Finally, the reaction mixture was added with ammonium carbonate (14.22 mg, 0.148 mmol), and stirred at room temperature for 14 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water (10 ml) and dichloromethane (10 ml3). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The crude product obtained was subjected to Prep-TLC (eluted with dichloromethane containing 9.1% methanol) to obtain yellow solid compound 99 tert-butyl (3-(3-(2-(2-(2-(2-amino-2-oxoethoxy)ethoxy)ethoxy)ethoxy)acetamido)phenyl)imidazolin[1,2-a]pyridin-6-yl)(methyl)carbamate (9 mg).
[0598] LC_MS: (ES.sup.+): m/z 542.3 [M+H].sup.+.
Example 20: Synthesis of Compound 100, Compound 101 and Compound 102
[0599] ##STR00270##
[0600] Step 1: The synthesis of compound 100-C was performed referring to the third step of the synthesis process of intermediate BB5.
[0601] Step 2: The synthesis of compound 100-D was performed referring to the fourth step of the synthesis process of intermediate BB5.
[0602] Step 3: Compound 100 4-(3-bromo-6-nitroimidazo[1,2-a]pyridin-7-yl)morpholine
##STR00271##
[0603] A solution containing compound 100-D (150 mg, 542.55 mol) and compound 100-E (70.9 mg) in acetonitrile (3 mL) was added with DIPEA (140.2 mg). The reaction solution was stirred at 20 C. for 12 hours of reaction. The product Ms was detected by LCMS. The reaction solution was diluted with water (20 mL), and extracted with ethyl acetate (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was separated and purified by silica gel column chromatography (eluted with petroleum ether solution containing 50% ethyl acetate) to obtain yellow solid compound 100 4-(3-bromo-6-nitroimidazo[1,2-a]pyridin-7-yl)morpholine (45 mg).
[0604] LC_MS: (ES.sup.+): m/z 327.0 [M+H].sup.+.
[0605] Step 4: The synthesis of compound 101 was performed referring to the first step of the synthesis process of compound 2.
##STR00272##
[0606] LC_MS: (ES.sup.+): m/z 325.1 [M+H].sup.+.
Step 5: Compound 102-A 7-morpholin-3-phenylimidazo[1,2-a]pyridin-6-amine
[0607] ##STR00273##
[0608] A mixed solution of compound 101 (14 mg, 43.16 mol) in ethanol (2 mL) and water (0.2 mL) was added with NH.sub.4Cl (11.5 mg, 215.82 mol) and iron powder (12.1 mg, 215.82 mol). The reaction solution was stirred at 20 C. for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was filtered through diatomite, and the mother liquor was concentrated. The residue was diluted with water (10 mL) and extracted with ethyl acetate (10 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was used directly in the next step without further purification. A yellow oil compound 102-A 7-morpholin-3-phenylimidazo[1,2-a]pyridin-6-amine (12.7 mg) was obtained.
[0609] LC_MS: (ES.sup.+): m/z 295.1 [M+H].sup.+.
Step 6: Compound 102 N-(7-morpholin-3-phenylimidazol[1,2-a]pyridin-6-yl)acetamide
[0610] ##STR00274##
[0611] A solution containing compound 102-A (12.7 mg, 43.14 mol) and triethylamine (129.43 mol) in dichloromethane (1 mL) was added with acetyl chloride (4.1 mg, 51.77 mol). The reaction solution was stirred at 20 C. for 12 hours of reaction. The product Ms was detected by LCMS. The reaction solution was concentrated. The residue was separated and purified by Prep-TLC (eluted with a dichloromethane solution containing 10% methanol) to obtain a yellow gum compound 102 N-(7-morpholin-3-phenylimidazo[1,2-a]pyridin-6-yl)acetamide (0.6 mg).
[0612] LC_MS: (ES.sup.+): m/z 337.1 [M+H].sup.+.
Example 21: Synthesis of Compound 103, Compound 104 and Compound 105
[0613] ##STR00275##
Step 1: Compound 103-B 6-((3,4-dimethylbenzyl)amino)imidazo[1,2-a]pyridin-3-carboxylic acid
[0614] ##STR00276##
[0615] A solution containing compound 103-A (500 mg, 1.86 mmol) and 2,4-dimethoxybenzylamine (372.8 mg, 2.23 mmol) in dioxane (20 mL) was added sodium tert-butoxide (357.5 mg, 3.72 mmol) and BrettPhos-Pd-G3 (84.3 mg, 0.093 mmol). The reaction solution was stirred at 100 C. under nitrogen for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was diluted with water (20 mL), and extracted with ethyl acetate (20 mL2). The organic layer was adjusted to pH=7 with 2N HCL. A large amount of solids were generated. The mixture was filtered. The filter cake was collected and dried under vacuum. The residue was used directly in the next step without further purification. A yellow solid compound 103-B 6-((3,4-dimethylbenzyl)amino)imidazo[1,2-a]pyridin-3-carboxylic acid (230 mg) was obtained.
[0616] LC_MS: (ES.sup.+): m/z 337.1 [M+H].sup.+.
Step 2: Compound 103 6-((3,4-dimethylbenzyl)amino)-N-phenylimidazo[1,2-a]pyridin-3-carboxamide
[0617] ##STR00277##
[0618] A solution containing compound 103-B (100 mg, 305.49 mol) and compound 103-C (56.9 mg, 610.99 mol) in DMF (2 mL) was added with DIPEA (118.5 mg, 916.48 mol) and HATU (139.4 mg, 366.59 mol). The reaction solution was stirred at 20 C. for 3 hours of reaction. TLC (DCM:MeOH=10:1) monitoring showed that compound 103-B (Rf=0.05) was completely consumed and a new spot (Rf=0.5) was generated. The reaction solution was diluted with water (10 mL), and extracted with ethyl acetate (10 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was subjected to Prep-TLC (eluted with dichloromethane containing 10% methanol) to obtain compound 103 6-((3,4-dimethylbenzyl)amino)-N-phenylimidazo[1,2-a]pyridin-3-carboxamide (95 mg).
[0619] LC_MS: (ES.sup.+): m/z 403.2 [M+H].sup.+.
Step 3: Compound 104 6-((3,4-dimethylbenzyl)(methyl)amino)-N-phenylimidazo[1,2-a]pyridin-3-carboxamide
[0620] ##STR00278##
[0621] A solution containing compound 103 (95 mg, 236.05 mol) and formaldehyde (98.4 mg, 1.18 mmol, 36% wt in water) in methanol (1 mL) was added with sodium cyanoborohydride (29.7 mg, 472.10 mol) and one drop of acetic acid. The reaction solution was stirred at 20 C. for 12 hours of reaction. TLC (DCM:MeOH=10:1) monitoring showed that most of the compound 103 (Rf=0.55) was consumed and a new spot (Rf=0.6) was generated. The reaction solution was diluted with water (10 mL), and extracted with dichloromethane (10 mL2). The organic layers were combined, washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was subjected to Prep-TLC (eluted with dichloromethane containing 5% methanol) to obtain compound 104 6-((3,4-dimethylbenzyl)(methyl)amino)-N-phenylimidazo[1,2-a]pyridin-3-carboxamide as a yellow solid (42 mg).
[0622] LC_MS: (ES.sup.+): m/z 417.2 [M+H].sup.+.
Step 4: Compound 105 6-(methylamino)-N-phenylimidazo[1,2-a]pyridin-3-carboxamide
[0623] ##STR00279##
[0624] A solution of compound 104 (37.0 mg, 88.84 mol) in dichloromethane (3 mL) was added with trifluoroacetic acid (1 mL). The reaction solution was stirred at 45 C. for 3 hours of reaction. The reaction was monitored by TLC (DCM:MeOH=10:1) to be completed. The reaction solution was concentrated, diluted with saturated sodium bicarbonate solution (10 mL), and extracted with dichloromethane (10 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was subjected to Prep-TLC (eluted with dichloromethane containing 10% methanol) to obtain compound 105 6-(methylamino)-N-phenylimidazo[1,2-a]pyridin-3-carboxamide as a white solid (12.1 mg).
[0625] LC_MS: (ES) m/z 267.1 [M+H].sup.+.
Example 22: Synthesis of Compound 106
[0626] ##STR00280##
Step 1: Compound 106 ethyl 6-((2,4-dimethoxybenzyl)amino)imidazo[1,2-a]pyridin-3-carboxylate
[0627] ##STR00281##
[0628] A solution containing compound 106-A (20 mg, 74.32 mol) and 2,4-dimethoxybenzylamine (14.9 mg, 89.19 mol) in dioxane (20 mL) was added with cesium carbonate (72.65 mg, 222.97 mol) and BrettPhos-Pd-G3 (3.3 mg, 3.716 mol). The reaction solution was stirred at 100 C. under nitrogen for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was diluted with water (10 mL), and extracted with ethyl acetate (10 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was subjected to Prep-TLC (eluted with a petroleum ether solution containing 50% ethyl acetate) to obtain a green gum compound 106 ethyl 6-((2,4-dimethoxybenzyl)amino)imidazo[1,2-a]pyridin-3-carboxylate (4.1 mg).
[0629] LC_MS: (ES.sup.+): m/z 356.1 [M+H].sup.+.
Example 23: Synthesis of Compound 107
[0630] ##STR00282##
[0631] Step 1: The synthesis of compound 107-B was performed referring to the third step of the synthesis process of intermediate BB5.
[0632] Step 2: The synthesis of compound 107-C was performed referring to the fourth step of the synthesis process of intermediate BB5.
[0633] Step 3: The synthesis of compound 107-D was performed referring to the first step of the synthesis process of compound 2.
[0634] Step 4: Compound 107-E 7-methoxy-3-phenylimidazo[1,2-a]pyridin-6-amine
##STR00283##
[0635] A solution of compound 107-D (80 mg, 297.11 mol) in methanol (5 mL) was added with palladium/carbon (10 mg). The reaction solution was stirred under a hydrogen balloon atmosphere at 20 C. for 12 hours of reaction. TLC (DCM:MeOH=10:1) monitoring showed that compound 107-D (Rf=0.7) was reacted completely, and a new spot (Rf=0.6) was generated. The reaction solution was filtered through diatomite, the mother liquor was concentrated, and the residue was used directly in the next step without further purification. A brown oil crude compound 107-E 7-methoxy-3-phenylimidazo[1,2-a]pyridin-6-amine (71 mg) was obtained.
[0636] LC_MS: (ES.sup.+): m/z 240.1 [M+H].sup.+.
Step 5: Compound 107 N-(7-methoxy-3-phenylimidazo[1,2-a]pyridin-6-yl)acetamide
[0637] ##STR00284##
[0638] A solution containing compound 107-E (33 mg, 137.91 mol) in acetonitrile (2 mL) was added with potassium carbonate (38.1 mg, 275.83 mol), acetyl chloride (23.8 mg, 303.42 mol) and di-tert-butyl dicarbonate (60.2 mg, 275.82 mol). The reaction solution was stirred at 60 C. for 12 hours of reaction. The reaction was monitored by TLC (DCM:MeOH=10:1) to be completed. The reaction solution was diluted with water (10 mL), and extracted with dichloromethane (10 mL2). The organic layers were combined, washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was separated and purified by Prep-TLC (eluted with petroleum ether containing 6.7% dichloromethane and 75% ethyl acetate) to obtain yellow solid compound 107 N-(7-methoxy-3-phenylimidazo[1,2-a]pyridin-6-yl)acetamide (3.6 mg).
[0639] LC_MS: (ES.sup.+): m/z 282.1 [M+H].sup.+.
Example 24: Synthesis of Compound 108 and Compound 109
[0640] ##STR00285##
Step 1: Compound 108-C 3-bromo-N-(2-(2-methoxyethoxy)ethyl)benzenesulfonamide
[0641] ##STR00286##
[0642] A solution containing compound 108-A 3-bromobenzenesulfonyl chloride (800 mg, 3.13 mmol) and triethylamine (633.7 mg, 6.26 mmol) in dichloromethane was added with compound 108-B 2-(2-methoxyethoxy)ethan-1-amine (391.8 mg, 3.29 mmol). The reaction solution was stirred at 0 C. for 12 hours of reaction. The reaction was monitored by TLC (petroleum ether:ethyl acetate=1:1) to be completed. The reaction solution was diluted with water (20 mL), and extracted with dichloromethane (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was separated and purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:1) to obtain compound 108-C 3-bromo-N-(2-(2-methoxyethoxy)ethyl)benzenesulfonamide (840 mg) as an oil.
[0643] LC_MS: (ES.sup.+): m/z 337.9 [M+H].sup.+.
Step 2: Compound 108-E N-(2-(2-methoxyethoxy)ethyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzenesulfonamide
[0644] ##STR00287##
[0645] A solution containing compound 108-C 3-bromo-N-(2-(2-methoxyethoxy)ethyl)benzenesulfonamide (840 mg, 2.48 mmol) and compound 108-D bis(pinacolato)borate (946.0 mg, 3.73 mmol) in 1,4-dioxane was added with potassium acetate (731.2 mg, 7.45 mmol) and [1,1-bis(diphenylphosphino)ferrocene]palladium dichloride dichloromethane complex (202.5 mg, 0.248 mmol). The reaction solution was stirred under a nitrogen atmosphere at 85 C. for 12 hours of reaction. The reaction was monitored by TLC (petroleum ether:ethyl acetate=1:1) to be completed. The reaction solution was filtered through diatomite, and the mother liquor was diluted with water (20 mL), and extracted with ethyl acetate (20 mL2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was separated and purified by silica gel column chromatography (petroleum ether:ethyl acetate=1:1) to obtain crude compound 108-E N-(2-(2-methoxyethoxy)ethyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzenesulfonamide as a yellow oil (806 mg).
[0646] LC_MS: (ES.sup.+): m/z 385.6 [M+H].sup.+.
Step 3: Compound 108 tert-butyl (3-(3-(N-(2-(2-methoxyethoxy)ethyl)sulfamoyl)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0647] ##STR00288##
[0648] The synthesis of this step was performed referring to the first step of the synthesis process of compound 2.
[0649] LC_MS: (ES.sup.+): m/z 505.1 [M+H].sup.+.
Step 4: Compound 109 N-(2-(2-methoxyethoxy)ethyl)-3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)benzenesulfonamide
[0650] ##STR00289##
[0651] The synthesis of this step was performed referring to the first step of the synthesis process of compound 63.
[0652] LC_MS: (ES.sup.+): m/z 405.0 [M+H].sup.+.
[0653] The following compounds were synthesized referring to the synthesis of compound 108 and compound 109.
Synthesis of Compound 110
[0654] ##STR00290##
[0655] Step 1: The synthesis of compound 110-C was performed referring to the first step of the synthesis process of compound 109.
[0656] Step 2: The synthesis of compound 110-E was performed referring to the second step of the synthesis process of compound 109.
[0657] Step 3: The synthesis of compound 110-G was performed referring to the third step of the synthesis process of compound 109.
Step 4: Compound 110 3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)-N-(tetrahydro-2H-pyran-4-yl)benzenesulfonamide
[0658] ##STR00291##
[0659] The synthesis of this step was performed referring to the fourth step of the synthesis process of compound 109.
[0660] LC_MS: (ES.sup.+): m/z 387.0 [M+H].sup.+.
Example 25: Synthesis of Compound 111 and Compound 112
[0661] ##STR00292##
Step 1: Compound 111-B and Compound 112-B: 6-amino-3-phenylimidazo[1,2-a]pyridin-7-ol and 6-amino-8-bromo-3-phenylimidazo[1,2-a]pyridin-7-ol
[0662] ##STR00293##
[0663] A solution of compound 111-A (20 mg, 83.58 mol) in dichloromethane (5 mL) was added with boron tribromide (41.9 mg, 167.17 mol) at 0 C. The reaction solution was stirred for 12 hours of reaction. LCMS detected the MS of compound 111-B and compound 112-B. The reaction solution was concentrated. The residue was used directly in the next step without further purification. Thus, yellow solid crude product compounds 111-B and 112-B: 6-amino-3-phenylimidazo[1,2-a]pyridin-7-ol, and 6-amino-8-bromo-3-phenylimidazo[1,2-a]pyridin-7-ol were obtained (18.8 mg).
[0664] LC_MS: (ES.sup.+): m/z 226.1 [M+H].sup.+.
Step 2: Compound 111 7-phenyl-3,4-dihydro-2H-imidazo[1,2:1,6]pyrido[4,3-b][1,4]oxazine and Compound 112 10-bromo-7-phenyl-3,4-dihydro-2H-imidazol[1,2:1,6]pyrido[4,3-b][1,4]oxazine
[0665] ##STR00294##
[0666] A solution containing compound 111-B and compound 112-B (18.8 mg, 83.46 mol) in DMF (2 mL) was added with 1,2-dibromoethane (18.8 mg, 100.15 mol) and potassium carbonate (34.6 mg, 250.39 mol). The reaction was stirred at 100 C. for 12 hours of reaction. The target product and by-products were detected by LCMS. The reaction solution was diluted with water (10 mL), and extracted with ethyl acetate (10 mL2). The organic layers were combined, washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was subjected to silica gel column chromatography (eluted with dichloromethane containing 10% methanol) to obtain yellow oil compound 111 7-phenyl-3,4-dihydro-2H-imidazo[1,2:1,6]pyrido[4,3-b][1,4]oxazine (3.0 mg) and yellow oil compound 112 10-bromo-7-phenyl-3,4-dihydro-2H-imidazol[1,2:1,6]pyrido [4,3-b][1,4]oxazine (3.4 mg).
[0667] LC_MS: (ES): m/z 252.1 [M+H].sup.+.
[0668] LC_MS: (ES): m/z 330.0 [M+H].sup.+.
Example 26: Synthesis of Compound 113
[0669] ##STR00295##
Step 1: Compound 113-B 2-(2-(2-((3-(6-((tert-butoxycarbonyl)(methyl)amino)imidazo[1,2-a]pyridin-3-yl)phenyl)amino)-2-oxyethoxy)ethoxy)acetic acid
[0670] ##STR00296##
[0671] Compound 113-A (40 mg, 220 mol) was added to thionyl chloride (4 mL). The reaction solution was stirred at 60 C. for 2 hours until the solution was clear. The reaction solution was concentrated under reduced pressure, and dried. The residue was dissolved with dichloromethane (30 mL), and then added with compound 2 (25 mg, 74 mol) and triethylamine (52 L, 370 mol) at 0 C. The reaction solution was stirred at 0 C. for 3 hours of reaction. After the reaction was completed, the reaction solution was added with aqueous hydrochloric acid solution (30 mL, 0.1 N), and extracted with ethyl acetate (30 mL2). The combined organic layers were washed with saturated brine (30 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The residue was separated and purified by preparative thin-layer chromatography (eluent: dichloromethane solution containing 15% methanol) to obtain compound 113-B (20 mg) as a yellow solid.
[0672] LC_MS: (ES.sup.+): m/z 499.2 [M+H].sup.+.
Step 2: Compound 113 tert-butyl (3-(3-(2-(2-(2-((((S)-1-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)ethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0673] ##STR00297##
[0674] A solution containing compound 113-B (20 mg, 40 mol), compound 113-C (18 mg, 40 mol) and triethylamine (12 L, 80 mol) in dichloromethane was added with HATU (23 mg, 60 mol). The reaction mixture was stirred at room temperature for 9 hours of reaction. After the reaction was completed, the reaction solution was diluted with water (20 mL) and extracted with dichloromethane (20 mL2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated. The residue was separated and purified by preparative thin-layer chromatography (eluent: dichloromethane solution containing 8% methanol) to obtain compound 113 (15 mg) as a white solid.
[0675] LC_MS: (ES.sup.+): m/z 911.4 [M+H].sup.+.
Example 27: Synthesis of Compound 114
[0676] ##STR00298##
Step 1: Compound 114 (2S,4R)-1-((S)-3,3-dimethyl-2-(2-(2-(2-((3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)amino)-2-oxoethoxy)ethoxy)acetamido)butyryl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidin-2-carboxamide hydrochloride
[0677] ##STR00299##
[0678] Compound 113 (5 mg, 5.5 mol) was dissolved in dichloromethane (3 mL). The reaction solution was then added with a solution of hydrogen chloride in dioxane (1 mL, 4 M), and stirred at room temperature for 3 hours of reaction. After the reaction was completed, the reaction solution was concentrated under reduced pressure, and dried to obtain a yellow solid compound 114 (4 mg).
[0679] LC_MS: (ES.sup.+): m/z 811.3 [M+H].sup.+.
Example 28: Synthesis of Compound 115
[0680] ##STR00300##
Step 1: Compound 115-B 2-(2-(2-(2-((3-(6-((tert-butoxycarbonyl)(methyl)amino)imidazo[1,2-a]pyridin-3-yl)phenyl)amino)-2-oxoethoxy)ethoxy)ethoxy)acetic acid
[0681] ##STR00301##
[0682] The synthesis of this step was performed referring to the first step of the synthesis process of compound 113.
Step 2: Compound 115 tert-butyl (3-(3-(2-(2-(2-(2-((2-(2,6-dioxopiperidin-3-yl))-1-oxoisoindolin-4-yl)amino)-2-oxoethoxy)ethoxy)ethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl) carbamate
[0683] ##STR00302##
[0684] A solution containing compound 115-B (20 mg, 40 mol), compound 115-C (14 mg, 55 mol) and triethylamine (15 L, 111 mol) in acetonitrile (3 mL) was added with phosphorus oxychloride (7 L, 74 mol). The reaction mixture was stirred at room temperature for 4 hours of reaction. After the reaction was completed, the reaction solution was diluted with water (20 mL) and extracted with dichloromethane (20 mL2). The combined organic layers were washed with saturated brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated. The residue was separated and purified by preparative thin-layer chromatography (eluent: dichloromethane solution containing 10% methanol) to obtain compound 115 (5.0 mg) as a white solid.
[0685] LC_MS: (ES.sup.+): m/z 784.3 [M+H].sup.+.
Example 29: Synthesis of Compound 116
[0686] ##STR00303##
Step 1: Compound 116 ((((((2,2-(ethane-1,2-diylbis(oxy))bis(acetyl))bis(azadialkyl))bis(31-phenylene))bis(imidazo[1,2-a]pyridin-3,6-diyl))bis(tert butylmethylcarbamate)
[0687] ##STR00304##
[0688] Compound 116-A (40 mg, 220 mol) was added to thionyl chloride (4 mL). The reaction solution was stirred at 60 C. for 2 hours until the solution was clear. The reaction solution was concentrated under reduced pressure, and dried. The residue was dissolved with dichloromethane (30 mL), and then added with compound 2 (25 mg, 74 mol) and triethylamine (52 L, 370 mol) at 0 C. The reaction solution was stirred at 0 C. for 3 h of reaction. After the reaction was completed, the reaction solution was added with aqueous hydrochloric acid solution (30 mL, 0.1 N), and extracted with ethyl acetate (30 mL2). The combined organic layers were washed with saturated brine (30 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated. The residue was separated and purified by preparative thin-layer chromatography (eluent: dichloromethane solution containing 8% methanol) to obtain compound 116 (10 mg) as a white solid.
[0689] LC_MS: (ES.sup.+): m/z 819.4 [M+H].sup.+.
[0690] .sup.1H NMR (400 MHz, DMSO) 8.91 (s, 2H), 8.23 (d, J=82.5 Hz, 4H), 7.77 (d, J=19.8 Hz, 6H), 7.42 (t, J=7.9 Hz, 2H), 7.32 (d, J=9.4 Hz, 2H), 7.22 (s, 2H), 4.27 (s, 4H), 4.01 (s, 4H), 3.28 (d, J=6.1 Hz, 6H), 1.47 (s, 18H).
Synthesis of Compound 117
[0691] ##STR00305##
[0692] Step 1: The synthesis of compound 117-B was performed referring to the first step of the synthesis process of compound 113.
[0693] Step 2: The synthesis of compound 117 was performed referring to the second step of the synthesis process of compound 113.
(2S,4R)-1-((S)-12-(tert-butyl)-2-(3-(2-chlorophenyl)imidazo[1,2-a]pyridin-6-yl)-3,10-dioxo-5,8-dioxa-2,11-diazahexadecane-13-acyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidin-2-carboxamide
[0694] ##STR00306##
[0695] LC_MS: (ES.sup.+): m/z 830.3 [M+H].sup.+.
Synthesis of Compound 118
[0696] ##STR00307##
[0697] Step 1: The synthesis of compound 118-B was performed referring to the first step of the synthesis process of compound 113.
[0698] Step 2: The synthesis of compound 118 was performed referring to the second step of the synthesis process of compound 113.
(2S,4R)-1-((S)-15-(tert-butyl)-2-(3-(2-chlorophenyl)imidazo[1,2-a]pyridin-6-yl)-3,13-di oxo-5,8,11-trioxa-2,14-diazahexadecane-16-acyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl) pyrrolidin-2-carboxamide
[0699] ##STR00308##
[0700] LC_MS: (ES.sup.+): m/z 874.3 [M+H].sup.+.
Synthesis of Compound 119
[0701] ##STR00309##
[0702] Step 1: The synthesis of compound 119-B was performed referring to the first step of the synthesis process of compound 113.
[0703] Step 2: The synthesis of compound 119 was performed referring to the second step of the synthesis process of compound 113.
Tert-butyl (3-(3-((S)-13-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidin-1-carbonyl)-14,14-dimethyl-11-oxo-3,6,9-trioxa-12-azaglutaramide)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0704] ##STR00310##
[0705] LC_MS: (ES.sup.+): m/z 955.4 [M+H].sup.+.
Synthesis of Compound 120
[0706] ##STR00311##
[0707] Step 1: The synthesis of compound 120 was performed referring to the first step of the synthesis process of compound 114.
(2S,4R)-1-((S)-2-(tert-butyl)-14-((3-(6-(methylamino)imidazo[1,2-a]pyridin-3-yl)phenyl)amino)-4,14-dioxo-6,9,12-trioxa-3-azatetradecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidin-2-carboxamide hydrochloride
[0708] ##STR00312##
[0709] LC_MS: (ES.sup.+): m/z 855.3 [M+H].sup.+.
Synthesis of Compound 121
[0710] ##STR00313##
[0711] Step 1: The synthesis of compound 121 was performed referring to the first step of the synthesis process of compound 116.
((((2,2-((oxybis(ethane-2,1-diyl))bis(oxy))bis(acetyl))bis(azadiyl))bis(3,1-phylene))bis(imidazo[1,2-a]pyridin-3,6-diyl))bis(tert-butyl (methyl)carbamate)
[0712] ##STR00314##
[0713] LC_MS: (ES.sup.+): m/z 863.4 [M+H].sup.+.
[0714] .sup.1H NMR (400 MHz, DMSO) 8.89 (s, 2H), 8.32 (s, 5H), 7.74 (s, 5H), 7.45 (t, J=23.9 Hz, 4H), 7.26-7.21 (m, 2H), 4.12 (s, 4H), 3.82 (s, 8H), 3.26 (s, 6H), 1.43 (s, 18H).
Synthesis of Compound 122
[0715] ##STR00315##
[0716] Step 1: The synthesis of compound 122 was performed referring to the first step of the synthesis process of compound 116.
##STR00316##
[0717] LC_MS: (ES.sup.+): m/z 791.1 [M+H].sup.+.
Synthesis of Compound 123
[0718] ##STR00317##
[0719] Step 1: The synthesis of compound 123 was performed referring to the first step of the synthesis process of compound 116.
##STR00318##
[0720] LC_MS: (ES.sup.+): m/z 835.1 [M+H].sup.+.
Example 30: Synthesis of Compound 124 and Compound 125
[0721] ##STR00319##
Step 1: Compound 124 methyl 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophene-3-carboxylate
[0722] ##STR00320##
[0723] Under nitrogen protection, a solution containing intermediate BB5 tert-butyl (3-bromoimidazo[1,2-a]pyridin-6-yl)carbamate (30 mg, 0.096 mmol), compound 124-A methyl 5-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)thiophene-3-carboxylate (38.65 mg, 0.144 mmol), cesium carbonate (125.11 mg, 0.384 mmol), S-Phos (7.9 mg, 0.0192 mmol) and cuprous chloride (9.5 mg, 0.096 mmol) in N,N-dimethylformamide was added with palladium acetate (1.08 mg, 0.0048 mmol). The reaction system was replaced with nitrogen 3 times, heated to 100 C., and stirred for 18 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water (15 ml) and ethyl acetate (15 ml3). The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain a yellow solid compound 124 methyl 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophene-3-carboxylate (12 mg).
[0724] LC_MS: (ES.sup.+): m/z 374.0 [M+H].sup.+.
Step 2: Compound 125-A 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophene-3-carboxylic acid
[0725] ##STR00321##
[0726] A solution of compound 124 methyl 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophene-3-carboxylate (12 mg, 0.032 mmol) in methanol/water/tetrahydrofuran (1.5 ml, 1:1:1) was added with lithium hydroxide hydrate (6.71 mg, 0.16 mmol). The reaction solution was stirred at room temperature for 5 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was acidified with dilute hydrochloric acid and concentrated under reduced pressure to obtain yellow solid compound 125-A 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophene-3-carboxylic acid (10 mg, crude product). The crude product was directly used in the next reaction.
Step 3: Compound 125 tert-butyl (3-(4-((tetrahydro-2H-pyran-4-yl)carbamoyl)thiophen-2-yl)imidazo[1,2-a]pyridin-6-yl) carbamate
[0727] ##STR00322##
[0728] A solution containing compound 125-A 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophene-3-carboxylic acid (10 mg, 0.0278 mmol), compound 125-B tetrahydro-2H-pyran-4-amine (2.81 mg, 0.0278 mmol), HATU (10.56 mg, 0.0278 mmol) and N,N-diisopropylethylamine (10.76 mg, 0.0834 mmol) in N,N-dimethylformamide (1 ml) was stirred at room temperature for 18 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain yellow solid compound 125 tert-butyl (3-(4-((tetrahydro-2H-pyran-4-yl)carbamoyl)thiophen-2-yl)imidazo[1,2-a]pyridin-6-yl) carbamate (2.3 mg).
[0729] LC_MS: (ES.sup.+): m/z 443.1 [M+H].sup.+.
[0730] The following compounds were synthesized referring to the synthesis of compound 124 and compound 125.
Synthesis of Compound 126 and Compound 127
[0731] ##STR00323##
Step 1: Compound 126 ethyl 5-(6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-yl)thiophen-2-carboxylate
[0732] ##STR00324##
[0733] This step was performed referring to the first step of the synthesis process of compound 125.
[0734] LC_MS: (ES.sup.+): m/z 2.636 [M+H].sup.+.
[0735] Step 2: Compound 127-A was synthesized referring to the second step of the synthesis process of compound 125.
Step 3: Compound 127 tert-butyl (3-(5-((tetrahydro-2H-pyran-4-yl)carbamoyl)thiophen-2-yl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0736] ##STR00325##
[0737] This step was performed referring to the third step of the synthesis process of compound 125.
[0738] LC MS: (ES.sup.+): m/z 443.1 [M+H].sup.+.
Example 31: Synthesis of Compound 128 and Compound 129
[0739] ##STR00326##
Step 1: Compound 128 N-(3-(6-aminoimidazo[1,2-a]pyridin-3-yl)phenyl)-2-(2-methoxyethoxy)acetamide
[0740] ##STR00327##
[0741] A solution containing compound 58 tert-butyl (3-(3-(2-(2-methoxyethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)carbamate (200 mg, 0.454 mmol) in dichloromethane (4 ml) and trifluoroacetic acid (800 l) was stirred at room temperature for 5 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 4.76%-9.0% methanol) to obtain brown solid compound 128 N-(3-(6-aminoimidazo[1,2-a]pyridin-3-yl)phenyl)-2-(2-methoxyethoxy)acetamide (150 mg).
[0742] LC_MS: (ES.sup.+): m/z 341.1 [M+H].sup.+.
Step 2: Compound 129 N-(3-(3-(2-(2-methoxyethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)cyclopropanecarboxamide
[0743] ##STR00328##
[0744] A solution containing compound 128 N-(3-(6-aminoimidazo[1,2-a]pyridin-3-yl)phenyl)-2-(2-methoxyethoxy)acetamide (30 mg, 0.0881 mmol) and triethylamine (26.74 mg, 0.264 mmol) in dichloromethane (2 ml) was added with cyclopropaneformyl chloride (9.67 mg, 0.0925 mmol). The reaction solution was heated from 0 C. to room temperature and stirred for 18 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and dichloromethane. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The crude product obtained was separated and purified by preparative TLC (eluted with dichloromethane containing 4.76% methanol) to obtain yellow solid compound 129 N-(3-(3-(2-(2-methoxyethoxy)acetamido)phenyl)imidazo[1,2-a]pyridin-6-yl)cyclopropanecarboxamide (16 mg).
[0745] LC_MS: (ES.sup.+): m/z 409.0 [M+H].sup.+.
[0746] .sup.1H NMR (400 MHz, CDCl.sub.3) 9.29 (d, J=20.4 Hz, 2H), 9.15 (s, 1H), 7.90-7.75 (m, 2H), 7.71 (s, 1H), 7.61 (d, J=8.2 Hz, 1H), 7.47 (dd, J=13.6, 5.7 Hz, 2H), 7.31 (s, 1H), 4.15 (s, 2H), 3.82-3.78 (m, 2H), 3.66-3.62 (m, 2H), 3.46 (s, 3H), 1.82 (dd, J=8.0, 3.7 Hz, 1H), 1.03-0.97 (m, 2H), 0.84 (dd, J=7.6, 3.1 Hz, 2H).
[0747] The following compounds were synthesized referring to the synthesis of compound 129
Synthesis of Compound 130
[0748] ##STR00329##
[0749] Step 1: The synthesis of compound 130 was performed referring to the second step of the synthesis process of compound 129.
##STR00330##
[0750] LC_MS: (ES.sup.+): m/z 425.1 [M+H].sup.+.
[0751] .sup.1H NMR (400 MHz, DMSO) 9.85 (s, 1H), 9.41 (s, 1H), 9.26 (s, 1H), 7.87 (t, J=1.7 Hz, 1H), 7.79 (d, J=8.2 Hz, 1H), 7.68 (d, J=8.5 Hz, 2H), 7.56 (dd, J=14.0, 6.2 Hz, 2H), 7.35 (d, J=7.8 Hz, 1H), 4.12 (s, 2H), 3.72-3.68 (m, 2H), 3.56-3.53 (m, 2H), 3.30 (s, 3H), 1.23 (s, 9H).
Synthesis of Compound 131
[0752] ##STR00331##
[0753] Step 1: The synthesis of compound 131 was performed referring to the second step of the synthesis process of compound 129.
##STR00332##
[0754] LC_MS: (ES.sup.+): m/z 413.1 [M+H].
[0755] .sup.1H NMR (400 MHz, DMSO) 10.04 (s, 1H), 9.84 (s, 1H), 9.30 (s, 1H), 7.89 (t, J=1.7 Hz, 1H), 7.80-7.76 (m, 1H), 7.71 (d, J=8.1 Hz, 2H), 7.60-7.51 (m, 2H), 7.36 (d, J=7.9 Hz, 1H), 4.12 (s, 2H), 4.03 (s, 2H), 3.71-3.68 (m, 2H), 3.56-3.53 (m, 2H), 3.39 (s, 3H), 3.30 (s, 3H).
Example 32: Synthesis of Compound 132, Compound 133 and Compound 134
[0756] ##STR00333##
[0757] Step 1: The synthesis of compound 132-A was performed referring to the fifth step of the synthesis process of intermediate BB-6.
[0758] Step 2: The synthesis of compound 132-C was performed referring to the first step of the synthesis process of compound 2.
[0759] Step 3: Compound 132 3-(6-((tert-butoxycarbonyl)(methyl)amino)imidazo[1,2-a]pyridin-3-yl)benzoic acid
##STR00334##
[0760] A solution containing compound 132-C methyl 3-(6-((tert-butoxycarbonyl)(methyl)amino)imidazo[1,2-a]pyridin-3-yl)benzoate (148 mg, 0.388 mmol) in methanol (3 ml) was added with a solution of sodium hydroxide (46.56 mg, 1.164 mmol) in water (1 ml). The reaction mixture was stirred at room temperature for 4 hours of reaction. The reaction was monitored by TLC to be completed. The pH of the reaction solution was adjusted to 5-6 with dilute hydrochloric acid, and the reaction mixture was concentrated under reduced pressure to obtain brown solid compound 132 3-(6-((tert-butoxycarbonyl)(methyl)amino)imidazo[1,2-a]pyridin-3-yl)benzoic acid (138 mg, crude product), which was directly used in the next reaction.
[0761] LC_MS: (ES.sup.+): m/z 368.0 [M+H].sup.+.
Step 4: Compound 133 tert-butyl (3-(3-((2-(2-methoxyethoxy)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0762] ##STR00335##
[0763] A solution containing compound 132 3-(6-((tert-butoxycarbonyl)(methyl)amino)imidazo[1,2-a]pyridin-3-yl)benzoic acid (50 mg, 0.136 mmol), compound 133-A 2-(2-methoxyethoxy)eth-1-amine (16.2 mg, 0.136 mmol) and 2-(7-azobenzotriazole)-N,N,N,N-tetramethylurea hexafluorophosphate (51.68 mg, 0.136 mmol) in N,N-dimethylformamide (1 ml) was added with N,N-diisopropylethylamine (52.63 mg, 0.408 mmol). The reaction mixture was stirred at room temperature for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was extracted with water and ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 8.33% methanol) to obtain yellow gel compound 133 tert-butyl (3-(3-((2-(2-methoxyethoxy)ethyl)carbamoyl)phenyl)imidazo[1,2-a]pyridin-6-yl) (methyl)carbamate (44 mg).
[0764] LC_MS: (ES.sup.+): m/z 469.1 [M+H].sup.+.
[0765] Step 5: The synthesis of compound 134 was performed referring to the synthesis process of compound 63.
##STR00336##
[0766] LC_MS: (ES) m/z 369.1 [M+H].sup.+.
[0767] The following compounds were synthesized referring to the synthesis of compound 134
Synthesis of Compound 135 and Compound 136
[0768] ##STR00337##
[0769] Step 1: The synthesis of compound 135 was performed referring to the fourth step of the synthesis process of compound 134.
##STR00338##
[0770] LC_MS: (ES.sup.+): m/z 451.1 [M+H].sup.+.
[0771] Step 2: The synthesis of compound 136 was performed referring to the fifth step of the synthesis process of compound 134.
##STR00339##
[0772] LC_MS: (ES.sup.+): m/z 351.0 [M+H].sup.+.
[0773] .sup.1H NMR (400 MHz, CDCl.sub.3) 7.98 (s, 2H), 7.86 (d, J=7.1 Hz, 1H), 7.66 (s, 2H), 7.58 (t, J=7.7 Hz, 1H), 7.35 (s, 1H), 6.95 (s, 1H), 4.28-4.17 (m, 1H), 4.02 (d, J=10.6 Hz, 2H), 3.58-3.49 (m, 2H), 2.75 (s, 3H), 2.07-1.96 (m, 2H), 1.68-1.60 (m, 2H).
Example 33: Synthesis of Compound 137
[0774] ##STR00340##
Step 1: Compound 137-B ethyl 6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-carboxylate
[0775] ##STR00341##
[0776] A suspension containing compound 137-A ethyl 6-bromoimidazo[1,2-a]pyridin-3-carboxylate (1 g, 3.37 mmol), tert-butyl carbamate (592 mg, 5.06 mmol), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (390 mg, 0.67 mmol) and cesium carbonate (3.3 g, 10.11 mmol) in 1,4-dioxane (1 ml) was added with tris(dibenzylideneacetone)dipalladium (309 mg, 0.34 mmol) under a nitrogen atmosphere at room temperature. The reaction solution was replaced with nitrogen three times, and stirred at 110 C. for 16 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was cooled to room temperature and partitioned between water (20 ml) and ethyl acetate (20 ml). The organic layer was collected and the aqueous layer was extracted with dichloromethane containing 10% methanol (10 ml3). The organic layers were combined, washed with saturated brine (30 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified by Prep-TLC (eluted with dichloromethane containing 0.8% methanol) to obtain a light yellow solid compound 137-B ethyl 6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-carboxylate (600 mg, 52%).
[0777] LC_MS: (ES.sup.+): m/z 306.6 [M+H].sup.+.
[0778] .sup.1H NMR (400 MHz, CDCl.sub.3): 1.42 (t, J=7.2 Hz, 3H), 1.54 (s, 9H), 4.39-4.44 (m, 2H), 6.60 (s, 1H), 7.36-7.38 (m, 1H), 7.66 (d, J=9.6 Hz, 1H), 8.26 (s, 1H), 9.67 (s, 1H).
Step 2: Compound 137-C 6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-carboxylic acid
[0779] ##STR00342##
[0780] A mixed solution containing compound 137-B ethyl 6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-carboxylate (600 mg, 1.97 mmol) and lithium hydroxide monohydrate (248 mg, 5.90 mmol) in tetrahydrofuran (4 ml)-water (1 ml)-methanol (1 ml) was stirred at room temperature for 4 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was acidified to pH 5-6 with 1N hydrochloric acid, and extracted with dichloromethane containing 10% methanol (20 ml5). The organic layers were combined, washed with saturated brine (30 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain crude white solid compound 137-C 6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-carboxylic acid (300 mg, 55%), which was used in the next step without further purification.
[0781] LC_MS: (ES.sup.+): m/z 278.4 [M+H].sup.+.
[0782] .sup.1H NMR (400 MHz, DMSO-d6): 1.50 (s, 9H), 7.38-7.41 (m, 1H), 7.62 (d, J=9.2 Hz, 1H), 8.02 (s, 1H), 9.55 (s, 1H), 9.86 (s, 1H).
Step 3: Compound 137 di-tert-butyl (3,3-((ethane-1,2-diylbis(azadiyl))bis(carbonyl)) bis(imidazo[1,2-a]pyridin-6,3-diyl))dicarbamate
[0783] ##STR00343##
[0784] A solution containing compound 137-C 6-((tert-butoxycarbonyl)amino)imidazo[1,2-a]pyridin-3-carboxylic acid (20 mg, 0.072 mmol), ethane-1,2-diamine (2.17 mg, 0.036 mmol) and N-ethyl-N-isopropylpropan-2-amine (14 mg, 0.108 mmol) in DMF (1 mL) was added with HATU (42 mg, 0.11 mmol). The reaction solution was warmed to room temperature, and stirred for 30 minutes of reaction. The reaction was monitored by TLC to be completed. The mixture was partitioned between ethyl acetate (10 ml) and water (10 ml). The organic layer was collected, washed with saturated brine (10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting crude product was separated and purified to preparative TLC (eluted with dichloromethane (50%)-ethyl acetate (50%) containing 10% ammonia methanol) was separated and purified to obtain white solid compound 137 di-tert-butyl (3,3-((ethane-1,2-diylbis(azadiyl))bis(carbonyl))bis(imidazo[1,2-a]pyridin-6,3-diyl))dicarbamate (8.7 mg, 42%).
[0785] LC_MS: (ES.sup.+): m/z 579.3 [M+H].sup.+.
[0786] .sup.1H NMR (400 MHz, DMSO-d6): 1.50 (s, 18H), 3.47-3.48 (m, 4H), 7.38-7.40 (m, 2H), 7.61-7.64 (m, 2H), 8.26 (s, 2H), 8.58-8.60 (m, 2H), 9.55 (s, 2H), 9.98 (s, 2H)
[0787] Using the corresponding amine compound, the following compounds were synthesized referring to the synthesis of compound 137
Synthesis of Compound 138
[0788] ##STR00344##
[0789] Step 1: The synthesis of compound 138 was performed referring to the third step of the synthesis process of compound 137.
##STR00345##
[0790] LC_MS: (ES.sup.+): m/z 781.6 [M+H].sup.+.
[0791] .sup.1H NMR (400 MHz, DMSO-d6): 1.49 (s, 18H), 3.29 (s, 4H), 3.34-3.36 (m, 4H), 3.60 (s, 4H), 3.88 (s, 4H), 7.36-7.38 (m, 2H), 7.60-7.62 (d, J=9.6 Hz, 2H), 7.91 (t, J=5.6 Hz, 2H), 8.21 (s, 2H), 8.45 (t, J=5.2 Hz, 2H), 9.53 (s, 2H), 9.95 (s, 2H).
Synthesis of Compound 139
[0792] ##STR00346##
[0793] Step 1: The synthesis of compound 139 was performed referring to the third step of the synthesis process of compound 137.
##STR00347##
[0794] LC_MS: (ES.sup.+): m/z 667.2 [M+H].sup.+.
[0795] .sup.1HNMR (400 MHz, DMSO-d6): 1.49 (s, 18H), 3.40-3.44 (m, 4H), 3.54-3.58 (m, 8H), 7.35-7.38 (m, 2H), 7.61 (d, J=9.6 Hz, 2H), 8.26 (s, 2H), 8.47 (t, J=5.2 Hz, 2H), 9.54 (s, 2H), 9.97 (s, 2H).
Synthesis of Compound 140
[0796] ##STR00348##
[0797] Step 1: The synthesis of compound 140 was performed referring to the third step of the synthesis process of compound 137.
##STR00349##
[0798] LC_MS: (ES.sup.+): m/z 695.2 [M+H].sup.+.
[0799] .sup.1H NMR (400 MHz, DMSO-d6): 1.49 (s, 18H), 1.74-1.81 (m, 4H), 3.29 (s, 2H), 3.34 (brs, 2H), 3.47-3.53 (m, 8H), 7.36 (d, J=9.6 Hz, 2H), 7.61 (d, J=9.6 Hz, 2H), 8.22 (s, 2H), 8.36 (t, J=5.6 Hz, 2H), 9.52 (s, 2H), 9.56 (s, 2H).
Synthesis of Compound 141
[0800] ##STR00350##
[0801] Step 1: The synthesis of compound 141 was performed referring to the third step of the synthesis process of compound 137.
##STR00351##
[0802] LC_MS: (ES.sup.+): m/z 623.6 [M+H].sup.+.
[0803] .sup.1H NMR (400 MHz, DMSO-d6): 1.49 (s, 18H), 3.45-3.49 (m, 4H), 3.61 (t, J=5.8 Hz, 4H), 7.37-7.40 (m, 2H), 7.61 (d, J=9.6 Hz, 2H), 8.26 (s, 2H), 8.46 (t, J=5.6 Hz, 2H), 9.54 (s, 2H), 9.96 (s, 2H).
Example 34: Synthesis of Compound 142
[0804] ##STR00352##
Step 1: Compound 142-B N-methylimidazo[1,2-a]pyridin-6-amine
[0805] ##STR00353##
[0806] A solution containing compound 142-A 6-bromoimidazo[1,2-a]pyridine (50 mg, 0.25 mmol), (R)-1-[(S)-2-(dicyclohexylphosphino)ferrocenyl]ethyl tert-butylphosphine (cas:158923-11-6)(14 mg, 0.025 mmol), bis[tris(2-methylphenyl)phosphine]palladium (cas:69861-71-8)(18 mg, 0.025 mmol) and sodium tert-butoxide (328 mg, 3.3 mmol) in 1,4-dioxane was replaced with nitrogen three times, and then added with methylamine hydrochloride (171 mg, 2.5 mmol) rapidly. The reaction solution was sealed and stirred at 100 C. for 24 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was partitioned between ethyl acetate (20 ml) and water (20 ml). The organic layer was collected, washed with saturated brine (10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 5% methanol) to obtain a gray oil compound 142-B N-methylimidazo[1,2-a]pyridin-6-amine (17 mg, 45%).
[0807] LC_MS: (ES.sup.+): m/z 148.1 [M+H].sup.+.
Step 2: Compound 142-C 2,2,2-trifluoro-N-(imidazo[1,2-a]pyridin-6-yl)-N-methylacetamide
[0808] ##STR00354##
[0809] A solution containing compound 142-B N-methylimidazo[1,2-a]pyridin-6-amine (50 mg, 0.34 mmol), triethylamine (114 mg, 1.12 mmol) and N,N-dimethylpyridin-4-amine (4 mg, 0.034 mmol) in dichloromethane (1 ml) was added with trifluoroacetic anhydride (86 mg, 0.41 mmol) dropwise at 0 C. The reaction solution was warmed to room temperature and stirred for 15 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was partitioned between dichloromethane (10 ml) and water (10 ml). The organic layer was collected, washed with saturated brine (10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 3% methanol) to obtain a yellow oil compound 142-C 2,2,2-trifluoro-N-(imidazo[1,2-a]pyridin-6-yl)-N-methylacetamide (33 mg, 40%).
[0810] LC_MS: (ES.sup.+): m/z 244.10 [M+H].sup.+.
Step 3: Compound 142-D 2,2,2-trifluoro-N-methyl-N-(3-nitroimidazo[1,2-a]pyridin-6-yl)acetamide
[0811] ##STR00355##
[0812] A solution containing compound 142-C 2,2,2-trifluoro-N-(imidazo[1,2-a]pyridin-6-yl)-N-methylacetamide (33 mg, 0.14 mmol) in concentrated sulfuric acid (1 ml) was added with concentrated nitric acid (9 mg, 0.14 mmol) under stirring at 0 C. The reaction mixture was warmed to room temperature and stirred for 1 hour of reaction. The reaction was monitored by TLC to be completed. The reaction solution was basified to pH=7 with saturated aqueous sodium carbonate solution, and then partitioned between ethyl acetate (10 ml) and water (10 ml). The organic layer was collected, washed with saturated brine (10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain a yellow solid crude compound 142-D 2,2,2-trifluoro-N-methyl-N-(3-nitroimidazo[1,2-a]pyridin-6-yl)acetamide (30 mg, 76%), which was used directly in the next step without further purification.
[0813] LC_MS: (ES.sup.+): m/z 288.95 [M+H].sup.+.
Step 4: Compound 142-E N-(3-aminoimidazo[1,2-a]pyridin-6-yl)-2,2,2-trifluoro-N-methylacetamide
[0814] ##STR00356##
[0815] A solution containing palladium carbon (20%, 6 mg) and compound 142-D 2,2,2-trifluoro-N-methyl-N-(3-nitroimidazo[1,2-a]pyridin-6-yl)acetamide (30 mg, 0.1 mmol) in methanol (15 ml) was stirred under a hydrogen atmosphere (hydrogen balloon) at room temperature for reaction overnight. The reaction was monitored by TLC to be completed. The reaction mixture was filtered to remove palladium carbon, and rinsed with ethanol (5 ml2). The filtrates were combined and concentrated under reduced pressure. The obtained crude product was separated and purified by preparative TLC (eluted with dichloromethane containing 5% methanol) to obtain a brown oil compound 142-E N-(3-aminoimidazo[1,2-a]pyridin-6-yl)-2,2,2-trifluoro-N-methylacetamide (8 mg, 30%).
[0816] LC_MS: (ES.sup.+): m/z 259.10 [M+H].sup.+.
Step 5: Compound 142 N,N-(3,3-((2,2-((oxybis(ethane-2,1-diyl))bis(oxy))bis (acetyl))bis(azadialkyl))bis(imidazo[1,2-a]pyridin-6,3-diyl))bis(2,2,2-trifluoro-N-methylacetamide)
[0817] ##STR00357##
[0818] The synthesis of this step was performed referring to Example 29, the synthesis procedure of compound 123.
[0819] LC_MS: (ES.sup.+): m/z 703.50 [M+H].sup.+.
[0820] .sup.1H NMR (400 MHz, CDCl.sub.3): 3.37 (s, 6H), 3.79-3.80 (m, 8H), 4.04-4.18 (m, 4H), 7.10-7.13 (m, 2H), 7.57-7.69 (m, 4H), 7.93-8.01 (m, 2H), 8.88-9.07 (m, 2H).
[0821] The following compounds were synthesized referring to the corresponding routes described in compound 2, intermediate BB5 or BB6:
##STR00358##
[0822] Compound 143
##STR00359##
[0823] LC_MS: (ES.sup.+): m/z 373.9 [M+H].sup.+.
[0824] .sup.1H NMR (400 MHz, DMSO) 8.14 (s, 1H), 7.70 (s, 1H), 7.59 (d, J=9.2 Hz, 1H), 7.52 (t, J=5.9 Hz, 1H), 7.24 (dd, J=9.2, 1.5 Hz, 1H), 4.22 (d, J=6.0 Hz, 2H), 3.17 (d, J=4.9 Hz, 1H), 1.41 (s, 9H).
[0825] Compound 144
##STR00360##
[0826] LC_MS: (ES.sup.+): m/z 339.1 [M+H].sup.+.
[0827] Compound 145
##STR00361##
[0828] LC_MS: (ES.sup.+): m/z 455.1 [M+H].sup.+.
[0829] Compound 146
##STR00362##
[0830] LC_MS: (ES.sup.+): m/z 439.1 [M+H].sup.+.
[0831] Compound 147
##STR00363##
[0832] LC_MS: (ES.sup.+): m/z 466.1 [M+H].sup.+.
[0833] .sup.1H NMR (400 MHz, DMSO) 9.92 (s, 1H), 8.52 (d, J=1.2 Hz, 1H), 7.94 (t, J=1.7 Hz, 1H), 7.78 (s, 1H), 7.73-7.64 (m, 2H), 7.50 (t, J=7.9 Hz, 1H), 7.34 (ddd, J=11.4, 8.8, 4.2 Hz, 2H), 3.67-3.61 (m, 4H), 3.22 (s, 3H), 3.17 (s, 2H), 2.55-2.51 (m, 4H), 1.37 (s, 9H).
[0834] Compound 148
##STR00364##
[0835] LC_MS: (ES.sup.+): m/z 466.2 [M+H].sup.+.
[0836] Compound 149
##STR00365##
[0837] LC_MS: (ES.sup.+): m/z 437.2 [M+H].sup.+.
[0838] .sup.1H NMR (400 MHz, DMSO) 10.22 (s, 1H), 8.50 (s, 1H), 7.92 (s, 1H), 7.77 (s, 1H), 7.65 (dd, J=17.5, 8.6 Hz, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.34 (d, J=8.0 Hz, 2H), 3.96 (t, J=8.1 Hz, 1H), 3.74 (dq, J=15.3, 7.5 Hz, 3H), 3.22 (s, 3H), 3.17 (d, J=7.2 Hz, 1H), 2.10 (dd, J=14.2, 7.0 Hz, 2H), 1.37 (s, 9H).
[0839] Compound 150
##STR00366##
[0840] LC_MS: (ES.sup.+): m/z 423.1 [M+H].sup.+.
[0841] .sup.1H NMR (400 MHz, DMSO) 10.13 (s, 1H), 8.51 (s, 1H), 7.94 (s, 1H), 7.78 (s, 1H), 7.65 (dd, J=12.4, 9.2 Hz, 2H), 7.51 (t, J=7.9 Hz, 1H), 7.35 (t, J=7.6 Hz, 2H), 4.75-4.69 (m, 4H), 4.03-3.95 (m, 1H), 3.22 (s, 3H), 1.38 (s, 9H).
[0842] Compound 151
##STR00367##
[0843] LC_MS: (ES.sup.+): m/z 467.2 [M+H].sup.+.
Example 35: Synthesis of Compound 152
[0844] ##STR00368##
[0845] A solution containing compound 2 (30 mg, 88.65 mol) and N,N-diisopropylethylamine (22.9 mg, 177.3 mol) in dichloromethane (3 mL) was added with triphosgene (8.7 mg, 29.25 mol) at 0 C. After stirring for 30 minutes, the reaction solution was added with a solution containing compound 152-A (23.2 mg, 265.95 mol) and N,N-diisopropylethylamine (34.4 mg, 265.95 mol) in dichloromethane (2 mL), and heated to room temperature for 12 hours of reaction. The reaction was monitored by LCMS to be completed. The reaction solution was diluted with water (10 mL), and extracted with dichloromethane (10 mL2). The organic layers were combined, washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was separated and purified by Prep-TLC (eluted with dichloromethane containing 10% methanol) to obtain compound 152 (16.8 mg) as a yellow solid.
[0846] LC_MS: (ES.sup.+): m/z 452.1 [M+H].sup.+.
Example 36: Synthesis of Compound 153
[0847] ##STR00369##
[0848] Step 1: The synthesis of compound 153-B was performed referring to the first step of the synthesis process of compound 2.
Step 2: Compound 153-D tert-butyl(3-(3-(2-(2-methoxyethoxy)ethoxy)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0849] ##STR00370##
[0850] A solution containing compound 153-B (50 mg, 0.15 mmol), compound 153-C (27 mg, 0.15 mmol), potassium carbonate (61 mg, 0.44 mmol) and potassium iodide (3 mg, 0.015 mmol) in anhydrous N,N-dimethylformamide (2 ml) was stirred at 50 C. for 15 hours of reaction. The reaction was monitored by TLC to be completed. The reaction solution was partitioned between ethyl acetate (20 mL) and water (20 mL). The organic layer was collected, washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by Prep-HPLC to obtain a colorless oil compound 153-D tert-butyl(3-(3-(2-(2-methoxyethoxy)ethoxy)phenyl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (36 mg).
[0851] LC_MS: (ES.sup.+): m/z 442.60 [M+H].sup.+.
[0852] .sup.1H NMR (400 MHz, CDCl.sub.3): 1.46 (s, 9H), 3.27 (s, 3H), 3.39 (s, 3H), 3.57-3.60 (m, 2H), 3.72-3.75 (m, 2H), 3.90 (t, J=4.8 Hz, 2H), 4.22 (t, J=4.8 Hz, 2H), 7.03-7.06 (m, 1H), 7.10-7.13 (m, 2H), 7.38 (d, J=9.6 Hz, 1H), 7.47 (t, J=4.0 Hz, 1H), 7.75 (s, 1H), 7.94 (d, J=12.4 Hz, 1H), 8.34 (s, 1H).
[0853] Step 3: The synthesis of compound 153 was performed referring to the first step of the synthesis method of compound 63.
##STR00371##
[0854] LC_MS: (ES.sup.+): m/z 342.30 [M+H].sup.+.
[0855] .sup.1H NMR (400 MHz, CD.sub.3OD): 2.73 (s, 3H), 3.36 (s, 3H), 3.56-3.58 (m, 2H), 3.70-3.72 (m, 2H), 3.86-3.88 (m, 2H), 4.20-4.22 (m, 2H), 7.06-7.12 (m, 2H), 7.20-7.23 (m, 2H), 7.46-7.51 (m, 2H), 7.58 (s, 1H), 7.66 (d, J=9.6 Hz, 1H).
[0856] The synthesis of compound 154 was performed referring to the second step (using compound 154-B) and the third step of the synthetic route of compound 153:
##STR00372##
[0857] LC_MS: (ES.sup.+): m/z 338.65 [M+H].sup.+.
[0858] .sup.1H NMR (400 MHz, CDCl.sub.3): 1.42-1.53 (m, 2H), 1.76-1.79 (m, 2H), 2.05-2.14 (m, 1H), 2.76 (s, 3H), 3.42-3.48 (m, 2H), 3.85 (d, J=6.4 Hz, 2H), 4.01-4.04 (m, 2H), 6.92-6.98 (m, 2H), 7.05 (s, 1H), 7.13 (d, J=7.2 Hz, 1H), 7.39-7.42 (m, 2H), 7.64 (s, 1H), 8.12 (brs, 1H).
[0859] The following compounds were synthesized referring to the synthetic route of compound 153 in Example 36 using corresponding reagents:
##STR00373##
TABLE-US-00001 Number Structural formula Mass spectrometry and NMR Compound 155
Example 37: Synthetic Route of Compound 158 and Compound 159
[0860] ##STR00377##
Step 1: Compound 158 tert-butyl methyl (3-(3-(N-methyltetrahydro-2H-pyran-4-carboxamido)phenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0861] ##STR00378##
[0862] A solution of compound 49 (200.00 mg, 443.91 mol) in DMF (10 ml) was added with sodium hydride (19.53 mg, 488.30 mol, 60%) and methyl iodide (75.61 mg, 532.70 mol) under a nitrogen atmosphere at 0 C. The reaction solution was stirred at 0 C. for 1 hour of reaction. The reaction was monitored by TLC to be completed. The reaction solution was poured into saturated ammonium chloride solution (20 mL), and extracted with ethyl acetate (15 mL2). The organic phases were combined, washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluent: dichloromethane solution containing 0%-5% methanol) to obtain white solid compound 158 tert-butyl methyl (3-(3-(N-methyltetrahydro-2H-pyran-4-carboxamido)phenyl)imidazo[1,2-a]pyridin-6-yl)carbamate (150 mg).
[0863] LC_MS: (ES): m/z 465.24 [M+H].sup.+.
[0864] Step 2: The synthesis of compound 159 was performed referring to the first step of the synthesis process of Example 6.
##STR00379##
[0865] LC_MS: (ES.sup.+): m/z 365.19 [M+H].sup.+.
[0866] Compound 160 was synthesized referring to the synthetic route of compound 158 in Example 37, using corresponding reagents:
##STR00380##
[0867] LC_MS: (ES.sup.+): m/z 481.24 [M+H].sup.+.
Example 38: Synthetic Routes of Compound 161 and Compound 162
[0868] ##STR00381##
Step 1: Compound 161-B tert-butyl (3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0869] ##STR00382##
[0870] A solution containing compound 61-E tert-butyl (3-iodoimidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (300 mg, 0.8 mmol) and compound 161-A 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborane (225 mg, 1.2 mmol) in anhydrous tetrahydrofuran (10 ml) was slowly added with isopropyl magnesium chloride lithium chloride complex (0.75 ml, 0.96 mmol, 1.3 N in tetrahydrofuran) dropwise. The reaction mixture was stirred at 0 C. for 2 hours of reaction. The reaction was monitored by TLC to be completed. The reaction was quenched with saturated ammonium chloride solution (30 ml). The reaction solution was extracted with ethyl acetate (30 ml). The organic layer was collected, washed with saturated brine (20 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain light red solid compound 161-B tert-butyl (3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-a]pyridin-6-yl)carbamate (285 mg, crude product).
[0871] LC_MS: (ES.sup.+): m/z 291.8 [M+H].sup.+.
Step 2: Compound 161 tert-butyl (3-(1H-pyrrolo[2,3-c]pyridin-5-yl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0872] ##STR00383##
[0873] A suspension containing compound 161-C 5-bromo-1H-pyrrolo[2,3-c]pyridine (100 mg, 0.508 mmol), compound 161-B tert-butyl (3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-a]pyridin-6-yl)carbamate (284.2 mg, 0.761 mmol, crude product) and sodium carbonate (1N, 1.52 ml, 1.52 mmol) in acetonitrile (5 ml) and water (1 ml) was added with tetrakis(triphenylphosphine)palladium (58.7 mg, 50.75 mol). The reaction mixture was replaced with nitrogen three times, and stirred at 90 C. for 16 hours of reaction. The reaction was monitored by TLC to be completed. The reaction mixture was partitioned between ethyl acetate (20 ml) and water (10 ml). The organic layer was collected, washed with saturated brine (20 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 1% methanol) to obtain compound 161 tert-butyl (3-(1H-pyrrolo[2,3-c]pyridin-5-yl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate (50 mg).
[0874] LC_MS: (ES.sup.+): m/z 364.2 [M+H].sup.+
Step 3: Compound 162 N-methyl-3-(1H-pyrrolo[2,3-c]pyridin-5-yl)imidazo[1,2-a]pyridin-6-amine
[0875] ##STR00384##
[0876] The synthesis of this step was performed referring to the first step of the synthesis process of Example 6.
[0877] LC_MS: (ES.sup.+): m/z 264.1 [M+H].sup.+
[0878] The following compounds were synthesized referring to the synthetic procedure of compound 161 and compound 162 in Example 38, using corresponding reagents:
##STR00385##
TABLE-US-00002 Number Structural formula Mass spectrometry and NMR Compound 163
Example 39 Synthetic Route of Compound 201 and Compound 202
[0879] ##STR00424##
Step 1: Compound 201-C 6-(1H-pyrazol-1-yl)imidazo[1,2-a]pyridine
[0880] ##STR00425##
[0881] A solution containing compound 201-A 6-iodoimidazo[1,2-a]pyridine (1.0 g, 4.10 mmol) and compound 201-B pyrazole (418.5 mg, 6.15 mmol) in 1,4-dioxane (20 mL) was added with cuprous iodide (78.04 mg, 409.78 mol), tripotassium phosphate (78.04 mg, 409.78 mol) and N1,N2-dimethyl transcyclohexane-1,2-diamine (58.29 mg, 409.78 mol) at room temperature. The reaction mixture was replaced with nitrogen three times, and stirred at 110 C. for 12 h of reaction. The reaction was monitored by TLC to be completed. The reaction solution was filtered through diatomite and concentrated under reduced pressure. The crude product obtained was separated and purified by silica gel column chromatography (eluted with dichloromethane containing 0-10% methanol) to obtain compound 201-C 6-(1H-pyrazol-1-yl)imidazo[1,2-a]pyridine (500 mg).
[0882] LC_MS: (ES.sup.+): m/z 185.07[M+H].sup.+
Step 2: Compound 201 3-iodo-6-(1H-pyrazol-1-yl)imidazo[1,2-a]pyridine
[0883] ##STR00426##
[0884] The synthesis of this step was performed referring to the fourth step of the synthesis process of intermediate BB5.
[0885] LC_MS: (ES.sup.+): m/z 310.97[M+H].sup.+
[0886] .sup.1H NMR (400 MHz, DMSO) 8.71 (d, J=1.4 Hz, 1H), 8.65 (d, J=2.4 Hz, 1H), 7.92 (dd, J=9.7, 2.0 Hz, 1H), 7.85-7.78 (m, 3H), 6.62 (dd, J=5.6, 3.4 Hz, 1H).
Step 3: Compound 202 3-(1H-indol-4-yl)-6-(1H-pyrazol-1-yl)imidazo[1,2-a]pyridine
[0887] ##STR00427##
[0888] The synthesis of this step was performed referring to the synthesis process of compound 2 in Example 2.
[0889] LC_MS: (ES.sup.+): m/z 300.12[M+H].sup.+.
[0890] The following compounds were synthesized referring to the synthetic procedure of compound 201 and compound 202 in Example 39, using corresponding reagents:
##STR00428##
TABLE-US-00003 Number Structural formula Mass spectrometry and NMR Compound 203
Example 40: Synthetic Route of Compound 208 and Compound 209
[0891] ##STR00434##
Step 1: Compound 208-C tert-butyl (3-(1H-pyrrolo[2,3-c]pyridin-4-yl)imidazo[1,2-a]pyridin-6-yl)(methyl)carbamate
[0892] ##STR00435##
[0893] The synthesis of this step was performed referring to the second step of the synthesis process of Compound 161 and Compound 162 in Example 38.
[0894] LC_MS: (ES.sup.+): m/z 364.17[M+H].sup.+.
Step 2: Compound 208 tert-butyl (3-(3-iodo-1H-pyrrolo[2,3-c]pyridin-4-yl)imidazo[1,2-a]pyridin-6-yl)(methyl) carbamate
[0895] ##STR00436##
[0896] The synthesis of this step was performed referring to the fourth step of the synthesis process of intermediate BB5.
[0897] LC_MS: (ES.sup.+): m/z 490.07[M+H].sup.+.
Step 3: Compound 209 (3-(3-iodo-1H-pyrrolo[2,3-c]pyridin-4-yl)-N-methylimidazo[1,2-a]pyridin-6-amine
[0898] ##STR00437##
[0899] The synthesis of this step was performed referring to the first step of the synthesis method of Example 6.
[0900] LC_MS: (ES.sup.+): m/z 390.01[M+H].sup.+.
[0901] Compound 210 3-(3-iodo-1H-indazol-7-yl)-N-methylimidazol[1,2-a]pyridin-6-amine hydrochloride was synthesized referring to the synthesis of compound 209 in Example 40, using corresponding reagents:
##STR00438##
[0902] LC_MS: (ES): m/z 390.01[M+H].sup.+.
Example 41: Synthetic Route of Compound 211 Compound 212, and Compound 213
[0903] ##STR00439##
Step 1: Compound 211-C tert-butyl allyl(3-iodoimidazo[1,2-a]pyridin-6-yl)carbamate
[0904] ##STR00440##
[0905] The synthesis of this step was performed referring to the fifth step of the synthesis process of intermediate BB6.
[0906] LC_MS: (ES.sup.+): m/z 400.04[M+H].sup.+.
Step 2: Compound 211 tert-butyl allyl(3-(3-aminophenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0907] ##STR00441##
[0908] The synthesis of this step was performed referring to the synthesis process of compound 2 in Example 2.
[0909] LC_MS: (ES.sup.+): m/z 365.19[M+H].sup.+.
Compound 212 tert-butyl (E)-(3-(3-aminophenyl)allyl)(3-(3-aminophenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0910] ##STR00442##
[0911] The synthesis of this step was performed referring to the synthesis process of compound 2 in Example 2.
[0912] LC_MS: (ES.sup.+): m/z 456.23[M+H].sup.+.
Step 3: Compound 213 tert-butyl allyl(3-(3-(tetrahydro-2H-pyran-4-carboxamido)phenyl)imidazo[1,2-a]pyridin-6-yl)carbamate
[0913] ##STR00443##
[0914] The synthesis of this step was performed referring to the synthesis process of compound 47 in Example 3.
[0915] LC_MS: (ES) m/z 477.24[M+H].sup.+.
[0916] The following compounds were synthesized referring to the synthetic procedure of compound 211, compound 212, and compound 213 in Example 41, using corresponding reagents:
##STR00444##
TABLE-US-00004 Number Structural formula Mass spectrometry and NMR Compound 214
[0917] The following compounds were synthesized referring to the synthetic route of intermediates BB5, BB6 and compound 2 in Example 2, using corresponding reagents:
##STR00453##
TABLE-US-00005 Number Structural formula Mass spectrometry and NMR Compound 222
[0918] The following compounds were synthesized referring to the synthetic procedure of compound 47 in Example 3 and compound 63 in Example 6, using corresponding reagents:
##STR00468##
TABLE-US-00006 Number Structural formula Mass spectrometry and NMR Compound 236
[0919] The following compounds were synthesized referring to the synthetic route of Compound 2 in Example 2 and Compound 63 in Example 6, using corresponding reagents:
##STR00487##
TABLE-US-00007 Number Structural formula Mass spectrometry and NMR Compound 254
[0920] Compound 299 and compound 300 were synthesized referring to the synthetic routes of compound 2 in Example 2 and compound 47 in Example 3, using corresponding reagents:
##STR00533##
TABLE-US-00008 Number Structural formula Mass spectrometry and NMR Compound 299
[0921] The synthetic route of compounds 301-304 was as follows:
##STR00536##
[0922] Step 1: The synthesis was performed referring to the synthesis process of compound 63 in Example 6 using corresponding reagents.
[0923] Step 2: The synthesis was performed referring to the second step of the synthesis process of compound 129 in Example 31 using corresponding reagents.
[0924] Step 3: The synthesis was performed referring to the fifth step of the synthesis process of intermediate BB6 using corresponding reagents.
[0925] Step 4: The synthesis was performed referring to the synthesis process of compound 2 in Example 2 using corresponding reagents.
TABLE-US-00009 Number Structural formula Mass spectrometry and NMR Compound 301
[0926] Compounds 305-307 were synthesized according to the following route:
##STR00541##
[0927] Step 1: The synthesis was performed referring to the synthesis process of compound 63 in Example 6 using corresponding reagents.
[0928] Step 2: The synthesis was performed referring to the second step of the synthesis process of compound 129 in Example 31 using corresponding reagents.
[0929] Step 3: The synthesis was performed referring to the fifth step of the synthesis process of intermediate BB6 using corresponding reagents.
[0930] Step 4: The synthesis was performed referring to the synthesis process of compound 2 in Example 2 using corresponding reagents.
TABLE-US-00010 Number Structural formula Mass spectrometry and NMR Compound 305
[0931] Compounds 308-310 were synthesized according to the following route:
##STR00545##
[0932] Step 1: The synthesis was performed referring to the synthesis process of compound 63 in Example 6 using corresponding reagents.
[0933] Step 2: The synthesis was performed referring to the second step of the synthesis process of compound 129 in Example 31 using corresponding reagents.
[0934] Step 3: The synthesis was performed referring to the fifth step of the synthesis process of intermediate BB6 using corresponding reagents.
[0935] Step 4: The synthesis was performed referring to the synthesis procedure of compound 2 in Example 2 using corresponding reagents.
TABLE-US-00011 Number Structural formula Mass spectrometry and NMR Compound 308
[0936] The following compounds were synthesized referring to the synthetic procedure of compound 83, compound 84, and compound 85 in Example 9, using corresponding reagents:
##STR00549##
TABLE-US-00012 Number Structural formula Mass spectrometry and NMR Compound 311
Biological Activity Examples
Biological Activity Example 1: Preparation of SARM1 and Assay of NAD Enzymatic Activity
Preparation of Compounds to be Tested:
[0937] Compounds to be tested were stocked at 200 M or 10 mM (in DMSO), and further diluted to the desired compound concentration for the in vitro SARM1 enzyme assay and inhibitor screening.
Expression and Purification of SARM1 Protein
(1) Plasmid Construction
[0938] In this example, the gene sequence of dN-SARM1 was amplified using PCR, the N-terminal mitochondrial localization signal peptide of SARM1 was removed, and the PCR amplification product was constructed into the pLenti-CMV-puro-dest plasmid (addgene catalog #17452). The details were as follows:
[0939] BC2T-TEV polypeptide gene fragment, dN-SARM1-F and dN-SARM1-R were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The BC2T-TEV polypeptide gene fragment had a sequence set forth in SEQ ID No.: 1, dN-SARM1-F had a sequence set forth in SEQ ID No.: 2, and dN-SARM1-R had a sequence set forth in SEQ ID No.: 3.
TABLE-US-00013 SEQIDNo.:1: 5-CTCATGccagacagaaaagcggctgttagtcactggcagcaaGATAT CGGCGGAGGCGGATCTGGCGGAGGCGGATCTGGCGGAGGCGGATCTgaga atttgtattttcagggtGGCGGAGGCGGAGGTACCCTG-3 SEQIDNo.:2: 5-GGTACCCTGGCGGTGCCTGGGCCAG-3 SEQIDNo.:3: 5-GCGGCCGCCTAGGTTGGACCCATGGGTGCAGCACCC-3
[0940] The synthesized BC2T-TEV polypeptide gene fragment was connected into the pENTR vector pENTR1A-GFP-N2 (addgene: catalog #19364) through HindIII/KpnI restriction sites. The dN-SARM1 gene fragment was amplified using primers dN-SARM1-F and dN-SARM1-R. The dN-SARM1 gene fragments obtained from amplification were constructed into pENTR vector with BC2T-TEV through KpnI and NotI restriction sites. All endonucleases used in this example were purchased from Thermo.
[0941] The dN-SARM1 gene fragment obtained by PCR amplification had a sequence set forth in SEQ ID No.: 4.
TABLE-US-00014 SEQIDNo.:4: GGTACCCTGGCGGTGCCTGGGCCAGATGGGGGCGGTGGCACGGGCCCATG GTGGGCTGCGGGTGGCCGCGGGCCCCGCGAAGTGTCGCCGGGGGCAGGCA CCGAGGTGCAGGACGCCCTGGAGCGCGCGCTGCCGGAGCTGCAGCAGGCC TTGTCCGCGCTGAAGCAGGCGGGCGGCGCGCGGGCCGTGGGCGCCGGCCT GGCCGAGGTCTTCCAACTGGTGGAGGAGGCCTGGCTGCTGCCGGCCGTGG GCCGCGAGGTAGCCCAGGGTCTGTGCGACGCCATCCGCCTCGATGGCGGC CTCGACCTGCTGTTGCGGCTGCTGCAGGCGCCGGAGTTGGAGACGCGTGT GCAGGCCGCGCGCCTGCTGGAGCAGATCCTGGTGGCTGAGAACCGAGACC GCGTGGCGCGCATTGGGCTGGGCGTGATCCTGAACCTGGCGAAGGAACGC GAACCCGTAGAGCTGGCGCGGAGCGTGGCAGGCATCTTGGAGCACATGTT CAAGCATTCGGAGGAGACATGCCAGAGGCTGGTGGCGGCCGGCGGCCTGG ACGCGGTGCTGTATTGGTGCCGCCGCACGGACCCCGCGCTGCTGCGCCAC TGCGCGCTGGCGCTGGGCAACTGCGCGCTGCACGGGGGCCAGGCGGTGCA GCGACGCATGGTAGAGAAGCGCGCAGCCGAGTGGCTCTTCCCGCTCGCCT TCTCCAAGGAGGACGAGCTGCTTCGGCTGCACGCCTGCCTCGCAGTAGCG GTGTTGGCGACTAACAAGGAGGTGGAGCGCGAGGTGGAGCGCTCGGGCAC GCTGGCGCTCGTGGAGCCGCTTGTGGCCTCGCTGGACCCTGGCCGCTTCG CCCGCTGTCTGGTGGACGCCAGCGACACAAGCCAGGGCCGCGGGCCCGAC GACCTGCAGCGCCTCGTGCCGTTGCTCGACTCTAACCGCTTGGAGGCGCA GTGCATCGGGGCTTTCTACCTCTGCGCCGAGGCTGCCATCAAGAGCCTGC AAGGCAAGACCAAGGTGTTCAGCGACATCGGCGCCATCCAGAGCCTGAAA CGCCTGGTTTCCTACTCTACCAATGGCACTAAGTCGGCGCTGGCCAAGCG CGCGCTGCGCCTGCTGGGCGAGGAGGTGCCACGGCCCATCCTGCCCTCCG TGCCCAGCTGGAAGGAGGCCGAGGTTCAGACGTGGCTGCAGCAGATCGGT TTCTCCAAGTACTGCGAGAGCTTCCGGGAGCAGCAGGTGGATGGCGACCT GCTTCTGCGGCTCACGGAGGAGGAACTCCAGACCGACCTGGGCATGAAAT CGGGCATCACCCGCAAGAGGTTCTTTAGGGAGCTCACGGAGCTCAAGACC TTCGCCAACTATTCTACGTGCGACCGCAGCAACCTGGCGGACTGGCTGGG CAGCCTGGACCCGCGCTTCCGCCAGTACACCTACGGCCTGGTCAGCTGCG GCCTGGACCGCTCCCTGCTGCACCGCGTGTCTGAGCAGCAGCTGCTGGAA GACTGCGGCATCCACCTGGGCGTGCACCGCGCCCGCATCCTCACGGCGGC CAGAGAAATGCTACACTCCCCGCTGCCCTGTACTGGTGGCAAACCCAGTG GGGACACTCCAGATGTCTTCATCAGCTACCGCCGGAACTCAGGTTCCCAG CTGGCCAGTCTCCTGAAGGTGCACCTGCAGCTGCATGGCTTCAGTGTCTT CATTGATGTGGAGAAGCTGGAAGCAGGCAAGTTCGAGGACAAACTCATCC AGAGTGTCATGGGTGCCCGCAACTTTGTGTTGGTGCTATCACCTGGAGCA CTGGACAAGTGCATGCAAGACCATGACTGCAAGGATTGGGTGCATAAGGA GATTGTGACTGCTTTAAGCTGCGGCAAGAACATTGTGCCCATCATTGATG GCTTCGAGTGGCCTGAGCCCCAGGTCCTGCCTGAGGACATGCAGGCTGTG CTTACTTTCAACGGTATCAAGTGGTCCCACGAATACCAGGAGGCCACCAT TGAGAAGATCATCCGCTTCCTGCAGGGCCGCTCCTCCCGGGACTCATCTG CAGGCTCTGACACCAGTTTGGAGGGTGCTGCACCCATGGGTCCAACCTAG
[0942] The PCR amplification reaction system comprised: 10 L of 5 PrimeSTAR Buffer (Mg.sup.2+ plus), 4 L of dNTP Mixture (2.5 mM each), dN-SARM1-F with a final concentration of 0.2 mol/L, dN-SARM1-R with a final concentration of 0.2 mol/L, 100 ng of DNA template, and 0.5 L of PrimeSTAR HS DNA Polymerase (2.5 U/L), and the system was finally added with sterilized ddH.sub.2O to 50 L. The full-length SARM1 was synthesized into the pUC57 plasmid by WZ Biosciences Inc., and PCR was performed using pUC57-SARM1 as a DNA template.
[0943] The PCR amplification products were electrophoresed using agarose gel, and then recovered and purified using Omega gel recovery kit D2500-02. The specific steps of gel cutting and recovery were performed referring to the kit instruction. The recovered and purified PCR amplification product was constructed into the pENTR vector with BC2T-TEV
[0944] A recombinant plasmid was constructed as follows:
[0945] Enzyme digestion reaction system comprised 800 ng of PCR amplification recovery product or plasmid, 1 L each of endonuclease (Fastdigest) and 1 L of buffer, and the system was added with sterilized water to a volume of 10 L. The enzyme digestion reaction was performed at a constant temperature of 37 C. for 30 minutes.
[0946] Plasmid ligation: After the enzyme digestion reaction was completed, 300 ng of the enzyme-digested PCR amplification recovery product and 50 ng of the enzyme-digested plasmid were evenly mixed with 1 L of T4 DNA ligase and 1 L of T4 DNA ligase buffer, and the mixture was added with sterilized water to a volume of 20 L. The ligation was performed at a constant temperature of 16 C. overnight.
[0947] The ligation product was subjected to agarose gel electrophoresis, and then recovered and purified using Omega gel recovery kit D2500-02. The recovered and purified product was the recombinant plasmid of this example, labeled as pENTR1A-BC2T-dN-SARM1.
[0948] After the pENTR1A-BC2T-dN-SARM1 plasmid was constructed, dN-SARM1 was recombined into pLenti-CMV-puro-dest through LR reaction.
[0949] Recombinant reaction system comprised 150 ng of pENTR1A-BC2T-dN-SARM1, 50 ng of pLenti-CMV-puro-dest and 1 L of 5 LR Clonase reaction buffer, and the system was added with sterilized water to a total volume of 5 L.
(2) Transfection
[0950] In this example, the constructed pLenti-CMV-puro-dest and viral packaging plasmid psPAX2, pMD2.G (addgene psPAX2: #12260, pMD2.G: #12259) were co-transfected into HEK293T cells (ATCC) through liposomes Lipofectamine 2000 (Life Technologies), to prepare viruses with dN-SARM1 reading frame. The details were as follows:
[0951] 110.sup.6 cells were plated in a 3.5 cm dish, and transfect the next day.
[0952] A plasmid mixture comprised 1.7 g of pLenti-dN-SARM1, 1.7 g of psPAX2, 0.6 g of pMD2.G, and 8 L of lipofectamine 2000 transfection reagent. Transfection was carried out according to the instruction. The medium was changed after 8 hours, and the virus was collected after 48 hours.
(3) Cell Screening
[0953] HEK293T cells obtained in the (2) Transfection step were infected with dN-SARM1 virus, and cells stably expressing dN-SARM1 protein were screened by adding puromycin. The details were as follows:
[0954] Virus: 210.sup.5 cells were infected with virus at 80 L/3.5 cm. After 48 hours of infection, 2 g/mL puromycin was added for screening. After 48 hours of screening, cells not infected with the virus were completely dead. Most of the virus-infected cells survived. 2 g/mL puromycin was added for secondary screening for 48 hours.
(4) Protein Extraction
[0955] Cells stably expressing dN-SARM1 protein obtained in the (3) Cell Screening step were cultured and collected. The dN-SARM1 protein expressed in the cytoplasm was obtained through digitonin cleavage, which was used for in vitro activity assay. The details were as follows:
[0956] Cells were cultured in DMEM in a 10 cm dish, digested with trypsin-EDTA, then centrifuged at 1000 rpm for 5 minutes, washed once with PBS, then resuspended with PBS containing 100 M digitonin at 0.6 mL PBS/10 cm cells, and lysed for 5 minutes. The cells were added with trypan blue and observed under a microscope. More than 90% of the cells had been lysed. The cells were centrifuged at 5000 rpm for 10 minutes, and the supernatant of dN-SARM1 protein was collected.
Biological Activity Example 2: In Vitro Biochemical Assay for Inhibiting SARM1 Enzymatic Activity (% Inhibition Rate)
[0957] The compounds were subjected to PC6 fluorescence method measurement [Chinese Patent 202010528147.3] using the dN-SARM1 protein obtained through (4) Protein extraction in Expression and purification of SARM1 protein in the above biological activity example 1.
Reaction Conditions:
[0958] First, 0.05 g/ml dN-SARM1 and 20 M compound were incubated in 50 mM Tris-HCl (pH 7.5) solution for 10 min, and then added with 50 M NAD and 50 M PC6 as substrate and 50 M NMN as activator for 30 minutes of reaction at room temperature. The concentration of each component was the final concentration in the reaction system.
[0959] During the reaction, PC6 fluorescence spectrum dynamics were detected by a microplate reader, wherein the excitation wavelength and emission wavelength for detection were 390 nm and 520 nm, respectively. Finally, the reaction rate was used to express the activity of the protein. The higher the reaction rate, the stronger the activity of the protein and the lower the inhibitory efficiency of the compound.
[0960] Table 1 below provides the inhibition rate interval of SARM1 enzymatic activity by some compounds at 20 M: A>90%; B: 50-89%; C: 25-49%;
TABLE-US-00015 TABLE 1 Compound Inhibition rate of number enzymatic activity 1 A 19 A 20 B 22 B 24 A 25 A 26 A 27 B 28 B 32 A 33 A 34 A 35 B 37 B 40 A 41 A 44 B 46 A 48 B 49 A 50 A 53 A 54 A 55 A 56 A 57 A 58 B 75 A 77 A 78 A 79 A 90 A 94 A 95 B 105 A 108 B 109 B 110 A 115 A 122 A 123 A 124 A 125 A 126 A 127 B 128 A 129 A 130 A 131 A 132 A 133 B 134 A 135 B 136 A 139 B 142 A 143 A 144 A 145 A 146 A 147 A 148 A 149 A 150 A 151 A 152 A 153 A 154 A
Biological Activity Example 3: In Vitro Biochemical Assay for Inhibiting SARM1 Enzymatic Activity (IC.SUB.50.)
[0961] 200 M compound was first added to a solution of 0.05 g/ml dN-SARM1 in 50 mM Tris-HCl (pH 7.5). Half of the mixture was added to an equal volume of a solution of 0.05 g/ml dN-SARM1 in 50 mM Tris-HCl (pH 7.5) and mixed. The drug was diluted 6 times in this manner, with the final concentrations being 200, 100, 50, 25, 12.5, 6.25, 3.125 M, or 200, 50, 12.5, 3.125, 0.78, 0.195, 0.049 M, respectively. The protein without inhibitors added, being used as control group, was incubated at room temperature for 10 minutes.
[0962] 50 M NAD, 50 M PC6 as substrate and 50 M NMN as activator were added to the dN-SARM1 protein incubated with the inhibitor and reacted for 30 minutes at room temperature. The concentration of each component was the final concentration in the reaction system.
[0963] During the reaction, PC6 fluorescence spectrum dynamics were detected by a microplate reader, wherein the excitation wavelength and emission wavelength for detection were 390 nm and 520 nm, respectively. Finally, the reaction rate was used to express the activity of the protein, and the half inhibitory concentration was calculated. The higher the reaction rate, the stronger the protein activity, and the lower the inhibitory efficiency of the compound.
[0964] The dose curve of compounds inhibiting SARM1 enzymatic activity was determined using the above method.
[0965] IC.sub.50 intervals of these compounds in the assay are provided in Table 2 below:
[0966] IC.sub.50 intervals for inhibiting SARM1 enzymatic activity: A<1.0 M; B: 1-10 M; C: 10-25 M
TABLE-US-00016 TABLE 2 Compound Number IC.sub.50 2 A 5 B 6 B 7 B 8 B 9 B 10 B 11 B 12 B 13 A 14 B 15 B 16 B 17 B 18 B 20 A 23 B 24 B 25 B 26 A 27 B 32 B 33 B 34 B 37 B 40 B 41 B 42 A 43 B 44 B 46 B 47 A 49 B 50 B 53 B 54 A 55 B 56 A 57 A 58 A 59 B 60 B 61 B 62 B 63 B 64 B 65 A 67 B 68 B 69 B 70 B 72 B 73 B 74 B 75 B 76 B 77 B 78 A 79 A 80 B 81 B 82 B 83 B 84 B 85 B 86 A 87 A 89 A 90 B 91 B 92 B 94 A 96 A 99 B 105 B 108 B 110 A 113 B 114 A 115 A 116 A 117 B 118 B 119 A 120 A 121 A 122 A 123 A 124 B 125 B 128 B 129 A 130 A 131 B 132 B 134 A 136 A 143 B 144 A 145 A 146 B 149 B 150 B 151 B 152 B 153 B 154 A 156 B 157 B 158 B 159 A 160 A 161 A 162 A 163 A 164 A 165 A 166 A 167 A 168 A 169 A 170 A 171 A 172 A 173 B 174 A 175 A 176 B 177 B 178 A 179 A 180 B 181 B 182 B 183 B 184 B 185 B 186 B 191 B 192 B 193 B 194 B 195 B 196 B 197 B 199 B 200 B 201 B 202 B 203 A 204 B 205 B 207 B 208 B 209 B 210 B 211 B 212 B 213 B 217 B 218 B 219 B 220 B 221 B 222 B 223 A 226 B 227 B 229 B 230 B 231 B 232 B 234 B 235 B 236 A 237 A 238 A 239 A 240 A 241 A 242 A 244 B 245 B 246 B 247 B 248 B 249 B 250 B 251 B 253 B 254 A 255 A 256 A 257 A 258 A 259 A 260 A 261 A 262 A 263 A 264 A 265 A 266 B 267 A 268 A 269 B 270 A 271 A 272 B 273 B 274 B 275 B 276 B 278 B 283 B 284 B 285 B 286 B 290 B 291 B 292 B 293 A 294 B 295 B 296 B 297 B 298 B 301 A 302 B 304 B 305 A 306 A 307 A 308 B 309 B 310 B 311 A 312 B
Biological Activity Example 4: Assay of Inhibitory Activity of Drugs in Inducible SARM1 Overexpressing Cell Line
(1) Preparation of iSARM1 Cell Line
[0967] In this example, the gene sequence of SARM1 was amplified using PCR, and constructed into pInducer20-neo plasmid. pInducer20-SARM1 virus was packaged in a liposome and infected HEK293 to obtain an inducible SARM1-overexpressing cell line, which was labeled as iSARM1 (HEK293). The specific preparation was as follows:
[0968] In this example, the SARM1 gene sequence was amplified by PCR using the primers comprising sequences set forth in SEQ ID No.: 5 and SEQ ID No.: 6. The recovery of PCR amplification products, enzyme digestion, recombinant plasmid construction, transfection and cell screening were all performed in the same manner as dN-SARM1 in Expression and purification of SARM1 protein, except that when performing (3) Cell screening, 2 g/mL puromycin was replaced with 2 mg/mL neomycin. The rest were the same, which will not be repeated here.
TABLE-US-00017 SEQIDNo.:5: 5-TCTAGAGCCACCATGGTCCTGACGCTGCTTC-3 SEQIDNo.:6: 5-GAATTCTTAGGTTGGACCCATGGGTG-3
(2) Determination of Inhibitory Activity of the Inhibitors on SARM1 Protein in Cell Lines
[0969] First, a 96-well culture plate was treated with 0.05 mg/ml polylysine for 5 minutes and washed once with PBS. 310.sup.4 iSARM1 (HEK293) cells were plated into the 96-well plate and cultured overnight in a 37 C. and 5% incubator. The next day, the cells were added with an inhibitor with a final concentration of 50 M, incubated in the incubator for 1.5 hours, added with activator CZ-48 with a final concentration of 100 M, and incubated for 16 hours. Meanwhile, the cells without adding CZ-48 or without adding drug were set as control group. Finally, the intracellular cADPR level was detected to represent the activity of SARM1, and the inhibition rate of SARM1 in cells by 50 M inhibitor was calculated.
[0970] The cADPR measurement was performed as follows. First, the cells were washed once with PBS, and added with 150 l of pre-cooled 0.6M perchloric acid (PCA) to quickly lyse the cells and precipitate the protein. The PCA supernatant was transferred to a 1.5 ml centrifuge tube. The protein in the culture medium was dissolved again with 100 l of 1M NaOH. The supernatant was added with 0.5 ml of organic reagent mixture (trioctylamine:chloroform=1:3) to extract PCA from water. After sufficient shaking, the mixture was centrifuged at 12,000 rpm for 10 minutes. The solution was divided into 3 layers: the upper aqueous phase, containing the small molecules of interest; the lower organic phase, in which PCA was dissolved; and a thin protein layer between the upper and lower layers. The upper layer was transferred to a new centrifuge tube, added with 1M Tris-Mg at a ratio of 1:100 (1M Tris (pH 8.0): 1M MgCl2=9:1), added with NADase at a ratio of 1:250, and treated at 37 C. overnight to remove NAD.sup.+ from the mixed solution. After the treatment was completed, the mixed solution was filtered using Millipore's 10 K 96-well filter plate to remove NADase.
[0971] The cADPR content in the solution was determined through Cycling analysis method. The specific steps were as follows: 20 l of the sample to be tested or the cADPR standard was taken and added to a 96-well opaque white plate. Preparation of reaction solution: 9.6 ml of PBS (pH 7.4), 200 l of ethanol, 150 l of 1 mg/ml AD, 10 l of 10 mM FMN, 5 l of 18 mg/ml Diaphorase, 10 l of 10 mM Resazurin, and 100 l of 1M Nam. Half of the reaction solution was divided and added with 0.2 g/ml cyclase. The reaction solution without adding cyclase was used as control experiment. Each sample was divided into two groups, 3 replicates in each group. The reaction solutions containing or not containing cyclase were added to each group to perform the reaction. The reaction kinetic curve within 30 minutes was recorded (Ex:Em=544/599). The average slope of the reaction was calculated. Conversion was performed according to cADPR standard to obtain the accurate cADPR content. A curve of intracellular cADPR content vs corresponding inhibitor concentration was plotted. The half inhibitory concentration of the inhibitor was calculated.
[0972] Using the above method, the drug inhibitory activity (EC50) in the inducible overexpressing SARM1 cell line is shown in Table 3 below: cell activity EC50 interval: A<1.0 M; B: 1-10 M; C: 10-25 M
TABLE-US-00018 TABLE 3 Compound Number EC.sub.50 2 B 6 A 7 B 8 B 9 B 10 A 11 A 12 A 13 B 14 B 15 B 17 B 20 B 25 B 32 B 33 B 34 B 40 B 44 B 47 A 49 A 50 B 63 B 65 B 68 B 69 B 70 B 75 A 78 B 79 B 84 A 87 B 90 B 96 B 99 B 105 B 113 B 114 B 115 B 116 A 118 A 119 B 121 A 122 A 123 A 129 B 130 B 155 A 156 B 157 B 158 A 159 B 160 A 161 B 162 A 164 B 167 A 168 B 169 B 171 A 181 B 183 B 185 B 201 A 205 A 211 A 212 A 213 A 215 A 219 B 220 B 221 A 227 A 230 B 231 B 234 B 236 B 237 A 238 A 239 A 240 A 241 A 244 A 245 A 246 B 247 A 248 A 249 A 251 B 253 B 254 B 255 B 256 B 259 B 260 B 262 A 272 B 273 B 274 B 275 B 276 B 278 B 301 B 307 B