METHODS, SYNTHETIC HOSTS AND REAGENTS FOR THE BIOSYNTHESIS OF DIENES AND DERIVATIVES THEREOF
20180094282 ยท 2018-04-05
Assignee
Inventors
- Stephen Thomas Cartman (Eaglescliffe, GB)
- Alexander Brett Foster (Yarm, GB)
- Ana Teresa dos Santos Brito Mendes (Eaglescliffe, GB)
- Mark Paul Taylor (Middlesbrough, GB)
Cpc classification
C12R2001/01
CHEMISTRY; METALLURGY
C12P5/007
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
C12P5/026
CHEMISTRY; METALLURGY
Y02E50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y503/03002
CHEMISTRY; METALLURGY
International classification
Abstract
Methods and compositions for synthesizing dienes and derivative thereof, such as isoprene, in Cupriavidus necator are provided.
Claims
1. A method for synthesizing isoprene or derivatives thereof in Cupriavidus necator, said method comprising: enzymatically converting isopentenyl-pyrophosphate to dimethylallylpyrophosphate using a polypeptide having isopentenyl diphosphate isomerase enzyme activity; and/or enzymatically converting dimethylallylpyrophosphate to isoprene using a polypeptide having isoprene synthase enzyme activity.
2. The method of claim 1 wherein the polypeptide having isopentenyl diphosphate isomerase enzyme activity: (a) has at least 70% sequence identity to an amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof; (b) comprises the amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof; (c) is encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence set forth in any of SEQ ID NOs: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof; or (d) is encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NOs: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof.
3-6. (canceled)
7. The method of claim 1 wherein the polypeptide having isoprene synthase enzyme activity: (a) has at least 70% sequence identity to the amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof; (b) comprises the amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof; (c) is encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 14 or a functional fragment thereof; or (d) is encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 14 or a functional fragment thereof.
8-19. (canceled)
20. The method of claim 1, wherein said method is performed in a recombinant Cupriavidus necator host.
21. The method of claim 20 wherein the recombinant Cupriavidus necator host comprises an exogenous nucleic acid sequence encoding a polypeptide having isopentenyl diphosphate isomerase enzyme activity.
22. The method of claim 21 wherein the polypeptide having isopentenyl diphosphate isomerase enzyme activity: (a) has at least 70% sequence identity to an amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof; (b) comprises an amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof; (c) has at least 70% sequence identity to the nucleic acid sequence set forth in any of SEQ ID NOs: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof; or (d) comprises SEQ ID NO: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof.
23-25. (canceled)
26. The method of claim 20 wherein the recombinant Cupriavidus necator host comprises an exogenous nucleic acid encoding a polypeptide having isoprene synthase enzyme activity.
27. The method of claim 26 wherein the polypeptide having isoprene synthase enzyme activity: (a) has at least 70% sequence identity to an amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof; (b) comprises an amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof; (c) has at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 14 or a functional fragment thereof; or (d) comprises SEQ ID NO: 14 or a functional fragment thereof.
28-30. (canceled)
31. The method of claim 20 wherein the recombinant Cupriavidus necator host comprises an exogenous nucleic acid encoding a polypeptide having isopentenyl diphosphate isomerase enzyme activity and an exogenous nucleic acid encoding a polypeptide having isoprene synthase enzyme activity.
32. The method of claim 20 wherein the recombinant Cupriavidus necator host has been transfected with a vector comprising any of SEQ ID NOs: 15, 16, 17, 18, 19, 20 or 21.
33. The method of claim 1, wherein at least one of the enzymatic conversions comprises gas fermentation within the Cupriavidus necator.
34. The method of claim 33, wherein the gas fermentation comprises at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical or petrochemical industry.
35. The method of claim 34 wherein the gas fermentation comprises CO.sub.2/H.sub.2.
36. The method of claim 1, further comprising recovering produced isoprene.
37. A substantially pure recombinant Cupriavidus necator host capable of producing isoprene via a methylerythritol phosphate (MEP) pathway.
38. The recombinant Cupriavidus necator host of claim 37 comprising an exogenous nucleic acid sequence encoding a polypeptide having isopentenyl diphosphate isomerase enzyme activity.
39. The recombinant Cupriavidus necator host of claim 38 wherein the polypeptide having isopentenyl diphosphate isomerase enzyme activity: (a) has at least 70% sequence identity to an amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof; (b) comprises an amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof; (c) has at least 70% sequence identity to the nucleic acid sequence set forth in any of SEQ ID NOs: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof; or (d) comprises SEQ ID NO: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof.
40-42. (canceled)
43. The recombinant Cupriavidus necator host of claim 37 comprising an exogenous nucleic acid sequence encoding a polypeptide having isoprene synthase enzyme activity.
44. The recombinant Cupriavidus necator host of claim 43 wherein the polypeptide having isoprene synthase enzyme activity: (a) has at least 70% sequence identity to an amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof; (b) comprises an amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof; (c) has at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 14 or a functional fragment thereof; or (d) comprises SEQ ID NO: 14 or a functional fragment thereof.
45-47. (canceled)
48. The recombinant Cupriavidus necator host of claim 37 comprising an exogenous nucleic acid sequence encoding a polypeptide having isopentenyl diphosphate isomerase enzyme activity and an exogenous nucleic acid sequence encoding a polypeptide having isoprene synthase enzyme activity.
49. The recombinant Cupriavidus necator host of claim 48, wherein at least one of the exogenous nucleic acid sequences is contained within a plasmid.
50. The recombinant Cupriavidus necator host of claim 48, wherein at least one of the exogenous nucleic acid sequences is integrated into a chromosome of the host.
51. The recombinant Cupriavidus necator host of claim 37 which has been transfected with a vector comprising any of SEQ ID NOs: 15, 16, 17, 18, 19, 20 or 21.
52. The recombinant Cupriavidus necator host of claim 37, wherein the host performs the enzymatic synthesis by gas fermentation.
53. The recombinant Cupriavidus necator host of claim 52, wherein the gas fermentation comprises at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical or petrochemical industry.
54. The recombinant Cupriavidus necator host of claim 53, wherein the gas fermentation comprises CO.sub.2/H.sub.2.
55. A bioderived isoprene produced in a recombinant Cupriavidus necator host according to claim 37, wherein said bioderived isoprene has a carbon-12, carbon-13, and carbon-14 isotope ratio that reflects an atmospheric carbon dioxide uptake source.
56. A bio-derived, bio-based, or fermentation-derived product produced from the method of claim 1, wherein said product comprises: (i) a composition comprising at least one bio-derived, bio-based, or fermentation-derived compound or any combination thereof; (ii) a bio-derived, bio-based, or fermentation-derived polymer comprising the bio-derived, bio-based, or fermentation-derived composition or compound of (i), or any combination thereof; (iii) a bio-derived, bio-based, or fermentation-derived cis-polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, comprising the bio-derived, bio-based, or fermentation-derived compound or bio-derived, bio-based, or fermentation-derived composition of (i), or any combination thereof or the bio-derived, bio-based, or fermentation-derived polymer of (ii), or any combination thereof; (iv) a molded substance obtained by molding the bio-derived, bio-based, or fermentation-derived polymer of (ii), or the bio-derived, bio-based, or fermentation-derived rubber of (iii), or any combination thereof; (v) a bio-derived, bio-based, or fermentation-derived formulation comprising the bio-derived, bio-based, or fermentation-derived composition of (i), the bio-derived, bio-based, or fermentation-derived compound of (i), the bio-derived, bio-based, or fermentation-derived polymer of (ii), the bio-derived, bio-based, or fermentation-derived rubber of (iii), or the bio-derived, bio-based, or fermentation-derived molded substance of (iv), or any combination thereof; or (vi) a bio-derived, bio-based, or fermentation-derived semi-solid or a non-semi-solid stream, comprising the bio-derived, bio-based, or fermentation-derived composition of (i), the bio-derived, bio-based, or fermentation-derived compound of (i), the bio-derived, bio-based, or fermentation-derived polymer of (ii), the bio-derived, bio-based, or fermentation-derived rubber of (iii), the bio-derived, bio-based, or fermentation-derived formulation of (iv), or the bio-derived, bio-based, or fermentation-derived molded substance of (v), or any combination thereof.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0017]
[0018]
DETAILED DESCRIPTION
[0019] Cupriavidus necator is a Gram-negative soil bacterium of the Betaproteobacteria class. This hydrogen-oxidizing bacterium is capable of growing at the interface of anaerobic and aerobic environments and easily adapts between heterotrophic and autotrophic lifestyles. Sources of energy for the bacterium include both organic compounds and hydrogen. C. necator does not naturally contain genes for isoprene synthase (ISPS) or isopentyl diphosphate isomerase (IDI) and therefore does not express these enzymes.
[0020] The present invention provides methods and compositions for synthesizing isoprene in C. necator. In the methods and compositions of the present invention, C. necator is used to synthesize isoprene via a methylerythritol phosphate (MEP) pathway.
[0021] Surprisingly, the inventors herein have found that the overexpression of IDI and ISPS in C. necator resulted in the production of isoprene, via the MEP pathway. Various vectors were constructed and confirmed by sequencing. Vectors constructed included pBBR1-ISPS, pBBR1-EC IDI-ISPS, pBBR1-BS IDI-ISPS, pBBR1-SCIDI-ISPS, pBBR1EF-IDI-ISPS, pBBR1-SPyrIDI-ISPS and pBBR1-Spneu IDI-ISPS. Images of the constructed vectors are set forth in
[0022] This document thus provides methods and compositions which can convert central precursors including isopentenyl-pyrophosphate and/or dimethylallylpyrophosphate into isoprene.
[0023] As used herein, the term central precursor is used to denote any metabolite in any metabolic pathway described herein leading to the synthesis of isoprene.
[0024] The term central metabolite is used herein to denote a metabolite that is produced in all microorganisms to support growth.
[0025] A nonlimiting example of a C. necator host useful in the present invention is a C. necator of the H16 strain. In one nonlimiting embodiment, a C. necator host of the H16 strain with the phaCAB gene locus knocked out (phaCAB) is used.
[0026] In one nonlimiting embodiment, the method comprises enzymatically converting isopentenyl-pyrophosphate to dimethylallylpyrophosphate using a polypeptide having IDI enzyme activity.
[0027] Polypeptides having IDI enzyme activity and nucleic acids encoding IDIs have been identified from various organisms and are readily available in publicly available databases such as GenBank or EMBL. Examples include, but are in no way limited to, IDIs from E. coli, B. subtilis, S. cerevisiae, E. faecalis, S. pyrogenes and S. pneumonia. In one nonlimiting embodiment, the polypeptide having IDI enzyme activity has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having IDI enzyme activity comprises the amino acid sequence set forth in any of SEQ ID NOs: 1, 2, 3, 4, 5 or 6 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having IDI enzyme activity is encoded by a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in any of SEQ ID NOs: 8, 9, 10, 11, 12 or 13 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having IDI enzyme activity is encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NOs. 8, 9, 10, 11, 12 or 13 or a functional fragment thereof.
[0028] In another nonlimiting embodiment, the method comprises enzymatically converting dimethylallylpyrophosphate to isoprene using a polypeptide having ISPS enzyme activity.
[0029] Polypeptides having ISPS enzyme activity and nucleic acids encoding ISPSs have been identified from various organisms and are readily available in publicly available databases such as GenBank or EMBL. A nonlimiting example is the ISPS of Populus alba. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity comprises the amino acid sequence set forth in SEQ ID NO: 7 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity is encoded by a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 14 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity is encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NOs. 14 or a functional fragment thereof.
[0030] In one nonlimiting embodiment, the method for synthesizing isoprene in Cupriavidus necator comprises enzymatically converting isopentenyl-pyrophosphate to dimethylallylpyrophosphate using a polypeptide having IDI enzyme activity and enzymatically converting dimethylallylpyrophosphate to isoprene using a polypeptide having ISPS enzyme activity. In this embodiment, any of the polypeptides having IDI enzyme activity or ISPS enzyme activity described supra can be used.
[0031] The percent identity (homology) between two amino acid sequences can be determined as follows. First, the amino acid sequences are aligned using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLAST containing BLASTP version 2.0.14. This stand-alone version of BLAST can be obtained from the U.S. government's National Center for Biotechnology Information web site (www with the extension ncbi.nlm.nih.gov). Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two amino acid sequences using the BLASTP algorithm. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq-i c:\seq1.txt-j c:\seq2.txt-p blastp-o c:\output.txt. If the two compared sequences share homology (identity), then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology (identity), then the designated output file will not present aligned sequences. Similar procedures can be following for nucleic acid sequences except that blastn is used.
[0032] Once aligned, the number of matches is determined by counting the number of positions where an identical amino acid residue is presented in both sequences. The percent identity (homology) is determined by dividing the number of matches by the length of the full-length polypeptide amino acid sequence followed by multiplying the resulting value by 100. It is noted that the percent identity (homology) value is rounded to the nearest tenth. For example, 90.11, 90.12, 90.13, and 90.14 is rounded down to 90.1, while 90.15, 90.16, 90.17, 90.18, and 90.19 is rounded up to 90.2. It also is noted that the length value will always be an integer.
[0033] It will be appreciated that a number of nucleic acids can encode a polypeptide having a particular amino acid sequence. The degeneracy of the genetic code is well known to the art; i.e., for many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid. For example, codons in the coding sequence for a given enzyme can be modified such that optimal expression in a particular species (e.g., bacteria or fungus) is obtained, using appropriate codon bias tables for that species.
[0034] Functional fragments of any of the polypeptides or nucleic acid sequences described herein can also be used in the methods of the document. The term functional fragment as used herein refers to a peptide fragment of a polypeptide or a nucleic acid sequence fragment encoding a peptide fragment of a polypeptide that has at least 25% (e.g., at least: 30%; 40%; 50%; 60%; 70%; 75%; 80%; 85%; 90%; 95%; 98%; 99%; 100%; or even greater than 100%) of the activity of the corresponding mature, full-length, polypeptide. The functional fragment can generally, but not always, be comprised of a continuous region of the polypeptide, wherein the region has functional activity.
[0035] In one nonlimiting embodiment, methods of the present invention are performed in a recombinant Cupriavidus necator host. Recombinant hosts can naturally express none or some (e.g., one or more, two or more) of the enzymes of the pathways described herein. Endogenous genes of the recombinant hosts also can be disrupted to prevent the formation of undesirable metabolites or prevent the loss of intermediates in the pathway through other enzymes acting on such intermediates. Recombinant hosts can be referred to as recombinant host cells, engineered cells, or engineered hosts. Thus, as described herein, recombinant hosts can include exogenous nucleic acids encoding one or more of IDIs and/or ISPSs, as described herein.
[0036] The term exogenous as used herein with reference to a nucleic acid (or a protein) and a host refers to a nucleic acid that does not occur in (and cannot be obtained from) a cell of that particular type as it is found in nature or a protein encoded by such a nucleic acid. Thus, a non-naturally-occurring nucleic acid is considered to be exogenous to a host once in the host. It is important to note that non-naturally-occurring nucleic acids can contain nucleic acid subsequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature. For example, a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non-naturally-occurring nucleic acid, and thus is exogenous to a host cell once introduced into the host, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature. Thus, any vector, autonomously replicating plasmid, or virus (e.g., retrovirus, adenovirus, or herpes virus) that as a whole does not exist in nature is considered to be non-naturally-occurring nucleic acid. It follows that genomic DNA fragments produced by PCR or restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally-occurring nucleic acid. A nucleic acid that is naturally-occurring can be exogenous to a particular host microorganism. For example, an entire chromosome isolated from a cell of yeast x is an exogenous nucleic acid with respect to a cell of yeast y once that chromosome is introduced into a cell of yeast y.
[0037] In contrast, the term endogenous as used herein with reference to a nucleic acid (e.g., a gene) (or a protein) and a host refers to a nucleic acid (or protein) that does occur in (and can be obtained from) that particular host as it is found in nature. Moreover, a cell endogenously expressing a nucleic acid (or protein) expresses that nucleic acid (or protein) as does a host of the same particular type as it is found in nature. Moreover, a host endogenously producing or that endogenously produces a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as does a host of the same particular type as it is found in nature.
[0038] In one nonlimiting embodiment of the present invention, the method for isoprene production is performed in a recombinant Cupriavidus necator host comprising an exogenous nucleic acid sequence encoding a polypeptide having IDI enzyme activity. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having IDI enzyme activity as described supra can be used.
[0039] In another nonlimiting embodiment of the present invention, the method is performed using a recombinant Cupriavidus necator host comprising an exogenous nucleic acid encoding a polypeptide having ISPS enzyme activity. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having ISPS enzyme activity as described supra can be used.
[0040] In another nonlimiting embodiment, the method is performed using a recombinant Cupriavidus necator host comprising an exogenous nucleic acid encoding a polypeptide having IDI enzyme activity and an exogenous nucleic acid encoding a polypeptide having ISPS enzyme activity. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having IDI enzyme activity and any of the nucleic acid sequences having ISPS enzyme activity as described supra can be used.
[0041] In another nonlimiting embodiment, the method for isoprene production of the present invention is performed in a recombinant Cupriavidus necator host which has been transformed with a vector comprising any of SEQ ID NOs:15, 16, 17, 18, 19, 20 or 21.
[0042] In any the methods described herein, a fermentation strategy can be used that entails anaerobic, micro-aerobic or aerobic cultivation. A fermentation strategy can entail nutrient limitation such as nitrogen, phosphate or oxygen limitation. A cell retention strategy using a ceramic hollow fiber membrane can be employed to achieve and maintain a high cell density during fermentation. The principal carbon source fed to the fermentation can derive from a biological or non-biological feedstock. The biological feedstock can be, or can derive from, monosaccharides, disaccharides, lignocellulose, hemicellulose, cellulose, lignin, levulinic acid and formic acid, triglycerides, glycerol, fatty acids, agricultural waste, condensed distillers' solubles or municipal waste. The non-biological feedstock can be, or can derive from, natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue (NVR) a caustic wash waste stream from cyclohexane oxidation processes or waste stream from a chemical or petrochemical industry.
[0043] In one nonlimiting embodiment, at least one of the enzymatic conversions of the isoprene production method comprises gas fermentation within the Cupriavidus necator. In this embodiment, the gas fermentation may comprise at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical or petrochemical industry. In one nonlimiting embodiment, the gas fermentation comprises CO.sub.2/H.sub.2.
[0044] The methods of the present invention may further comprise recovering produced isoprene from the Cupriavidus necator.
[0045] Once produced, any method can be used to isolate isoprene. For example, isoprene can be recovered from the fermenter off-gas stream as a volatile product as the boiling point of isoprene is 34.1 C. At a typical fermentation temperature of approximately 30 C., isoprene has a high vapor pressure and can be stripped by the gas flow rate through the broth for recovery from the off-gas. Isoprene can be selectively adsorbed onto, for example, an adsorbent and separated from the other off-gas components. Membrane separation technology may also be employed to separate isoprene from the other off-gas compounds. Isoprene may desorbed from the adsorbent using, for example, nitrogen and condensed at low temperature and high pressure.
[0046] Compositions for synthesizing isoprene in C. necator are also provided by the present invention.
[0047] In one nonlimiting embodiment, a substantially pure recombinant C. necator host capable of producing isoprene via a methylerythritol phosphate (MEP) pathway is provided.
[0048] As used herein, a substantially pure culture of a recombinant host microorganism is a culture of that microorganism in which less than about 40% (i.e., less than about 35%; 30%; 25%; 20%; 15%; 100; 5%; 2%; 1%; 0.5%; 0.25%; 0.1%; 0.01%; 0.001%; 0.0001%; or even less) of the total number of viable cells in the culture are viable cells other than the recombinant microorganism, e.g., bacterial, fungal (including yeast), mycoplasmal, or protozoan cells. The term about in this context means that the relevant percentage can be 15% of the specified percentage above or below the specified percentage. Thus, for example, about 20% can be 17% to 23%. Such a culture of recombinant microorganisms includes the cells and a growth, storage, or transport medium. Media can be liquid, semi-solid (e.g., gelatinous media), or frozen. The culture includes the cells growing in the liquid or in/on the semi-solid medium or being stored or transported in a storage or transport medium, including a frozen storage or transport medium. The cultures are in a culture vessel or storage vessel or substrate (e.g., a culture dish, flask, or tube or a storage vial or tube).
[0049] In one nonlimiting embodiment, the recombinant C. necator host comprises an exogenous nucleic acid sequence encoding a polypeptide having IDI enzyme activity. Any nucleic acid sequence encoding a polypeptide having IDI enzyme activity as described supra can be used in this embodiment.
[0050] In another nonlimiting embodiment, the recombinant C. necator host comprises an exogenous nucleic acid encoding a polypeptide having IPSP enzyme activity. Any nucleic acid sequence encoding a polypeptide having IPSP enzyme activity as described supra can be used in this embodiment.
[0051] In another nonlimiting embodiment, the recombinant C. necator host comprises an exogenous nucleic acid encoding a polypeptide having IDI enzyme activity and an exogenous nucleic acid encoding a polypeptide having ISPS enzyme activity. Any of the nucleic acid sequences encoding a polypeptide having IDI enzyme activity or IPSP enzyme activity as described supra can be used.
[0052] In one nonlimiting embodiment, at least one of the exogenous nucleic acid sequences in the recombinant host is contained within a plasmid.
[0053] In one nonlimiting embodiment, at least one of the exogenous nucleic acid sequences is integrated into a chromosome of the host.
[0054] In one nonlimiting embodiment, the recombinant C. necator host has been transfected with a vector comprising any of SEQ ID NOs:15, 16, 17, 18, 19, 20 or 21.
[0055] Also provided by the present invention is isoprene bioderived from a recombinant C. necator host according to any of methods described herein. In one nonlimiting embodiment, the bioderived isoprene has carbon isotope ratio that reflects an atmospheric carbon dioxide uptake source. Examples of such ratios include, but are not limited to, carbon-12, carbon-13, and carbon-14 isotopes.
[0056] In addition, the present invention provides bio-derived, bio-based, or fermentation-derived product produced using the methods and/or compositions disclosed herein. Examples of such products include, but are not limited to, compositions comprising at least one bio-derived, bio-based, or fermentation-derived compound or any combination thereof, as well as polymers, rubbers such as cis-polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, molded substances, formulations and semi-solid or non-semi-solid streams comprising one or more of the bio-derived, bio-based, or fermentation-derived compounds or compositions, combinations or products thereof.
[0057] The following section provides further illustration of the methods and compositions of the present invention. These working examples are illustrative only and are not intended to limit the scope of the invention in any way.
EXAMPLES
Example 1: Primers
[0058] Primers as listed in Table 1 were used in the following disclosed experiments.
TABLE-US-00001 Primer Sequence 1 5GGAAGGAGCGAAGCATGCGTTGTAGCGTTAGC 3(SEQ ID NO: 22) 2 5GGGCTTTGTTAGCAGGCTTAGCGTTCGAACGGCAGAAT 3(SEQ ID NO: 23) 3 5GCCTGCTAACAAAGCCCGAAA 3(SEQ ID NO: 24) 4 5GCTTCGCTCCTTCCTTAAAG 3(SEQ ID NO: 25) 5 5GCCGCCCTATACCTTGTCT 3(SEQ ID NO: 26) 6 5ACGGCGTCACACTTTGCTAT 3(SEQ ID NO: 27) 7 5CGCGTCGCGAACGCCAGCAA 3(SEQ ID NO: 28) 8 5ACGGGGCCTGCCACCATACC 3(SEQ ID NO: 29) 9 5CTTATCGATGATAAGCTGTC 3(SEQ ID NO: 30) 10 5CAGCCCTAGATCGGCCACAG 3(SEQ ID NO: 31) 11 5TGCCTGCCCCTCCCTTTTGG 3(SEQ ID NO: 32) 12 5GCGGCGAGTGCGGGGGTTCC 3(SEQ ID NO: 33) 13 5GGAAACCCACGGCGGCAATG 3(SEQ ID NO: 34) 14 5ATCGGCTGTAGCCGCCTCTAGATT 3(SEQ ID NO: 35) 15 5AGTAACAATTGCTCAAGCAG 3(SEQ ID NO: 36) 16 5ATTCAGAGAAGAAACCAATT 3(SEQ ID NO: 37) 17 5GCTAGAAATAATTTTGAGCTCGCCAAGGAGATATAATGCAAAC 3(SEQ ID NO: 38) 18 5GCTTCGCTCCTTCCTTAAAGTTATTTAAGCTGGGTAAATGC 3(SEQ ID NO: 39) 19 5GCTAGAAATAATTTTGAGCTCGCCAAGGAGATATAATGGTC 3(SEQ ID NO: 40) 20 5GCTTCGCTCCTTCCTTAAAGTCAGCGCACCGAATACGA 3(SEQ ID NO: 41) 21 5GCTAGAAATAATTTTGAGCTCGCCAAGGAGATATAATGACTGCCGACAACAATAG 3(SEQ ID NO: 42) 22 5GCTTCGCTCCTTCCTTAAAGTTATAGCATTCTATGAATTTGCC 3(SEQ ID NO: 43) 23 5GCTAGAAATAATTTTGAGCTCGCCAAGGAGATATAATGAATCGAAAAGATGAAC 3(SEQ ID NO: 44) 24 5GCTTCGCTCCTTCCTTAAAGTTAACGTTTTGCGAAAACAG 3(SEQ ID NO: 45) 25 5GCTAGAAATAATTTTGAGCTCGCCAAGGAGATATAATGACTAACCGTAAAGATGATC 3 (SEQ ID NO: 46) 26 5GCTTCGCTCCTTCCTTAAAGCTAATTGACCTGCTGCAAG 3(SEQ ID NO: 47) 27 5GCTAGAAATAATTTTGAGCTCGCCAAGGAGATATAATGACGACCAACCGCAAGGATG 3 (SEQ ID NO: 48) 28 5GCTTCGCTCCTTCCTTAAAGTCACGCCTTCTTCATCTG 3(SEQ ID NO: 49) 29 5GCCGCCCTATACCTTGTCT 3(SEQ ID NO: 50) 30 5ACGGCGTCACACTTTGCTAT 3(SEQ ID NO: 51)
Example 2: Cloning of Poplar ISPS for Expression in C. necator spp.
[0059] The protein sequence for the Populus alba was obtained from GenBank (BAD98243.1) and the full gene (with an additional promoter and terminator), codon optimized for E. coli was purchased from Eurofins MWG (SEQ ID NO:52). This DNA was used as a template for amplification of the gene using primers 1 and 2 (see Table 1) and Phusion polymerase (NEB) with an annealing temperature of 45 C. (the open reading frame (ORF) generated lacked the native plasmid tag; this ORF corresponds to nucleotides 168-1865 of SEQ ID NO:52). The vector backbone of pBBR1MCS3-pBAD was generated with primer 3 and 4 (see Table 1) and with Merck Millipore KOD polymerase with annealing temperatures of 50-55 C. The two fragments were ligated using NEB Gibson Assembly reaction master mix as per the manufacturer's recommended protocol. The ligation mix was transformed into chemically competent E. coli NEB5 and correct clones verified via a combination of colony PCR and sequencing with primers 5 and 6 (see Table 1). Subsequently the whole construct was sequenced by MWG-Eurofins using primers 7-16 (see Table 1). A single verified construct was taken forward for further work and designated pBBR1-ISPS (see
Example 3: Cloning of IDI-ISPS Bicistrons for Expression in C. necator spp.
[0060] A unique SacI restriction site was identified in pBBR1-ISPS, upstream of the ribosome binding site and downstream of the predicted transcriptional start site. pBBR1-ISPS was purified from NEB5a alpha using the Qiagen plasmid Midi prep kit, cut with SacI (NEB) and purified using the Qiagen PCR purification kit as per the recommended protocol. Nucleic acid sequences for IDIs from E. coli (SEQ ID NO:8), B. subtilis (SEQ ID NO:9), S. cerevisiae (SEQ ID NO:10), E. faecalis (SEQ ID NO:11), S. pyrogenes (SEQ ID NO:12) and S. pneumonia (SEQ ID NO:13) were obtained from GenBank. Each IDI was amplified from genomic DNA (purchased directly from DSMZ or ATCC) or in the case of the B. subtilis and S. pneumonia variants, from a codon optimized (C. necator) synthetic operon purchased from Eurofins MWG.
[0061] PCR products were generated with Merck Millipore KOD polymerase and an annealing temperature of 55 C. and using primers 17-28 (see Table 1) purified using the Qiagen PCR purification kit and the recommended protocol. The PCR products were then used in a Gibson assembly with the SacI digested and purified pBBR1-ISPS and individual ligations transformed to E. coli NEB5a. Clones were verified via a combination of colony PCR with Taq polymerase (NEB) and sequencing with primers 29 and 30 (see Table 1). Single verified constructs representing each IDI coupled to ISPS were designated pBBR-EC IDI-ISPS (
Example 4: Vector Preparation and Transference to C. necator H16 AphaCAB
[0062] Vectors pBBR-EC IDI-ISPS, pBBR1-BS IDI-ISPS, pBBR1-SCIDI-ISPS, pBBR1-EFIDI-ISPS, pBBR1-SPyrIDI-ISPS and pBBR1 SpneuIDI-ISPS were prepared from their respective NEB5 hosts using the Qiagen Midi prep kit and appropriate culture volumes. A C. necator H16 strain with the phaCAB gene locus knocked out (AphaCAB) was grown to mid/late exponential phase in tryptic soy broth (TSB) media at 30 C. Cells were made competent with glycerol washes and used immediately. Unexpectedly, competent cells were transformed with at least 1 g of vector DNA via electroporation and recovered in TSB medium. Transformants were identified on TSB agar with 10 g/ml tetracycline. Single transformants representative of each IDI-ISPS clone were further examined.
Example 5: Isoprene Production in C. necator H16 AphaCAB
[0063] IDI-ISPS clones in C. necator H16 AphaCAB, representative of each IDI under study, were grown over 48 hours on TSB agar (without dextrose). The P. alba ISPS construct (pBBR1-ISPS) containing strain was also grown on the same media, as a control. Cultures were grown, induced and harvested. Cell pellets were resuspended in a suitable media and normalized in solution based on the wet cell weight. Further incubations with induction were performed in screw cap headspace gas chromatography (GC) vials (Anatune 093640-040-00 and 093640-038-00). Surprisingly, isoprene was produced and could be measured via gas chromatography-mass spectrometry (GCMS), the parameters for which are set out in Table 2. Ions monitored for isoprene were 39, 53 and 67 on an Agilent DB-624 column Agilent.
TABLE-US-00002 TABLE 2 GCMS analysis conditions for Isoprene GCMS CONDITIONS PARAMETER VALUE Carrier Gas Helium at constant flow (2.0 ml/min) Injector Split ratio Split 10:L Temperature 150 C. Detector Source Temperature 230 C. Quad Temperature 150 C. Interface 260 C. Gain 1 Scan Range] m/z 30-200 Threshold 150 Scan Speed 2{circumflex over ()}2(A/D samples) 4 Sampling Rate 2{circumflex over ()}n = 2{circumflex over ()}2 Mode SCAN and SIM Solvent delay * 2.80 min Oven Temperature Initial T: 40 C. 10 min Oven Ramp 40 C./min to 260 C. for 5 min Injection volume 50 l from the HS in the GC 2 ml vial Incubation time and T 15 min at 95 C. Agitator ON 500 rpm Injection volume 500 l of the Head Space Gas saver On after 2 min Concentration range 0.1-5.0 (g/ml) GC Column DB-624 (122-1334 Agilent) 60 m 250 m 1.4 m
Results of these isoprene production studies are shown in Table 3 and depicted graphically in
TABLE-US-00003 TABLE 3 Isoprene production results of IDI-ISPS expressing C. necator strains Culture C. necator Mean Standard H16 phaCAB isoprene ppm deviation pBBR1-ISPS 0.0078 0.000051 pBBR1 - EC IDI-ISPS 0.030 0.0032 pBBR1 - BS IDI-ISPS 0.40 0.021 pBBR1 - SC-IDI-ISPS 0.076 0.0005 pBBR1 - EF IDI-ISPS 0.018 0.0012 pBBR1 - SPyr IDI-ISPS 0.0089 0.00089 pBBR1 - EC IDI-ISPS 0.184 0.003 pBBR1 - Spneu IDI-ISPS 0.595 0.011