Multiplexed genome editing
12133515 ยท 2024-11-05
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
A01K2207/05
HUMAN NECESSITIES
A01K2267/025
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
A01K2207/10
HUMAN NECESSITIES
International classification
A01K67/0275
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
A method of modulating some or all copies of a gene in a cell is provided including introducing into a cell one or more ribonucleic acid (RNA) sequences that comprise a portion that is complementary to all or a portion of each of the one or more target nucleic acid sequences, and a nucleic acid sequence that encodes a Cas protein and maintaining the cells under conditions in which the Cas protein is expressed and the Cas protein binds and modulates the one or more target nucleic acid sequences in the cell.
Claims
1. An isolated porcine organ comprising a plurality of genetically engineered porcine cells, wherein each genetically engineered porcine cell of said plurality is characterized by a plurality of endogenous retrovirus genes and in that at least 20% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
2. The organ of claim 1, wherein at least 50% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
3. The organ of claim 1, wherein at least 70% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
4. The organ of claim 1, wherein at least 80% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
5. The organ of claim 1, wherein at least 85% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
6. The organ of claim 1, wherein at least 90% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
7. The organ of claim 1, wherein at least 95% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
8. The organ of claim 1, wherein at least 96% of the endogenous retrovirus genes comprise a genetically engineered genomic mutation.
9. The organ of claim 1, wherein the endogenous retrovirus genes are porcine endogenous retrovirus (PERV) genes.
10. The organ of claim 1, wherein the endogenous retrovirus genes are retroviral pol genes.
11. The organ of claim 1, wherein the retrovirus genes are retroviral porcine endogenous retrovirus (PERV) pol genes.
12. The organ of claim 1, wherein the genetically engineered genomic mutation is observed by sequencing.
13. The organ of claim 1, wherein the plurality of endogenous retrovirus genes includes 5 or more retrovirus genes.
14. The organ of claim 1, wherein the plurality of genetically engineered porcine cells contains intact porcine endogenous retrovirus (PERV) gag and/or env genes.
15. An isolated porcine organ comprising a plurality of genetically engineered porcine cells, wherein each genetically engineered porcine cell of said plurality comprises genetically engineered genomic mutations in porcine endogenous retrovirus (PERV) genes and exhibits at least a 1000-fold reduction in PERV transmission co-culturing a human cell with the genetically engineered porcine cell as compared to co-culturing a human cell with a wild-type porcine cell.
16. The organ of claim 15, wherein the human cell is HEK293.
17. The organ of claim 15, wherein the porcine endogenous retrovirus (PERV) genes are PERV pol genes.
18. The organ of claim 15, wherein the genetically engineered genomic mutations are observed by sequencing.
19. The organ of claim 15, wherein the plurality of genetically engineered porcine cells contains intact porcine endogenous retrovirus (PERV) gag and/or env genes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
DETAILED DESCRIPTION OF THE INVENTION
(31) Aspects of the present invention are directed to the use of CRISPR/Cas9, for nucleic acid engineering. Described herein is the development of an efficient technology for the generation of animals (e.g., pigs) carrying multiple mutated genes. Specifically, the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated genes (Cas genes), referred to herein as the CRISPR/Cas system, has been adapted as an efficient gene targeting technology e.g., for multiplexed genome editing. Demonstrated herein is that CRISPR/Cas mediated gene editing allows the simultaneous inactivation of 62 copies of the porcine endogenous retrovirus (PERV) pol gene in a porcine kidney epithelial cell line (e.g., PK15) with high efficiency. Co-injection or transfection of Cas9 mRNA and guide RNA (gRNA) targeting PERVs into cells generated a greater than 1000 fold reduction in PERV transmission to human cells with biallelic mutations in both genes with an efficiency of up to 100%. Shown herein is that the CRISPR/Cas system allows the one step generation of cells carrying inactivation of all copies of PERV. In certain embodiments a method described herein generates cell and animals, e.g., pigs, with inactivation of 1, 2, 3, 4, 5, or more genes with an efficiency of between 20% and 100%, e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or more, e.g., up to 96%, 97%, 98%, 99%, or more.
Exemplification
Example 1
Genome-Wide Inactivation of Porcine Endogenous Retroviruses (PERVs)
(32) The shortage of organs for transplantation is a major barrier to the treatment of organ failure. While porcine organs are considered promising, their use has been checked by concerns about transmission of porcine endogenous retroviruses (PERVs) to humans. Here, the eradication of all PERVs in a porcine kidney epithelial cell line (PK15) was performed. It was first determined the PK15 PERV copy number to be 62. Using CRISPR-Cas9, all 62 copies of the PERV pol gene were disrupted and demonstrated a >1000-fold reduction in PERV transmission to human cells using our engineered cells. This study showed that CRISPR-Cas9 multiplexability can be as high as 62 and demonstrates the possibility that PERVs can be inactivated for clinical application to porcine-to-human xenotransplantation.
(33) Pig genomes contain from a few to several dozen copies of PERV elements. Unlike other zoonotic pathogens, PERVs cannot be eliminated by biosecure breeding. Prior strategies for reducing the risk of PERV transmission to humans have included small interfering RNAs (RNAi), vaccines, and PERV elimination using zinc finger nucleases and TAL effector nucleases, but these have had limited success. Here, the successful use of the CRISPR-Cas9 RNA-guided nuclease system can be used to inactivate all copies of the PERV pol gene and effect a 1000-fold reduction of PERV infectivity of human cells.
(34) To design Cas9 guide RNAs (gRNAs) that specifically target PERVs, the sequences of publically available PERVs and other endogenous retroviruses in pigs (Methods) were analyzed. A distinct Glade of PERV elements (
(35) Initial experiments showed inefficient PERV editing when Cas9 and the gRNAs were transiently transfected (
(36) Single cells from PK15 cells with high PERV targeting efficiency were sorted using flow cytometry and genotyped the pol locus of the resulting clones via deep sequencing. A repeatable bimodal (
(37) Next, unexpected genomic rearrangements had occurred as a result of the multiplexed genome editing was examined. Karyotyping of individual modified clones (
(38) Last, disruption of all copies of PERV pol in the pig genome could eliminate in vitro transmission of PERVs from pig to human cells was examined. No detection of RT activity in the cell culture supernatant of the highly modified PK15 clones (
(39) In summary, it was successfully targeted the 62 copies of PERV pol in PK15 cells and demonstrated greatly reduced in vitro transmission of PERVs to human cells. While in vivo PERV transmission to humans has not been demonstrated, PERVs are still considered risky and our strategy could completely eliminate this. As no porcine embryonic stem cells exist, this system will need to be recapitulated in primary porcine cells and cloned into animals using somatic cell nuclear transfer. Moreover, simultaneous Cas9 targeting of 62 loci in single pig cells without salient genomic rearrangement was achieved. To our knowledge, the maximum number of genomic sites previously reported to be simultaneously edited has been six. Our methods thus open the possibility of editing other repetitive regions of biological significance.
Example 2
Methods
(40) PERV copy number quantification: Droplet Digital PCR? PCR (ddPCR?) was usd to quantify the copy number of PERVs according to the manufacturer's instructions (Bio-Rad). Briefly, genomic DNA (DNeasy Blood & Tissue Kit, Qiagen) from cultured cells was purified, digested 50 ng genomic DNA with MseI (10 U) at 37? C. for 1 hour, and prepared the ddPCR reaction with 10 ?l 2? ddPCR Master mix, 1 ?l of 18 ?M target primers & 5 ?M target probe (VIC), 1 ?l of 18 ?M reference primers & 5 ?M reference probe (FAM), 5 ng digested DNA, and water to total volume of 20 ?l. The sequence of the primers and the probe information can be found in Extended Data Table 1.
(41) Methods
(42) TABLE-US-00001 TABLE1 PrimersusedinddPCRassay Name Sequence PrimerPol1-FW CGACTGCCCCAAGGGTTCAA(SEQIDNO:1) PrimerPo12-FW CCGACTGCCCCAAGAGTTCAA(SEQIDNO:2) PrimerPol-RV TCTCTCCTGCAAATCTGGGCC(SEQIDNO:3) ProbePol /56FAM/CACGTACTGGAGGAGGGTCACCTG (SEQIDNO:4) Primerpig_actin_F Taaccgatcctttcaagcattt(SEQIDNO:5) Primerpig_actin_R Tggtttcaaagcttgcatcata(SEQIDNO:6) Probepig_actin /5Hex/cgtggggatgcttcctgagaaag(SEQIDNO:7) Primerpig_GAPDH_F Ccgcgatctaatgttctctttc(SEQIDNO:8) Primerpig_GAPDH_R Ttcactccgaccttcaccat(SEQIDNO:9) Probepig_GAPDH /5Hex/cagccgcgtccctgagacac(SEQIDNO:10)
(43) CRISPR-Cas9 gRNAs design: MUSCLE was used to carry out a multiple sequence alignment of 245 endogenous retrovirus found in the porcine genome. A phylogenetic tree of the sequences was built and identified a Glade that included the PERVs (see
(44) Cell culture: PK15 were maintained in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) high glucose supplemented with 10% fetal bovine serum (Invitrogen), and 1% penicillin/streptomycin (Pen/Strep, Invitrogen). All cells were maintained in a humidified incubator at 37? C. and 5% CO.sub.2.
(45) PiggyBac-Cas9/2gRNAs construction and cell line establishment: PiggyBac-Cas9/2gRNAs construct is derived from a plasmid previously reported in Wang et al (2). Briefly, a DNA fragment encoding U6-gRNA1-U6-gRNA2 was synthesized (Genewiz) and incorporated it into a PiggBac-Cas9 construct. To establish PK15 cell lines with PiggyBac-Cas9/2gRNAs integration, 5.Math.10.sup.5 PK15 cells was transfected with 4 ?g PiggyBac-Cas9/2gRNAs plasmid and 1 ?g Super PiggyBac Transposase plasmid (System Biosciences) using Lipofectamine 2000 (Invitrogen). To enrich for the cells carrying the integrated construct, 2 ?g/mL puromycin was added to the transfected cells. Based on the negative control, puromycin was applied to wild type PK15 cells, it was determined that the selection completed in 3 days. The PK15-PiggyBac cell lines were maintained with 2 ?g/mL puromycin hereafter. 2 ?g/ml doxycycline was applied to induce Cas9 expression.
(46) Lentivirus-Cas9/2gRNAs construction and cell line establishment: Lenti-Cas9/2gRNAs constructs were derived from a plasmid previously reported (3). A DNA fragment encoding U6-gRNA1-U6-gRNA2 was synthesized (Genewiz) and incorporated it into a Lenti-Cas9-V2. To generate lentivirus carrying Lenti-Cas9/2gRNAs, ?5.Math.10.sup.6 293FT HEK cells was transfected with 3 ?g Lenti-Cas9-gRNAs and 12 ?g ViraPower Lentiviral Packaging Mix (Invitrogen) using Lipofectamine 2000. The lentiviral particles were collected 72 hours after transfection, and the viral titer was measured using Lenti-X GoStix (Takara Clonetech). ?10.sup.5 lentiviral particles to ?1.Math.10.sup.6 PK15 cells were transduced and conducted selection by puromycin to enrich transduced cells 5 days after transduction. The PK15-Lenti cell lines were maintained with 2 ?g/mL puromycin thereafter.
(47) Genotyping of colonized and single PK15 cells: PK15 cultures were dissociated using TrypLE (Invitrogen) and resuspended in PK15 medium with the viability dye ToPro-3 (Invitrogen) at a concentration of 1-2.Math.10.sup.5 cells/ml. Live PK15 cells were single-cell sorted using a BD FACSAria II SORP UV (BD Biosciences) with 100 mm nozzle under sterile conditions. SSC-H versus SSC-W and FSC-H versus FSC-W doublet discrimination gates and a stringent 0/32/16 single-cell sorting mask were used to ensure that one and only one cell was sorted per well. Cells were sorted in 96-well plates with each well containing 100 ?l PK15 medium. After sorting, plates were centrifuged at 70 g for 3 min. Colony formation was seen 7 days after sorting and genotyping experiment was performed 2 weeks after FACS.
(48) To genotype single PK15 cells without clonal expansion, the PERV locus was directly amplified from sorted single cells according to a previously reported single cell genotyping protocol (4). Briefly, prior to sorting, all plastics and non-biologic buffers were treated with UV radiation for 30 min. Single cells were sorted into 96-well PCR plates with each well carrying 0.5 ?l 10? KAPA express extract buffer (KAPA Biosystems), 0.1 ?l 1 U/?l KAPA Express Extract Enzyme and 4.6 ?l water. The lysis reaction was incubated at 75? C. for 15 min and inactivated the reaction at 95? C. for 5 min. All reactions were then added to 25 ?l PCR reactions containing 12.5 ?l 2? KAPA 2G fast (KAPA Biosystems), 100 nM PERV illumina primers (Methods Table 2), and 7.5 ?l water. Reactions were incubated at 95? C. for 3 min followed by 25 cycles of 95? C., 10 s; 65? C., 20 s and 72? C., 20 s. To add the Illumina sequence adaptors, 5 ?l of reaction products were then added to 20 ?l of PCR mix containing 12.5 ml of 2 KAPA HIFI Hotstart Readymix (KAPA Biosystems), 100 nM primers carrying Illumina sequence adaptors and 7 ?l water. Reactions were incubated at 95? C. for 5 min followed by 15-25 cycles of 98? C., 20 s; 65? C., 20 s and 72? C., 20 s. PCR products were checked on EX 2% gels (Invitrogen), followed by the recovery of 300-400 bp products from the gel. These products were then mixed at roughly the same amount, purified (QIAquick Gel Extraction Kit), and sequenced with MiSeq Personal Sequencer (Illumina). Deep sequencing data was analyzed and determined the PERV editing efficiency using CRISPR-GA (5).
(49) TABLE-US-00002 TABLE2 PrimersusedinthePERVpolgenotyping Name Sequence illumina_primerPol1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGACTGCCCC AAGGGTTCAA(SEQIDNO:11) illumina_primerPol2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGACTGCCC CAAGAGTTCAA(SEQIDNO:12) illumina_primerPo3 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTCTCCTG CAAATCTGGGCC(SEQIDNO:13)
(50) Targeting efficiency estimation: a custom pipeline was built to estimate the efficiency of PERV inactivation. Briefly, the pol gene was amplified and sequenced via Illumina Next Generation Sequencing using PE250 or PE300. First, the two overlapping reads were combined using PEAR (6) and mapped to the reference region using BLAT. After mapping, the reads were grouped into sets containing specific combinations of haplotypes (see Extended Data
(51) RNA-seq analysis: The susScr3 pig genome and Ensembl transcripts were obtained from the UCSC Genome Brower Database. RNA-Seq reads were mapped to the reference genome using the STAR software (7) and the RPKM of the transcripts were quantified using BEDTools (8). Differential expression analysis was performed in R using the DESeq2 package (9), and gene set enrichment analysis was carried out by the GSEA software (10), with gene set definitions obtained from the software's website.
(52) Reverse transcriptase (RT) assay: To test the RT activity of the PK15 cells and modified PK15 clones (4 highly and 1 lowly modified clones), 5.Math.10.sup.5 cells were plated in T75 cm.sup.2 flasks, and collected the supernatant 4 days after seeding. The media was filtered using a 0.45 ?M Millex-HV Syringe Filter (EMD Millipore Corporation), and the filtered supernatant was concentrated at 4000 g for 30 min using Amicon Ultra-15 Centrifugal Filter Unit (EMD Millipore Corporation). The concentrated supernatant was ultra-centrifuged at 50,000 rpm for 60 min. The supernatant was carefully removed, and the virus pellet was collected and lysed with 20 ?l of 10% NP40 at 37? C. for 60 min.
(53) The RT reaction was conducted using the Omniscript RT Kit (Qiagen). The total volume of the reaction was 20 ?l, which contained 1? RT buffer, 0.5 mM dNTPs, 0.5 ?M Influenza reverse primer (5 CTGCATGACCAGGGTTTATG 3) (SEQ ID NO:14), 100 units of RnaseOUT (Life Technology, Invitrogen), 100 units of SuperRnase Inhibitor (Life Technologies), 5 ?l of sample lysis and 40 ng of IDT-synthesized Influenza RNA template which was rnase resistant in both 5 and 3 end. The RNA template sequence was 5 rA*rA*rC*rA*rU*rGrGrArArCrCrUrUrUrGrGrCrCrCrUrGrUrUrCrArUrUrUrUrArGrArArAr UrCrArArGrUrCrArArGrArUrArCrGrCrArGrArArGrArGrUrArGrArCrArUrArArArCrCrCrUr GrGrUrCrArUrGrCrArGrArCrCrU*rC*rA*rG*rU*rG 3 (* phosphodiester bond) (SEQ ID NO:15). After the RT reaction was completed, the RT product was examined by PCR using Influenza forward (5 ACCTTTGGCCCTGTTCATTT 3) (SEQ ID NO:16) and Influenza reverse primers (sequence shown as above). The expected size of the amplicon was 72 bp.
(54) Infectivity Assay
(55) HEK293-GFP cell line establishment: The Lenti-GFP construct was derived from the plasmid pLVX-IRES-ZsGreen1 (Clontech. Catalog No. 632187; PT4064-5). To generate the lentivirus carrying Lenti-GFP, ?5.Math.10.sup.6 293FT HEK cells were transfected with 3 ?g of pVX-ZsGreen plasmid and 12 ?g of ViraPower Lentiviral Packaging Mix (Invitrogen) using Lipofectamine 2000 (Invitrogen). Lentiviral particles were collected 72 hours after transfection, and the viral titer was measured using Lenti-X GoStix (Takara Clonetech). ?10.sup.5 lentivirus particles to ?1.Math.10.sup.6 HEK293 cells were transfected and conducted selection by puromycin to enrich the transduced cells 5 days after transduction. The 293-GFP-Lenti cell lines were maintained with 0.5 ?g/mL puromycin thereafter.
(56) Infectivity test of PK15 WT to HEK293-GFP: 1.Math.10.sup.5 cells of Lenti-GFP-293FT HEK cells and 1.Math.10.sup.5 PK15 WT cells were cultured together in a 6-well plate. In parallel, 2.Math.10.sup.5 PK15 WT cells were cultured alone in another well as a control. The puromycin selection experiment was done by adding 5 ?g/ml of the antibiotic for 7 days. The time point was determined when no viable cells in the control well and approximately 100% GFP positive cells in the experimental well as the time point when the puromycin selection was completed to purify lenti-GFP-293FT human cells. Cells from the 293FT HEK/PK15 WT co-culture were collected at different time periods. The genomic DNA was extracted using (DNeasy Blood & Tissue Kit, Qiagen) from cultured cells of the 293-GFP WT, PK15 WT and the co-cultured cells. The genomic DNA concentration was measured using a Qubit 2.0 Fluorometer (Invitrogen), and 3 ng from each sample was used as DNA template for PCR. In all, 1 ?L of the genomic DNA were added to 25 ?L of a PCR mix containing 12.5 ?L 2? KAPA Hifi Hotstart Readymix (KAPA Biosystems) and 100 ?M of primers as listed in Methods Table 3. Reactions were incubated at 95? C. for 5 min followed by 35 cycles of 98? C., 20 s; 65? C., 20 s and 72? C., 20 s. PCR products were visualized on EX 2% gels (Invitrogen) and observed for bands of 300-400 base pairs.
(57) TABLE-US-00003 TABLE3 Atableexhibitingtheprimersusedinthe infectivityassay Name Sequence PERVpol-Forward GGGAGTGGGACGGGTAACCCA (SEQIDNO:17) PERVpol-Reverse GCCCAGGCTTGGGGAAACTG (SEQIDNO:18) PERVenv-Forward ACCTCTTCTTGTTGGCTTTG (SEQIDNO:19) PERVenv-Reverse CAAAGGTGTTGGTGGGATGG (SEQIDNO:20) PERVgag-Forward CGCACACTGGTCCTTGTCGAG (SEQIDNO:21) PERVgag-Reverse TGATCTAGTGAGAGAGGCAGAG (SEQIDNO:22) PigGGTA1-Forward GGAGCCCTTAGGGACCATTA (SEQIDNO:23) PigGGTA1-Reverse GCGCTAAGGAGTGCGTTCTA (SEQIDNO:24) HumanACTB-Forward GCCTTCCTTCCTGGGCATGG (SEQIDNO:25) HumanACTB-Reverse GAGTACTTGCGCTCAGGAGG (SEQIDNO:26)
(58) Quantification of PERV copy numbers infected in HEK293-GFP cells: qPCR was performed to quantify the PERV copy number in HEK293-GFP cells. Genomic DNA of PK15 WT cells of different amounts was used as the template for the qPCR reactions. Reactions were conducted in triplicate using KAPA SYBR FAST qPCR Master Mix Universal (KAPA Biosystems). PERV pol, env, gag primers, human ACTB and pig GGTA1 primers (Methods Table 3) were added to a final concentration of 1 ?M. Reactions were incubated at 95? C. for 3 min (enzyme activation) followed by 50 cycles of 95? C., 5 s (denaturation); 60? C., 60 s (annealing/extension). The logarithm of the genomic DNA amount linearizes with the quantification cycle (Cq). pol, gag, env primers were used to examine for presence of PERVs. Pig GGTA1 primers served to control for potential porcine genome contaminants in human cells after infection. All experiments were conducted in triplicate.
(59) Infectivity Assay of the Modified PK15 clones to HEK293-GFP: 1.Math.10.sup.5 cells of HEK293-GFP cells and 1.Math.10.sup.5 cells of the high modified (15, 20, 29, 38) clones and low modified clones (40,41) were co-cultured in a 6-well plate for 7 days. To isolate the HEK293-GFP cells in order to examine for PERV elements, the GFP positive cells were double sorted to purify the human cell populations.
(60) To quantify the PERV infectivity of different clones to HEK293-GFP cells, both qPCR assays and PCR assays were conducted on series diluted HEK293-GFP cells after sorting. For the qPCR assays, the genomic DNA (DNeasy Blood & Tissue Kit, Qiagen) was extracted from double sorted HEK293-GFP cells. The genomic DNA concentration was measured using Qubit 2.0 fluorometer (Invitrogen). In all, 3 ng of the genomic DNA was added to 20 ?L of KAPA SYBR FAST qPCR reaction (KAPA Biosystems) using PERV pol, env, gag and pig GGTA primers respectively (Extended Data Table 2). The qPCR procedure was performed as described above. For the series dilution assay, purified HEK293-GFP cells were sorted (1 cell/well, 10 cells/well, 100 cells/well, 1000 cells/well) into 96-well PCR plates for direct genomic DNA extraction and PCR reactions. Briefly, cells were sorted into 20 ?L lysis reaction including 2 ?L of 10? KAPA Express Extract Buffer, 0.4 ?L of 1 U/?l KAPA Express Extract Enzyme and 17.6 ?L of PCR-grade water (KAPA Biosystems). The reactions were then incubated at 55? C. for 10 min (lysis), then at 95? C. for 5 min (enzyme inactivation). Subsequently, the PCR master mix was prepared. In all, 2 ?L of the genomic DNA lysis was added to 4 different 25 ?L of KAPA Hifi Hotstart PCR reactions (KAPA Biosystems) using 1 ?M PERV pol, env, gag primers, and pig GGTA primers, respectively (Extended Data Table 2). The reactions were incubated at 95? C. for 3 min (initial denaturation) followed by 35 cycles of 95? C., 15 s (denaturation); 60? C., 15 s (annealing), 72? C., 15 sec/kb, then 75? C., 1 min/kb (final extension). (KAPA Biosystems). The PCR products were visualized on 96 well E-Gel? Agarose Gels, SYBR? Safe DNA Gel (Invitrogen).
(61) CRISPR-Cas9 off-target analysis: whole genome sequencing (WGS) data was obtained for PK15 (untreated cell line) and clone 20 (highly edited clone). To investigate potential off-target effects of the Cas9/2gRNAs, the reference sequence (Sus Scrofa 10.2) was searched for sites that differed from the 20 bp sequences targeted by the two gRNAs by only 1 or 2 bp. 11 such sites were identified and extracted them, together with 200 bp of their neighboring regions (
(62) Mathematical model of DNA repair process interaction during cumulative PERV inactivation: In this study PERV elements were inactivated by mutations generated by DNA repair processes in response to dsDNA cuts created by Cas9. It is generally understood that dsDNA cuts may be repaired either by non-homologous end joining (NHEJ) or Homologous Repair (HR), and that while HR can create precise copies of a DNA template sequence at the cut site given the presence of a template with suitable homology arms, NHEJ can generate mutations (especially indels) and is often considered error prone. However, there is also evidence that NHEJ can also repair dsDNA cuts highly accurately (11, 12), and the relative rates of mutated vs. perfect repair by NHEJ have never been precisely measured. Especially when efficient targeted nucleases such as Cas9 are expressed for protracted time periods, perfect repair of a cut site by either NHEJ or HR would regenerate a target site that could be cut again. A plausible hypothesis is that the process of perfect repair and re-cutting would occur repeatedly until a mutation arose that destroyed the nuclease's ability to recognize the target site. To explore the way these repair modalities might work together during the course of PERV elimination, their interactions as a Markov process was modeled. Specifically, it was assumed: There are N identical copies of the nuclease target in a cell. Only wild-type targets are recognized and cut, and only one target is cut and repaired at a time. DNA repair is either perfect restoration of the target site by NHEJ (with probability n) NHEJ that results in generation of a mutation that ablates target recognition (with probability m) repair by HR using any one of the other N?1 target sequences in the cell (with probability h)
Thus, n+m+h=1.
(63) The Markov model computes the probability distribution P.sup.(c)=(p.sub.0.sup.(c),p.sub.1.sup.(c), . . . , p.sub.N.sup.(c)), where p.sub.i.sup.(c) is the probability that there are i target-ablating mutations at cut c, where c=0, 1, 2 . . . . It is assumed that the initial condition P.sup.(0)=(1,0, . . . , 0), i.e., that all targets begin as wild-type. The N+1-by-N+1 transition matrix M is given as
(64)
Finally, P.sup.(c+1)=P.sup.(c)M for c=0,1,2, . . .
(65) The formulas for M assume proposition ii above and state in mathematical terms that the number of mutated sites in a cell remains unchanged whenever a cut at a wild-type site is repaired perfectly by NHEJ or by HR using another copy of the wild-type template (formula for M(i, i)), but increases by one if the cut is repaired by mutagenic NHEJ or by HR using a previously mutated site (formula for M(i, i+1)).
(66) The model incorporates two notable simplifications to actual biology: (i) Target recognition is assumed to be binaryeither the nuclease recognizes a target or it does not. This is tantamount to assuming that small mutations that still support target recognition do not substantially alter wild-type cutting rates and therefore can be effectively lumped together with wild-type sites. (ii) HR repairs using mutated vs. wild-type templates are assumed to be equally efficient. Modifications could be made to the model to address these simplifications, but this is not considered here. It is also worth noting that, formally, given assumption ii above, the Markov process should actually stop should the condition p.sub.N.sup.(c)=1 be reached for some value of c, since at this point no wild-type sites remain to be cut, whereas what happens instead mathematically is that cuts continue but the model remains in a fixed state. Finally, the model effectively represents the mutation count distribution as a function of independent variable c (number of cuts) and not as a function of time. No prediction is made regarding the time rates of DNA repair or PERV site elimination, although time can be assumed to increase monotonically with c.
(67) To analyze PERV elimination through the Markov model, N was always set to 62. However, since the relative efficiencies of perfect vs. mutagenic NHEJ repair are unknown (as noted above), and because relative rates of mutagenic NHEJ vs. HR repair can vary widely depending on cell state and type, the mutation count distributions for a discrete grid covering the complete two-dimensional space of all possible parameter values for n, m, and h, (2500 parameter combinations in all) was computed. The model was implemented both as a MatLab (Mathworks, Waltham) script and as an R script using the library markovchain (available as Supplemental Files modelMarkov.m, modelMarkov.R, respectively).
(68) In addition to computing the mutation count distribution via the Markov model for particular parameter values, the MatLab script performed random simulations of the NHEJ and HR repair processes throughout a series of K cuts, allowing bivariate distributions of the numbers of total mutations vs. distinct NHEJ events to be estimated, illustrated in
(69) Data Deposition
(70) Illumina Miseq data with PERVs elements genotyping data has been uploaded to the European Nucleotide Archive (ENA) hosted by the European Bioinformatics Institute (EBI) with the submission reference PRJEB11222.
(71) Appendix A provide further information regarding various aspects of the present teachings, which is herein incorporated by reference in its entirety.
(72) The DNA sequence listing further includes genome sequences of multiple endogenous retroviral elements extracted from pig genome sequence and from public sequence databases. (SEQ ID NO:30-280)
(73) The teachings of all patents, published applications and references cited herein are incorporated by reference in their entirety.
(74) While this invention has been particularly shown and described with references to example embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.