Application of breast milk-derived <i>Lactobacillus reuteri </i>in regulating maternal and infant immune function

12133874 ยท 2024-11-05

Assignee

Inventors

Cpc classification

International classification

Abstract

The disclosure discloses application of breast milk-derived Lactobacillus reuteri in regulating the maternal and infant immune function, belonging to the fields of microbiological technology and food science. The disclosure provides the effects of Lactobacillus reuteri Fn041 in enhancing the immunity of pregnant or lactating women and infants, i.e., enhancing the mucosal barrier, promoting the production of intestinal antibacterial peptides and IgA, promoting the development of the immune system of infants, preventing pathogen infection and reducing the incidence of allergic diseases.

Claims

1. A method of enhancing immunity, establishing an intestinal barrier, and/or strengthening the intestinal barrier, which comprises administering to a subject in need thereof Lactobacillus reuteri Fn041 or a composition comprising L. reuteri Fn041, wherein administering the L. reuteri Fn041 enhances immunity, establishes an intestinal barrier, and/or enhances an intestinal barrier in the subject, wherein the subject is an infant, pregnant woman, or lactating woman, and wherein the L. reuteri Fn041 has a preservation number GDMCC No. 60546.

2. The method according to claim 1, wherein the composition is a food or a medicine.

3. The method according to claim 1, wherein enhancing immunity, establishing the intestinal barrier, and/or strengthening the intestinal barrier comprises any one or more of: increasing mRNA expression and secretion of intestinal antibacterial peptide; promoting an increase in intestinal immunoglobulin A and intestinal IgA plasma cells; enhancing the barrier function of intestinal mucosae; enhancing the immunity of pregnant or lactating women; promoting development of the immune system of infants; and increasing L. reuteri in breast milk of the lactating women.

4. The method according to claim 1, wherein the subject is the infant, and wherein the infant is between 0 months and 36 months in age.

5. The method according to claim 1, wherein establishing the intestinal barrier or strengthening the intestinal barrier comprises decreasing a rate of pathogenic bacteria infection, and wherein the pathogenic bacteria comprises Salmonella.

6. The method according to claim 1, wherein the composition comprises an amount of 110.sup.4 cfu to 110.sup.11 cfu of the L. reuteri Fn041, and wherein the composition is administered once per day.

7. The method according to claim 1, wherein the composition comprises an amount of 110.sup.7 cfu to 110.sup.11 cfu of L. reuteri Fn041.

8. The method according to claim 1, wherein the composition comprises L. reuteri Fn041 in an amount of 110.sup.4 cfu/g to 110.sup.12 cfu/g dry matter.

9. The method according to claim 1, wherein the L. reuteri Fn041 is living or inactivated, and wherein the composition comprises fermentation products, or metabolites thereof, or a mixture of any one of the above.

10. The method according to claim 2, wherein the composition is the food.

11. The method according to claim 10, wherein the food is a fermented food that comprises one or more of fermented dairy products, fermented bean products, fermented fruit, and vegetable products.

12. The method according to claim 2, wherein the composition is the medicine and wherein the medicine is in a form of tablets, capsules, solid powder, or oral liquid.

13. The method according to claim 12, wherein the medicine further comprises a pharmaceutically acceptable carrier.

14. The method according to claim 12, wherein the composition further comprises one or more of: prebiotics, Euglena powder or extract, pericarpium citri reticulatae powder or extract, huckleberry fruit powder or extract, wolfberry fruit powder or extract, fructus cannabis powder, fructus cannabis protein, milk protein, animal hydrolyzed protein or peptide, and plant hydrolyzed protein or peptide.

15. The method according to claim 14, wherein the prebiotics comprise one or more of inulin, fructooligosaccharides, short-chain fructooligosaccharides, galactooligosaccharides, human milk oligosaccharides, and cow milk oligosaccharides.

16. A method of enhancing immunity, establishing an intestinal barrier, and/or strengthening the intestinal barrier, which comprises: administering to a subject in need thereof Lactobacillus reuteri Fn041 or a composition comprising L. reuteri Fn041, wherein administering the L. reuteri Fn041 enhances the immunity, establishes the intestinal barrier, and/or enhances the intestinal barrier in the subject, wherein the subject is an infant, pregnant woman, or lactating woman, and wherein the L. reuteri Fn041 has a preservation number GDMCC No. 60546, wherein the composition is a food, and wherein the food comprises fermented dairy products selected from one or more of fermented bean products, fermented fruit, and vegetable products.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1A shows the effect of Lactobacillus reuteri Fn041 treatment on the intestinal villi height;

(2) FIG. 1B shows the effect of Lactobacillus reuteri Fn041 treatment on the intestinal crypt depth;

(3) FIG. 1C shows the effect of Lactobacillus reuteri Fn041 treatment on the intestinal villi to crypt depth ratio;

(4) FIG. 1D shows the effect of Lactobacillus reuteri Fn041 treatment on the mucosal morphology of pups; From left to right are control, Inf, Lacm and CoT, wherein Inf indicates intragastric administration of Lactobacillus to pups, Lacm indicates intragastric administration of Lactobacillus to lactating dams, CoT indicates intragastric administration of Lactobacillus to both dams and pups, ** indicates a significant difference from the control group (p<0.01), and * indicates a significant difference from the control (P<0.05).

(5) FIG. 2A shows the effect of Lactobacillus reuteri Fn041 treatment on the number of IgA plasma cells in the intestinal mucosa of pups, including the average number of IgA.sup.+ cells per unit vill and an optical density per unit area

(6) FIG. 2B shows a typical immunohistochemical staining pattern; from left to right are control, Inf, Lacm and CoT, wherein Inf indicates intragastric administration of Lactobacillus to pups, Lacm indicates intragastric administration of Lactobacillus to dams, CoT indicates intragastric administration of Lactobacillus to both dams and pups, and * indicates a significant difference from the control (P<0.05).

(7) FIG. 3 shows the effect of Lactobacillus reuteri Fn041 treatment on the gene expression of the intestinal antimicrobial peptide pathway in pups. Inf indicates intragastric administration of Lactobacillus to pups, Lacm indicates intragastric administration of Lactobacillus to dams, CoT indicates intragastric administration of Lactobacillus to both dams and pups, ** indicates a significant difference from the control (p<0.01), and * indicates a significant difference from the control (P<0.05).

(8) FIG. 4 shows the effect of Lactobacillus reuteri Fn041 treatment on the bactericidal activity of the intestinal crypt in pups. Inf indicates intragastric administration of Lactobacillus to pups, Lacm indicates intragastric administration of Lactobacillus to dams, CoT indicates intragastric administration of Lactobacillus to both dams and pups, ** indicates a significant difference from the control (p<0.01), and * indicates a significant difference from the control (P<0.05).

(9) FIG. 5 shows the effect of Lactobacillus reuteri Fn041 treatment on intestinal Peyer's patch IgA.sup.+ cell production pathway gene expression in pups. Inf indicates intragastric administration of Lactobacillus to pups, Lacm indicates intragastric administration of Lactobacillus to dams, CoT indicates intragastric administration of Lactobacillus to both dams and pups, ** indicates a significant difference from the control (p<0.01), and * indicates a significant difference from the control (P<0.05).

(10) FIG. 6 shows the effect of Lactobacillus reuteri Fn041 treatment on the expression of intestinal mucosal barrier related genes in pups. Inf indicates intragastric administration of Lactobacillus to pups, Lacm indicates intragastric administration of Lactobacillus to dams, CoT indicates intragastric administration of Lactobacillus to both dams and pups, ** indicates a significant difference from the control (p<0.01), and * indicates a significant difference from the control (P<0.05).

(11) FIG. 7 shows the effect of Lactobacillus reuteri Fn041 treatment on serum IgA, IgE, IgG2a and intestinal sIgA antibody concentration in adult female mice. Control indicates a control group, LR indicates a Lactobacillus reuteri Fn041 treatment group, and * indicates a significant difference between the two groups after a T test (p<0.05).

(12) FIG. 8 shows the effect of Lactobacillus reuteri Fn041 treatment on IgA plasma cell content in the lamina propria of intestinal villi of adult female mice. CON indicates a control group, LR indicates a Lactobacillus reuteri Fn041 treatment group, and * indicates a significant difference between the two groups after a T test (p<0.05).

(13) FIG. 9 shows the effect of Lactobacillus reuteri Fn041 treatment on the morphology of intestinal villi of adult female mice. CON indicates a control group, LR indicates a Lactobacillus reuteri Fn041 treatment group, a significant difference is shown between the two groups after a T test, **p<0.01, and ***p<0.001.

(14) FIG. 10 shows the effect of Lactobacillus reuteri Fn041 treatment on intestinal Peyer's patch IgA.sup.+ cell production pathway gene expression in adult female mice. Control indicates a control group, LR indicates a Lactobacillus reuteri Fn041 treatment group, a significant difference is shown between the two groups after a T test, *p<0.05, and ***p<0.01.

(15) FIG. 11 shows the effect of Lactobacillus reuteri Fn041 treatment on the expression of intestinal mucosal barrier related genes in adult female mice. Control indicates a control group, LR indicates a Lactobacillus reuteri Fn041 treatment group, a significant difference is shown after a Ttest, and **p<0.01.

(16) FIG. 12 shows the effect of Lactobacillus reuteri Fn041 treatment on gene expression of the intestinal antimicrobial peptide pathway in adult female mice. Control indicates a control group, LR indicates a Lactobacillus reuteri Fn041 treatment group, a significant difference in the antibacterial peptide is shown after a T test, *p<0.05, and ***p<0.01.

DETAILED DESCRIPTION

(17) The disclosure will be further explained with specific examples below.

(18) In the data analysis methods adopted in the following examples, experimental results are all expressed in (meanstandard deviation). SPSS 25.0 was used for statistical analysis of data, and one-way analysis of variance (ANOVA) and a Tukey test were used for comparison between groups. When the homogeneity of variance was less than 0.05, a nonparametric independent two-sample T test was conducted, and a Kruskal-Wallis test was used to analyze the data. Significant level: P<0.05, very significant level: P<0.01, and extremely significant level: P<0.001.

Example 1: Animal Experiment

(19) (1) Experimental Method

(20) Animal grouping: 40 BALB/C female mice and 14 BALB/C male mice were fed with common feed at room temperature 22-24 C. and humidity 40-70% with the day and night cycle maintained at 8:00-20:00. The male mice and the female mice were separated for one week, and then put together according to a female to male ratio of 3:1 after one week. After the female mice were pregnant, the male mice were taken out. After the female mice gave birth, the dams were divided into two groups, one group was given normal saline (CON) through intragastric administration, the other group was given Lactobacillus reuteri Fn041 (1101 CFU per mouse per day) through intragastric administration, and when pups reached 3 weeks old, they were weaned naturally. Each group of breast-fed male pups were divided into two groups, which were given normal saline or Lactobacillus reuteri respectively through intragastric administration. After 14 days, the treated pups were killed. The above pups were divided into: (1) Con group, in which both damsdams and pups were given normal saline through intragastric administration; (2) Inf group, in which the damsdams were given normal saline through intragastric administration, and the pups were given Lactobacillus reuteri Fn041 (110.sup.9 CFU per mouse per day); (3) Lacm group, in which the damsdams were given Lactobacillus reuteri Fn041 (110.sup.10 CFU per mouse per day) through intragastric administration, and the pups were given normal saline through intragastric administration; and (4) CO-T group, in which both damsdams and pups were given Lactobacillus reuteri Fn041 through intragastric administration, and the dose for the damsdams was 10.sup.10 CFU per mouse per day and 10.sup.9 CFU per mouse per day for pups.

Example 2 Immunohistochemical Analysis of Intestinal IgA.SUP.+ Plasma Cells

(21) (1) Dehydration: Intestine tissue was put into 50% ethanol, 75% ethanol, 85% ethanol and 90% ethanol respectively for shaking dehydration for 15 min, and then was put in 100% ethanol for treatment for 30 min, wherein the ethanol was replaced every 15 min.

(22) (2) Transparentizing: Ethanol and n-butanol was mixed according to the ratio of 1:1 to obtain a mixed solution, the intestine tissue was put into the mixed solution, shaking was performed for 20 min, the liquid was poured out, and the intestine tissue was transferred to an n-butanol solution for treatment for 40 min, wherein n-butanol was replaced every 20 min.

(23) (3) Wax immersion: Immersing was performed in 70 C. paraffin I for 3 h, and then transferring to 70 C. paraffin II was performed for immersion for 3 h.

(24) (4) Embedding: The intestine tissue treated in step (3) was embedded in paraffin.

(25) (5) Slicing: Jejunum tissue was sliced into pieces with a thickness of 5 m with a Leica microtome, the pieces were spread in a water bath at 42 C., and the pieces were baked at 70 C. for 30 min.

(26) (6) Dewaxing and hydration: Soaking was performed in xylene three times, each time lasting 5 min; soaking was performed in 100% ethanol twice, each time lasting 5 min; soaking was performed in 95% ethanol, 85% ethanol and 75% ethanol sequentially for 3 min respectively; and then washing with deionized water was performed for 5 min.

(27) (7) Antigen repair: 200 mL of EDTA buffer solution with pH 9.0 was added into a dyeing box, the tissue slices after dewaxing and hydration were placed on a plastic slice rack of the dyeing box, heating was performed in an autoclave till saturation, then continuing heating was performed for 5 min, a power supply was turned off, the dyeing box was taken out after 10 min, the dyeing box was cooled at room temperature for 30 min, and the dyeing box was soaked in a PBS buffer solution for 3 min3 times.

(28) (8) 100 L of 3% H.sub.2O.sub.2 was added to each slice, incubating at room temperature was performed for 10 min, and soaking was performed in PBS for 3 min3 times.

(29) (9) The PBS buffer solution was removed, 100 L of 2.5% goat serum was added, incubating at room temperature was performed for 30 min, and a blocking solution was removed.

(30) (10) 100 L of diluted rabbit anti-mouse IgA monoclonal antibody (primary antibody) was added to each slice, incubating was performed at 25 C. for 1 h, and soaking was performed in PBS for 3 min3 times.

(31) (11) PBS was removed, 100 L of goat anti-rabbit IgG monoclonal antibody (secondary antibody) was added, incubating was performed at 25 C. for 30 min, and soaking was performed in PBS for 3 min3 times.

(32) (12) PBS was removed, 100 L of DAB color developing solution prepared in real time was added, color development was performed under a microscope for 5 min, and the reaction was stopped with tap water.

(33) (13) Redyeing was performed with hematoxylin for 12 sec and tap water was used for rinsing.

(34) (14) Differentiating was performed with 1% hydrochloric acid alcohol for 1 sec, tap water was used for washing, and returning to blue with tap water was performed for 5 min.

(35) (15) Dehydration and transparentizing: treating was performed with 75% ethanol, 85% ethanol and 95% ethanol respectively for 3 min, then treating was performed with 100% ethanol for 5 min, the operation was repeated three times, and then soaking was performed in xylene for 5 min and then 3 min.

(36) (16) Sealing with neutral gum and baking in an oven at 60 C. for 20 min were performed.

(37) An eyepiece of a microscope was inverted by 10 times and an objective lens 20 times, and after observation and photo shooting, and Image-Pro Plus software was used for imaging analysis. The mean optical density (density (mean)) was calculated, density (mean)=integrated optical density (IOD)/area. The mean number of plasma cells contained in each villus was counted with the microscope.

(38) The villi height to crypt depth ratio can comprehensively reflect the digestion and absorption function of intestines. The higher the villi, the larger the intestinal surface area and the stronger the intestinal absorption function. The intestinal crypt depth represents the cell production rate. The shallower the crypt, the better the cell maturity and the more mature the secretion function. FIG. 1 shows that the villi height to crypt depth ratio is significantly increased after pups ingest Lactobacillus reuteri (p<0.01), and the villi height to crypt depth ratio can also be increased by giving Lactobacillus reuteri to dams (p<0.05), indicating that Lactobacillus reuteri promotes the intestinal absorption function and crypt cell maturation, and the content of IgA plasma cells in villi can be significantly increased by breast milk combined with intragastric administration to pups (FIG. 2) (p<0.05).

Example 3 Expression and Antibacterial Activity of Antimicrobial Peptide Genes in Intestinal Epithelial Cells of Pups

(39) RNA extraction and cDNA preparation of jejunum and intestine Peyer's patch, comprising the following steps: taking out the liver and spleen of mice in an ultra-clean table, cutting off 0.1 g of jejunum and putting it into Trizol quickly, extracting RNA from the jejunum and Peyer's patch by a Trizol method, determining OD.sub.260/280 and concentration by NanoDrop, adjusting the RNA concentration to 1,000 ng/L, making OD.sub.260/280 within the range of 1.8-2.0, conducting reverse transcription of RNA according to reaction systems in Table 1, mixing with the reaction system in step 1 evenly and then bathing in ice at 70 C. for 5 min, then mixing with the second system evenly and bathing in water at 37 C. for 1 h and in ice at 95 C. for 3 min, and storing the cDNA after reverse transcription at 80 C.

(40) Reverse transcription fluorescence quantitative PCR in jejunum (RT-PCR), comprising the following steps: conducting quantitative PCR analysis by using cDNA after reverse transcription in jejunum as an amplification template, wherein the reaction system: 2SYBR Rreen Master Mix 5 L, 0.4 L for upstream primer and 0.4 L for downstream primer (10 M, see Table 2 for sequence), cDNA 0.3 L, and DEPC water 3.7 L; amplification conditions: 95 C., 5 min; 95 C., 20 sec; 60 C., 30 sec; 72 C., 1 min, 40 cycles, 72 C., 2 min; and using -actin as internal reference, and analyzing the data by a 2-Ct method.

(41) TABLE-US-00001 TABLE 1 Reverse transcription reaction system Reagent Volume (L) Concentration Step 1 RNA 2 1000 ng/L (10 L dNTP 2 10 mM system) Oligo (dT) 1.5 10 mM DEPC water 4.5 Step 2 5 reverse transcription 5 (10 L + buffer 15 L Rnaase inhibitor 0.25 50 U/L system) M-MLV reverse 0.5 200 U/L transcriptase DEPC water 9.25

(42) TABLE-US-00002 TABLE2 Real-timefluorescencequantitativeRT-PCRprimer Serial table Genename Sequence number Epithelialcellmucosalbarrierrelatedgenes -actin F:TGACGTTGACATCCGTAAAGACC; SEQIDNO: R:CTCAGGAGGAGCAATGATCTTGA 1/2 ZO-1 F:TACCTCTTGAGCCTTGAACTT; SEQIDNO: R:CGTGCTGATGTGCCATAATA 3/4 ZO-2 F:GCCAAAACCCAGAACAAAGA; SEQIDNO: R:ACTGCTCTCTCCCACCTCCT 5/6 Occludin F:GTGTGGTTGATCCCCAGGAG; SEQIDNO: R:TCGCTTGCCATTCACTTTGC 7/8 Claudin-2 F:CCCAGGCCATGATGGTGA; SEQIDNO: R:TCATGCCCACCACAGAGATAAT 9/10 PlgR F:AGTAACCGAGGCCTGTCCTT; SEQIDNO: R:GTCACTCGGCAACTCAGGA 11/12 MUC2 F:CCCAGAAGGGACTGTGTATG; SEQIDNO: R:TGCAGACACACTGCTCACA 13/14 PeyerspatchIgAplasmacellinductionpathway CXCR5 F:ATGAACTACCCACTAACCCTGG; SEQIDNO: R:TGTAGGGGAATCTCCGTGCT 15/16 CXCL13 F:GGCCACGGTATTCTGGAAGC; SEQIDNO: R:GGGCGTAACTTGAATCCGATCTA 17/18 APRIL F:CTTTCGGTTGCTCTTTGGTTG; SEQIDNO: R:CGACAGCACAAGTCACAGC 19/20 TGF- F:CTCCCGTGGCTTCTAGTGC; SEQIDNO: R:GCCTTAGTTTGGACAGGATCTG 21/22 Foxp3 F:CCCATCCCCAGGAGTCTTG; SEQIDNO: R:ACCATGACTAGGGGCACTGTA 23/24 Intestinalantimicrobialpeptide productionpathwaygenes TLR2 F:AAAATGTCGTTCAAGGAG SEQIDNO: R:TTGCTGAAGAGGACTGTT 25/26 TLR4 F:GGAACAAACAGCCTGAGACAC SEQIDNO: R:CAAGGGATAAGAACGCTGAGAA 27/28 TLR9 F:GGTGTGGAACATCATTCT; SEQIDNO: R:ATACGGTTGGAGATCAAG 29/30 MyD88 F:TGGCATGCCTCCATCATAGTTAACC; SEQIDNO: R:GTCAGAAACAACCACCACCATGC 31/32 NF-kB F:AGGCTTCTGGGCCTTATGTG; SEQIDNO: R:TGCTTCTCTCGCCAGGAATAC 33/34 CRS1C F:TGCTCTTCAAGATGTAGCCCAACG; SEQIDNO: R:TGGAGCTTGGGTGGTGATTGCA 35/36 CRS4C F:GCATGGAATCTGGGTCAAGATAAC; SEQIDNO: R:AGAAGGAAGAGCAATCAAGGCTAAG 37/38 RegIII- F:TTCCTGTCCTCCATGATCAAAA; SEQIDNO: R:CATCCACCTCTGTTGGGTTCA 39/40 a-defensin F:ATCATCCAGGTGATTCCCAGCCAT; SEQIDNO: R:TTCCGGGTCTCCAAAGGAAACAGA 41/42

(43) Preparation of intestine crypt and evaluation of antibacterial activity of antibacterial peptide, comprising the following steps: washing a segment of intestine cavity of mice with precooled sterile water, everting the intestinal segment and shaking in a PBS buffer containing 30 mM EDTA without Ca.sup.++ and Mg.sup.++ to elute the crypts, eluting the villi and crypts several times at 5 min intervals, conducting centrifugation (700 g), resuspending in the PBS buffer, transferring a single crypt into a silicified microcentrifuge tube with a capillary pipette, estimating about 1000 crypts by a blood cell counting method, resuspending in 2 ml of iPIPES buffer (10 mM PIPES+137 mM NaCl, pH 7.4), adding Salmonella at 1000 CFU/crypt, incubating at 37 C. for 30 min, conducting centrifugation on the crypts, take 10 l of supernatant, spreading it on a nutrient agar plate, determining the colony number after growing overnight, and measuring the germicidal rates for 1, 2.5, 5, 10, 15 and 30 min respectively.

(44) The antimicrobial peptide expressed by Paneth cells at the base of the intestinal crypt is an important defensive molecule in the intestinal tract, which is secreted into the intestinal mucus layer to resist the invasion of pathogenic bacteria and potentially pathogenic symbiotic bacteria. Peptidoglycan, endotoxin, bacterial DNA released by bacterial cells are combined with toll-like receptors (TLR2, TLR4, TLR9, etc.) of Paneth cells, and through signal transduction mediated by transducing protein MyD88, Nf-B sub-protein in cytoplasm can be released, enter cells and induce a variety of antimicrobial expressions. FIG. 3 shows that the expression of the TLR4 gene in the intestine of the three groups of mice was significantly inhibited by about 0.5 times, and the expression of the TLR-9 gene was activated by 0.5-1 time respectively (p<0.05), and the expression of TLR2 was significantly increased by direct intragastric administration to pups, which was twice as high as that of the control (p<0.05). Besides, all the three treatments inhibited the expression of Myd88 (p<0.05), and significantly induced the expression of -defense peptide, CRS1C and CRS4C. The expression of reg3g and CRS1C was also significantly induced by direct intragastric administration to pups, and the expression of Reg3g and a-defensin was even increased by 2 times and 1.5 times respectively (p<0.05).

(45) FIG. 4 shows that treating the intestinal crypt cells of mice in three ways also significantly inhibited Salmonella. A lethal rate of 50% can be achieved within 5 min simply by treating the secretions of 1000 crypts of pups, and a lethal rate of 50% for Salmonella can be achieved within 10 min by treating the damsdams or the damsdams and pups simultaneously. The bacteriostatic effect was significantly higher than that of the control.

Example 4 Intestinal Peyer's Patch IgA Gene Expression in Pups

(46) IgA is the most important active molecule of the intestinal immune system, which is mainly released into the mucous layer in the form of secretory IgA (sIgA) to restrain the excessive proliferation and migration of pathogenic bacteria. Intestinal Peyer's patch is the initial induction site of IgA plasma cells. Bacteria are absorbed by M cells of the Peyer's patch and then transmitted to dendritic cells (DC), so as to activate DC, induce follicular dendritic cells (FDC) to produce TGF1 and CLCL13 through TLR and FDC, and promote Foxp3-T cells to transform into follicular helper T(Tfh) cells, which express CXCR5. Under the participation of TGF, the antibodies expressed by initial IgM.sup.+ B cells undergo class conversion and are differentiated into IgA.sup.+ B cells. After migrating to the lamina propria, these cells are transformed into IgA plasma cells, which can produce and secrete IgA. IgM.sup.+ cells in the lamina propria can be transformed into IgA.sup.+ cells under the action of APPIL on the premise that the intestinal immune function is mature.

(47) RNA extraction and fluorescent quantitative PCR (RT-PCR) were carried out according to the method of Example 3. Results are shown in FIG. 5. The expression of Peyer's patch CXCR5, CXCL13, APPIL, TGF- and Foxp3 were significantly induced by treating pups or damsdams separately or simultaneously (P<0.01), and the expression was increased by about one time. The results indicate that Lactobacillus reuteri treatment causes Foxp3.sup.+T to become intestinal chemotaxis and participate in the production of IgA.sup.+ plasma cells.

Example 5 Expression of Intestinal Mucosal Barrier Related Genes in Pups Corresponding to Different Treatments

(48) According to the grouping of Example 1, an animal experiment was carried out. The mice were given 4 kDa fluorescein isothiocyanate-dextran (FD4, 125 mg/mL) (600 mg/kg body weight) through intragastric administration. After 4 hours, the eyeballs were taken for blood collection, and all treatments after blood collection needed to be protected from light. Blood was incubated at room temperature (RT) for at least 1 h to coagulate blood, and high-speed centrifugation was conducted for 10 min to separate serum. Serum aliquot was diluted with PBS 1:1 in duplicate, and fluorescence readings at 488/530 nm were analyzed. The concentration of FD4 in serum samples was determined according to the FD4 standard curve value of PBS continuous dilution. The control mouse serum of FD4 in all the serum samples was standardized.

(49) As shown in FIG. 6, the concentration of FD4 in blood decreased by all three treatments, indicating that the permeability of the mucous membrane of pups was improved, and the concentration of FD4 could be reduced by at least 20% by treating only pups and treating pups and damsdams simultaneously.

(50) The first line of defense against symbiotic bacteria and pathogenic bacteria in infants' intestines is the intestinal mucosal barrier, and this physical barrier includes biochemical and immune components. The physical barrier is mainly composed of intestinal epithelial cells through tight junctions, and the chemical barrier is mainly composed of mucus covering the intestinal surface. The tight junction is a complex composed of intracellular zona occludens (ZO1), Claudin, and intercellular Occludin. The expression of Claudin-2 was down-regulated and the expression of ZO1 and Occludin genes was up-regulated when the mucosal barrier weakened. Mucus is mainly composed of mucin 2 expressed by epithelial cells, and its enhanced expression is beneficial to the maintenance of the mucus barrier.

(51) FIG. 6 shows that pups ingesting Lactobacillus reuteri Fn041 can significantly up-regulate the expression of ZO-2 and ZO-1 mRNA and mucin-2, and the increase amount can reach 0.5-3 times. Claudin-2 can be significantly inhibited and mucin-2 mRNA can be induced after damsdams ingest Lactobacillus reuteri, which indicates that ingestion of Lactobacillus reuteri Fn041 in different ways can improve the mucosal barrier.

Example 6 Effects of Different Treatments on Intestinal Immune Function, Intestinal Morphology and Mucosal Barrier of Damsdams

(52) Intestine tissue was treated according to the method of Example 1, and the content of sIgA in the intestine of the damsdams was determined strictly according to the instructions of sIgA ELISA kit.

(53) After treatment with Lactobacillus reuteri, serum IgA, IgE and intestinal sIgA of the damsdams increased significantly (p<0.05) (FIG. 7). Serum IgA increased from 11.97 ng/mL to 12.10 ng/mL, and IgE increased from 11.55 ng/mL to 11.73 ng/mL, indicating that mucosal immunity and systemic immunity were both enhanced. Besides, the number of IgA plasma cells in the lamina propria of the intestine of the damsdams increased by about one time (p<0.05, FIG. 8), and the expression of two genes CXCR5 (p<0.05) and CXCL13 (p<0.01) related to IgA plasma cell transformation in the Peyer's patch of the intestine increased significantly (FIG. 10), which further indicate that mucosal immunity was enhanced, so as to prevent bacterial infection and diarrhea and prevent allergic diseases such as eczema. FIG. 9 shows that after treating breast milk with Lactobacillus reuteri, the intestinal villi height and the intestinal villi to crypt depth ratio both increased by 60% or more, and the expression intensity of PIgR, mucin-2 and Occludin genes increased by 0.5 times, 4 times and 1.4 times, respectively. The FITC-F000 entering blood was reduced from 3.2 g/mL to 2.1 g/mL by Lactobacillus reuteri treatment (FIG. 11), indicating that the intestinal tissue structure and mucosal integrity was improved. According to the method of Example 4, the mouse crypts were isolated and cultured, and it was found that the ability of killing Salmonella of mouse crypts treated with Lactobacillus reuteri was significantly higher than that of the control (p<0.01, FIG. 12). Lactobacillus reuteri Fn041 also significantly enhanced the expression of several genes related to the antimicrobial peptide pathway in the intestinal mucosa of the dams, and increased the expression intensity of a-defesin, MyD88, ReglIl-gamma, CRS1C and TLR2 by 3.5 times, 0.25 times, 0.3 times, 3.1 times and 2.2 times respectively. In the receptor, TLR2, TLR4 and TLR9 recognized bacterial peptidoglycan/lipoteichoic acid, lipopolysaccharide and CpG unmethylated DNA respectively, and only TRL2 expression was significantly up-regulated, indicating that Lactobacillus reuteri mainly stimulated the expression of antibacterial peptides through cytopeptidoglycan/lipoteichoic acid.

Example 7 Prevention of Salmonella Infection with Lactobacillus reuteri FN041

(54) Six-week-old male C57BL/6J mice without specific pathogen were divided into three groups (30 mice in each group): (1) control group: treated with 0.1 mL of phosphate buffer through intragastric administration; (2) Salmonella infection group (SI): treated with 0.1 mL of phosphate buffer through intragastric administration for 10 days, and then infected with 1.010.sup.6 Salmonella typhimurium SL1344 for 10 days every day; (3) Lactobacillus reuteri Fn041 intervention group (Fn041+SI): firstly treated with Lactobacillus reuteri Fn041 for 20 days (110.sup.9 CFU per mouse per day, suspended in 100 L of phosphate buffer), and treated with Salmonella infection every day from the 11.sup.th day to the 20.sup.th day. The experiment was ended on the 21.sup.st day.

(55) As shown in FIG. 13, the survival rate of mice infected with Salmonella was only 40% on the 20.sup.th day, but the survival rate of mice treated with Lactobacillus reuteri Fn041 increased to 70%, and there was a significant difference in the survival rate (p<0.01). The experiment further shows that Fn041 can enhance the resistance to pathogenic bacteria infection by enhancing the mucosal immunity of mice.

Example 8 Preparation of Formula Food with Lactobacillus reuteri Fn041

(56) An de Man, Rogosa and Sharpe medium was inoculated with Lactobacillus reuteri Fn041, culturing was performed at 35-37 C. until the concentration of bacteria was 110.sup.3 CFU/mL, and the bacterial cells were collected.

(57) Optionally, a protective agent was added to the bacterial cells to prepare bacterial powder. The protective agent can be selected from monosaccharide, oligosaccharide, polysaccharide, polyol or a mixture thereof, such as trehalose, sorbitol, mannitol, etc.

(58) The Lactobacillus reuteri Fn041 prepared by any one of the above methods was added to food in an amount of 110.sup.4 to 110.sup.11, preferably 110.sup.7 to 110.sup.11 cfu/unit mass (g) or unit volume (mL).

(59) Optionally, the food also contains prebiotics, Euglena powder or Euglena extract, pericarpium citri reticulatae powder or pericarpium citri reticulatae extract, huckleberry fruit powder or huckleberry fruit extract, wolfberry fruit powder or wolfberry fruit extract, fructus cannabis powder, fructus cannabis protein, milk protein, and animal and plant hydrolyzed protein or peptide.

(60) The prebiotics include, but are not limited to, inulin, fructooligosaccharides, short-chain fructooligosaccharides, galactooligosaccharides, human milk oligosaccharides or cow milk oligosaccharides or a combination of the above prebiotics.