N,N′-diarylurea compounds and N,N′-diarylthiourea compounds as inhibitors of translation initiation
09932300 · 2018-04-03
Assignee
Inventors
- Bertal Huseyin Aktas (Newton, MA)
- José A. Halperin (Brookline, MA, US)
- Michael Chorev (Chestnut Hill, MA)
Cpc classification
C07D295/135
CHEMISTRY; METALLURGY
C07D285/14
CHEMISTRY; METALLURGY
C07D409/04
CHEMISTRY; METALLURGY
C07D307/88
CHEMISTRY; METALLURGY
A61K31/5377
HUMAN NECESSITIES
C07D319/08
CHEMISTRY; METALLURGY
C07D213/75
CHEMISTRY; METALLURGY
C07C275/30
CHEMISTRY; METALLURGY
C07D317/66
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C07D333/38
CHEMISTRY; METALLURGY
C07C275/40
CHEMISTRY; METALLURGY
C07D405/12
CHEMISTRY; METALLURGY
C07C275/34
CHEMISTRY; METALLURGY
C07C2602/08
CHEMISTRY; METALLURGY
C07D271/12
CHEMISTRY; METALLURGY
C07D277/66
CHEMISTRY; METALLURGY
C07C275/38
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C07D231/56
CHEMISTRY; METALLURGY
C07D233/36
CHEMISTRY; METALLURGY
C07D215/06
CHEMISTRY; METALLURGY
International classification
A61K31/519
HUMAN NECESSITIES
C07C275/38
CHEMISTRY; METALLURGY
C07C275/40
CHEMISTRY; METALLURGY
C07D215/06
CHEMISTRY; METALLURGY
C07D231/56
CHEMISTRY; METALLURGY
C07D233/36
CHEMISTRY; METALLURGY
C07D271/12
CHEMISTRY; METALLURGY
C07D277/66
CHEMISTRY; METALLURGY
C07D285/14
CHEMISTRY; METALLURGY
C07D295/135
CHEMISTRY; METALLURGY
A61K31/5377
HUMAN NECESSITIES
C07C275/30
CHEMISTRY; METALLURGY
C07C275/34
CHEMISTRY; METALLURGY
C07D409/04
CHEMISTRY; METALLURGY
C07D405/12
CHEMISTRY; METALLURGY
C07D333/38
CHEMISTRY; METALLURGY
C07D319/08
CHEMISTRY; METALLURGY
C07D317/66
CHEMISTRY; METALLURGY
C07D307/88
CHEMISTRY; METALLURGY
Abstract
Compositions and methods for inhibiting translation initiation are provided. Compositions, methods and kits for treating (1) cellular proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infections, using N,N-diarylureas and/or N,N-diarylthiourea compounds are described.
Claims
1. A compound of formula ##STR00299##
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The foregoing and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19) It will be recognized that the results and examples in the figures are only illustrative and other examples and illustrations will be readily recognized by the person of ordinary skill in the art, given the benefit of this disclosure.
DETAILED DESCRIPTION
(20) In accordance with certain examples, compounds of Formula I and/or Formula II and/or Formula III and/or Formula IV inhibit translation (e.g., translation initiation). Such compounds are useful for the treatment of (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infections. Certain examples are described below with reference to various chemical formulae. The chemical formulae referred to herein can exhibit the phenomena of tautomerism, conformational isomerism, stereo isomerism or geometric isomerism. As the formulae drawings within this specification can represent only one of the possible tautomeric, conformational isomeric, enantiomeric or geometric isomeric forms, it should be understood that the invention encompasses any tautomeric, conformational isomeric, enantiomeric or geometric isomeric forms which exhibit biological or pharmacological activity as described herein.
(21) The compounds and compositions provided below are effective to inhibit translation (e.g., translation initiation) at least to the extent necessary for effective treatment of one or more disorders described herein. While in certain examples translation may be substantially inhibited such that little or no activity results, in other examples the inhibition is at least sufficient to relieve and or alleviate the symptoms from a selected disorder to be treated.
(22) In accordance with certain embodiments, compounds of the invention are represented by the generic formula set forth below.
(23) ##STR00001##
(24) In certain exemplary embodiments with respect to Formula I, II or III,
(25) R.sub.1 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, aryl sulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroaryl sulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(26) ##STR00002## ##STR00003## ##STR00004##
(27) R.sub.2 is H, C.sub.1, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2, 3, 4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, aryl sulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroaryl sulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(28) ##STR00005## ##STR00006## ##STR00007##
(29) R.sub.3 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, arylsulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroarylsulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(30) ##STR00008## ##STR00009## ##STR00010##
(31) R.sub.4 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, aryl sulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroaryl sulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(32) ##STR00011## ##STR00012## ##STR00013##
(33) R.sub.5 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, arylsulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroarylsulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(34) ##STR00014## ##STR00015## ##STR00016##
(35) R.sub.6 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, aryl sulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroaryl sulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(36) ##STR00017## ##STR00018##
(37) R.sub.7 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, aryl sulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroaryl sulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(38) ##STR00019## ##STR00020##
(39) R.sub.8 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, arylsulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroarylsulfonyl amino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(40) ##STR00021## ##STR00022##
(41) R.sub.9 is H, C.sub.1, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, arylsulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroarylsulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(42) ##STR00023## ##STR00024##
(43) R.sub.10 is H, Cl, CH.sub.3, OCH.sub.3, NO.sub.2, OH, F, CF.sub.3, OCF.sub.3, Br, CH.sub.3S, AcHN, (CH.sub.3).sub.2N, CONHNH.sub.2, SO.sub.2NH.sub.2, C(CH.sub.3).sub.3, COOCH.sub.2CH.sub.3, COCH.sub.3, O(CH.sub.2).sub.2CH.sub.3, CHO, CO.sub.2H, OCONH.sub.2, CN, CCH, N-methylacetamido, 1-[1,2,3]triazolyl, 4-[1,2,3]triazolyl, 5-[1,2,3,4]tetrazolyl, guanidine, C.sub.1-6-alkyl, C.sub.1-6-alkyl amino substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, C.sub.1-6-alkoxy, C.sub.2-6-alkenyloxy, C.sub.1-6-alkoxycarbonyl, C.sub.1-6-alkylcarbonyl, C.sub.1-6-alkylcarbonyloxy, N,N-dimethylamino, N,N-di(C.sub.1-6-alkyl)amino, mono- and di-(C.sub.1-6-alkyl)aminocarbonyl, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylsulfonylamino, C.sub.1-6-alkylthio, C.sub.1-6-alkylsulphinyl, aryl, aryloxy, arylcarbonyl, arylamino, aryl sulfonylamino, hetrocyclyl, hetrocyclyloxy, heterocyclylamino, heterocyclylcarbonyl, heteroaryl, heteroaryloxy, heteroarylamino, heteroarylcarbonyl, heteroaryl sulfonylamino, O(CH.sub.2).sub.2-4-morpholino, O(CH.sub.2).sub.2-4-(piperazin-1-yl), O(CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), O(CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, O(CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4(1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), O(CH.sub.2).sub.2-4-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl),
(44) ##STR00025## ##STR00026##
(45) R.sub.11 is H, CH.sub.3
(46) ##STR00027##
(47) R.sub.12 is H, CH.sub.3,
(48) ##STR00028##
(49) R.sub.13 is O, S, NH or NR.sub.19. For compounds of Formulae II and III, R.sub.13 is preferably S, NH or NR.sub.19.
(50) R.sub.14 is NH, S or
(51) ##STR00029##
(52) R.sub.15 is NH, S or NHNCH.
(53) R.sub.16 is C.
(54) R.sub.17 is H, CH.sub.3, [(CH.sub.2).sub.2O].sub.1-3H, [(CH.sub.2).sub.2O].sub.1-3CH.sub.3, (CH.sub.2).sub.2NH.sub.2, (CH.sub.2)NHCH.sub.3, (CH.sub.2).sub.2N(CH.sub.3).sub.2, [(CH.sub.2).sub.2O].sub.1-2(CH.sub.2).sub.2NHCH.sub.3, [(CH.sub.2).sub.2O].sub.1-2(CH.sub.2).sub.2N(CH.sub.3).sub.2,
(55) ##STR00030##
(56) R.sub.18 is H, CH.sub.3, [(CH.sub.2).sub.2O].sub.1-3H, [(CH.sub.2).sub.2O].sub.1-3CH.sub.3, (CH.sub.2).sub.2NH.sub.2, (CH.sub.2).sub.2NHCH.sub.3, (CH.sub.2).sub.2N(CH.sub.3).sub.2, [(CH.sub.2).sub.2O].sub.1-2(CH.sub.2).sub.2NHCH.sub.3, [(CH.sub.2).sub.2O].sub.1-2(CH.sub.2).sub.2N(CH.sub.3).sub.2,
(57) ##STR00031##
(58) R.sub.19 is CH.sub.3, C(CH.sub.3).sub.3, C.sub.1-6-alkyl, C.sub.1-6-alkyl substituted with: hydroxyl, C.sub.1-6-alkoxy, amino, mono- and di-(C.sub.1-6-alkyl)amino, carboxy, C.sub.1-6-alkylcarbonylamino, C.sub.1-6-alkylaminocarbonyl, aminosulfonyl, mono- and di-(C.sub.1-6-alkyl)aminosulfonyl, carbamido, mono- and di-(C.sub.1-6-alkyl)aminocarbonylamino, halogen(s), aryl, arylheterocycle, heterocycle, and heteroaryl. C.sub.2-6-alkenyl, (CH.sub.2).sub.2-4-morpholino, (CH.sub.2).sub.2-4-(piperazin-1-yl), (CH.sub.2).sub.2-4-(4-methylpiperazin-1-yl), (CH.sub.2).sub.2-4-mono- and di-(C.sub.1-6-alkyl)amino, (CH.sub.2).sub.2-4-1H-[1,2,3]triazol-1-yl, (CH.sub.2).sub.2-4-1H-[1,2,3]triazol-4-yl, (CH.sub.2).sub.2-4-(4-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-1-yl), or (CH.sub.2).sub.2-4-(1-(C.sub.1-6-alkyl)-1H-[1,2,3]triazol-4-yl).
(59) According to one particular embodiment of Formula I, II or III, R.sub.11 and R.sub.12 are absent and a covalent linkage is present between the nitrogenes that is
(60) ##STR00032##
According to another particular embodiment R.sub.17 and R.sub.18 are absent and replaced by either
(61) ##STR00033##
covalently linked to the nitrogen atom.
(62) In certain exemplary embodiments, compounds within the scope of Formula I, II or III are those where, optionally, at least one atom is covalently linked between two R groups. In certain exemplary embodiments, a covalent linkage is present between R.sub.1 and R.sub.15 that is
(63) ##STR00034##
In certain exemplary embodiments, a covalent linkage is present between R.sub.2 and R.sub.3 that is
(64) ##STR00035##
(65) In other embodiments, a covalent linkage is present between R.sub.7 and R.sub.8 that is
(66) ##STR00036##
In certain exemplary embodiments, a covalent linkage is present between R.sub.1 and R.sub.2 that is
(67) ##STR00037##
In certain exemplary embodiments, a covalent linkage is present between R.sub.6 and R.sub.7 that is
(68) ##STR00038##
In other embodiments, a covalent linkage is present between R.sub.8 and R.sub.9 that is
(69) ##STR00039##
In other embodiments, a covalent linkage is present between R.sub.9 and R.sub.10 that is
(70) ##STR00040##
In other embodiments, a covalent linkage is present between R.sub.10 and R.sub.12 that is
(71) ##STR00041##
In other embodiments, a covalent linkage is present between R.sub.14 and R.sub.15 that is
(72) ##STR00042##
In other embodiments, a covalent linkage is present between R.sub.15 and R.sub.16 that is
(73) ##STR00043##
(74) With respect to the substituents identified above, it is to be understood that the substituents are to be covalently linked to an atom or atoms and so one of skill in the art would understand that the terminal lines in the moieties for the various R groups in this application may indicate linkage points to an atom and not the presence of an atom itself.
(75) In accordance with certain embodiments, compounds of the invention are represented by the generic formula set forth below.
(76) ##STR00044##
(77) In certain exemplary embodiments with respect to Formula IV above,
(78) R.sub.1 is S or O.
(79) R.sub.2 is NH.sub.2, CH.sub.3,
(80) ##STR00045##
and
(81) R.sub.3 is OH, NH.sub.2, CH.sub.3,
(82) ##STR00046##
(83) Specific compounds within the scope of the present invention include the following/those set forth in Table 1, below.
(84) TABLE-US-00001 TABLE 1 Compounds according to certain exemplary embodiments. Compound Number Structure 1439
(85) In at least certain examples, the compounds disclosed here can be used in the treatment of cellular proliferative disorders, such as cancer and non-cancerous cellular proliferative disorders. Treatment of cellular proliferative disorders is intended to include, but is not limited to, inhibition of proliferation including rapid proliferation. As used herein, the term cellular proliferative disorder includes, but is not limited to, disorders characterized by undesirable or inappropriate proliferation of one or more subset(s) of cells in a multicellular organism. The term cancer refers to various types of malignant neoplasms, most of which can invade surrounding tissues, and may metastasize to different sites (see, for example, PDR Medical Dictionary 1st edition (1995)). The terms neoplasm and tumor refer to an abnormal tissue that grows by cellular proliferation more rapidly than normal and continues to grow after the stimuli that initiated proliferation is removed. Id. Such abnormal tissue shows partial or complete lack of structural organization and functional coordination with the normal tissue which may be either benign (i.e., benign tumor) or malignant (i.e., malignant tumor).
(86) Examples of general categories of cancer include, but are not limited to, carcinomas (i.e., malignant tumors derived from epithelial cells such as, for example, common forms of breast, prostate, lung and colon cancer), sarcomas (i.e., malignant tumors derived from connective tissue or mesenchymal cells), lymphomas (i.e., malignancies derived from hematopoietic cells), leukemias (i.e., malignancies derived from hematopoietic cells), germ cell tumors (i.e., tumors derived from totipotent cells. In adults most often found in the testicle or ovary; in fetuses, babies and young children, most often found on the body midline, particularly at the tip of the tailbone), blastic tumors (i.e., a typically malignant tumor which resembles an immature or embryonic tissue) and the like. One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional cancers based on the disclosure herein.
(87) Examples of specific neoplasms intended to be encompassed by the present invention include, but are not limited to, acute lymphoblastic leukemia; myeloid leukemia, acute myeloid leukemia, childhood; adrenocortical carcinoma; AIDS-related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytoma (e.g., cerebellar, cerebral); atypical teratoid/rhabdoid tumor; basal cell carcinoma; bile duct cancer, extrahepatic; bladder cancer; bone cancer, osteosarcoma and malignant fibrous histiocytoma; brain tumor (e.g., brain stem glioma, central nervous system atypical teratoid/rhabdoid tumors, central nervous system embryonal tumors, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and/or pineoblastoma, visual pathway and/or hypothalamic glioma, brain and spinal cord tumors); breast cancer; bronchial tumors; Burkitt lymphoma; carcinoid tumor (e.g., gastrointestinal); carcinoma of unknown primary; central nervous system (e.g., atypical teratoid/rhabdoid tumor, embryonal tumors (e.g., lymphoma, primary); cerebellar astrocytoma; cerebral astrocytoma/malignant glioma; cervical cancer; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; embryonal tumors, central nervous system; endometrial cancer; ependymoblastoma; ependymoma; esophageal cancer; Ewing family of tumors; extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; eye cancer (e.g., intraocular melanoma, retinoblastoma); gallbladder cancer; gastric cancer; gastrointestinal tumor (e.g., carcinoid tumor, stromal tumor (gist), stromal cell tumor); germ cell tumor (e.g., extracranial, extragonadal, ovarian); gestational trophoblastic tumor; glioma (e.g., brain stem, cerebral astrocytoma); hairy cell leukemia; head and neck cancer; hepatocellular cancer; Hodgkin lymphoma; hypopharyngeal cancer; hypothalamic and visual pathway glioma; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; large cell tumors; laryngeal cancer (e.g., acute lymphoblastic, acute myeloid); leukemia (e.g., acute myeloid, chronic lymphocytic, chronic myelogenous, hairy cell); lip and/or oral cavity cancer; liver cancer; lung cancer (e.g., non-small cell, small cell); lymphoma (e.g., AIDS-related, Burkitt, cutaneous Tcell, Hodgkin, non-Hodgkin, primary central nervous system); macroglobulinemia, Waldenstrom; malignant fibrous histiocytoma of bone and/or osteosarcoma; medulloblastoma; medulloepithelioma; melanoma; merkel cell carcinoma; mesothelioma; metastatic squamous neck cancer; mouth cancer; multiple endocrine neoplasia syndrome; multiple myeloma/plasma cell neoplasm; mycosis fungoides; myelodysplastic syndromes; myelodysplastic/myeloproliferative diseases; myelogenous leukemia (e.g., chronic, acute, multiple); myeloproliferative disorders, chronic; nasal cavity and/or paranasal sinus cancer; nasopharyngeal cancer; neuroblastoma; non-Hodgkin lymphoma; non-small cell lung cancer; oral cancer; oral cavity cancer, oropharyngeal cancer; osteosarcoma and/or malignant fibrous histiocytoma of bone; ovarian cancer (e.g., ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor); pancreatic cancer (e.g., islet cell tumors); papillomatosis; paranasal sinus and/or nasal cavity cancer; parathyroid cancer; penile cancer; pharyngeal cancer; pheochromocytoma; pineal parenchymal tumors of intermediate differentiation; pineoblastoma and supratentorial primitive neuroectodermal tumors; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system lymphoma; prostate cancer; rectal cancer; renal cell cancer; renal, pelvis and/or ureter, transitional cell cancer; respiratory tract carcinoma involving the nut gene on chromosome 15; retinoblastoma; rhabdomyosarcoma; salivary gland cancer; sarcoma (e.g., Ewing family of tumors, Kaposi, soft tissue, uterine); Sezary syndrome; skin cancer (e.g., non-melanoma, melanoma, merkel cell); small cell lung cancer; small intestine cancer; soft tissue sarcoma; squamous cell carcinoma; squamous neck cancer with occult primary, metastatic; stomach cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma, cutaneous; testicular cancer; throat cancer; thymoma and/or thymic carcinoma; thyroid cancer; transitional cell cancer of the renal, pelvis and/or ureter; trophoblastic tumor; unknown primary site carcinoma; urethral cancer; uterine cancer, endometrial; uterine sarcoma; vaginal cancer; visual pathway and/or hypothalamic glioma; vulvar cancer; Waldenstrom macroglobulinemia; Wilms tumor and the like. For a review, see the National Cancer Institute's Worldwide Website (cancer.gov/cancertopics/alphalist). One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional cancers and/or neoplasms based on the disclosure herein.
(88) Examples of noncancerous cellular proliferative disorders includes fibroadenoma, adenoma, intraductal papilloma, nipple adenoma, adenosis, fibrocystic disease or changes of breast, plasma cell proliferative disorder (PCPD), restenosis, atherosclerosis, rheumatoid arthritis, myofibromatosis, fibrous hamartoma, granular lymphocyte proliferative disorders, benign hyperplasia of prostate, heavy chain diseases (HCDs), lymphoproliferative disorders, psoriasis, idiopathic pulmonary fibrosis, sclroderma, cirrhosis of the liver, IgA nephropathy, mesangial proliferative glomerulonephritis, membranoproliferative glomerulonephritis, hemangiomas, vascular and non-vascular intraocular proliferative disorders and the like. One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional noncancerous cellular proliferative disorders based on the disclosure herein.
(89) The language treatment of cellular proliferative disorders is intended to include, but is not limited to, the prevention of the growth of neoplasms in a subject or a reduction in the growth of pre-existing neoplasms in a subject, as well as the prevention or reduction of increased or uncontrollable cell growth. The inhibition also can be the inhibition of the metastasis of a neoplasm from one site to another. In certain embodiments, the neoplasms are sensitive to one or more compounds of Formulae I and II as described herein.
(90) In accordance with certain other examples, methods for treating viral infections are also disclosed. Treatment of viral infections is intended to include, but is not limited to, the use of a N,N-diarylurea and/or N,N-diarylthiourea compounds described herein to prevent the initiation of viral protein synthesis. The term viral infection, as used herein, refers to one or more cells which have been infected with a virus, such as a DNA or RNA animal virus. As used herein, RNA viruses include, but are not limited to, virus families such as picornaviridae (e.g., polioviruses), reoviridae (e.g., rotaviruses), togaviridae (e.g., encephalitis viruses, yellow fever virus, rubella virus), orthomyxoviridae (e.g., influenza viruses), paramyxoviridae (e.g., respiratory syncytial virus, measles virus, mumps virus, parainfluenza virus), rhabdoviridae (e.g., rabies virus), coronaviridae, bunyaviridae, flaviviridae, filoviridae, arenaviridae, bunyaviridae, and retroviridae (e.g., human T-cell lymphotropic viruses (HTLV), human immunodeficiency viruses (HIV)). As used herein, DNA viruses include, but are not limited to, virus families such as papovaviridae (e.g., papilloma viruses), adenoviridae (e.g., adenovirus), herpesviridae (e.g., herpes simplex viruses), and poxviridae (e.g., variola viruses). In certain embodiments, the viral infection is caused by hepatitis B virus, hepatitis C virus and/or HIV. One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional viral infections based on the disclosure herein.
(91) In accordance with other examples, methods for treating disorders associated with viral infections are disclosed. Treatment of one or more disorders associated with viral infections is intended to include, but is not limited to, the use of a N,N-diarylurea and/or N,N-diarylthiourea compound described herein to reduce or alleviate one or more symptoms of a viral infection. As used herein, the term disorders associated with viral infection refers to the host's response to infection by one or more viruses. Such responses include, but are not limited to neurological symptoms (e.g., encephalitis, meningoencephalitis, paralysis, myelopathy, neuropathy, aseptic meningitis, hemiparesis, dementia, dysphagia, lack of muscular coordination, impaired vision, coma, and the like), wasting symptoms (e.g., inflammatory cell infiltration, perivascular cuffing of blood vessels, demyelination, necrosis, reactive gliosis and the like), gastroenteritis symptoms (e.g., diarrhea, vomiting, cramps and the like), hepatitis symptoms (nausea, vomiting, right upper quadrant pain, raised liver enzyme levels (e.g., AST, ALT and the like), jaundice and the like), hemorrhagic fever symptoms (e.g., headache, fever, chills body pains, diarrhea, vomiting, dizziness, confusion, abnormal behavior, pharyngitis, conjunctivitis, red face, red neck, hemorrhage, organ failure and the like), oncogenic symptoms (e.g., sarcomas, leukemias and the like, as well as rare malignancies, e.g., Kaposi's sarcoma, oral hairy leukoplasia, lymphomas and the like), immunodeficiency symptoms (e.g., opportunistic infections, wasting, rare malignancies, neurological disease, fever, diarrhea, skin rashes and the like), lesions (e.g., warts (e.g., common wart, flat wart, deep hyperkaratotic palmoplantar wart, superficial mosaic type palmoplantar wart and the like), epidermodysplasia, mucosal lesions, ulcers and the like), and systemic symptoms (e.g., fever, chills, headache, muscle pain, bone pain, joint pain, pharyngitis, tonsillitis, sinusitis, otitis, bronchitis, pneumonia, bronchopneumonia, nausea, vomiting, increased salivation, rash, macules, lymphadenopothy, arthritis, ulcers, photosensitivity, weight loss, irritability, restlessness, anxiety, coma, death and the like). Disorders associated with viral infections are described in Fields Virology 4.sup.th Ed. (2001) Lippincott, Williams & Wilkins, and the introduction to medical virology website (web.uct.ac.za/depts./mmi/jmoodie/introvi2.html). One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional disorders associate with viral infections based on the disclosure herein.
(92) In accordance with other examples, methods for treating disorders characterized by unwanted synthesis and/or abnormal accumulation of one or more mutant and/or wild-type proteins are provided. Treatment of one or more disorders associated with unwanted synthesis and/or abnormal accumulation is intended to include, but is not limited to, the use of a N,N-diarylurea and/or N,N-diarylthiourea compound described herein to reduce or alleviate one or more symptoms characterized by unwanted synthesis and/or abnormal accumulation. Without intending to be bound by scientific theory, contacting a subject afflicted with a disorder characterized by unwanted synthesis and/or abnormal accumulation of one or more mutant and/or wild-type proteins with a compound described herein (e.g., a compound that can inhibit translation initiation) can reduce the load on the protein-folding machinery and, accordingly, may reduce the severity of the disorder. Disorders associated with unwanted synthesis and/or abnormal accumulation of one or more mutant and/or wild-type proteins include, but are not limited to, Tay-Sachs disease, cystic fibrosis, phenylketonuria, Fabry disease, Alzheimer's disease, Huntington's disease, Parkinson's disease, congophilic angiopathy, prion related disorders (i.e., transmissible spongiform encephalopathies such as Creutzfeldt-Jacob disease, kuru, fatal familial insomnia, scrapie, bovine spongiform encephalopathy and the like) and the like. One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional disorders characterized by unwanted synthesis and/or abnormal accumulation of one or more mutant and/or wild-type proteins based on the disclosure herein.
(93) In accordance with other examples, methods for treating non-proliferative, degenerative disorders associated with aberrant translation initiation using a N,N-diarylurea and/or N,N-diarylthiourea compound described herein to alleviate and/or reduce one or more symptoms associated with a non-proliferative, degenerative disorder are disclosed. Treatment of non-proliferative, degenerative diseases is intended to include, but is not limited to, the use of N,N-diarylurea and/or N,N-diarylthiourea compounds described herein. As used herein, the term non-proliferative degenerative disorder is intended to include, but is not limited to, diseases characterized by a loss of function of cells, tissues, and/or organs due to aberrant translation initiation. Non-proliferative degenerative disorders include, but are not limited to, disorders such as Alzheimer's disease and insulin resistance. One of skill in the art will understand that this list is exemplary only and is not exhaustive, as one of skill in the art will readily be able to identify additional non-proliferative degenerative disorders based on the disclosure herein.
(94) In accordance with certain other examples, kits for treating one or more (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infections are provided. In one example, the kit may comprise one or more compounds of Formulae I and II as described herein. In another example, the kit may comprise a pharmaceutically acceptable carrier. In an additional example, the kit may also include instructions for treating (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, (4) disorders associated with viral infections, and/or (5) disorders characterized by unwanted protein synthesis or diseases for which reducing protein synthesis is advantageous. In some examples, the kit may also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent. In other examples, the kit may also contain a control sample or a series of control samples which can be assayed and compared to the test sample contained. Other suitable components for including in the kit will be selected by the person of ordinary skill in the art, given the benefit of this disclosure.
(95) In accordance with certain examples, compounds of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the compounds disclosed here and a pharmaceutically acceptable carrier. As used herein the term pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
(96) In accordance with certain examples, a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Such pharmaceutical compositions may be administered by inhalation, transdermally, orally, rectally, transmucosally, intestinally, parenterally, intramuscularly, subcutaneously, intravenously or other suitable methods that will be readily selected by the person of ordinary skill in the art, given the benefit of this disclosure. For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.
(97) In accordance with other examples, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMPHOR EL (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
(98) In accordance with other examples, sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation can be vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
(99) In at least certain examples, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811, incorporated herein by reference in its entirety for all purposes.
(100) In accordance with certain examples, pharmaceutical compositions of the invention comprise one or more N,N-diarylurea and/or N,N-diarylthiourea compounds covalently linked to a peptide (i.e., a polypeptide comprising two or more amino acids). Peptides may be assembled sequentially from individual amino acids or by linking suitable small peptide fragments. In sequential assembly, the peptide chain is extended stepwise, starting at the C-terminus, by one amino acid per step. In fragment coupling, fragments of different lengths can be linked together, and the fragments can also be obtained by sequential assembly from amino acids or by fragment coupling of still shorter peptides.
(101) In both sequential assembly and fragment coupling it is necessary to link the units (e.g., amino acids, peptides, compounds and the like) by forming an amide linkage, which can be accomplished via a variety of enzymatic and chemical methods. The methods described herein for formation of peptidic amide linkages are also suitable for the formation of non-peptidic amide linkages.
(102) Chemical methods for forming the amide linkage are described in detail in standard references on peptide chemistry, including Muller, Methoden der organischen Chemie Vol. XV/2, 1-364, Thieme Verlag, Stuttgart, (1974); Stewart and Young, Solid Phase Peptide Synthesis, 31-34 and 71-82, Pierce Chemical Company, Rockford, Ill. (1984); Bodanszky et al., Peptide Synthesis, 85-128, John Wiley & Sons, New York, (1976); Practice of Peptide Synthesis, M. Bodansky, A. Bodansky, Springer-Verlag, 1994 and other standard works in peptide chemistry. Methods include the azide method, the symmetric and mixed anhydride method, the use of in situ generated or preformed active esters, the use of urethane protected N-carboxy anhydrides of amino acids and the formation of the amide linkage using coupling reagents, such as dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC), 1-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ), pivaloyl chloride, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCl), n-propane-phosphonic anhydride (PPA), N,N-bis (2-oxo-3-oxazolidinyl)amido phosphoryl chloride (BOP-Cl), bromo-tris-pyrrolidinophosphonium hexafluorophosphate (PyBrop), diphenylphosphoryl azide (DPPA), Castro's reagent (BOP, PyBop), O-benzotriazolyl-N,N,N,N-tetramethyluronium salts (HBTU), O-azabenzotriazolyl-N,N,N,N-tetramethyluronuim salts (TATU), diethylphosphoryl cyanide (DEPCN), 2,5-diphenyl-2,3-dihydro-3-oxo-4-hydroxythiophene dioxide (Steglich's reagent; HOTDO), 1,1-carbonyldiimidazole (CDI) and the like. The coupling reagents can be employed alone or in combination with additives such as N,N-dimethyl-4-aminopyridine (DMAP), N-hydroxy-benzotriazole (HOBt), N-hydroxybenzotriazine (HOOBt), N-hydroxysuccinimide (HOSu), 2-hydroxypyridine and the like.
(103) In accordance with other examples, methods of modulating translation initiation for therapeutic purposes are disclosed. In one example, a method involves contacting a cell with an agent that inhibits translation initiation. An agent that inhibits translation initiation can be any one of the compounds described herein, such as a N,N-diarylurea and/or N,N-diarylthiourea compound. In at least certain examples, the compound modulates the depletion of intracellular calcium stores. Methods of modulating translation initiation can be performed in vitro (e.g., by culturing a cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). Certain examples disclosed herein are directed to methods of treating an individual afflicted with a disease or disorder characterized by aberrant translation initiation. Examples of such disorders are described herein. In one embodiment, the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that inhibits translation initiation. As used herein, an individual afflicted with a disease or disorder is intended to include both human and non-human mammals. Examples of non-human mammals include, but are not limited to, non-human primates, horses, cows, goats, sheep, dogs, cats, mice, rats, hamsters, guinea pigs and the like.
(104) The present invention provides for both prophylactic and therapeutic methods of treating a subject for one or more (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infection. In one aspect, the invention provides a method for preventing in a subject, a disease or condition associated with one or more (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infection, by administering, to the subject one or more N,N-diarylurea and/or N,N-diarylthiourea compounds described herein to modulate one or more (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infection. Administration of a prophylactic agent can occur prior to the manifestation of symptoms, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
(105) Another aspect of the invention pertains to therapeutic methods of treating one or more (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, and/or (4) disorders associated with viral infection for therapeutic purposes. Accordingly, in an exemplary embodiment, a therapeutic method of the invention involves contacting a subject with a N,N-diarylurea and/or N,N-diarylthiourea compound that therapeutically treats one or more (1) proliferative disorders, (2) non-proliferative, degenerative disorders, (3) viral infections, (4) disorders associated with viral infection, and/or (5) disorders characterized by unwanted protein synthesis or diseases for which reducing protein synthesis is advantageous.
(106) One embodiment of the present invention involves a method of treating a translation initiation-associated disease or disorder which includes the step of administering a therapeutically and/or prophylactically effective amount of an agent which inhibits translation initiation to a subject. In another embodiment, a subject is administered a therapeutically and/or prophylactically effective amount that is effective to deplete intracellular calcium stores. As defined herein, a therapeutically and/or prophylactically effective amount of agent (i.e., an effective dosage) ranges from about 0.001 to 30 mg/kg body weight, from about 0.01 to 25 mg/kg body weight, from about 0.1 to 20 mg/kg body weight, from about 1 to 10 mg/kg, from about 2 to 9 mg/kg, from about 3 to 8 mg/kg, from about 4 to 7 mg/kg, or from about 5 to 6 mg/kg body weight. The skilled artisan will appreciate that certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Treatment of a subject with a therapeutically and/or prophylactically effective amount of an inhibitor can include a single treatment or can include a series of treatments. It will also be appreciated that the effective dosage of in used for treatment may increase or decrease over the course of a particular treatment.
(107) It is to be understood that the embodiments of the present invention which have been described are merely illustrative of some of the applications of the principles of the present invention. Numerous modifications may be made by those skilled in the art based upon the teachings presented herein without departing from the true spirit and scope of the invention. The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference in their entirety for all purposes.
(108) The following examples are set forth as being representative of the present invention. These examples are not to be construed as limiting the scope of the invention as these and other equivalent embodiments will be apparent in view of the present disclosure, figures, and accompanying claims.
Example I
N,N-Diarylurea Translation Initiation Inhibitors
(109) Design and Development of a Ternary Complex Assay
(110) For assay development, a bi-directional plasmid was designed in which a common promoter/enhancer complex drives the transcription of firefly luciferase (F-luc) ORF fused to the 5 untranslated region (UTR) of ATF-4, and of the renilla luciferase (R-luc) ORF fused to a 90-nucleotide 5 UTR derived from the plasmid (
(111) The KLN-tTA colonies that drove expression of reporter genes from pBISA-DL plasmid were selected by transient transfection and dual luciferase assay. One of these KLN-tTA cell lines was transfected with the pBISA-DL.sup.(ATF-4) expression vector, stable colonies were selected by dual luciferase assay and expanded. To determine if reduced availability of the eIF2*GTP*Met-tRNA.sub.i ternary complex increased the translation of firefly luciferase and decreased translation of renilla luciferase, selected KLN-tTA/pBISA-DL.sup.(AFT-4) colonies were treated with thapsigargin (TG) or tunicamycin (TU), two agents known to cause phosphorylation of eIF2.
(112) This assay was then adapted for high throughput screening in 96 and 384 well plates. This was done by evaluating the cell density, length of exposure to compounds, DMSO tolerance and optimum firefly and renilla substrate. We then challenged these cells with thapsigargin or DMSO. The scattered plot of these data is shown in
(113) Screening
(114) Screening was conducted in 384 well white opaque plates (Nalge Nunc), 100 l volume RPMI+10% fetal bovine serum. Cells were plated at the sub-confluent density of 10,000 cells/well, and allowed to attach for a period of 16-18 hours at 37 C., 5% CO.sub.2. Compounds were added as 1 l of a 1 mM DMSO stock solution for a final screening concentration of 10 M, using low-volume tips for transfer (Molecular Bioproducts). Cells were then incubated in the presence of compound for an additional sixteen hours, again at 37 C., 5% CO.sub.2. Following incubation 70 l of the culture medium was removed from each well to allow for reagent addition and plates were allowed to equilibrate to room temperature for thirty minutes. Firefly luciferase reporter activity was then read by the addition of thirty microliters of Dual Glo Luciferase reagent (Promega), followed by one hour incubation at room temperature to allow for adequate signal buildup. Luminescence counting was conducted on a Microbeta Trilux using a 1 second read time. Renilla luciferase reporter activity was measured following addition of 30 l Stop and Glo Luciferase reagent (Promega) and incubation identical to the one carried out for the firefly luciferase one.
(115) Compound scores were interpreted as firefly luciferase activity divided by renilla luciferase activity, normalized to the plate's DMSO control. Using a preliminary screen of the NCI Diversity set as a guide (1990 compounds), a hit threshold of three times the DMSO control readout was chosen to achieve a target hit rate of 1%; wells with this threshold value typically fell three standard deviations from the plate mean. All data analysis was conducted using the BioAssay HTS software package (CambridgeSoft).
(116) With this format, signal-to-noise and signal-to-background typically ran at 100 and 10 respectively, with thapsigargin (TG) an agent known to induce eIF2 phosphorylation at 100 nM.
(117) 102,709 compounds in the NCI Open Chemical Repository were then screened using this HTS assay. Of these, approximately 1200 compounds were identified as hits in the primary screen (1.2% hit rate). Initial hits were confirmed by repeating the same dual luciferase assay in 96 well plates. Briefly, 20,000 cells/well were plated in triplicate for each concentration (10, 5 and 2.5 M) of the compounds. The compounds that increased firefly/renilla luciferase ratio at least three-fold above the same ratio in the DMSO treated wells were considered confirmed hits. The final number of confirmed hits was 648 (See Table 5).
(118) Lead Scaffolds
(119) A review of the confirmed hits identified N,N-diarylureas as a privileged scaffold that can provide attractive leads. Using commercially available sources we assembled a 120 member lead finding library of N,N-diarylureas with various substitutions. Among these compounds three aryl-substituted active and one inactive N,N-diarylureas were selected for further evaluation (
(120) ##STR00246##
(121) Characterization of N,N-Diarylurea Compounds in Secondary Assays
(122) In order to validate the N,N-diarylurea compounds bona fide modifiers of the abundance of the eIF2-GTP-Met-tRNA.sub.i ternary complex, we determined effects selected active and inactive N,N-diarylureas on endogenous cellular markers of the ternary complex. For example, reducing amount of the ternary complex increases translation of ATF-4, which results in elevated expression of CHOP mRNA and protein. Therefore, expression of endogenous CHOP mRNA and CHOP protein in KLN-tTA/pBISA-DL.sup.(ATF-4) cells were utilized as secondary assays to validate N,N-diarylurea compounds as modifiers of the eIF2GTPMet-tRNA.sub.i ternary complex. As shown in
(123) The effect of certain compounds on ternary complex activity has been studied and the results presented below
(124) TABLE-US-00002 Ternary Complex Activity Maximum effect (E.sub.max, Maximum effective dose Compound Structure fold over control) C.sub.max (M)
(125) NN-Diarylurea Compounds Modify Availability of the eIF2-GTP-Met-tRNA.sub.i Ternary Complex by Causing Phosphorylation of eIF2
(126) The amount of the eIF2 GTP Met-tRNA.sub.i complex can be reduced by phosphorylation of eIF2, reduced expression of Met-tRNA.sub.i, or eIF2 phosphorylation independent reduction in the activity of eIF2B, the eIF2 guanine nucleotide exchange factor. To determine which of these was the case, the effect of active N,N-diarylureas on the phosphorylation of eIF2 was studied. KLN-tTA/pBISA-DL.sup.(ATF-4) or PC-3 prostate cancer cells were incubated with three active and one inactive N,N-diarylurea compounds and determined the phosphorylation of eIF2 by Western blot analysis. As shown in
(127) N,N-Diarylurea Compounds Reduce Expression of Cyclin D1
(128) As shown in
(129) N,N-Diarylurea Compounds Specifically Activate Heme Regulated Inhibitor (HRI)
(130) Four distinct kinases are shown to specifically phosphorylate eIF2 in response to the metabolic state of the cells or external stimuli. These are PKR, PKR-like endoplasmic reticulum kinase (PERK), general control derepressible kinase 2 (GCN2), and heme regulated inhibitor. To determine if N,N-diarylurea compounds cause phosphorylation of eIF2 by causing activation of one or more of these kinases, knockdown expression of these kinases was assayed in KLN-tTA/pBISA-DL.sup.(ATF-4) cells individually or in combinations, treating the cells with compound #1781 or DMSO. As seen in
(131) Heme Regulated Inhibitor (HRI) Mediates Phosphorylation of eIF2 by N,N-Diarylureas
(132) Further studies were done to determine which eIF2 kinase(s) mediate phosphorylation of eIF2 by N,N-diarylureas. In accordance with this aspect, the expression of each one of the four eIF2 kinases was knocked down either individually or in all possible combinations. Mouse KLN-tTA/pBISA-DL.sup.(ATF-4) and human CRL-2813 melanoma cells were transfected with siRNAs targeting PKR, GCN2, PERK or HRI, which knocked down their respective mRNAs with 70-80% efficiency (see data presented in Table 1).
(133) TABLE-US-00003 TABLE 1 Efficiency of siRNAs in knocking down the expression of eIF2 kinase mRNAs in KLN-tTA/pBISA-DL.sup.(ATF-4) and CRL-2813 cancer cells. Knockdown efficiency (%) PERK GCN2 PKR HRI KLN 68.8 3.5 75.3 0.7 79.8 5.6 65.7 2.5 CRL-2813 82.5 5.7 80.3 1.5 69.4 2.6 70.5 3.4
(134) The co-transfected cells were treated with vehicle or an active N,N-diarylurea, compound #1781, and determined the normalized F-luc/R-luc ratio.
(135) N,N-Diarylureas Activate HRI in Cell-Free Lysates
(136) Compound #1781 was added to lysates of CRL-2813 cells or heme-supplemented rabbit reticulocytes and phosphorylation of eIF2 by Western blot was determined. As shown in
(137) N,N-Diarylureas Inhibit Cell Proliferation by Reducing the Availability of the eIF2GTPMet-tRNA.sub.i Ternary Complex
(138) Reduced availability of the ternary complex causes inhibition of translation initiation and thereby of cell proliferation. Cell proliferation was selected as a biological response parameter to demonstrate target specificity and in vitro potency of N,N-diarlyureas. The effects of N,N-diarlyureas on the proliferation KLN mouse squamous cell carcinoma, CRL-2351 human breast, CRL-2813 human melanoma, A549 human lung and PC-3 human prostate cancer cell lines were tested. N,N-diarylureas active in the ternary complex assay were potent inhibitors of cells proliferation (see data presented in Table 2).
(139) TABLE-US-00004 TABLE 2 Effect of N,N -diarylureas on proliferation of human cancer cells IC.sub.50 .sup.*(M) Cell line 1527 1780 1781 KM094748 PC-3 8.3 0.9 1.1 1.4 KLN >20 14.8 17.1 8.5 CRL-2813 20 0.1 0.5 0.3 CRL-2351 9.5 1.3 3.0 0.1 A549 >20 0.8 1.2 1.3 *Concentration of compound that inhibit cell proliferation by 50%.
(140) To determine if N,N-diarylureas inhibit cell proliferation by reducing the availability of the ternary complex, the effect of N,N-diarylureas on proliferation of previously described transgenic PC-3 human prostate cancer cell lines expressing either the non-phosphorylatable eIF2-S51A mutant or the eIF2-WT was studied. The results of these studies, shown in
(141) Expression of HRI Correlates with the Sensitivity of Cancer Cells to N,N-Diarylureas
(142) To determine correlate the sensitivity of the various cell lines to anti-proliferative effects of N,N-diarylureas with the expression of HRI, cell lysates were probed with anti-HRI antibodies and relative level of HRI expression was correlated with the inhibition of cell proliferation exerted by N,N-diarylureas. KLN cells, which express undetectable levels of HRI are very resistant to inhibition of cell proliferation by N,N-diarylureas whereas CRL-2813 cells that express high level of HRI are most sensitive (see Table 2 and
(143) N,N-Diarylureas Display No Apparent Toxicity In Vivo
(144) To study toxicity effects, mice were treated with various doses of compound #1781 or vehicle. As shown in
(145) Discussion
(146) The ternary complex assay described herein is particularly robust because expression of both reporters is controlled by the same enhancer/promoter complex, therefore any effect of the test compounds on the transcription will be same for both reporters. Furthermore any effect of the test compounds on translation elongation or termination will be similar for both reporters. Because of these features, the ternary complex assay described herein controls for many variables at once. In addition, the primary assay is backed by the secondary assays such as the expression of CHOP protein and mRNA, which faithfully reflects the abundance of the ternary complex. The specificity of the assay was further demonstrated by testing well-known anti-cancer agents for their effects on the abundance of the ternary complex. None of these anti-cancer agents with no known effect on the formation of the ternary complex showed any activity, indicating that this assay is suitable for identification of mechanism specific active compounds. In addition to identifying privileged scaffolds that could be utilized for design of focused libraries for lead generation, a library of N,N-diarylureas was prepared and studied using the ternary complex assay. Further characterization of selected compounds indicated that N,N-diarylurea compounds reduced the amount of the ternary complex by causing phosphorylation of eIF2. These findings indicate that the ternary complex assay is highly suitable for guiding development of translation initiation inhibitors, and that these N,N-diarylurea compounds do in fact display potent anti-proliferative activity correlated with their activity in the ternary complex assay.
(147) The data described herein indicate that the active N,N-diarylurea compounds cause phosphorylation of eIF2, induce expression of CHOP mRNA and protein and potently inhibit cell proliferation. The N,N-diarylurea compounds also preferentially inhibited expression of cyclin D1. The data presented herein demonstrate that phosphorylation of eIF2 by N,N-diarylurea compounds is required for reducing amount of the ternary complex by these agents. It was further demonstrated that N,N-diarylureas compounds inhibit cell proliferation by causing phosphorylation of eIF2 with IC.sub.50 values in the low/sub-micromolar range.
(148) The data presented herein demonstrates the clear potential for targeting of the eIF2-GTP-Met-tRNA.sub.i ternary complex in a cell based high throughput screening campaign to develop translation initiation inhibitors and potential of N,N-diarylurea compounds for development of novel mechanism specific agents for cancer therapy.
(149) Materials and Methods
(150) Cell Growth Assay: Cell growth was measured by the SRB assay.
(151) Plasmids: The bi-directional mammalian expression vector pBI (Clontech, CA) was modified to expand the multiple cloning sites MCSs and thereafter named pBISA. This vector contains seven copies of the tetracycline regulated transactivator response element (TRE), which together act as core promoter/enhancer. The TRE is flanked on both sides by minimal human cytomegalovirus (CMV) minimal promoters allowing bi-directional transcription and two (MCS). Firefly and renilla luciferases were subcloned into MCS-I and MCS-II, respectively. This base plasmid, designated pBISA-DL, transcribes two mRNAs that contain the 90 nucleotide plasmid derived 5 UTR (same sequence in both mRNAs), and the ORF encoding either firefly or renilla luciferase followed by a polyadenylation sequence. This plasmid was further modified by inserting the 5 UTR of ATF-4 into MCS-I in front of the firefly luciferase mRNA. Transcription from this direction generates an mRNA that contains the firefly luciferase ORF preceded by a 5 UTR composed of 90 nucleotides derived from the plasmid and 267 nucleotides derived from the 5 UTR of ATF-4 mRNA. Transcription from the other direction generates an mRNA that contains the renilla luciferase ORF preceded only by the 90-nucleotide plasmid-derived sequence in the 5 UTR (
(152) Stable and transient transfection: Cells were seeded at the density of 10.sup.5 in 60-mm (stable transfection) or 10.sup.4 cells per well of 96-well plate (transient transfection) plates and transfected one day later using the Qiagen Transfectamine transfection kit. For selection of stable cell lines, transfected cells were transferred to 100-mm plates and selected with appropriate antibiotics.
(153) Western blotting: Cell extracts were separated by SDS-PAGE and probed with anti-phosphoserine-51-eIF2 (PS51-eIF2), anti-total eIF2-specific antibodies (PS51-eIF2 (Biosource International, Hopkinton, Mass.), anti-CHOP, or anti -actin (Santa Cruz Biotechnology, CA) as described.
(154) Robotics: Liquid handling was conducted on a Biomek FX (Beckman Coulter). Luminescence measurements were conducted on a Microbeta Trilux (Perkin Elmer). Both are components on a Sagian Core robotic platform (Beckman Coulter).
(155) Dual luciferase assay: Cells or minced tumors expressing firefly and renilla luciferases were lysed and the extracts assayed with a glow type dual luciferase assay kit, per manufacturer's instruction (Promega Inc., Madison, Wis.).
(156) Real time PCR: For real time PCR, total RNA was extracted with TaqMan Gene Expression Cells-to-Ct Kit (Applied Biosystems, Branchburg, N.J.) according to manufacturer's protocol. Contaminating DNA was removed by DNase I treatment. 1-Step Real-time PCR was performed on a Bio-Rad iCycler IQ5 system by using B-R 1-Step SYBR Green qRT-PCR Kit (Quanta BioSciences, Gaithersburg, Md.) according to manufacturer's specifications. The thermal cycler conditions were as follows: 10 minutes at 50 C., hold for 5 minutes at 95 C., followed by 2-step PCR for 45 cycles of 95 C. for 15 seconds followed by 60 C. for 30 seconds. All PCRs were performed triplicate in independent PCR runs. Mean values of these repeated measurements were used for calculation. To calibrate the results, all the transcripts quantities were normalized to 18S rRNA (was 18S ribosomal RNA-like mRNA in mouse). The following primers were used in real-time PCR reactions:
(157) TABLE-US-00005 HumanCHOP (SEQIDNO:1) 5 AGAACCAGGAAACGGAAACAGA3 (SEQIDNO:2) 5 TCTCCTTCATGCGCTGCTTT3 MouseCHOP (SEQIDNO:3) 5 CATACACCACCACACCTGAAAG3 (SEQIDNO:4) 5 CCGTTTCCTAGTTCTTCCTTGC3 HumanCyclinD1 (SEQIDNO:5) 5 CGGAGGAGAACAAACAGA3 (SEQIDNO:6) 5 TGAGGCGGTAGTAGGACA3 MouseCyclinD1 (SEQIDNO:7) 5 TACCGCACAACGCACTTTCTT3 (SEQIDNO:8) 5 CGCAGGCTTGACTCCAGAAG3 Human/Mouse18srRNA (SEQIDNO:9) 5 CGGCGACGACCCATTCGAAC3 (SEQIDNO:10) 5 GAATCGAACCCTGATTCCCCGTC3
Example II
Structure-Activity Relationship (SAR) Study of N,N-Diarylureas as Inhibitors of Translation Initiation, Potent Anti-Cancer Agents
(158) The general synthetic approaches to produce N,N-diarylurea compounds of the present invention are set forth below.
(159) Chemistry
(160) The first series of molecules in this example, most of which are symmetrical N,N-diarylureas substituted by heteroatoms or groups of heteroatoms, was prepared by using appropriate commercially available aryl isocyanates and aryl amines according to Scheme 1.
(161) ##STR00250## Reagents and conditions: (i) anilines, 1,4-dioxane, 55 C.
(162) The synthesis of compounds 1-3 was carried out in one step in 1,4-dioxane at 55 C. overnight. The same simple procedure using 5-aminocresol or 3-methoxy-4-methylaniline as new starting aryl amines was followed for the elaboration of the unsymmetrical N,N-diarylureas 4-9 according to Scheme 2.
(163) ##STR00251## Reagents and conditions: (i) anilines, 1,4-dioxane, 55 C.
(164) Analogs 11-13 and 15-17 were prepared in a slightly different manner. The synthesis began by the elaboration of two different substituted anilines starting from 2-methyl-5-nitrophenol. Compound 10, which was the precursor of N,N-diarylureas 11-13, was obtained via a classic Mitsunobu coupling reaction in presence of N,N-dimethylethanolamine according to Scheme 3.
(165) ##STR00252## Reagents and conditions: (i) N,N-dimethylethanolamine, PPh.sub.3, DEAD, THF, 0 C.; (ii) SnCl.sub.2, EtOH, 90 C.; (iii) phenylisocyanates, dioxane, 55 C.
(166) In the same way, compound 14, which was the precursor of N,N-diarylureas 15-17 was obtained starting from 4-(2-hydroxymethyl)morpholine according to Scheme 4.
(167) ##STR00253## Reagents and conditions: (i) 4-(2-hydroxyethyl)morpholine, PPh.sub.3, DEAD, THF, 0 C.; (ii) SnCl.sub.2, EtOH, 90 C.; (iii) phenylisocyanates, dioxane, 55 C.
(168) After reduction of the nitro group in amine by the use of tin chloride in ethanol at 90 C., the substituted anilines were directly coupled to the same various isocyanates in 1,4-dioxane at 55 C. overnight to produce 11-13 and 15-17.
(169) In order to couple piperazine with 2-methyl-5-nitrophenol via a Mitsunobu reaction (compound 19), the secondary amine was first protected by a benzyloxycarbonyl group. The protection was carried out with benzylclhoroformate and a solution of NaOH 4N to afford 18 according to Scheme 5.
(170) ##STR00254## Reagents and conditions: (i) benzylchloroformate, NaOH 4N, CH.sub.3CN/H.sub.2O; (ii) 2-methyl-5-nitrophenol, PPh.sub.3, DEAD, THF, 0 C.; (iii) SnCl.sub.2, EtOH, 90 C.; (iv) phenylisocyanates, dioxane, 55 C.; (v) H.sub.2, PdC, MeOH, 1 atm; (vi) HCl 4N, dioxane.
(171) After the coupling reaction using triphenylphosphine and DEAD in THF, the nitro group was, as previously described, reduced in amine and coupled to the same various isocyanates to produce protected intermediates 20-22. Finally, after a hydrogenolysis carried out at atmospheric pressure under hydrogen and in presence of palladium on carbon, a precipitation in a solution of HCl 4N in 1,4-dioxane allowed the isolation of N,N-diarylureas 23-25 as salts.
(172) The last series of molecules in this example, in which heteroatoms were included in the aromatic ring, was prepared starting from several substituted pyridine and pyrimidine and using the same general procedure in 1,4-dioxane at 55 C. overnight according to Scheme 6.
(173) ##STR00255## Reagents and conditions: (i) 2-amino-3-hydroxypyridine, dioxane 55 C.
(174) While compounds 26 and 27 appeared to be easily isolable by crystallization or purification by preparative HPLC, compound 28, which was derivated from 2-amino-4-hydroxy-6-methylpyrimidine, appeared to be not soluble in any solvent. Because it could not be purified, this compound was removed from the structure-activity relationship (SAR) study.
General Procedure A for the Synthesis of Compounds 1-9
1,3-bis(3,4-dichlorophenyl)urea (Compound 1)
(175) As a non-limiting example, 3,4-dichlorophenylisocyanate (188 mg, 1 mmol) and 3,4-dichloroaniline (178 mg, 1.1 mmol) were dissolved in 10 mL of anhydrous dioxane. The reaction mixture was warmed to 55 C., stirred under nitrogen over night and then cooled to room temperature. The solvent was removed under vacuum and the crude was purified twice by crystallization in ethyl acetate/hexane to afford 1 (262 mg, 75%) as a white powder.
1,3-bis[4-chloro-3-(trifluoromethyl)phenyl]urea (Compound 2)
(176) As another non-limiting example, 4-chloro-3(trifluoromethyl)phenylisocyanate (222 mg, 1 mmol) and 4-chloro-3-(trifluoromethyl)aniline (215 mg, 1.1 mmol) were used following the general procedure A to isolate 2 (250 mg, 60%) as a white powder.
1,3-bis[3,5-bis(trifluoromethyl)phenyl]urea (Compound 3)
(177) As another non-limiting example, 3,5-bis(trifluoromethyl)phenylisocyanate (600 mg, 2.353 mmol) and 3,5-bis(trifluoromethyl)aniline (647 mg, 2.824 mmol) were used following the general procedure A to isolate 3 (1140 mg, 78%) as a white powder. .sup.1H NMR (500 MHz, CD.sub.3OD, ): 8.12 (s, 1H, CH.sub.arom.), 7.59 (s, 1H, CH.sub.arom.). .sup.13C NMR (400 MHz, CD.sub.3OD, ): 152.89, 141.32, 132.55, 131.80, 124.9, 122.2, 118.4, 115.24.
3-(3,4-dichlorophenyl)-1-(3-hydroxy-4-methylphenyl)urea (Compound 4)
(178) As another non-limiting example, 3,4dichlorophenylisocyanate (202 mg, 1.073 mmol) and 5-aminocresol (120 mg, 0.976 mmol) were used following the general procedure A to isolate 4 (244 mg, 81%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.24 (s, 1H, OH), 8.82 (s, 1H, NH), 8.57 (s, 1H, NH), 7.85 (s, 1H, CH.sub.arom.), 7.47 (d, J=11 Hz, 1H, CH.sub.arom.), 7.28 (d, J=11 Hz, 1H, CH.sub.arom.), 7.04 (s, 1H, CH.sub.arom.), 6.90 (d, J=10 Hz, 1H, CH.sub.arom.), 6.69 (d, J=10 Hz, 1H, CH.sub.arom.), 2.02 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 156.09, 152.84, 140.77, 138.45, 131.68, 131.19, 131.06, 123.54, 119.78, 118.84, 118.35, 109.71, 105.96, 16.09.
3-[4-chloro-3-(trifluoromethyl)phenyl]-1-(3-hydroxy-4-methylphenyl)urea (Compound 5)
(179) As another non-limiting example, 4-chloro-3-(trifluoromethyl)phenylisocyanate (198 mg, 0.894 mmol) and 5-aminocresol (100 mg, 0.813 mmol) were used following the general procedure A to isolate 5 (102 mg, 46%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.26 (s, 1H, OH), 9.03 (s, 1H, NH), 8.64 (s, 1H, NH), 8.12 (s, 1H, CH.sub.arom.), 7.58 (m, 2H, CH.sub.arom.), 7.10 (s, 1H, CH.sub.arom.), 6.92 (d, J=8 Hz, 1H, CH.sub.arom.), 6.69 (d, J=8 Hz, 1H, CH.sub.arom.), 2.04 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 156.09, 125.93, 140.17, 138.38, 132.62, 131.05, 123.53, 122.72, 118.40, 109.79, 106.04, 16.07.
3-[3,5-bis(trifluoromethyl)phenyl]-1-(3-hydroxy-4-methylphenyl)urea (Compound 6)
(180) As another non-limiting example, 3,5-bis(trifluoromethyl) phenylisocyanate (200 mg, 0.784 mmol) and 5-aminocresol (106 mg, 0.862 mmol) were used following the general procedure A to synthesize 9. At the end of the reaction, the crude was purified by flash chromatography (15 to 30% of ethyl acetate in cyclohexane). After concentration of the pure fractions, the white solid was crystallized in hexane to afford 6 (260 mg, 52.5%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.27 (s, 1H, OH), 9.25 (s, 1H, NH), 8.79 (s, 1H, NH), 8.11 (s, 2H, CH.sub.arom.), 7.61 (s, 1H, CH.sub.arom.), 7.12 (s, 1H, CH.sub.arom.), 6.94 (d, J=8 Hz, 1H, CH.sub.arom.), 6.72 (d, J=8 Hz, 1H, CH.sub.arom.), 2.05 (s, 3H, CH.sub.3). .sup.13C NMR (500 MHz, DMSO.sub.d6, ): 156.11, 152.97, 142.26, 138.20, 131.48, 131.23, 130.97, 127.27, 125.10, 122.93, 118.76, 114.85, 110.05, 106.30, 16.09.
Compound 7
(181) As another non-limiting example, 3,4-dichlorophenylisocyanate (151 mg, 0.803 mmol) and 3-methoxy-4-methylaniline (100 mg, 0.730 mmol) were used following the general procedure A to isolate 7 (204 mg, 86%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 8.91 (s, 1H, NH), 8.70 (s, 1H, NH), 7.88 (s, 1H, CH.sub.arom.), 7.50 (d, J=9 Hz, 1H, CH.sub.arom.), 7.30 (d, J=9 Hz, 1H, CH.sub.arom.), 7.19 (s, 1H, CH.sub.arom.), 7.01 (d, J=8 Hz, 1H, CH.sub.arom.), 6.82 (d, J=8 Hz, 1H, CH.sub.arom.), 3.76 (s, 3H, OCH.sub.3), 2.07 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 157.99, 152.97, 140.71, 139.02, 131.70, 131.22, 130.87, 123.67, 119.91, 119.84, 119.00, 110.72, 102.14, 55.72, 16.15.
Compound 8
(182) As another non-limiting example, 4-chloro-3-(trifluoromethyl)phenylisocyanate (151 mg, 0.682 mmol) and 3-methoxy-4-methylaniline (85 mg, 0.620 mmol) were used following the general procedure A to isolate 8 (102 mg, 46%) as a white powder. 1H NMR (500 MHz, DMSO.sub.d6, ): 9.07 (s, 1H, NH), 8.74 (s, 1H, NH), 8.07 (s, 1H, CH arom.), 7.60 (m, 2H, CH arom.), 7.17 (s, 1H, CH arom.), 7.00 (d, J=10 Hz, 1H, CH arom.), 6.82 (d, J=10 Hz, 1H, CH arom.), 3.74 (s, 3H, OCH.sub.3), 2.06 (s, 3H, CH.sub.3). 13C NMR (400 MHz, DMSO.sub.d6, ): 157.99, 153.05, 140.10, 138.95, 132.64, 130.87, 123.70, 119.95, 117.39, 110.85, 102.22, 55.70, 16.14.
Compound 9
(183) As another non-limiting example, 3,5-bis(trifluoromethyl)phenylisocyanate (143 mg, 0.562 mmol) and 3-methoxy-4-methylaniline (70 mg, 0.511 mmol) were used following the general procedure A to isolate 9 (92 mg, 46%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.32 (s, 1H, NH), 8.90 (s, 1H, NH), 8.10 (m, 2H, CH.sub.arom.), 7.61 (s, 1H, CH.sub.arom.), 7.18 (s, 1H, CH.sub.arom.), 7.00 (d, J=10 Hz, 1H, CH.sub.arom.), 6.85 (d, J=10 Hz, 1H, CH.sub.arom.), 3.74 (s, 3H, OCH.sub.3), 2.06 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 157.98, 153.05, 142.59, 138.74, 131.50, 131.18, 130.86, 128.06, 125.35, 122.64, 120.16, 118.59, 114.92, 111.08, 102.42, 55.73, 16.15.
General Procedure B (for the Synthesis of Compounds 10, 14 and 19)
Compound 10
(184) As another non-limiting example, 2-methyl-5-nitrophenol (2.00 g, 13.07 mmol), N,N-dimethylethanolamine (1.31 mL, 13.07 mmol) and triphenylphosphine (4.46 g, 16.99 mmol) were placed in a 100 mL round-bottomed flask under nitrogen. 40 mL of anhydrous THF were added via syringe at 0 C. After stirring the reaction mixture at this temperature for 10 minutes, 7.32 mL of a solution of diethylazodicarboxylate 40% in toluene (2.93 g, 16.99 mmol) were added via syringe. The reaction was warmed to room temperature and stirred under nitrogen for two hours. The solvents were removed under vacuum. Triphenylphosphine oxide formed during the reaction was precipitated in a mixture of ethyl acetate/hexane and filtrated. The crude was then purified by flash chromatography (0 to 2% of MeOH in DCM) to afford 10 (2.11 g, 70%) as a yellow oil.
General Procedure C (for the Synthesis of Compounds 11-13, 14-16 and 20-22)
3-(3,4-dichlorophenyl)-1-{3-[2-(dimethylamino)ethoxy]-4-methylphenyl}urea (Compound 11)
(185) As another non-limiting example, Compound 10 (262 mg, 1.169 mmol) was dissolved in 10 mL of EtOH. SnCl.sub.2H.sub.2O (1316 mg, 5.848 mmol) was added and the temperature was increased to 90 C. The reaction mixture was stirred for 1.5 hours, cooled to room temperature and poured into iced water. The solution was made alkaline with solid NaOH and then extracted with DCM (330 mL). Organic extracts were combined, washed with water (60 mL) and brine (60 mL), dried over sodium sulfate, concentrated and finally dried under high vacuum over night to afford the substituted aniline (202 mg, 1.041 mmol) as a light-yellow oil. This compound was then dissolved in 10 mL of anhydrous dioxane and 3,4-dichlorophenylisocyanate (254 mg, 1.353 mmol) was added. The reaction mixture was warmed to 55 C., stirred under nitrogen overnight and then cooled to room temperature. The crude was purified by flash chromatography (0 to 2% of MeOH in DCM). After concentration of the pure fractions, the obtained white solid was crystallized in hexane to afford 11 (260 mg, 58%) as a white powder. .sup.1H NMR (300 MHz, DMSO.sub.d6, ): 8.92 (s, 1H, NH), 8.69 (s, 1H, NH), 7.85 (s, 1H, CH.sub.arom.), 7.45 (d, J=8.7 Hz, 1H, CH.sub.arom.), 7.27 (d, J=8.7 Hz, 1H, CH.sub.arom.), 7.15 (m, 1H, CH.sub.arom.), 6.98 (d, J=7.8 Hz, 1H, CH.sub.arom.), 6.80 (d, J=7.8 Hz, 1H, CH.sub.arom.), 3.98 (t, J=5.7 Hz, 2H, OCH.sub.2), 2.63 (t, J=5.7 Hz, 2H, CH.sub.2N), 2.21 (s, 6H, N(CH.sub.3).sub.2), 2.04 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 157.22, 152.97, 140.67, 138.88, 131.68, 131.19, 130.90, 123.66, 120.11, 119.89, 118.99, 110.88, 103.09, 66.72, 58.30, 46.30, 16.11.
3-[4-chloro-3-(trifluoromethyl)phenyl]-1-{3-[2-(dimethylamino)ethoxy]-4-methylphenyl}urea (Compound 12)
(186) As another non-limiting example, Compound 10 (155 mg, 0.692 mmol) and 4-chloro-3-(trifluoromethyl) phenyl isocyanate (151 mg, 0.682 mmol) were used following the general procedure B to synthesize 12. At the end of the reaction, the mixture was precipitated in a solution of HCl 4N in dioxane. After filtration, the white solid was dissolved in acetic acid and purified by preparative HPLC (10 to 40% of acetonitrile in water with 0.1% of acetic acid) to afford 12 (161 mg, 52%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.26 (s, 1H, NH), 8.86 (s, 1H, NH), 8.09 (s, 1H, CH.sub.arom.), 7.62 (m, 2H, CH.sub.arom.), 7.18 (s, 1H, CH.sub.arom.), 7.15 (d, J=8 Hz, 1H, CH.sub.arom.), 6.85 (d, J=8 Hz, 1H, CH.sub.arom.), 4.02 (t, J=5.5 Hz, 2H, OCH.sub.2), 2.71 (t, J=5.5 Hz, 2H, CH.sub.2N), 2.27 (s, 6H, N(CH.sub.3).sub.2), 2.08 (s, 3H, CH.sub.3).
3-[3,5-bis(trifluoromethyl)phenyl]-1-{3-[2-(dimethylamino)ethoxy]-4-methylphenyl}urea (Compound 13)
(187) As another non-limiting example, Compound 10 (248 mg, 1.107 mmol) and 3,5-bis(trifluoromethyl) phenylisocyanate (326 mg, 1.280 mmol) were used following the general procedure B to synthesize 13. At the end of the reaction, the crude was purified by flash chromatography (2 to 8% of MeOH in DCM). After concentration of the pure fractions, the white solid was crystallized in hexane to afford 13 (260 mg, 52.5%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.37 (s, 1H, NH), 8.90 (s, 1H, NH), 8.12 (s, 2H, CH.sub.arom.), 7.62 (m, 1H, CH.sub.arom.), 7.19 (s, 1H, CH.sub.arom.), 7.03 (d, J=8 Hz, 1H, CH.sub.arom.), 6.88 (d, J=8 Hz, 1H, CH.sub.arom.), 4.03 (t, J=5.5 Hz, 2H, OCH.sub.2), 2.68 (t, J=5.5 Hz, 2H, CH.sub.2N), 2.25 (s, 6H, N(CH.sub.3).sub.2), 2.09 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 157.24, 153.05, 142.58, 138.61, 131.51, 131.19, 130.90, 127.78, 125.34, 122.62, 120.46, 118.53, 114.89, 111.26, 103.40, 66.77, 58.30, 46.28, 15.95.
Compound 14
(188) As another non-limiting example, 2-methyl-5-nitrophenol (2.00 g, 13.07 mmol), 4(2-hydroxyethyl)morpholine (1.71 mg, 13.07 mmol), triphenylphosphine (4.46 g, 16.99 mmol) and 7.32 mL of a solution of diethylazodicarboxylate 40% in toluene (2.93 g, 16.99 mmol) were used following the general procedure B to synthesize 14. After treatments, the crude was purified by flash chromatography (0 to 3% of MeOH in DCM) to afford 14 (0.85 g, 23%) as a brown oil.
3-(3,4-dichlorophenyl)-1-{4-methyl-3-[2-(morpholin-4-yl)ethoxy]phenyl}urea (Compound 15)
(189) As another non-limiting example, Compound 14 (278 mg, 1.045 mmol) and 3,4-dichlorophenylisocyanate (285 mg, 1.118 mmol) were used following the general procedure C to synthesize 14. At the end of the reaction, the crude was purified by flash chromatography in normal phase (10 to 0% of cyclohexane in ethyl acetate). After concentration of the pure fractions, the obtained white solid was crystallized in hexane to afford 15 (217 mg, 49%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 8.94 (s, 1H, NH), 8.70 (s, 1H, NH), 7.89 (s, 1H, CH.sub.arom.), 7.51 (d, J=8.5 Hz, 1H, CH.sub.arom.), 7.32 (d, J=8.5 Hz, 1H, CH.sub.arom.), 7.20 (s, 1H, CH.sub.arom.), 7.02, (d, J=8 Hz, 1H, CH.sub.arom.), 6.81 (d, J=8 Hz, 1H, CH.sub.arom.), 4.05 (t, J=5.5 Hz, 2H, OCH.sub.2), 3.58 (m, 4H, CH.sub.2OCH.sub.2), 2.73 (t, J=5.5 Hz, 2H, CH.sub.2N), 2.50 (m, 4H, N(CH.sub.2).sub.2), 2.08 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 157.19, 152.96, 140.66, 138.88, 131.68, 131.19, 130.91, 123.67, 120.15, 119.89, 118.98, 110.95, 103.22, 66.87, 66.46, 57.62, 54.62, 15.98.
3-[4-chloro-3-(trifluoromethyl)phenyl]-1-{4-methyl-3-[2-(morpholin-4-yl)ethoxy]phenyl}urea (Compound 16)
(190) As another non-limiting example, Compound 14 (267 mg, 1.004 mmol) and 4-chloro-3-(trifluoromethyl) phenylisocyanate (241 mg, 1.091 mmol) were used following the general procedure C to synthesize 16. At the end of the reaction, the crude was purified by flash chromatography (10 to 0% of cyclohexane in ethyl acetate). After concentration of the pure fractions, the obtained white solid was crystallized in hexane to afford 16 (263 mg, 58%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 9.11 (s, 1H, NH), 8.74 (s, 1H, NH), 8.09 (s, 1H, CH.sub.arom.), 7.61 (m, 2H, CH.sub.arom.), 7.20 (s, 1H, CH.sub.arom.), 7.02 (d, J=8 Hz, 1H, CH.sub.arom.), 6.83 (d, J=8 Hz, 1H, CH.sub.arom.), 4.05 (t, J=5.5 Hz, 2H, OCH.sub.2), 3.58 (m, 4H, CH.sub.2OCH.sub.2), 2.73 (t, J=5.5 Hz, 2H, CH.sub.2N), 2.50 (m, 4H, N(CH.sub.2).sub.2), 2.08 (s, 3H, CH.sub.3). .sup.13C NMR (400 MHz, DMSO.sub.d6, ): 157.23, 153.07, 140.11, 138.85, 1321.65, 130.92, 123.71, 120.27, 117.35, 110.12, 103.40, 66.77, 66.37, 57.65, 54.28, 15.98.
3-[3,5-bis(trifluoromethyl)phenyl]-1-{4-methyl-3-[2-(morpholin-4-yl)ethoxy]phenyl}urea (Compound 17)
(191) As another non-limiting example, Compound 14 (273 mg, 1.026 mmol) and 3,5-bis(trifluoromethyl) phenylisocyanate (285 mg, 1.118 mmol) were used following the general procedure C to synthesize 17. At the end of the reaction, the crude was purified by flash chromatography in normal phase (20 to 10% of cyclohexane in ethyl acetate). After concentration of the pure fractions, the obtained white solid was crystallized in hexane to afford 17 (235 mg, 48%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 10.11 (s, 1H, NH), 9.34 (s, 1H, NH), 8.11 (s, 2H, CH.sub.arom.), 7.60 (s, 1H, CH.sub.arom.), 7.22, (s, 1H, CH.sub.arom.), 7.02 (d, J=7.5 Hz, 1H, CH.sub.arom.), 6.85 (d, J=7.5 Hz, 1H, CH.sub.arom.), 4.05 (m, 2H, OCH.sub.2), 3.58 (m, 4H, CH.sub.2OCH.sub.2), 2.73 (m, 2H, CH.sub.2N), 2.51 (m, 4H, N(CH.sub.2).sub.2), 2.08 (s, 3H, CH.sub.3).
Compound 18
(192) As another non-limiting example, piperazine (3.00 g, 23.04 mmol) was dissolved in 15 mL of water in a three-neck round-bottomed flask. A solution of benzylchloroformate (3.95 mL, 27.65 mmol) in 15 mL of acetonitrile was added drop wise via isobar cylindrical funnel. In order to maintain the pH around 9, a solution of NaOH 4N was added drop wise via a second isobar cylindrical funnel. The reaction mixture was stirred over night at room temperature and then extracted with DCM (275 mL). The aqueous phase containing the final compound was acidified with HCl 3N and extracted with DCM (375 mL). Organic extracts were combined, washed with brine (150 mL), dried over sodium sulfate and concentrated under vacuum. The crude was purified by flash chromatography (0 to 2% of MeOH in DCM) to afford 18 (5.41 g, 90%) as a colorless oil.
(193) Compound 19:
(194) As another non-limiting example, 2-methyl-5-nitrophenol (1.70 g, 11.11 mmol), compound 18 (2.94 mg, 11.1 mmol), triphenylphosphine (3.79 g, 14.44 mmol) and 6.27 mL of a solution of diethylazodicarboxylate 40% in toluene (2.51 g, 14.44 mmol) were used following the general procedure B to synthesize 19. After treatments, the crude was then purified by flash chromatography (0 to 3% of MeOH in DCM) to afford 19 (3.82 g, 86%) as a yellow oil.
Compound 20
(195) As another non-limiting example, Compound 19 (1.172 g, 2.937 mmol) and 3,4-dichlorophenylisocyanate (0.545 g, 2.778 mmol) were used following the general procedure C to synthesize 20. After treatments, the crude was purified by flash chromatography (40 to 0% of cyclohexane in ethyl acetate) to afford 20 (0.984 g, 60%) as a white powder.
Compound 21
(196) As another non-limiting example, Compound 19 (1.042 g, 2.609 mmol) and 4-chloro-3-(trifluoromethyl) phenylisocyanate (0.545 g, 2.459 mmol) were used following the general procedure C to synthesize 21. After treatments, the crude was purified by flash chromatography (40 to 0% of cyclohexane in ethyl acetate) to afford 21 (1.045 g, 68%) as a white powder.
Compound 22
(197) As another non-limiting example, Compound 19 (992 mg, 2.486 mmol) and 3,5-bis(trifluoromethyl) phenylisocyanate (600 mg, 2.352 mmol) were used following the general procedure C to synthesize 22. After treatments, the crude was purified by flash chromatography (5 to 0% of cyclohexane in ethyl acetate) to afford 22 (945 mg, 71%) as a white powder.
General Procedure D (for the Synthesis of Compounds 23-25)
4-[2-(5-{[(3,4-dichlorophenyl)carbamoyl]amino}-2-methylphenoxy)ethyl]piperazine-1,4-diium dichloride (Compound 23)
(198) As another non-limiting example, Compound 20 (870 mg, 1.561 mmol) was dissolved in 20 mL of MeOH and PdC (10% by weight, 93 mg) was carefully added. The reaction mixture was stirred under a flux of hydrogen for 2 hours at atmospheric pressure and room temperature (the reaction was monitored by LCMS) and then filtered through a pad of celite. The filtrate was concentrated and purified by HPLC (10 to 45% of acetonitrile in water with 0.1% of acetic acid). After concentration of the pure fractions, the compound was precipitated in a solution of HCl 4N in dioxane to afford 23 (379 mg, 49%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 12.03 (s, 1H, NH), 9.77 (s, 1H, NH), 9.57 (m, 2H, NH), 9.36 (s, 1H, NH), 7.89 (s, 1H, CH.sub.arom.), 7.50 (d, J=8.5 Hz, 1H, CH.sub.arom.), 7.32 (m, 2H, CH.sub.arom.), 7.05 (d, J=8 Hz, 1H, CH.sub.arom.), 6.83 (d, J=8 Hz, 1H, CH.sub.arom.), 4.33 (m, 2H, OCH.sub.2), 3.74-3.39 (m, 10H, CH.sub.2N), 2.13 (s, 3H, CH.sub.3).
4-{2-[5-({[4-chloro-3-(trifluoromethyl)phenyl]carbamoyl}amino)-2-ethylphenoxy]ethyl}piperazine-1,4-diium dichloride (Compound 24)
(199) As another non-limiting example, Compound 21 (930 mg, 1.573 mmol) was treated following the general procedure D and purified by HPLC (15 to 45% of acetonitrile in water with 0.1% of acetic acid). After concentration of the pure fractions, the compound was precipitated in a solution of HCl 4N in dioxane to afford 24 (600 mg, 72%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 12.00 (s, 1H, NH), 9.94 (s, 1H, NH), 9.61 (m, 2H, NH), 9.40 (s, 1H, NH), 8.11 (s, 1H, CH.sub.arom.), 7.61 (m, 2H, CH.sub.arom.), 7.29 (s, 1H, CH.sub.arom.), 7.06 (d, J=8 Hz, 1H, CH.sub.arom.), 6.85 (d, J=8 Hz, 1H, CH.sub.arom.), 4.37 (m, 2H, OCH.sub.2), 3.85-3.46 (m, 10H, CH.sub.2N), 2.13 (s, 3H, CH.sub.3).
4-{2-[5-({[3,5-bis(trifluoromethyl)phenyl]carbamoyl}amino)-2-methylphenoxy]ethyl}piperazine-1,4-diium dichloride (Compound 25)
(200) As another non-limiting example, Compound 22 (840 mg, 1.345 mmol) was treated following the general procedure D and purified by HPLC (15 to 45% of acetonitrile in water with 0.1% of acetic acid). After concentration of the pure fractions, the compound was precipitated in a solution of HCl 4N in dioxane to afford 25 (318 mg, 42%) as a white powder. .sup.1H NMR (500 MHz, DMSO.sub.d6, ): 12.13 (s, 1H, NH), 10.45 (s, 1H, NH), 9.71 (m, 2H, NH), 9.58 (s, 1H, NH), 8.10 (s, 2H, CH.sub.arom.), 7.61 (m, 12H, CH.sub.arom.), 7.29 (s, 1H, CH.sub.arom.), 7.07 (d, J=8 Hz, 1H, CH.sub.arom.), 6.87 (d, J=8 Hz, 1H, CH.sub.arom.), 4.37 (m, 2H, OCH.sub.2), 3.77-3.40 (m, 10H, CH.sub.2N), 2.14 (s, 3H, CH.sub.3).
General Procedure E (for the Synthesis of Compounds 26-28)
Compound 26
(201) As another non-limiting example, 3,4-dichlorophenylisocyanate (250 mg, 1.330 mmol) and 2-amino-3-hydroxypyridine (146 mg, 1.330 mmol) were dissolved in 10 mL of anhydrous dioxane. The reaction mixture was warmed to 55 C., stirred under nitrogen over night and then cooled to room temperature. The crude was purified twice by crystallization in EtOH to afford 26 (178 mg, 45%) as a white powder.
Compound 27
(202) As another non-limiting example, 3,4-dichlorophenylisocyanate (250 mg, 1.330 mmol) and 4-amino-6-methoxypyrimidine (166 mg, 1.330 mmol) were used following the general procedure E to synthesize 27. At the end of the reaction, the crude was dissolved in acetic acid and purified by HPLC (70 to 100% of acetonitrile in water) to afford 27 (224 mg, 54%) as a white powder.
Compound 28
(203) As another non-limiting example, 3,4-dichlorophenylisocyanate (250 mg, 1.330 mmol) and 2-amino-4-hydroxy-6-methylpyrimidine (166 mg, 1.330 mmol) were used following the general procedure E to synthesize 28. Unfortunately, at the end of the reaction the crude wasn't purified as it wasn't soluble in any solvent tested.
(204) TABLE-US-00006 TABLE 2 ATF-4 assays in CRL-2351 cell line. ATF-4 C.sub.max C.sub.[5] Structure A.sub.max.sup.a (M).sup.b (M).sup.c 1
(205) TABLE-US-00007 TABLE 3 Determination of the IC.sub.50 (M) of the compounds by SRB assay. IC.sub.50 (M) Compound 2351 2813 KLN 1 2.6 0.8 >20 2 2.8 1.7 ND 3 0.6 0.1 3.9 4 9 1.8 >20 5 9.3 1.6 20 6 3.2 1 13.5 7 11 >20 >20 8 2.5 3 17.2 9 2.2 0.7 20 11 5.8 5.3 13.5 12 2.5 2.8 12.3 13 2.9 ND 12.4 15 2.4 ND 20 16 2.7 0.9 >20 17 2.3 0.8 18.6 23 4.5 5.1 >20 24 2 3.5 >20 25 5.2 3.1 ND 26 2 1.8 >20 27 1.2 0.8 12.5 28 0.7 0.7 15
(206) TABLE-US-00008 TABLE 4 In vitro Structure Activity Relationship of N,N-Diarylthioureas. Growth Ternary Ternary Inhibition Complex* Complex* IC.sub.50** Structure Code 10 m 3 m (m)
(207) TABLE-US-00009 TABLE 5 NSC Activity Activity Activity #* CAS_RN* 10 uM 5 uM 2.5 uM 495 3056-73-3 3.74 2.32 774 5394-77-4 22.38 10.06 864 959-36-4 3.57 1.81 1337 4567-99-1 7.15 1626 5346-51-0 5.31 0.79 1874 613-63-8 3.99 4.27 8275 22303-26-0 0.81 11235 2390-54-7 9.2 4.88 12134 8.83 12695 5410-88-8 6.31 12741 5425-32-1 8.35 12750 5450-50-0 4.9 1.79 13268 5423-92-7 3.18 1.46 14209 5429-71-0 14.32 0.85 14238 5429-90-3 3.02 1.37 14739 4.06 1.12 14755 6.63 0.68 19143 5444-68-8 3.2 1.72 19763 6957-97-7 13.29 4.63 21293 3.16 21533 5436-20-4 8.88 2.03 21620 2152-70-7 16.28 0.74 24794 3.37 0.55 24863 2083-09-2 3.22 1.87 26101 7770-76-5 4.13 0.78 26672 7375-42-0 57.61 1.44 26847 8.15 1.83 29215 68-76-8 36.4 30759 6.9 0.88 32929 5636-91-9 5.76 0.35 32994 7511-84-4 6.52 2.83 32999 6.87 2.41 35424 3.07 2.55 35730 6.76 5.35 36684 6267-09-0 4.2 0.76 38062 6337-31-1 5.58 2.61 39901 4.1 1.41 42108 6935-42-8 3.7 42112 135-64-8 3.76 3.76 43683 550-15-2 5.26 3.73 45171 6300-60-3 3.08 45226 2691-81-8 7.27 3.03 45884 27031-73-8 16.23 0.47 47145 6330-21-8 5.16 3.4 49546 4.62 3 50915 39077-64-0 7.81 1.11 51522 10.99 1.66 52531 7355-32-0 5.18 0.8 65429 6827-10-7 3.49 66326 14354-56-4 5.2 66379 2083-55-8 7.36 0.74 68751 4.46 76068 900-95-8 3.68 1.02 78577 3.56 0.74 83335 3743-99-5 3.31 2.77 86489 1027-40-3 3.17 2.73 86537 7.51 3.85 87240 7375-42-0 37.28 1.45 87695 16208-00-7 4.42 3.28 88655 19320-23-1 18.32 0.7 89160 9.22 90299 22397-40-6 3.21 2.1 90467 3.88 2.6 91815 20329-54-8 15.17 3.3 91816 20329-55-9 29.75 17.64 92938 7600-14-8 4.68 3.41 95832 3.2 0.46 96942 2562-90-5 7.54 4.17 97372 29676-50-4 4.98 1.62 97681 88893-89-4 8.98 1.17 99639 17958-62-2 8.32 0.7 100622 3.12 2.25 102003 9.46 0.42 102516 13266-07-4 3.4 103749 30117-68-1 5.25 2.76 105326 92967-81-2 9.56 106291 3.15 2.7 106378 3.69 2.55 106656 35694-47-4 3.26 1.89 107229 3.14 1.06 108310 20691-83-2 4.88 3.62 109326 23159-13-9 17.89 0.69 112921 61446-06-8 242.82 97.42 113085 1630-53-1 5.05 3.18 114995 20852-34-0 3.43 2.69 118028 17154-51-7 4.1 119675 8.78 5.52 122844 13.27 1.77 122854 13864-38-5 3.2 124738 3.7 0.79 125369 6683-64-3 9.98 1.08 125516 13.57 0.79 126650 77800-85-2 8.04 0.64 128665 22242-98-4 3.18 17.83 130140 19.67 0.74 130216 92295-16-4 4.77 0.51 131237 27117-05-1 3.3 0.87 131464 20958-78-5 3.99 3.63 131584 18754-93-3 7.95 0.89 131663 22242-87-1 8.18 7 131747 21628-67-1 3.25 2.54 134404 12.72 5.44 135155 7.19 0.94 135854 28558-65-8 5.75 3.56 141112 3.76 0.98 141226 3.5 1.05 3.8 1.02 142606 34.1 16.57 146184 2381-85-3 3.13 146216 21771-92-6 5.04 2.73 146249 15672-98-7 3.04 3.25 2.57 149109 59094-49-4 18.18 150279 3.9 0.62 150781 19802-61-0 3.78 150787 5.6 2.94 151117 12.07 0.85 151119 6.62 0.72 155015 73163-54-9 3.73 2.19 157236 3.4 0.75 157306 3.94 1.77 157382 23886-57-9 9.04 0.68 157487 34749-63-8 5.81 2.53 157507 3.33 2.07 158091 30710-21-5 4.83 1.66 158959 4.01 3.2 161089 19161-98-9 3.53 1.67 162375 3.07 1.7 163547 40114-82-7 4.38 3.27 163948 102-98-7 5.67 164212 4.07 2.04 165765 60696-76-6 4.44 1.34 168745 15963-72-1 36.37 0.39 170334 4.45 0.98 170444 12.56 0.66 170582 24596-38-1 4.44 3.72 170589 17010-61-6 6.57 3.81 170600 63019-82-9 3.46 2.21 170633 17076-37-8 8.99 5.12 170639 92296-17-8 5.38 3.93 171129 7.98 5.1 171134 3.68 2.89 172879 3.6 1.11 173000 3.68 0.61 173710 57013-87-3 16.35 0.83 174877 3.29 3.04 176145 108-07-6 3.81 176657 4.64 1.67 179739 27605-35-2 3.62 0.98 179762 18.35 0.72 179764 25094-60-4 179944 52494-54-9 6.1 0.54 187755 3.08 1.12 193484 22.72 1.24 193713 52197-19-0 24.26 0.55 194646 6.24 8.08 194807 77547-08-1 3.45 1.72 201570 3.02 2.16 202491 18723-92-7 3.05 0.5 202674 21227-23-6 4.67 203205 994-71-8 3.12 203373 20745-97-5 5.25 10.51 203423 20745-98-6 3.09 7.7 204163 56661-50-8 4.83 2.44 204246 3.49 1.92 204512 3837-55-6 4.16 2.67 204514 3010-57-9 4.66 3.6 204515 3789-77-3 5.31 2.84 204548 3.99 2.82 204716 37666-22-1 3.01 2.2 204750 29771-69-5 24.26 3.53 204751 4.76 2.91 205530 73190-69-9 3.34 3.08 205545 4.54 2.41 205548 4.01 2.94 205787 4.39 1.79 205789 7.26 3.99 212379 31191-41-0 4.4 2.28 229344 4.4 1.28 234486 10 236237 57.44 1.78 240577 4.63 2.68 258618 3.2 0.85 260514 3.87 1.94 262421 76609-51-3 107.79 24.56 263517 3529-04-2 8.78 1.39 268393 70380-40-4 0.71 270151 3.16 1.24 271272 71007-82-4 4.93 2.76 271654 18.07 0.44 276293 40919-31-1 20.35 278352 3.81 280894 2.06 281986 3561-04-4 3.37 3.11 286678 1124-50-1 1.72 287407 36.2 3.93 287413 17.06 0.68 291104 83379-23-1 3.83 1.4 293939 36539-81-8 7.78 1.54 295477 9.07 6.24 295679 75082-14-3 3.69 0.78 297153 67675-62-1 4.39 0.95 297154 67675-64-3 5.62 1.24 297156 5.15 1.08 297621 59404-25-0 18.95 298153 64862-32-4 3.43 3.67 299107 279.99 8.13 300554 56213-52-6 8.96 0.48 300559 4.71 0.71 306697 19.5 1.77 309898 13.68 1.07 310008 4256-25-1 4.92 1.66 310545 6.96 0.46 313162 4.03 1.07 315819 67507-09-9 13.17 2.12 315820 17.6 1.5 316746 6.11 0.88 319697 75602-17-4 3.1 319699 75602-13-0 3.62 0.29 322306 63.6 7.11 323938 5.53 0.99 324978 9.9 6.13 326059 82641-26-7 50.81 7.62 326123 77921-36-9 12.9 0.47 332426 71508-74-2 3.15 2.37 337856 25.44 5.52 338631 3.39 1.12 339119 71568-54-2 4.42 1.01 339567 39997-88-1 11.94 1.94 340215 3.11 2.4 340302 36536-22-8 4.54 3.29 343387 3.33 2.32 344506 71781-96-9 5.08 0.69 349125 13.75 0.47 353255 7487-94-7 3.3 353738 7.02 354087 10.14 2.65 354215 66646-01-3 4.14 3.08 355167 79441-89-7 4.17 3.09 359827 6.27 0.61 360648 3.85 1.88 361407 3.7 0.62 361597 13969-30-7 17.56 0.32 361889 91327-55-8 12.01 0.88 366233 88061-94-3 30.55 17.26 367620 16.04 0.49 369110 73723-79-2 6.46 1.84 369741 84405-20-9 6.34 0.96 370463 52837-61-3 5.98 4.76 370589 39.54 11.87 374924 6.35 2.1 374999 15.92 9.15 376265 7.26 2.72 376674 16 9.42 377376 5.14 0.96 377377 34.93 0.77 377378 87405-03-6 21.49 0.87 377831 23047-95-2 3.79 2.19 378135 3.15 1.75 379578 27.15 0.61 379665 67485-29-4 35.03 1.08 380207 88000-87-7 6.39 0.47 400077 888-71-1 3.14 2.04 400538 2150-58-5 6.8 0.57 400939 7467-29-0 3.56 2.36 401234 7621-92-3 24.65 1 401304 7469-11-6 43.11 1.04 402193 1940-43-8 3.19 0.56 402291 4.43 0.73 402592 2703-27-7 3.48 2.25 402600 4638-48-6 4.82 1.14 402785 50.88 402826 5.42 0.85 402866 26.02 1.66 403440 7404-15-1 3.83 1.41 403488 7502-07-0 4.41 1.55 403534 9.9 7.33 405522 6043-40-9 3.69 2.47 406018 7509-97-9 4.09 1.51 406824 7497-80-5 4.25 1.76 407396 426-79-9 4.74 1.72 407658 7499-45-8 5.17 1.57 408380 4.36 2.28 408383 10.77 0.84 408399 3.42 1.63 408711 21.88 1.47 408712 21.65 1.57 409777 19434-42-5 5.55 20.85 601076 3.17 2.48 601994 5.21 3.42 602807 3.12 2.08 603554 8.45 0.35 603854 4.19 0.93 604861 4.82 0.8 604868 5.36 0.86 607085 3.55 2.21 608144 112.47 3.82 609211 18.74 5.68 609810 4.69 2.44 610051 9.23 1.52 615538 4.53 1.65 617570 94.55 2.36 617738 7.65 1.05 617743 3.08 1.47 618767 6.58 0.7 620291 9.07 8.39 620296 3.13 5.24 620852 16.94 4.79 621482 5.15 1.17 621504 14.68 621792 3.75 1.27 621794 6.6 9.24 621795 18.49 621796 26.11 621797 30.28 25.08 621882 3.1 2.37 622579 6.29 2.99 622683 3.82 2.84 623141 4.84 0.53 624851 12.65 625863 3.72 3.75 627459 7.21 1.68 628577 3.06 1.45 628578 3.53 628594 3.94 631943 6.31 631945 5.72 0.76 631946 13.13 632134 3.5 1.26 633123 3.88 0.89 633268 16.53 3.96 633334 28.14 4.12 633346 11.64 8.05 633992 13.09 633995 11.56 14.38 633997 12.56 17.11 634000 12.96 1.1 634004 9.64 3.7 634014 12.92 11.17 634157 3.99 0.8 634838 30.9 13.01 634842 8.37 1.71 635009 10.57 5.71 635022 4.8 0.96 635030 71.33 1.68 635072 5.58 1.59 638113 3.17 1.87 642485 3.59 1.93 643139 1.53 643713 4.87 2.72 643762 3.47 1.99 644907 4.97 645170 5.1 3 647131 17.42 1.96 647134 3.1 647590 3.22 2.31 648479 3.37 2.55 650027 4.42 4.2 652047 3.51 1.15 652257 8.74 3.09 652531 12.9 0.71 652594 14.89 1.46 652890 7.57 2.23 652917 3.31 2.33 652924 3.58 1.78 7.29 655141 3.91 2.18 656075 7.97 2.33 656076 17.27 4.6 656711 6.66 0.59 657189 3.16 2.65 657424 3.36 1.17 658163 4.46 2.63 658355 8.48 0.5 658358 20.35 0.4 658830 4.21 0.48 659608 3.07 1.34 661223 11.8 1.05 661225 25.16 1.76 662875 40.72 10.55 664259 4.24 2.76 665512 15.46 0.47 665702 3.38 1.79 665910 4.69 0.72 666131 8.72 4.12 666356 30.26 2.43 667223 6.01 0.42 667226 4.79 0.34 667463 3.45 3.13 667472 9.48 0.35 667875 7.27 4.59 667885 15.62 8.61 668262 3.33 0.78 668297 37.53 10.51 668298 30.06 11.99 668332 63.38 27.24 668484 3.57 1.59 668494 13.68 3.76 668605 3.17 0.8 670779 6.67 2.57 670788 4.08 6.58 670961 4.46 7.92 670965 23.32 50.7 671441 5.35 671442 7.03 9.59 671896 4.31 0.85 673797 4.7 2.54 674469 23.82 1.37 678036 12.77 0.85 680834 4.25 0.76 682512 10.02 0.57 687849 12.02 0.88 690404 3.03 1.46 690734 10.02 0.48 186257 52197-26-9 59.966 49.982 185066 20.339 44.91067 118026 17154-55-1 40.338 37.512 150311 39.7 36.66967 75382 15091-30-2 21.055 33.125 273747 64724-84-1 26.646 29.296 174794 52197-13-4 33.869 24.857 150320 16.4 19.9 165688 22933-76-2 14.6965 17.91033 94582 17.458 17.82567 65486 3820-71-1 20.8755 17.496 177407 58885-11-3 21.876 16.53 135331 31.606 15.388 99047 17490-47-0 13.186 14.82433 148342 19.7555 14.51333 101539 6.8175 14.033 327371 71156-12-2 22.247 13.29167 55869 6947-89-3 13.613 13.23667 83318 88210-37-1 14.6225 12.02733 88001 21.4655 12.00033 58338 6627-15-2 17.599 11.604 54905 16.011 11.55767 167334 38633-42-0 12.373 11.387 72005 101-20-2 16.9235 11.24533 343385 8.3265 11.19733 93360 485-72-3 10.283 11.07867 98409 10432-50-5 25.659 10.997 152111 16436-29-6 10.391 10.85133 79681 5.9 10.5 83089 2428-35-5 5.1265 10.155 209832 4.7795 9.509333 89864 10.1 9.4 133463 1166-52-5 4.63 8.8 135741 25201-67-6 7.226 8.604667 321198 9.062 8.313333 73118 4273-92-1 10.008 8.006333 156572 7.9345 7.884 82910 2785-54-8 12.4425 7.653667 81523 8.879 7.525667 328479 2867-96-1 7.342 7.501667 68292 18.3 7.2 115157 40.7 7.1 135744 32251-73-3 21.9 7 693037 8.088 6.794333 100239 54980-33-5 7.6705 6.748 214041 8.374 6.705333 276393 64724-83-0 8.706 6.644333 87086 5.461 6.572333 90777 57532-86-2 8.406 6.553 104498 8.4845 6.367333 240870 27128-58-1 7.2395 6.351667 63346 21970-53-6 6.8235 6.234333 240575 7.0215 6.229667 59070 7.423 6.227 337757 22295-55-2 5.978 6.204667 69625 13208-31-6 4.8565 6.200667 109156 7204-43-5 9.1 6.2 367416 74396-45-5 7.3545 6.047333 227290 61471-39-4 6.8065 5.934667 268776 5.5035 5.767 71689 7.139 5.723667 69510 10.9 5.6 74740 7533-73-5 4.1 5.6 326181 67829-21-4 7.027 5.584333 240576 6.2885 5.469667 57019 2872-52-8 5.441 5.388 204668 4.923 5.386 346212 72499-61-7 5.7595 5.376 214004 6.0655 5.299333 87323 30041-69-1 6.0905 5.277333 204386 6.0225 5.251667 214029 6.8665 5.244667 104959 6824-07-3 5.474 5.189667 369061 93745-54-1 6.3 5.136667 321197 5.0845 5.014333 694092 5.898 4.958 687753 6.931 4.921667 86430 2428-30-0 6.063 4.871333 689962 7.987 4.784333 101082 5784-95-2 5.896 4.772333 292796 52053-74-4 5.6 4.759333 136768 28069-65-0 3.271 4.667667 213848 3.5355 4.586 691256 5.7865 4.563 338462 7560-35-2 6.4125 4.540333 222612 2.88 4.521333 186948 4.4425 4.507333 230359 72648-43-2 8.3955 4.464667 76429 5.2405 4.409333 356111 90760-42-2 3.2 4.4 159209 612-81-7 8.5 4.3 54895 74305-79-6 4.975 4.287667 332423 71536-10-2 5.4265 4.287 347204 72499-57-1 6.6455 4.245667 343386 5.4775 4.235333 55240 6951-36-6 5.2 4.2 213710 5.091 4.183 78949 7.7 4.1 231980 31392-73-1 3.8 4.1 332543 88324-30-5 5.182 4.082667 119026 90111-22-1 12.6 4 115724 21299-50-3 7.3 4 691255 5.5705 3.963 86544 637-47-8 4.845 3.953667 136889 16.7 3.9 109535 6.3 3.9 691258 3.904 3.891333 290436 53655-17-7 20.4 3.8 327414 6.977 3.793333 91885 2440-22-4 4.473 3.742333 191390 73108-79-9 4.295 3.709667 292795 35299-76-4 4.66 3.69 202060 64985-95-1 5.049 3.629667 191395 42174-34-5 7.0185 3.608667 240724 4.257 3.594 69580 6959-97-3 6.4 3.5 149581 41962-27-0 4.3 3.5 338119 6443-79-4 5.6885 3.434667 55237 6624-17-5 6.6 3.4 56345 3.64 3.4 82278 3.1525 3.287667 72035 87-22-9 3.8265 3.275 186256 52197-25-8 3.71 3.212333 159569 5.804 3.210333 135745 32251-74-4 6.5 3.2 122241 20286-82-2 5 3.2 94585 3.525 3.148333 347816 72499-65-1 3.5245 3.142667 85646 4.18 3.126667 75971 3.3355 3.111333 204931 93008-58-3 3.539 3.100333 67112 16.3 3.1 106344 61653-37-0 4.1 3.1 103755 16504-14-6 3.394 3.089667 99696 10499-10-2 3.4275 3.031333 191346 4.4055 3.017667 61369 5137-55-3 4.4 3 72266 7149-62-4 3.233 2.946333 71676 786-50-5 4.1015 2.921667 71690 34243-33-9 3.4315 2.888667 112668 13228-40-5 3.3905 2.854333 61626 2508-13-6 3.1685 2.793 101544 16722-41-1 3.1185 2.767 298243 64273-27-4 3.327 2.747 170680 1123-51-9 6.8 2.7 93861 3.171 2.622 71968 7779-17-1 3.5615 2.615 161504 22974-38-5 5.3 2.6 106343 5302-41-0 4.1 2.6 103842 27702-26-7 3.3 2.6 292587 239-58-7 3.294 2.576667 343979 3.1255 2.571333 369331 84859-31-4 2.7605 2.533 136886 28.5 2.5 230415 2829-28-9 3.3005 2.468333 119688 3.9 2.45 123507 3568-90-9 10.5 2.41 366583 3.134 2.409 356110 84633-99-8 3.9 2.4 101484 19749-34-9 3.4 2.4 120440 30251-61-7 3.8 2.3 168465 50286-86-7 6 2.2 96306 5.7 2.2 163454 10173-53-2 3.5 2.2 139221 5064-89-1 9 2.1 74568 4.8 2.1 85573 3.1 2.1 96375 5.9 2 94029 5659-13-2 3.2135 1.933667 116685 13432-87-6 4.5 1.9 59465 7400-23-9 6.8 1.8 106208 74037-43-7 4.3 1.8 146007 3.4 1.8 55879 6947-93-9 3.8 1.7 74566 13595-34-1 3.7 1.7 172656 53219-25-3 3.9 1.6 208394 13.4 1.5 112369 3.1 1.4 144126 7.3 1.3 106909 22966-82-1 3.4 1.2 55867 6947-88-2 3.2 1.1 11235 2390-54-7 27.11026 7.299852 163482 3.207313 1.587711 380207 88000-87-7 3.061186 0.36152 401162 64693-19-2 7.084166 0.378361 527347 7385-99-1 5.590928 2.550671 622579 10.08266 0.38273 643139 7.511198 0.181398 653438 12.31648 0.754953 658354 6.608676 0.23793 658916 3.180133 2.046552 667223 8.726255 0.154498 670779 8.739112 2.72082 670961 14.2083 3.272683 670965 25.3088 44.32161 670969 3.643563 1.549795 *Entering either the NSC number (NSC followed by the number) of a compound or the CAS number of the compound in the PubChem compound database will bring up the chemical structure and other publicly available information about the compound.
(208) TABLE-US-00010 TABLE 6 Effect of anti-cancer agents (20 M) on F-luc/ R-luc ratio in the ternary complex assay. Relative Mechanism F-luc/R-luc Agent of Action Ratio (+/ SEM) Camptothecin Topoisomerase inhibitor 1.3 + 0.3 Colchicine Inhibitor of tubulin polymerization 1.2 + 0.3 Threo-1-phenyl Glucolipid synthase inhibitor 1.5 + 0.4 Mitomycin C Alkylating agent, DNA 0.9 + 0.3 synthesis inhibitor H-89 PK-A inhibitor 1.5 + 0.6 5-fluorouracil Thymidilate synthase inhibitor 1 + 0.2 Epigallocatechin Laminin Receptor 1 activation 3-isobutyl-1- Phoshodiesterase inhibitor 1.1 + 0.2 methylxanthine Dilthiazem Ca++ channel blocker 1.4 + 0.4 Amiloride Na+ channel blocker 1.1 + 0.3 Okadaic acid Protein Phoshatase 1 inhibitor 1 + 0.3 Somatostatin Inhibitor of growth hormone 0.9 + 0.2 secretion Glycyl-1-histidyl Not known 1 + 0.1 acetate Etoposite Topoisomerase I inhibitor 1 + 0.2 CLT Ca.sup.++ store depletion 6 + 1.1
(209) Other embodiments will be evident to those of skill in the art. It should be understood that the foregoing description is provided for clarity only and is merely exemplary. The spirit and scope of the present invention are not limited to the above examples, but are encompassed by the following claims. All publications and patent applications cited above are incorporated by reference herein in their entirety for all purposes to the same extent as if each individual publication or patent application was specifically indicated to be so incorporated by reference.