ANTI-MICROBIAL AGENT FROM PAENIBACILLUS SP. AND METHODS AND USES THEREOF

20180087117 ยท 2018-03-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides, in part, a Paenibacillus sp. isolate, designated Paenibacillus polymyxa JB05-01-1, as well as an anti-microbial agent obtained from the bacterium or cell culture supernatant thereof. Compositions, methods and uses are also provided.

    Claims

    1. A method of inhibiting growth of a Gram-negative staining bacterium in a subject or substance in need thereof, the method comprising administering or applying an effective amount of an anti-microbial composition to the subject or substance, wherein the anti-microbial composition comprises: (a) an isolated Paenibacillus polymyxa bacterium which has a 16S ribosomal RNA (16SrRNA) gene containing a DNA comprising the base sequence of SEQ ID NO: 1; (b) an isolated Paenibacillus polymyxa bacterium deposited at the ATCC under the terms of the Budapest Treaty and designated Accession Number PTA-10436; (c) a cell culture comprising the Paenibacillus polymyxa bacterium; (d) a cell culture supernatant derived from growing the Paenibacillus polymyxa bacterium in a cell culture medium; or (e) an anti-microbial agent isolated from the Paenibacillus polymyxa bacterium, the cell culture or the cell culture supernatant.

    2. The method of claim 1, wherein the Gram-negative staining bacterium is selected from the group consisting of Escherichia sp., Pantoea sp., Pseudomonas sp., Butyrivibrio sp., Fibrobacter sp., Salmonella sp., Shigella sp., Helicobacter sp., and Campylobacter sp.

    3. The method of claim 1, wherein the Gram-negative staining bacterium is selected from the group consisting of Escherichia coli RR1, Escherichia coli TB1, Escherichia coli O157:H7, Pantoea agglomerans BC1, Pseudomonas fluorescens R73, Butyrivibrio fibrisolvens OR85, Fibrobacter succinogenes and Pseudomonas aeruginosa.

    4. The method of claim 1, which does not inhibit the growth of a Gram-positive staining bacterium.

    5. The method of claim 1, wherein the anti-microbial agent comprises a peptide.

    6. The method of claim 1, wherein the isolated Paenibacillus polymyxa bacterium DNA comprises at least one gene needed for the production of a bacitracin, polymyxin, or fusaricidin.

    7. The method of claim 1, wherein the anti-microbial agent has a molecular weight between about 1000 daltons to about 2500 daltons.

    8. The method of claim 1, wherein the anti-microbial agent comprises a polymyxin.

    9. The method of claim 1, wherein the anti-microbial agent comprises at least one of colistin A and colistin B.

    10. The method of claim 1, wherein the subject is a human, a pet or an agricultural animal.

    11. The method of claim 1, wherein the anti-microbial composition is used as a probiotic.

    12. The method of claim 1, wherein the substance is selected from the group consisting of a cosmetic product, a hygiene product, a feed product, a food product and packaging material thereof.

    13. The method of claim 12 wherein the food product is a dry feed product.

    14. A method of producing an anti-microbial agent comprising growing or culturing an isolated Paenibacillus polymyxa bacterium which has a 16S ribosomal RNA (16SrRNA) gene containing a DNA comprising the base sequence of SEQ ID NO: 1, or an isolated Paenibacillus polymyxa bacterium deposited at the ATCC under the terms of the Budapest Treaty and designated Accession Number PTA-10436, in a cell culture medium to produce a cell culture supernatant comprising the anti-microbial agent.

    15. The method of claim 14, further comprising isolating or purifying the anti-microbial agent from the cell culture supernatant.

    16. A method of producing an anti-microbial agent comprising growing or culturing an isolated Paenibacillus polymyxa bacterium which has a 16S ribosomal RNA (16SrRNA) gene containing a DNA comprising the base sequence of SEQ ID NO: 1, or an isolated Paenibacillus polymyxa bacterium deposited at the ATCC under the terms of the Budapest Treaty and designated Accession Number PTA-10436, in a cell culture medium to produce a cell culture comprising the anti-microbial agent.

    17. The method of claim 16, further comprising isolating or purifying the anti-microbial agent from the cell culture.

    18. A method of reducing mortality or morbidity of an animal comprising administering an effective amount of an anti-microbial composition to the animal, wherein the anti-microbial composition comprises: (a) an isolated Paenibacillus polymyxa bacterium which has a 16S ribosomal RNA (16SrRNA) gene containing a DNA comprising the base sequence of SEQ ID NO: 1; (b) an isolated Paenibacillus polymyxa bacterium deposited at the ATCC under the terms of the Budapest Treaty and designated Accession Number PTA-10436; (c) a cell culture comprising the Paenibacillus polymyxa bacterium; (d) a cell culture supernatant derived from growing the Paenibacillus polymyxa bacterium in a cell culture medium; or (e) an anti-microbial agent isolated from the Paenibacillus polymyxa bacterium, the cell culture or the cell culture supernatant.

    19. The method of claim 18, wherein the animal is a human, a pet or an agricultural animal.

    20. The method of claim 18, wherein the anti-microbial composition is used as a probiotic or a prebiotic.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0047] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:

    [0048] FIG. 1 is a graph showing Kinetics of P. polymyxa JB05-01-1 growth and production of JB05-01-1 during stirred batch culture in Luria-Bertani broth at 30 C. Filled diamond is culture optical density; open triangle is inhibitory activity expressed as AU/ml, determined by micro-dilution assay

    [0049] FIG. 2 is a pair of graphs showing the antimicrobial activity against E. coli RR1. DiVerent amounts of crude P. polymyxa culture supernatant (1 mg/ml) containing antimicrobial substance(s) JB05-01-1 at 0 (open diamond), 32 (open square), and 96 (open triangle) AU/ml or polymyxin B (0.1 g/ml) (open circle) were added to exponentially growing culture of Escherichia coli RR1 in tryptic soy broth at 30 C., wherein graph A is optical density at 600 nm and graph B is viable cell counts (CFU, colony forming unit). Arrows show crude antimicrobials peptides addition.

    [0050] FIG. 3 is a photograph showing SDS-PAGE profiles of partially purified antimicrobial substance produced by Paenibacillus polymyxa JB05-01-1, wherein the gel in part A was stained with Coomassie Brilliant Blue staining R-250 and the gel in part B was recovered with TSBA pre-overlaid with E. coli RR1. Lane 1 contains the molecular weight markers (in KD); Lane 2 contains partly purified antimicrobial substance JB05-01-1. Arrows in gel of parts A and B show a band and a zone of inhibition, respectively.

    [0051] FIG. 4 is a partial sequence of P. polymyxa JB05-01-1 16S rRNA gene (GenBank Accession Number GQ184435; SEQ ID NO: 1).

    [0052] FIG. 5 is a Fast Protein Liquid Chromatography (FPLC) of purified antimicrobials peptides produced by P. polymyxa JB05-01-1 eluted at 30% acetonitrile (CH.sub.3CN), 1% TFA.

    [0053] FIG. 6A is a mass spectrometry analysis of purified Colistin A produced by P. polymyxa JB05-01-1, and structure determination. FIG. 6B is a mass spectrometry analysis of purified Colistin B produced by P. polymyxa JB05-01-1, and structure determination. Molecular weights were determined using MS analysis (Colistin A: 1169 Da; Colistin B: 1155 Da). MS/MS spectrums relevant to the species at m/z 585.3 and 578.4 observed in the chromatograms of FIG. 6A and FIG. 6B, respectively. The assignments of the different peaks are shown for the corresponding peptide sequence. FIG. 6C is a chemical structure of fatty acid (FA): Colistin A, 6-methyloctanoyl; Colistin B, 6-methylhepatanoyl.

    [0054] FIG. 7A is an agar diffusion test showing inhibition of E. coli ATCC 25922 by supernatant of 20 h culture of Paenibacillus polymyxa JB05-01-1 (right); left=negative control (Tryptic soy broth)

    [0055] FIG. 7B is a paper disc spot test showing inhibition of E. coli ATCC 25922 by P. polymyxa JB05-01-1.

    [0056] FIG. 8 shows the affinity of P. polymyxa JB05-01-1, P. polymyxa ATCC 43865 and P. polymyxa ATCC 7070 strains for hexadecane (White) and decane (grey). Values presented are the means of three independent measurements.

    [0057] FIG. 9 shows the tolerance (Log CFU per ml) of selected P. polymyxa JB05-01-1 (), P. polymyxa ATCC 43865 (custom-character) and P. polymyxa ATCC 7070 (custom-character) strains to a simulated gastric juice (pH 2.0) over time (mins) Results are means of two independent experiments, vertical bars represent standard deviations.

    DETAILED DESCRIPTION

    [0058] The present invention provides, in part, a Paenibacillus sp. isolate, designated Paenibacillus polymyxa JB05-01-1 (deposited on Oct. 21, 2009, with the American Type Culture Collection (ATCC) under the terms of the Budapest Treaty and assigned Accession Number PTA-10436) obtained from an animal feed additive and identified by amplification and sequencing of the 16S rRNA gene. Characterization of the physical properties and anti-microbial activities of a substance secreted into the culture supernatant of a Paenibacillus polymyxa JB05-01-1 cell culture resulted in the identification of at least one anti-microbial agent.

    Anti-Microbial Agents

    [0059] An anti-microbial agent, as used herein, refers to an agent that exhibits one or more anti-microbial activity i.e., any activity that inhibits the growth of a micro-organism. By inhibit, inhibition or inhibiting is meant to destroy, prevent, control, decrease, slow or otherwise interfere with the growth or survival of a micro-organism by at least about 10% to at least about 100%, or any value therebetween for example about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% when compared to the growth or survival of the micro-organism in the absence of the anti-microbial agent. In alternative embodiments, by inhibit inhibition or inhibiting is meant to destroy, prevent, control, decrease, slow or otherwise interfere with the growth or survival of a micro-organism by at least about 1-fold or more, for example, about 1.5-fold to about 100-fold, or any value therebetween for example about 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold when compared to the growth or survival of the micro-organism in the absence of the anti-microbial agent. In alternative embodiments, the inhibition may be more than 100-fold. In alternative embodiments, the inhibition may be substantially complete inhibition of growth i.e., the growth rate may be reduced to about zero in the presence of the anti-microbial agent, and the anti-microbial agent may cause death of a micro-organism, when compared to the growth or survival of the micro-organism in the absence of the anti-microbial agent. Accordingly, an anti-microbial agent may be microbicidal or may be microbistatic.

    [0060] In some embodiments, the anti-microbial agent may be an anti-bacterial agent i.e., an agent that exhibits one or more anti-bacterial activity i.e., any activity that inhibits the growth of a bacterium. In alternative embodiments, the anti-bacterial agent may be bactericidal or bacteriostatic.

    [0061] In some embodiments, an anti-bacterial agent according to the invention may selectively inhibit the growth of a Gram-negative staining bacterium.

    [0062] By selectively inhibit selective inhibition or selectively inhibiting is meant to destroy, prevent, control, decrease, slow or otherwise interfere with the growth or survival of a Gram-negative staining bacterium by at least about 10% to at least about 100%, or any value therebetween for example about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% when compared to the growth or survival of a Gram-positive staining bacterium. In alternative embodiments, by selectively inhibit selective inhibition or selectively inhibiting is meant to destroy, prevent, control, decrease, slow or otherwise interfere with the growth or survival of a Gram-negative staining bacterium by at least about 1-fold or more, for example, about 1.5-fold to about 100-fold, or any value therebetween for example about 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold when compared to the growth or survival of a Gram-positive staining bacterium. In alternative embodiments, the selective inhibition may be more than 100-fold. In alternative embodiments, the selective inhibition may be substantially complete inhibition of growth of a Gram-negative staining bacterium i.e., the growth rate could be reduced to about zero and the anti-bacterial agent may cause death of a Gram-negative staining bacterium when compared to the growth or survival of Gram-positive staining bacterium.

    [0063] Gram-negative staining bacteria include without limitation Escherichia sp., Pantoea sp., Pseudomonas sp., Salmonella sp., Shigella sp., Pseudomonas sp., Helicobacter sp., Butyrivibrio sp., Fibrobacter sp. or Campylobacter sp. Examples of Gram-negative staining bacteria species include without limitation Escherichia coli (e.g., Escherichia coli RR1, Escherichia coli TB1, Escherichia coli O157:H7), Pantoea agglomerans, Pseudomonas fluorescens, Pseudomonas aeruginosa, Salmonella enteritidis, Salmonella typhi, Shigella dysenteriae, Helicobacter pylori, Butyrivibrio fibrisolvens, Fibrobacter succinogenes or Campylobacter jejuni.

    [0064] In alternative embodiments, an anti-microbial agent according to the invention does not substantially inhibit the growth of Gram-positive staining bacteria, such as one or more of Listeria innocua, Listeria monocytogenes, Pediococcus acidilactici, Paenibacillus polymyxa, Paenibacillus macerans, Bacillus lecheniformis, Bacillus subtilis, Bacillus circulans 9E2, Streptococcus bovis, Enterococcus mundtii, Staphylococcus aureus, or Lactococcus lactis.

    [0065] In some embodiments, an anti-microbial agent according to the invention may be sensitive or insensitive to various treatments. By sensitive or sensitivity is meant loss or reduction of anti-microbial activity by at least about 10% to at least about 100%, or any value therebetween for example about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% when an anti-microbial agent is subjected to a particular treatment, when compared to anti-microbial activity in the absence of the treatment. In alternative embodiments, by sensitive or sensitivity is meant loss or reduction of anti-microbial activity by at least about 1-fold or more, for example, about 1.5-fold to about 100-fold, or any value therebetween for example about 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold when an anti-microbial agent is subjected to a particular treatment, when compared to anti-microbial activity in the absence of the treatment. In alternative embodiments, the sensitivity may include loss or reduction of anti-microbial activity of more than 100-fold.

    [0066] It is to be understood that sensitivity may vary with the time of treatment. In alternative embodiments, the time of treatment may range from a few minutes to many hours. For example, the time of treatment may be about 5 minutes to over 25 hours, such as 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 55 minutes or any value therebetween, or such as 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0 hours, or any value therebetween. Anti-microbial activity may be tested by standard methods such as agar diffusion tests and micro-dilution assay as described herein, or by other standard methods such as disk diffusion, agar dilution, or through the use of automated instrumental testing systems (see, for example, Manual of Clinical Microbiology. 1995. P. M. Murray (ed). ASM Press, Washington, D.C.).

    [0067] By insensitive or insensitivity is meant no substantial observable effect or sensitivity when an anti-microbial agent is subjected to a particular treatment, when compared to anti-microbial activity in the absence of the treatment. In alternative embodiments, by insensitive or insensitivity is meant an observable effect of less than about 10%, for example about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, or 9% when an anti-microbial agent is subjected to a particular treatment, when compared to anti-microbial activity in the absence of the treatment.

    [0068] In some embodiments, an anti-microbial agent according to the invention may be sensitive to treatment with proteases such as proteinase K, trypsin, chymotrypsin or with a lipase.

    [0069] In some embodiments, an anti-microbial agent according to the invention may be sensitive to treatment with surfactants such as sodium dodecyl sulphate (SDS), chaotropics agents such as urea, or solvents such as acetonitrile or hexane.

    [0070] In some embodiments, an anti-microbial agent according to the invention may be insensitive to an organic solvent such as chloroform, propanol, methanol, ethanol or toluene.

    [0071] In some embodiments, an anti-microbial agent according to the invention may be insensitive to pH, for example, pH ranging from about 2 to about 9.

    [0072] In some embodiments, an anti-microbial agent according to the invention may be sensitive to a temperature in excess of about 80 C. In some embodiments, an anti-microbial agent according to the invention may be sensitive to a temperature in excess of about 90 C. Accordingly, in some embodiments, an anti-microbial agent according to the invention may be sensitive to a temperature in excess of about 90 C. when exposed for at least about 30 minutes. In alternative embodiments, an anti-microbial agent according to the invention may be sensitive to a temperature of about 100 C. when exposed for at least about 10 minutes.

    [0073] In some embodiments, an anti-microbial agent according to the invention may be insensitive to a temperature up to about 80 C. when exposed for about 30 minutes.

    [0074] In particular embodiments, sensitivity of an anti-microbial agent according to the invention may include: the loss (about 100%) of anti-microbial activity after treatment of a composition including the anti-microbial agent with proteinase K for 10 minutes at 100 C.; the reduction of anti-microbial activity to about 83% or about 75% by trypsin and chymotrypsin, respectively, or to about 62% by lipase; the reduction of anti-microbial activity to about 66% after SDS treatment and about 58% after Urea treatment.

    [0075] In some embodiments, the molecular weight of an anti-microbial agent according to the invention may be about 1,000 Da to about 2,500 Da. In some embodiments, an anti-microbial agent according to the invention may include more than one molecule having a molecular weight in the range of about 1,000 Da to about 2,500 Da. The agent may be a peptide, for example, a lipopeptide.

    [0076] In some embodiments, an anti-microbial agent according to the invention may be a peptidic compound including for example a nonproteinaceous amino acid, such as a D-amino acid or a hydroxy acid and/or may be modified for example by N methylation, acylation, glycosylation, or heterocyclic ring formation.

    [0077] In some embodiments, an anti-microbial agent according to the invention may be a polymyxin. By polymyxin is meant a peptide having anti-microbial activity. In general, the structure of a polymyxin may include a cyclic peptide e.g., a cyclic decapeptide, with a terminal fatty acid moiety, that is capable of inhibiting the growth of a micro-organism such as a Gram-negative staining bacterium.

    [0078] In some embodiments, an anti-microbial agent according to the invention may be one or both of colistin A and colistin B. By colistin A/B is meant a polymyxin having anti-microbial activity. In general, colistin A has a molecular weight of about 1169 Da and includes fatty acid moiety 6-methyloctanoyl. Colistin B generally has a molecular weight of 1155 Da and includes fatty acid moiety 6-methylhepatanoyl.

    [0079] An anti-microbial agent according to the invention may include an anti-microbial agent produced by Paenibacillus polymyxa JB05-01-1, ATCC Accession Number PTA-10436, or by a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1.

    [0080] In some embodiments, an anti-microbial agent may include one or more compounds.

    [0081] An anti-microbial agent may be present in a cell, cell membrane, or crude extract, cell culture, or cell culture supernatant thereof. The cell may be a Paenibacillus polymyxa JB05-01-1 cell or a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1.

    Methods of Obtaining and Producing Anti-Microbial Agents

    [0082] Anti-microbial agent(s) may be obtained from Paenibacillus polymyxa JB05-01-1 or from other sources. For example, RE3 (Basic Environmental Systems & Technology Inc. Edmonton, AB, Canada) is a direct-fed microbial product used to improve in vitro ruminal fermentation of barley grain/barley silage-based diets and includes a non-sterile liquid formulation containing L. paracasei and L. lactis cultures and their fermentation products. Paenibacillus polymyxa JB05-01-1 was obtained by culturing a sample of RE3. Other anti-microbial agents may similarly be found by routine screening for isolates that include the 16S rRNA sequence of SEQ ID NO:1 as described herein or known in the art.

    [0083] Anti-microbial agent(s) may be produced by growing or culturing Paenibacillus polymyxa JB05-01-1 or a bacterium that includes the 16S rRNA sequence of SEQ ID NO:1 in an appropriate cell culture medium under conditions suitable for production of anti-microbial agent(s) as described herein or known in the art. In alternative embodiments, Paenibacillus polymyxa JB05-01-1 or a bacterium that includes the 16S rRNA sequence of SEQ ID NO:1 may be grown in an appropriate cell culture medium under conditions suitable for secretion of anti-microbial agent(s) into the cell culture supernatant as described herein or known in the art.

    [0084] The cell culture medium may be a minimal medium or a complete medium. In some embodiments, the cell culture medium may be LB medium (Luria-Bertani medium). The medium may be a liquid medium or may be a solid or semi-solid medium, such as nutrient broth or agar, or tryptic soy broth or agar. In general, the cell culture medium includes a carbon/energy source, NH.sub.4N, and biotin.

    [0085] The cell culture conditions (e.g., temperature, time, etc.) may be varied as appropriate to optimize growth and/or production of the anti-microbial agent(s).

    [0086] In some embodiments, the temperature may range from about 5 C. to about 40 C., such as 10 C., 15 C., 20 C., 25 C., 30 C., or 35 C., or any value therebetween. In alternative embodiments, the temperature may be about 30 C.

    [0087] In some embodiments, the time may range from about 5 hours to about 48 hours or any value therebetween. In alternative embodiments, the time may be greater than 48 hours. In alternative embodiments, the time may be about 20 hours.

    [0088] The cell culture conditions may be aerobic or anaerobic.

    [0089] Standard separation processes may be used to obtain a substantially pure preparation of an anti-microbial agent. An agent or compound is substantially pure or isolated when it is separated from the components that naturally accompany it. Typically, an anti-microbial agent or compound is substantially pure when it is at least 10%, 20%, 30%, 40%, 50%, or 60%, more generally 70%, 75%, 80%, or 85%, or over 90%, 95%, or 99% by weight, of the total material in a sample. Thus, for example, a substantially pure preparation or culture of a cell expressing an anti-microbial agent, such as a Paenibacillus polymyxa JB05-01-1 cell or a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1, is a preparation of cells or cell culture in which contaminating cells that are not a Paenibacillus polymyxa JB05-01-1 cell, or do not have the desired 16S rRNA sequence of SEQ ID NO:1, or do not express an anti-microbial agent as described herein, constitute less than 1%, 5%, 10%, 20%, 30%, 40%, or 50%, of the total number of cells in the preparation. In some embodiments, a substantially pure Paenibacillus polymyxa JB05-01-1 cell or a substantially pure naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1, is a preparation of cells or cell culture that contains 100% of such cells.

    [0090] In some embodiments, an anti-microbial agent that is isolated by known purification techniques, or isolated as described herein, will be generally be substantially free from its naturally associated components. A substantially pure anti-microbial agent can be obtained, for example, by extraction from a natural source such as a Paenibacillus polymyxa JB05-01-1 cell or a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1.

    [0091] In some instances, an anti-microbial agent according to the invention will form part of a composition, for example, a crude extract containing other substances. For example, an anti-microbial agent may be present in a crude extract of a Paenibacillus polymyxa JB05-01-1 cell or a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1 that may also contain the other naturally occurring components found in such a cell. A crude extract of a Paenibacillus polymyxa JB05-01-1 cell or a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1 may be prepared by routine procedures, for example, disruption of the cells using standard mechanical or non-mechanical techniques such as freeze-thaw techniques, osmotic shock, enzyme (e.g., lysozyme) treatment, ultrasonication, liquid extrusion, etc., which may be followed by removal of the cell debris by for example centrifugation.

    [0092] In alternative embodiments, an anti-microbial agent may be present in a cell culture supernatant, such as a supernatant obtained from growing a Paenibacillus polymyxa JB05-01-1 cell or a naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1 in a suitable cell culture medium under conditions suitable for secretion of the anti-microbial agent into the supernatant. The term culture supernatant refers to the liquid broth remaining when cells grown in a medium are separated from the culture medium by for example centrifugation, filtration, sedimentation, or other means well known in the art. As an example, if the anti-microbial agent(s) is to be isolated from cell culture supernatant, a salt such as ammonium sulphate may be used at various concentrations, initially. Residual ammonium sulphate may then be removed by dialysis against water. The suspended precipitate containing one or more than one antimicrobial compound may be chromatographed on a column such as an ion exchanger, and the various compounds in the culture supernatant may be separated by monitoring absorbance at 280 nm. Active fractions can be determined from among the compounds thus separated, and selected on the basis of the efficacy with which aliquots thereof kill or inhibit the growth of microbes such as bacterial cells, i.e. the indicator strain, known to be sensitive to the anti-microbial agent(s). Active fractions may then be pooled. Further purification may be carried out by high performance liquid chromatography (HPLC) based on the charge of the compound. The various peaks obtained by monitoring absorbance at 280 nm may be separated and again tested for activity against the indicator strain. Purity can be measured using any appropriate method such as column chromatography, gel electrophoresis, HPLC, etc.

    [0093] The anti-microbial agent may be isolated from the cell culture supernatant using solid phase extraction with columns such as Amberlite XAD-16 column and Sep-Pak C18 Column. The active fraction eluted from the column(s) may be further purified based on molecular weight separation using a Fast Protein Liquid Chromatography (FPLC) system.

    [0094] A person skilled in the art would understand that other conventional concentration, purification or fractionation methods may be used to obtain one or more isolated or substantially purified anti-microbial agent(s) or partially purified fractions exhibiting an anti-microbial activity from whole or lysed cells or from cell culture supernatant. Typical methods include, without limitation, size exclusion or ion exchange chromatography, ammonium sulfate, alcohol, or chloroform extraction, or centrifugation with size filters.

    [0095] The anti-microbial activity of an anti-microbial agent may be determined by routine methods or as described herein. For example, anti-microbial activity may be detected by agar diffusion tests or micro-dilution assay.

    Pharmaceutical, Veterinary, Nutritional, Cosmetic and Other Uses

    [0096] Anti-microbial agent(s) according to the invention may be used in a variety of applications in which inhibition of growth of a micro-organism, such as a bacterium, is desirable. Such applications include, without limitation, pharmaceutical and veterinary applications (e.g., for the treatment of a microbial infection), nutritional supplements and animal feed, personal care (cosmetic or hygiene) applications, etc. In alternative embodiments, anti-microbial agent(s) according to the invention may be used to inhibit the growth of a microorganism (e.g., a bacterium) involved in the spoilage of food or other products.

    [0097] Food spoilage micro-organisms include without limitation one or more species of Clostridium, Pseudomonas, Porteus, Chromobacterium, Chromobacterium, Lactobacillus, Penicillium, Aspergillus, Rhizopus, Micrococcus, Bacillus, Streptococcus, Pediococcus, Leuconostoc, Chromobacterium, Halobacterium, Alcaigenes, Xanthomonas, Botryitis, Aerobacter, Cornebacterium, Arthrobacter, Microbacterium, Serratia, etc.

    [0098] The micro-organism may be a pathogenic micro-organism. The bacterium may a pathogenic bacterium, such as food-borne pathogenic bacterium. Food-borne pathogenic bacteria include without limitation one or more species of Staphylococcus, Escherichia, Listeria, Salmonella, Streptococcus, Vibrio, Campylobacter, Enterobacter, Shigella, etc.

    [0099] The bacterium may include a Gram-negative staining bacterium. Gram-negative staining bacteria include without limitation one or more species of Escherichia sp., Pantoea sp., Pseudomonas sp., Salmonella sp., Shigella sp., Helicobacter sp., Campylobacter sp. or Butyrivibrio sp., and Fibrobacter sp. Examples of Gram-negative bacteria species include without limitation Escherichia coli (e.g., Escherichia coli RR1, Escherichia coli TB1, Escherichia coli O157:H7), Pantoea agglomerans, Pseudomonas fluorescens, Pseudomonas aeruginosa, Salmonella enteritidis, Salmonella typhi, Shigella dysenteriae, Helicobacter pylori, Campylobacter jejuni, Butyrivibrio fibrisolvens, or Fibrobacter succinogenes.

    [0100] Other examples of bacteria include without limitation Gram-negative rods such as enteric Gram-negative staining rods, curved Gram-negative staining rods, parvobacteria and Haemophilus, Gram-negative staining cocci such as Neisseria, non-sporing anaerobes, and bacteria such as spirochaetes, rickettsia and chlamydia.

    [0101] Examples of microial infections, such as bacterial infections, include without limitation chlamydia, gonorrhea, salmonellosis, shigellosis, tuberculosis, syphilis, bacterial pneumonia, bacterial sepsis (bacteremia), bacterial urinary tract infections, vaginosis, bacterial upper respiratory tract infections, bacterial meningitis, bacterial enteritis, diphtheria, legionellosis, pertussis, scarlet fever, toxic shock syndrome, psittacosis, otitis media, lyme disease, etc.

    Pharmaceutical, Veterinary, Nutritional and Other Compositions, Dosages, and Administration

    [0102] Anti-microbial agents of the invention can be provided alone or in combination with other compounds, in the presence of any pharmaceutically, veterinary or cosmetically acceptable carrier, diluent, and/or excipient in a form suitable for administration to animals, for example, humans, cattle, sheep, pigs, poultry, etc. If desired, administration or application of an anti-microbial agent according to the invention may be combined with more traditional and existing anti-microbial therapies, treatments, supplements, or additives, or with other desirable therapies, treatments, supplements, or additives.

    [0103] Anti-microbial agents according to the invention may be provided chronically or intermittently. Chronic administration refers to administration of the anti-microbial agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. Intermittent administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.

    [0104] Conventional pharmaceutical or veterinary practice may be employed to provide suitable formulations or compositions to administer the anti-microbial agent(s) to subjects suffering from or presymptomatic for a microbial infection. Any appropriate route of administration may be employed, for example, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, intracisternal, intraperitoneal, intranasal, intra-anal, intravaginal, aerosol, topical, or oral administration. Therapeutic formulations may be in the form of liquid solutions, syrups, or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols; and topical formulations may come in the form of balms, creams, and lotions.

    [0105] Methods well known in the art for making formulations are found in, for example, Remington's Pharmaceutical Sciences (19.sup.th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel. For therapeutic or prophylactic compositions, the anti-microbial agent(s) are administered to a subject in an amount sufficient to inhibit the growth of a micro-organism.

    [0106] An effective amount of an anti-microbial agent(s) according to the invention includes a therapeutically effective amount or a prophylactically effective amount. A therapeutically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as inhibition of the growth of a micro-organism. A therapeutically effective amount of an anti-microbial agent(s) may vary according to factors such as the disease state, age, sex, and weight of the individual or subject, and the ability of the anti-microbial agent(s) to elicit a desired response in the individual or subject. Dosage regimens may be adjusted to provide the optimum therapeutic or prophylactic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the anti-microbial agent(s) are outweighed by the therapeutically beneficial effects. A prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as such as inhibition of the growth of a micro-organism. Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of disease, so that a prophylactically effective amount may be less than a therapeutically effective amount. An exemplary range for therapeutically or prophylactically effective amounts of an anti-microbial agent(s) may be any value from about 0.1 nM to about 0.1M, for example about 0.1 nM to about 0.05M, about 0.05 nM to about 15 M or about 0.01 nM to about.

    [0107] It is to be noted that dosage values may vary with the severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the anti-microbial agent(s). Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical or veterinary practitioners. The amount of active anti-microbial agent(s) in the composition may vary according to factors such as the disease state, age, sex, and weight of the individual. Dosage regimens may be adjusted to provide the optimum therapeutic or prophylactic response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, a subject may be a mammal, an agricultural (e.g., farm) or domestic animal, an experimental animal or any animal that may benefit from the anti-microbial agents as described herein. For example, a subject may include a human, non-human primate, rat, mouse, cow, horse, pig, sheep, goat, chicken, turkey, duck, goose, dog, cat, fish, crustacean, etc.

    [0108] In general, anti-microbial agent(s) of the invention should be used without causing substantial toxicity. Toxicity of the anti-microbial agent(s) of the invention can be determined using standard techniques, for example, by testing in cell cultures or experimental animals and determining the therapeutic index, i.e., the ratio between the LD50 (the dose lethal to 50% of the population) and the LD100 (the dose lethal to 100% of the population). In some circumstances however, such as in severe disease conditions, it may be necessary to administer substantial excesses of the anti-microbial agent(s).

    [0109] In alternative embodiments, an effective amount of an anti-microbial agent according to the invention includes an amount effective to inhibit the growth of a micro-organism, such as a bacterium. It is to be understood that such amounts need not be therapeutic or prophylactic amounts, as long as the amount of the anti-microbial agent is capable of inhibiting the growth of a micro-organism, such as a bacterium, in the context in which it is administered or applied, for example, for prevention of food spoilage, etc.

    [0110] In alternative embodiments, an anti-microbial agent according to the invention may be provided in a cell, for example a substantially pure Paenibacillus polymyxa JB05-01-1 cell or a substantially pure naturally-occurring bacterium that includes the 16S rRNA sequence of SEQ ID NO:1, or a cell culture thereof. The cell may be provided in a liquid, or may be frozen or dried, e.g., freeze-dried. The cell culture may be concentrated. The cell culture may be a starter culture for example for a dairy product (e.g., milk, cheese, etc.), or for selective media in a laboratory.

    [0111] The anti-microbial agent may be provided in a therapeutic, veterinary, hygiene, cosmetic, food, drink or feed product. In alternative embodiments, the anti-microbial agent may be provided in the packaging material for, for example, a therapeutic, veterinary, hygiene, cosmetic, food, drink or feed product. The packaging material may include without limitation, plastic, film, Styrofoam, etc.

    [0112] In alternative embodiments, an anti-microbial agent according to the invention may be provided in a kit that may optionally include additional anti-microbial agents or desirable therapies, treatments, supplements, or additives, optionally with instructions for use thereof.

    [0113] In alternative embodiments, an anti-microbial agent according to the invention may be provided as a nutritional or food additive, or feed supplement or additive.

    [0114] A nutritional additive or food additive refers to a substance that is added to food, generally to affect the characteristics of the food, such as spoilage. A food additive may be direct in that it is directly added to food for example to inhibit growth of a micro-organism. A food additive may be considered indirect when it is exposed to food during processing, packaging, or storage but is not present in the final food product. The term feed additive or feed supplement refers to products used in animal nutrition for purposes of improving the quality of feed, or to improve the animals' performance and health, e.g. providing enhanced digestibility of the feed materials or inhibiting the growth of micro-organisms. An example of an animal feed additive is a direct-fed microbial product which refers to a mono or mixed culture of live micro-organisms, which when applied to a host affects beneficially the host by improving the properties of the indigenous microflora. A non-limiting example of a direct-fed microbial product is RE3 from Basic Environmental Systems & Technology Inc. Edmonton, AB, Canada. In some embodiments, RE3 may be specifically excluded from a feed additive according to the invention.

    [0115] A probiotic candidate should display the ability to survive under gastrointestinal tract conditions, namely resistance to salivary lysozyme, gastric acid (HCl) and bile. The candidate should also be able to establish itself among the intestinal microbiota and adherence to the intestinal epithelium is considered a major parameter determining candidate's ability to colonize the intestinal tract and thus be effective as a probiotic. As shown in the Examples, P. polymyxa JB05-01-1 exhibited probiotic characteristics such as production of antimicrobials (FIGS. 7A and 7B), resistance to gastrointestinal conditions (e.g. lysozyme and acidic pHTable 5) and tolerance of hydrogen peroxide (Table 5), as well as adhesion to Caco-2 cells (Table 7). Therefore in alternative embodiments, the bacterium, cell culture, supernatant, or the anti-microbial agent according to the invention may be used as a probiotic.

    [0116] In alternative embodiments, anti-microbial agents of the invention can be provided in combination with other feed or nutritional supplements or additives. For example, at least one supplement or additive, such as listed herein, can be included for consumption with the anti-microbial agent of the invention and may have, for example, antioxidant, dispersant, antimicrobial, or solubilizing properties.

    [0117] A suitable antioxidant is, for example, vitamin C, vitamin E or rosemary extract. A suitable dispersant is, for example, lecithin, an alkyl polyglycoside, polysorbate 80 or sodium lauryl sulfate. A suitable antimicrobial is, for example, sodium sulfite or sodium benzoate. A suitable solubilizing agent is, for example, a vegetable oil such as sunflower oil, coconut oil, and the like, or mono-, di- or tri-glycerides. Additives include vitamins such as vitamin A (retinol, retinyl palmitate or retinol acetate), vitamin B1 (thiamin, thiamin hydrochloride or thiamin mononitrate), vitamin B2 (riboflavin), vitamin B3 (niacin, nicotinic acid or niacinamide), vitamin B5 (pantothenic acid, calcium pantothenate, d-panthenol or d-calcium pantothenate), vitamin B6 (pyridoxine, pyridoxal, pyridoxamine or pyridoxine hydrochloride), vitamin B12 (cobalamin or cyanocobalamin), folic acid, folate, folacin, vitamin H (biotin), vitamin C (ascorbic acid, sodium ascorbate, calcium ascorbate or ascorbyl palmitate), vitamin D (cholecalciferol, calciferol or ergocalciferol), vitamin E (d-alpha-tocopherol, d-beta-tocopherol, d-gamma-tocopherol, d-delta-tocopherol or d-alpha-tocopheryl acetate) and vitamin K (phylloquinone or phytonadione). Other additives include minerals such as boron (sodium tetraborate decahydrate), calcium (calcium carbonate, calcium caseinate, calcium citrate, calcium gluconate, calcium lactate, calcium phosphate, dibasic calcium phosphate or tribasic calcium phosphate), chromium (GTF chromium from yeast, chromium acetate, chromium chloride, chromium trichloride and chromium picolinate) copper (copper gluconate or copper sulfate), fluorine (fluoride and calcium fluoride), iodine (potassium iodide), iron (ferrous fumarate, ferrous gluconate or ferrous sulfate), magnesium (magnesium carbonate, magnesium gluconate, magnesium hydroxide or magnesium oxide), manganese (manganese gluconate and manganese sulfate), molybdenum (sodium molybdate), phosphorus (dibasic calcium phosphate, sodium phosphate), potassium (potassium aspartate, potassium citrate, potassium chloride or potassium gluconate), selenium (sodium selenite or selenium from yeast), silicon (sodium metasilicate), sodium (sodium chloride), strontium, vanadium (vanadium sulfate) and zinc (zinc acetate, zinc citrate, zinc gluconate or zinc sulfate). Other additives include amino acids, peptides, and related molecules such as alanine, arginine, asparagine, aspartic acid, carnitine, citrulline, cysteine, cystine, dimethylglycine, gamma-aminobutyric acid, glutamic acid, glutamine, glutathione, glycine, histidine, isoleucine, leucine, lysine, methionine, ornithine, phenylalanine, proline, serine, taurine, threonine, tryptophan, tyrosine and valine. Other additives include animal extracts such as cod liver oil, marine lipids, shark cartilage, oyster shell, bee pollen and d-glucosamine sulfate. Other additives include unsaturated free fatty acids such as -linoleic, arachidonic and -linolenic acid, which may be in an ester (e.g. ethyl ester or triglyceride) form. Other additives include herbs and plant extracts such as kelp, pectin, Spirulina, fiber, lecithin, wheat germ oil, safflower seed oil, flax seed, evening primrose, borage oil, blackcurrant, pumpkin seed oil, grape extract, grape seed extract, bark extract, pine bark extract, French maritime pine bark extract, muira puama extract, fennel seed extract, dong quai extract, chaste tree berry extract, alfalfa, saw palmetto berry extract, green tea extracts, angelica, catnip, cayenne, comfrey, garlic, ginger, ginseng, goldenseal, juniper berries, licorice, olive oil, parsley, peppermint, rosemary extract, valerian, white willow, yellow dock and yerba mate. Other additives include miscellaneous substances such as menaquinone, choline (choline bitartrate), inositol, carotenoids (beta-carotene, alpha-carotene, zeaxanthin, cryptoxanthin or lutein), para-aminobenzoic acid, betaine HCl, free omega-3 fatty acids and their esters, thiotic acid (alpha-lipoic acid), 1,2-dithiolane-3-pentanoic acid, 1,2-dithiolane-3-valeric acid, alkyl polyglycosides, polysorbate 80, sodium lauryl sulfate, flavanoids, flavanones, flavones, flavonols, isoflavones, proanthocyanidins, oligomeric proanthocyanidins, vitamin A aldehyde, a mixture of the components of vitamin A.sub.2, the D Vitamins (D.sub.1, D.sub.2, D.sub.3 and D.sub.4) which can be treated as a mixture, ascorbyl palmitate and vitamin K.sub.2.

    [0118] The supplement or additive may be packaged for consumption in softgel, capsule, tablet or liquid form. It can be supplied in edible polysaccharide gums, for example carrageenan, locust bean gum, guar, tragacanth, cellulose and carboxymethylcellulose. Cosmetic or hygiene supplements may be provided in for example, shampoos, conditioners, creams, pastes, lotions, lipsticks, lip balms, etc.

    [0119] The present invention will be further illustrated in the following examples.

    EXAMPLES

    [0120] The following examples are intended to illustrate embodiments of the invention and should not be construed as limiting.

    Example 1: Identification of Antimicrobial Agent Producing Strains

    Bacterial Strains and Growth Media

    [0121] The bacterial indicator strains used are listed in Table 1. All were maintained at 80 C. in appropriate media containing 10% glycerol (w/v). P. polymyxa and all indicator strains except Butyrivibrio fibrisolvens and Fibrobacter succinogenes were propagated aerobically at 30 C. in their respective culture media as indicated in Table 1. The media used were: Tryptic soy broth (TSB) (Difco Laboratories, Sparks, Md., USA), de Man, Rogosa and Sharpe broth (MRS) (Rosell Institute, Montreal, PQ, Canada) (de Man et al. 1960) and Luria-Bertani (LB) broth. Liquid or solid (1.2% w/v agar) anaerobic L-10 medium containing glucose, maltose and soluble starch as carbon sources (each at 0.1% w/w) was used for the growth of B. fibrisolvens and F. succinogenes (Caldwell and Bryant 1966). Their growth was carried out at 39 C. in a CO.sub.2:H.sub.2 atmosphere (95:5 v/v). Before starting the experiments, all strains were sub-cultured at least three times at 24-h intervals using 1% volume transfers.

    Isolation and Identification of Antimicrobial-Compound-Producing Bacteria

    [0122] The antimicrobial agent producer P. polymyxa JB05-01-1 was isolated from a direct-fed microbial product (RE3 Basic Environmental Systems & Technology Inc. Edmonton, AB, Canada). RE3 was screened for bacteria producing compounds inhibiting the growth of E. coli by a deferred antagonism plating procedure as described by Tagg et al. (1976). Briefly, 100 l of 10.sup.3-10.sup.4 dilutions of RE3 in L-10 or TSB media were spread on L-10 or TSB plates and incubated overnight at 39 C. and 37 C. The plates were replicated, and then the bacterial colonies on the original plates were washed from the agar surface and the plates were surface sterilized under Ultraviolet (UV) light at 254 nm for 20 minutes. The plates were then overlaid with 5 ml of melted LB (0.5% agar) containing 50 l of an overnight culture of E. coli RR1 and incubated overnight at 37 C. Colonies producing clearing zones were identified and picked from the replica plates for testing for activity against E. coli 0157:H7.

    [0123] Gram staining, motility, catalase and oxidase tests were conducted as a preliminary step in the characterization of the selected colonies. Tentative identifications were confirmed by amplification and sequencing of 16S ribosomal RNA genes.

    DNA Extraction

    [0124] The Paenibacillus strain (JB05-01-1) was grown in 3 ml of TSB at 30 C. overnight. The cells were harvested by centrifugation at 5000g for 5 min. DNA was extracted using a Power Soil DNA Kit (MoBio Laboratories Inc., Carlsbad, Calif., USA) according to the manufacturer's instructions. The DNA concentration was measured using the PicoGreen dsDNA quantitation kit (Molecular Probes, Invitrogen, Eugene, Oreg., USA) in a Multi Detection Microplate Reader (Model SIAFRM, BioTek Instruments, Winooski, Vt., USA) using calf thymus DNA (Sigma-Aldrich, St. Louis, Mo., USA) as the standard.

    Polymerase Chain Reaction Amplification of 16S rRNA Genes

    [0125] The PCR amplification targeted the approximately 1500 bp of the 16S rRNA gene. The PCR reaction contained 10 ng of template DNA, 2.5 ml of 10 dilution buffer, 10 pmol of each primer and 1 U of Taq polymerase (Takara Shuzo, Japan) in a final volume of 25 ml. The primers used were the universal bacterial primers 8-27 F (5-AGA GTT TGA TCC TGG CTC)AGA3 (Liu et al., 1997) and 1492R (5-TAC CTT GTT ACG ACT T-3) (Kane et al., 1993). The amplification conditions involved denaturation at 95 C. for 1 min, followed by 25 cycles of 95 C. for 30 s, 55 C. for 30 s and 72 C. for 1.5 min. The nomenclature of the primers used was based on E. coli numbering system.

    Cloning and Sequencing of 16S rRNA Genes

    [0126] Amplicons from the PCR reaction were electrophoresed on 1% agarose gel and purified by excising the correct sized bands. The DNA was extracted from the gel using QIAquick PCR purification Kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions. The purified DNA was cloned into TOPO vector (Invitrogen, Carlsbad, Calif.) and further used to transform electrocompetent E. coli (DH5- cells) by electroporation. The cells were then plated on LB/Kanamycin (50 mg/L) agar plates and incubated overnight at 37 C. Three clones, verified for correct inserts, were grown overnight in LB/Kanamycin (100 mg/L). All clones were sequenced by the University of Calgary Core DNA Services, Calgary, AB, Canada. The 16S rRNA sequence was a consensus from three clones. The 16S rDNA sequences of the isolates were compared with DNA sequences from the National Center for Biotechnology Information (NCBI) database using the standard nucleotide-nucleotide homology search Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1990).

    Results

    [0127] Sequencing of the 16S rDNA PCR products from the isolate showing the highest activity against E. coli O157:H7 identified an organism that shared 99% homology with Paenibacillus polymyxa. This isolate was designated as Paenibacillus polymyxa JB05-01-1. The 16S rRNA gene partial sequence of P. polymyxa JB05-01-1 was deposited with GenBank and has been assigned Accession Number GQ184435 (FIG. 4, SEQ ID NO: 1).

    TABLE-US-00001 TABLE 1 Antimicrobial spectrum of inhibitory substance produced by Paenibacillus polymyxa JB05-01-1 culture supernatant (CS-JB05-01-1) and polymyxin B, used as positive control. Inhibition* Polymyxin B Indicator strains Source Medium CS-JB05-01-1 (0.1 g ml.sup.1) Bacillus circulans LRC 9E2 LB Bacillus lecheniformis LRC 8422 LB Butyrivibrio fibrisolvens LRC 0R85 L-10 + + Escherichia coli LRC RR1 TSB +++ +++ Escherichia coli LRC TB1 TSB ++ +++ Escherichia coli LRC SA1650 TSB ++ ++ Enterococcus mundtii LRC 8369 LB Fibrobacter succinogenes ATCC 19169 L-10 + + Lactococcus lactis ATCC 7962 MRS Listeria innocua HPB 13 TSB Listeria ivanovii HPB 28 TSB Pantoea agglomerans LRC BC1 TSB + + Pseudomonas fluorescens LRC R73 TSB ++ ++ Paenibacillus polymyxa ATCC 43865 LB Paenibacillus polymyxa ATCC 7070 LB Paenibacillus polymyxa JB05-01A This study LB Pediococcus acidilactici ATCC 25740 MRS Pediococcus pentosaceus ATCC 25745 LB Streptococcus bovis ATCC 33317 LB *Determined from two individual assays No inhibition at concentrations up of 0.1 g ml.sup.1. + Diameter of the inhibition zone 10 2 mm ++ Diameter of the inhibition zone 16 2 mm +++ Diameter of the inhibition zone 28 2 mm ATCC: American Type Culture Collection, LRC: Lethbridge Research Center HPB: Health Product Branch, (Health and Welfare Canada, Ottawa, ON, Canada)

    Example 2: Production of the Antimicrobial Agent

    [0128] One litre of LB medium was inoculated with 10 ml of a fresh, overnight culture of P. polymyxa JB05-01-1 and incubated at 30 C. with agitation at 200 rpm. The culture optical density at 600 nm was measured every two hours using a Multi-detection micro-plate reader (Bio-Teck instrument Inc., Winooski, Vt., USA), and 1 mL of culture was centrifuged (8,000 rpm, 10 min, 4 C.) to remove the cells. The supernatant was heated at 70 C. for 10 min to inactivate any protease activity, as described by Martin et al. (2003). The agar diffusion assay and micro-dilution method were used to test the heated supernatants for antimicrobial activity as described herein.

    [0129] The determination of soluble protein was done using the Folin phenol reagent method as described by Lowry et al. (1951) with bovine serum albumin as standard. Polymyxin E, Polymyxin B and Nisin A were used as positive control for antimicrobial activity. Nisin A stock solutions were prepared from pure Nisin obtained from Aplin and Barrett (Beaminster, UK) in the form of Nisaplin, which contains 2.5% (w/w) Nisin A. Polymyxin E and Polymyxin B were purchased from Sigma-Aldrich (Oakville, ON, Canada).

    [0130] Inhibition of Escherichia coli RR1 by supernatant of a batch culture grown in Luria-Bertani broth, measured by the micro-dilution method, was maximal at 20 h and remained so through 48 h. Thus, based on agar diffusion and micro-dilution tests, the secretion of the antimicrobial agent was shown to start in the exponential phase and reach its maximum in the early stationary phase (FIG. 1). Production thus appeared to be growth associated and activity levels remained stable through 48 h. Inhibition zone diameters at 48 h were approximately 81 mm and activity was 96 AU ml.sup.1.

    Example 3: Spectrum of Activity

    [0131] The qualitative antimicrobial spectrum of P. polymyxa culture supernatant was determined using the agar well diffusion method (Wolf and Gibbons 1996). Briefly, a 25-ml volume of molten tryptic soy agar (0.75% agar w/v) was cooled to 47 C. and seeded with 1% (v/v) overnight TSB culture of an indicator strain. The seeded agar was then poured into a sterile Petri plate and allowed to solidify at room temperature. Wells (7 mm) were cut in the solidified agar using a sterile metal cork borer and filled with 80 of supernatant. The plates were left at 5 C. for 2 h to allow diffusion of the tested aliquot and then incubated aerobically for 18 h at 30 C. Absence or presence of inhibition zones as well as their diameters were recorded.

    [0132] The antimicrobial activity was also determined by the micro-dilution method described by Daba et al. (1994). Activity was expressed in arbitrary units per milliliter (AU ml.sup.1) using the formula (1000/125).sup.x(1/D), where D was the highest dilution causing inhibition of the indicator strains.

    [0133] The minimum inhibitory concentration (MIC) of P. polymyxa JB05-01-1 culture supernatant and pure polymyxin E or polymyxin B against E. coli RR1 was determined using a Microtest polystyrene micro-plate assay (96-well, Becton Dickinson Labware, Lincoln Park, N.J.) as described by Kheadr et al. (2004).

    [0134] The inhibitory spectrum of the culture supernatant is presented in Table 1. Gram-negative staining bacteria (E. coli RR1, Pantoea agglomerans BC1, Pseudomonas fluorescens R73, B. fibrisolvens OR85 and F. succinogenes S85) were inhibited while no activity was detected against Gram-positive staining bacteria. The spectrum of activity of the antimicrobial agent produced by P. polymyxa JB05-01-1 was different from that of Nisin A but similar to polymyxin E and polymyxin B used as a positive control (Table 1).

    [0135] To determine the effect of P. polymyxa JB05-01-1 culture supernatant, E. coli RR1 cells were cultivated in the presence of concentrated P. polymyxa culture supernatant containing JB05-01-1 at final total activity of 0, 32, and 96 AU/ml. The OD.sub.600 nm of culture was determined every two hours using a multi-detection microplate reader (Bio-Teck instrument Inc, Winooski, Vt., USA). The corresponding final cell concentration expressed as CFU/ml was determined as described by Naghmouchi et al. (2008). The inhibitory activity (I.A.) of culture supernatant containing JB05-01-1 was calculated as a percentage, I.A.=100100[OD.sub.600(x)/OD.sub.600(i)], where (x) is culture supernatant containing JB05-01-1 at the corresponded total activity and (i) is the control culture. Data was reported as means of duplicate analyses.

    [0136] To determine the mode of action of culture supernatant containing JB05-01-1, the viability of E. coli RR1 cells was examined (FIG. 2) upon their contact with culture supernatant containing JB05-01-1. Thus, addition of culture supernatant containing JB05-01-1 at total activity of 32 or 96 AU/ml reduced the final cells concentrations of E. coli RR1 by about 2.7 and 3.4 log.sub.10 CFU/ml after 2 h of exposure, respectively (graph B). The corresponding inhibitory activities were estimated to 47.1% and 51%, respectively. The OD.sub.600 nm of the cell suspension was constant through the experiments (graph A). The data obtained indicates that P. polymyxa JB05-01-1 has bactericidal action like polymyxin B, which was used as a positive control.

    Example 4: Characterization of the Antimicrobial Agent

    [0137] The sensitivities of the antimicrobial agent to proteases (all from Sigma-Aldrich, Oakville, ON) or other agents was tested by treating P. polymyxa JB05-01-1 culture supernatant with 2 mg ml.sup.1 final concentration of proteinase K (Tritirachium album), -chymotrypsin (bovine pancreas), lipase (Sigma-Aldrich, Oakville, ON), trypsin (porcine pancreas), urea (Sigma-Aldrich, St. Louis Mo.), sodium dodecyl sulfate (SDS) (Sigma-Aldrich, St. Louis Mo.) for 1 h at 37 C. (Motta et al. 2007). Thermal stability of the antimicrobial activity was determined by holding aliquots (1000 l) of 20 h culture supernatant at temperatures ranging from 50 C. to 90 C. for 30 min or at 100 C. for 10 min. The effect of pH was determined by adjusting the pH of P. polymyxa JB05-01-1 culture supernatant from 2 to 9 using 5 M HCl or NaOH. The activity of each sample was compared with the activity of untreated P. polymyxa JB05-01 culture supernatant at pH 6.8.

    [0138] The effect of several organic solvents was evaluated by stirring 20 h culture supernatant for 2 h with 10% (v/v) acetonitrile, hexane, propanol, ethanol, toluene, acetone, butanol or methanol (all solvents were obtained from Sigma-Aldrich, St. Louis Mo.). Residual antimicrobial activities were tested using the agar diffusion assay against E. coli RR1 as described herein, with controls for effects of residual solvent.

    [0139] The effect of enzymes, detergents and other compounds on the anti-E. coli activity of the P. polymyxa JB05-01-1 culture supernatant is shown in Table 2.

    TABLE-US-00002 TABLE 2 Inhibition of Escherichia coli RR1 by Paenibacillus polymyxa JB05-01-1 culture supernatant (CS-JB05-01-1) or polymyxin B treated with enzymes, detergents or urea, as determined by the agar diffusion test. % of residual activity* Treatment Polymyxin B agent CS-JB05-01-1 (0.1 g ml.sup.1) None 100 100 Proteinase K 0 4.5 Trypsin 83.3 62.5 Chymotrypsin 75 79.5 Lipase 62.5 58.3 SDS 66 70.1 Urea 58 62.5 *Antimicrobial activities of culture supernatant without additives are 100%. Results are means of two individual assays with an SD less than 5% about the mean.

    [0140] Activity was eliminated after proteinase K treatments. Lipase, trypsin, -chymotrypsin, sodium dodecyl sulphate (SDS) and urea reduced the antimicrobial activity by 38%, 17%, 25%, 34% and 42% respectively when compared to untreated activity.

    [0141] The antimicrobial activity remained unchanged after heating at 80 C. for 30 min. Loss of activity of about 60% was observed after heating at 90 C. for 30 min. Heating to 100 C. for 10 min completely eliminated the antimicrobial activity.

    [0142] Organic solvents such as chloroform, propanol, methanol, ethanol and toluene did not affect the activity of the antimicrobial peptide. Acetonitrile or hexane treatment at the same concentration (10%, v/v) reduced the antimicrobial activity by about 5% and 20%, respectively. Activity also remained stable after a two-hour incubation at pH ranging from 2 to 9.

    Example 5: Molecular Weight Determination

    [0143] P. polymyxa JB05-01-1 culture supernatant was analysed in duplicate using a NuPAGE 12% Bis-Tris gel kit (Invitrogen, Burlington, ON, Canada) as per manufacturer's instructions at 200 V (constant) for 40 min. The 2.5-200 kDa molecular weight marker kit from Invitrogen was used as a molecular weight standard. After electrophoresis, one gel was stained with Coomassie Brilliant Blue R250 (Invitrogen). A duplicate gel was used for the plate overlay assay to estimate the molecular weight of the antimicrobial compounds as described by Bhunia et al. (1987). Briefly, a SDS-PAGE gel prewashed with sterile water was placed in a Petri dish and overlaid with 10 ml tryptic soy agar containing growing cells of E. coli RR1 at about 10.sup.5 CFU ml.sup.1. The agar was allowed to solidify, held at 4 C. for 60 min, and then incubated for 18 h at 30 C. The formation of an inhibition zone indicated the position and size of the active antimicrobial peptide in the gel.

    [0144] Coomassie Brilliant Blue staining of SDS-PAGE gels of P. polymyxa JB05-01-1 culture supernatant revealed no distinct protein bands. However, inhibitory activity was detected as a clearly defined zone of inhibition in the region corresponding to a molecular mass of <2.5 kDa (<2500 Da) after gels were overlaid with E. coli RR1-seeded agar (FIG. 3). No inhibitory activity was detected when the SDS gels were overlaid with Listeria innocua.

    Example 6: Isolation and Purification of Antimicrobial Peptides

    Strains and Culture Conditions

    [0145] The bacterial strains used and their culture media are listed in Table 4. All strains were stored previously at 80 C. in media containing 20% glycerol (w/v) and were sub-cultured twice in the appropriate media prior to being used in experiments. Fresh cultures were prepared by inoculation of 10 ml of the corresponding medium with 100 l of the frozen stock followed by incubation for 18-24 h at the corresponding temperature.

    [0146] P. polymyxa JB05-01-1 was grown aerobically at 30 C. in Luria-Bertani (LB) broth (Difco Laboratories, Detroit, Mich., USA) for 16 h. Colistin-sensitive strain Escherichia coli RR1 (E. coli RR1), was obtained from the Lethbridge Research Center culture collection. E. coli RR1 was grown aerobically for 18 h at 30 C. in tryptic soy broth (TSB, Difco Laboratories, USA).

    Isolation of Antimicrobial Peptides

    [0147] P. polymyxa JB05-01-1 culture was used to inoculate 500 ml of Luria-Bertani (LB) broth (1% inoculum) in a 1-liter flask and incubated at 30 C. for 20 h. Cells in the fermentation broth were separated by centrifugation (12,000 g, 20 min, 4 C.). The resulting cell-free supernatant was heated (100 C. for 10 min) and passed through a 550 cm column (Amersham Pharmacia Biotech) packed with 60 g Amberlite XAD-16 resin (Sigma-Aldrich, Oakville, ON, Canada) via a Gilson MiniPlus 2 Pump at a flow rate of 5 ml/min to remove hydrophobic components from the medium as described by Martin et al. (2003). The Amberlite XAD-16 column was washed with 300 ml of 30% ethanol after which the active fraction was eluted with 500 ml of 70% isopropanol (pH 2; achieved through the addition of 1 M HCl) at a flow rate of 5 ml/min. The eluted active fraction was then evaporated to 30% aqueous volume (approximately 150 ml) using a rotary evaporator (Laborota 4001 Efficient; Krackeler Scientific, Inc., Albany, N.Y., U.S.A.) at 30 C. The Amberlite XAD-16 column was washed with 500 ml of HPLC grade water for future use.

    [0148] The evaporated active fraction was passed through a Waters Sep-Pak Vac 35 cc C18-10 g column (Waters, Milford, Mass., USA) via Gilson MiniPlus 2 Pump at a flow rate of 2.5 ml/min. The column was washed with 30 ml of 20% acetonitrile (CH.sub.3CN) 0.5 M HCl and the active fraction eluted with 50 ml of 50% acetonitrile 0.5 M HCl (Seim et al. 2005). The active fraction eluted from the Sep-Pak C18 column was evaporated under similar conditions as hereinbefore described to 20 ml and further concentrated to 5 ml using Centricon YM-3 centrifugal filter unit (Millipore: Bedford, Mass., USA) at 3000 g for 120 min at 4 C. The evaporated active fraction eluted from the Sep-Pak C18 column was designated as Fraction E.

    [0149] All fractions obtained at each stage of the isolation process were assessed for antibacterial activity using the micro-dilution method as described below.

    Gel Filtration Chromatography Technique

    [0150] Fraction E was applied to Superdex 75 HR 16/60 gel filtration chromatography to obtain the active fraction based on molecular weight separation. The Superdex 75 HR 16/60 column was equilibrated with 100 mM sodium phosphate extraction buffer (pH 7.4) containing 150 mM NaCl. This step was carried out at 4 C. with a flow rate of 0.5 ml/min using a Fast Protein Liquid Chromatography (FPLC) system (GE Healthcare Canada Inc.). One ml of Fraction E was applied onto the column and fractions of 1 ml were collected during the elution process using an isocratic gradient. The mobile phase consisted of 30% CH.sub.3CN/70% HPLC grade water, 0.1% trifluoroacetic acid (TFA) single buffer. Elution was monitored at wavelength detection of 218 nm during a total running time of about 600 min. Fractions exhibiting antibacterial activity, at a given retention time, were collected from different FPLC runs, pooled and lyophilized. The resulting powder was dissolved in 0.1 ml HPLC grade water and checked again for activity against E. coli RR 1 and the other bacteria listed in Table 4.

    Antibacterial Activity Assay

    [0151] Antibacterial activity of the fractions obtained at each stage of the isolation process was determined by the micro-dilution method (Daba et al. 1994). Total activity was expressed in arbitrary units per milliliter (AU/ml), using the formula (1000/125)(1/D), where D was the highest dilution causing complete inhibition of E. coli RR1, the indicator strain (Naghmouchi et al. 2010).

    Protein Concentration Determination

    [0152] The determination of soluble protein concentration was performed in triplicate with the Folin phenol reagent method (Lowry et al. 1951). Bovine serum albumin (BSA) was used as internal standard. Polymyxin E solution standard was obtained from Sigma-Aldrich (Oakville, ON, Canada).

    Determination of Minimum Inhibitory Concentration

    [0153] Minimum inhibitory concentration (MIC) for FPLC purified peptide peak (retention time of 361.55 min) and that of polymyxin (colistinstandard) were determined by the micro-dilution assay (Naghmouchi et al. 2010).

    MALDI TOF/TOF Analysis

    [0154] Two microlitres of the peak sample obtained from final FPLC purification step (retention time 361.55 min) was analysed directly by over-spotting with 1 L -Cyano-4-hydroxycinnamic acid (3 mg/mL containing 1.8 mg/mL ammonium citrate dissolved in 50% ACN/0.1% TFA). In addition, 5 L of each sample was diluted with 50 l, 0.1% TFA/water C18 Ziptip desalted and eluted with matrix. The samples were air dried and then analysed on an Applied Biosystems MDS Sciex 4800 TOF/TOF Mass Analyser over mass range 600-4000 m/z collecting 500 laser shots. Ions of highest intensity were manually selected for MSMS fragmentation for 1000 laser shots and data acquired.

    Manual Nanospray Analysis

    [0155] Four microliters of the peak sample obtained from final FPLC purification step (retention time 361.55 min) was placed into a silica Au/Pd coated nanoES spray tip (Proxeon, Odense. Denmark). Static manual nanospray was performed on an Applied Biosystems/MDS Sciex QStar Pulsar I fitted with a Protana/Proxeon Nanospray source. Spray was established by applying a tip voltage of 1200V and collecting a TOFMS survey scan 300-1200 m/z consisting of 50 accumulated 1 sec scans. Mass spectrometer parameters used were as follows: Declustering potential setting of 55, Focusing Potential setting of 265, Curtain gas setting of 25 and CAD gas setting of 6 with Nitrogen in the collision cell. The most intense double charged ions were selected for MSMS fragmentation. Product ion scans were acquired over the mass range 100-1500 m/z range and collision energy was manually increased to provide the best fragmentation during the 50 accumulated 1 second scans. Mass spectrometer parameters used for MSMS were as follows: Declustering potential setting of 50, Focusing Potential setting of 220, Curtain gas setting of 25 and CAD gas setting of 7 with Nitrogen in the collision cell.

    Isolation, Purification and Characterization of Antimicrobial Substance(s) Produced by P. polymyxa JB05-01

    [0156] The characterization of antimicrobial substance(s) from Luria-Bertani broth cultured with P. polymyxa JB05-01-1 is summarized in Table 3.

    TABLE-US-00003 TABLE 3 Antimicrobial substance(s) recovery at different stages of purification. Total and partial purified substance(s) were quantified by the micro-dilution test using E. coli RR1 as indicator strain. Increase in Total Total Specific Specific Re- Volume protein activity.sup.1 activity.sup.2 activity covery Step/fraction (ml) (mg) (AU) (AU/mg) (fold) (%) Supernatant 500 1750 48000 27.42 1 100 Amberlate 200 196 25600 130.61 4.8 53 XAD-16 Sep-Pack C.sub.18 50 3.15 6400 2031.7 74.09 13.33 eluate FPLC-system 1 0.05 256 5120 189.62 1.06 .sup.1Activity (AU/ml) determined by micro-titer plate assay using E. coli RR1 as indicator strain and multiplied by the volume in milliliters. .sup.2Activity (AU/ml) divided by total protein (mg).

    [0157] Extraction of the antimicrobial substance(s) was achieved using Amberlite XAD-16-adsorbent, a non-ionic macro-reticular resin that adsorbs and releases ionic species through hydrophobic and polar interactions (Zengguo et al. 2007). By applying)(AD-16 resin to clarified cell-free culture supernatant, the antimicrobial substance(s) was/were selectively adsorbed, whilst other water-soluble components remained in the liquid phase. The antimicrobial substance(s) was/were eluted from)(AD-16 by 70% acid and isopropyl alcohol, and the resulting fraction was evaporated to 30% aqueous volume which retained most of the antimicrobial activity. The specific activity obtained after Amberlite XAD-16-adsorbent was approximately 130.61 AU/mg of protein.

    [0158] The antimicrobial substance(s) was/were subsequently applied to Sep-Pack C18 column and the most active fraction purified with 50% acetonitrile and 0.5 M HCl. The recovery from the Sep-Pack C18 step was 13.3% with the specific activity of 2,032 AU/mg of protein.

    [0159] Finally, the antimicrobial fraction obtained from the Sep-Pack C18 recovery step was separated with the FPLC system connected to Hiload 16/60 Superdex 75 Prep grade size exclusion. In the FPLC profile, fractions with a peak retention time (RT) of 361.55 min were identified (FIG. 5). These fractions were active against E. coli RR1. Approximately 1.1% of the culture supernatant was recovered as antimicrobial substance(s) through the FPLC filtration process. The procedure increased the specific activity (per mg of protein) of the antimicrobial substance(s) 190-fold. Total purified antimicrobial substance(s) obtained from 500 ml of the fermented broth were approximately 0.05 mg.

    [0160] The MIC of FPLC purified peptide peak (retention times of 361.55 min) against E. coli RR1 was approximately 0.13 g/ml.

    Structure Determination

    [0161] The chemical nature of the antibacterial substance(s) produced by P. polymyxa JB05-01-1 was elucidated by MALDI TOF/TOF analysis and Nanospray analysis (FIGS. 6A and 6B) as described below.

    [0162] Tandem mass spectrometry MS analysis was performed for a single active peak obtained from the final FPLC purification (361.55 min) step. Data analysis revealed the presence of two compounds with the following molecular weights 1169.7 Da (FIG. 6A) and 1155.7 Da (FIG. 6B), which are equivalent to those of colistin A and colistin B. Further confirmation of this structure (colistin) was performed with MS/MS analysis on TOF and ESI. Fragmentation of peak 585.3 Da (A) in the ion trap permitted the identification in the spectrum (FIG. 6A) of the first series of product ions with m/z 829.5, 728.5, 628.4, 527.3, 427.3, 327.2, 227.2, which are formed by subsequent loss of amino acid moieties. Similar results were observed for peak 578.4 Da (FIG. 6B). The m/z ions obtained in the second series were identical to fragmentation patterns reported in the literature (Govaerts et al. 2002; De Crescenzo et al. 2007).

    [0163] FIG. 6C shows the chemical structure of fatty acid colistin A and colistin B. Thus it was concluded that the active antimicrobial substance purified from P. polymyxa JB0501 are colistin A and colistin B.

    Spectrum of Activity

    [0164] As shown in Table 4, purified colistin (A/B) produced by P. polymyxa JB05-01-1 had inhibitory activity against Gram-negative bacteria including E. coli O157:H7, E. coli RR1, Pseudomonas fluorescens R73 and Pseudomonas aeruginosa. The MIC values of the purified peptides were about 0.13 and 0.162 g/ml for E. coli O157:H7 and P. fluorescens LRC R73, respectively. Similar MIC values were obtained with the colistin standard.

    TABLE-US-00004 TABLE 4 Antimicrobial spectrum and minimal inhibitory concentration (MIC) of purified peptide (colistins A and B) produced by Paenibacillus polymyxa JB05-01-1 Inhibition zone * attributed to Purified Growth peptide MIC Indicator strains Source Medium at (5 g/ml) (g/ml) Listeria ivanovii HPB28 TSB 2.5-5 L. monocytogenes LSD530 TSB 5-10 Escherichia coli MC4100 TSB ++ 0.13-0.26 E. coli O157:H7 ATCC TSB ++ 0.13 35150 E. coli ATCC TSB ++ 0.13 25922 E. coli RR1 TSB +++ 0.13 Pseudomonas ATCC TSB +++ 0.52 aeruginosa 19442 P. fluorescens LRC R73 TSB +++ 0.162 Lactococcus lactis UL719 MRS Paenibacillus ATCC MRS polymyxa 43865 Pediococcus UL5 MRS acidilactici Salmonella enterica UL TSB + 1.04-2.08 Staphylococcus Scott A3 TSB aureus * Determined from two individual assays No inhibition at concentrations up of 5 g ml.sup.1 + Diameter of the inhibition zone 10 2 mm ++ Diameter of the inhibition zone 16 2 mm +++ Diameter of the inhibition zone 28 2 mm ATCC: American Type Culture Collection; UL: University Laval, Quebec, Canada LRC: Lethbridge Research Center, Alberta, Canada; LSD: Laboratory Services Division, Ottawa, ON, Canada; HPB: Health Product Branch, (Health and Welfare Canada, Ottawa, ON, Canada). MRS: de Man Rogosa and Sharpe medium TSB: Tryptone Soya Broth medium

    Example 7: Determination of the Potential of P. polymyxa JB05-01-1 as a Probiotic

    Strains and Culture Conditions

    [0165] Paenibacillus polymyxa JB05-01-1 and Paenibacillus polymyxa reference strains ATCC (43865 and 7070) were aerobically grown for 18 h at 30 C. with agitation in Tryptic Soy Broth (TSB) (Difco Laboratories, Detroit, Mich., USA) containing 1% of yeast extract leading to a medium named TSBYE. Escherichia coli generic ATCC 25922 (E. coli ATCC 25922) was grown for 16 h at 37 C. in TSB (Difco). The four strains were stored at 80 C. in the corresponding medium containing 20% glycerol (w/v). Frozen stocks were activated by re-suspending 100 l of each conserved strain in 10 ml of growth medium, followed by incubation for 18-24 h at the corresponding temperature.

    Antimicrobial Activity of Paenibacillus polymyxa JB05-01-1 Culture Supernatant

    [0166] To demonstrate that inhibition of E. coli ATCC 25922 by P. polymyxa JB05-01-1 was attributed in part to secreted substances, culture supernatant was tested using a qualitative agar well diffusion method (Wolf and Gibbons, 1996). Briefly, TSBYE containing 0.75% (w/v) agar was cooled to 47 C., seeded with overnight culture of E. coli ATCC 25922 (1% vol), and poured into sterile Petri plates. Wells (7 mm) were cut in the solidified agar using a sterile metal cork borer and filled with 80 l of P. polymyxa culture supernatant. The plates were incubated at 5 C. for 2 h to allow diffusion of the supernatant; the incubation continued aerobically for 18 h at 30 C. After this period, the plates were inspected for the presence or absence of zones of inhibition.

    Antagonism Between P. polymyxa JB05-01-1 and E. coli ATCC 25922

    [0167] P. polymyxa JB05-01-1 culture (10 ml) was centrifuged and the cells were resuspended in 50 l of LB broth. 20 l, of the suspension were deposited into a 5-mm paper disc. The paper discs impregnated with bacterial cell suspension were placed on the surface of TSBYE seeded with overnight culture of E. coli ATCC 25922 (0.25 ml in 25 ml), solidified with 0.75% agar and poured at 47 C. into Petri plates. The plates were incubated aerobically at 30 C. for 18 h and checked for zones of inhibition (clear agar) surrounding the paper discs (Lenni and Mauliya, 2010).

    Tolerance of P. polymyxa JB05-01-1 to Lysozyme, Acid, Bile and Hydrogen Peroxide (H.sub.2O.sub.2)

    [0168] Tolerance of the three P. polymyxa strains to lysozyme, acidic conditions, bile salts and hydrogen peroxide was tested using sterile flat-bottom 96-well microtiter plates (Falcon, Becton Dickinson and Company, Frankin Lakes, N.J., USA; Gagnon et al. 2004). Egg-white lysozyme (Sigma, 48,000 U/mg protein) was added at different concentrations (0, 3.9, 7.8, 15.6, 31.25, 62.5, 125, 250, 500, 1000 g/ml) to TSBYE broth. The medium was adjusted to different pH values (7.0, 6.5, 6. 5.5, 5.0, 4.75, 4.5, 4.25, 4.0) using 1M HCl. For another purpose, bovine bile salts (Sigma) were added to the medium at different concentrations (0.1%, 0.2%, 0.3%, and 0.4% w/v). Similarly, to study the effect of H.sub.2O.sub.2, different concentrations (0, 2.5, 5, 10, 20 and 40 g/ml) of H.sub.2O.sub.2 purchased from Merck (Darmstadt, Germany) was added. Wells (in duplicate) containing 200 l of tested broth were inoculated with 20 l of overnight culture of P. polymyxa diluted 1/100 in TSBYE. Microplates were incubated under anaerobic conditions at 30 C. for 18 h. Optical densities (OD) were read at 630 nm using a Thermomax microplate reader (Zeus, scientific Inc, Raritan, N.J.). Resistance to H.sub.2O.sub.2 and lysozyme (minimum inhibitory concentration) was expressed as the lowest concentration that maintained the OD under 50% of the OD in the 0 concentration wells. Acid resistance was expressed as the lowest pH at which the tested strain had an OD at least 40% of its level at pH 6.5.

    Tolerance to Gastric Acidity

    [0169] Determination of the tolerance to a simulated gastric transit was based on the procedure described by Charteris et al. (1998). A simulated gastric juice was prepared by suspending pepsin (3 mg/ml) in sterile saline (0.5% w/v) and adjusting the pH to 2.0 with concentrated HCl. Overnight 2 ml cultures of the three P. polymyxa variants were subjected to centrifugation in an Eppendorf centrifuge at 5000 g for 5 min and washed two times in quarter-strength Ringer's solution at pH 7. Then, 0.3 mL of the washed suspension was added to 1.5 mL of simulated gastric juice (pH 2.0) in a 2.0 mL Eppendorf tube and vortexed. In the controls, simulated gastric juice was replaced by 1.5 mL quarter-strength Ringer's solution and these samples were used for determination of the initial cell counts. Aliquots of 0.2 mL were removed after 15, 30, and 90 min at 37 C. and viable counts were determined by plating serial 10-fold dilutions on LB agar and counting the colony numbers after anaerobic incubation at 37 C. for 48 h. Experiments were carried out in duplicate and were repeated two times. Results are expressed as the mean and standard deviation of three determinations.

    Carbohydrate Utilization

    [0170] The abilities of P. polymyxa JB05-01-1 and other P. polymyxa strains (ATCC 43865, ATCC 7070) to utilize sugars, glycogen and pyruvate, to grow in the presence of 6.5% NaCl and finally to tolerate polymyxin B were determined using the Vitek 2 colorimetric GN-BCL card for the identification of Gram-positive spore-forming microorganisms of the family Bacillaceae (BioMerieux, Inc. Hazelwood, Mo., USA) according to the manufacturer's instructions (Scheldeman et al. 2004). Results were reported as negative or positive. The carbohydrate utilization profiles were compared and the homology was determined using the Vitek 2 compact system (BioMerieux, Inc. Hazelwood, Mo., USA).

    Determination of Cell Affinity for Hydrocarbons

    [0171] P. polymyxa JB05-01-1 and reference strains ATCC 43865 and ATCC 7070 were grown in TSBYE media at 30 C. to the logarithmic growth phase, harvested by centrifugation (3000 g, 10 min), washed twice, and resuspended at a concentration of 10.sup.8 CFU ml.sup.1 in 0.15 mol l.sup.1 NaCl solution. Hexadecane or decane (0.4 ml) was vortexed for 60 sec and the suspension was allowed to stand for 30 min (Doyle and Rosenberg, 1995). Absorbance by the aqueous phase at 400 nm was measured using a spectrophotometer (Molecular Devices Corp., Sunnyvale, Calif., USA). The percentage of cells extracted into each hydrocarbon liquid was determined by the following formula: 100[1(A/A.sub.0)], where A.sub.0 and A are absorbance by the aqueous phase prior to and after mixing.

    Caco-2 Cell Culture and Bacterial Adhesion Assay

    [0172] Enterocyte-like Caco-2 cells (ATCC HTB-37) obtained from the American Type Culture Collection (Rockville, Md.) were cultured routinely under a 5% (v/v) CO.sub.2 atmosphere at 37 C. as monolayer in Dulbecco-modified Eagle's minimal essential medium (DMEM; Gibco) containing 25 mM glucose, 4 mM glutamine and 1 mM sodium pyruvate (Gagnon et al. 2004), and then in medium supplemented with 20% (v/v) fetal calf serum (Hyclone Laboratories, Logan, Utah, USA). Wells in Multiwell tissue culture plates (Falcon, Becton-Dickinson) were seeded each with 10.sup.4 cells. The culture medium was replaced every 48 h and confluent monolayers obtained after the tenth sub-culture was used for the adhesion assay. Trypan Blue was used for viable staining and cells were counted by hemocytometer (Hausser scientific, Horsham, Pa., USA).

    [0173] The procedure of Cepeljnik et al. (2007) was followed. Caco-2 cell monolayers were washed twice with sterile phosphate-buffered saline (PBS, 100 mM, pH 7.3) and submerged in DMEM for 18 h, followed by one wash with PBS. Overnight culture of P. polymyxa in TSBYE broth was centrifuged and the bacterial cells were washed twice with PBS, suspended in DMEM at approximately 410.sup.4 CFU/ml or 410.sup.6 CFU/ml and 2 ml were added to the wells. Adhesion to Caco-2 cells was evaluated at 15, 30 and 60 min by washing twice with sterile PBS followed by addition of 0.25 ml of trypsin-EDTA (0.05% trypsin, 0.53 mM Na.sub.4-EDTA; Gibco). After 15 min of incubation at 37 C., 0.25 ml of DMEM supplemented with 20% FCS was added to each well to stop the trypsin reaction and the Caco-2 layer was detached by pipetting. Serial 10-fold dilutions were then plated on Bacillus cereus agar (Difco Laboratories), followed by incubation under aerobic conditions for 24 h at 37 C.

    Results

    [0174] Antimicrobial Activity of Paenibacillus polymyxa JB05-01-1 Culture Supernatant

    [0175] The antimicrobial substance(s) produced by P. polymyxa JB0501 was confirmed qualitatively using the agar diffusion test (FIG. 7A) against E. coli ATCC 25922 as the indicator strain.

    Antagonism Between Paenibacillus polymyxa JB05-01-1 and E. coli ATCC 25922

    [0176] Using the spot test, P. polymyxa JB05-01-1 was found to be antagonistic towards E. coli ATCC 25922 (FIG. 7B). Paper discs loaded with P. polymyxa JB05-01-1 produced clear zones of inhibition about 8 mm in diameter. TSB medium was tested as negative control.

    Lysozyme, Acid, Bile and Hydrogen Peroxide Tolerance by Paenibacillus polymyxa JB05-01-1

    [0177] For a probiotic candidate, it must display the ability to survive under gastrointestinal tract conditions. This means to begin with, resistance to salivary lysozyme, gastric acid (HCl) and bile. The candidate should also be able to establish itself among the intestinal microbiota. The ability of P. polymyxa JB05-01-1 to grow in the presence of lysozyme, acidic pH, bile salts and H.sub.2O.sub.2 is shown in Table 5. P. polymyxa JB05-01-1 was able to grow in the presence of egg-white lysozyme concentrations up to 16.5 g/ml which is supposed to be more than the physiological concentration of intestinal lysozyme (Suskovic et al. 1997). ATCC 43865 and ATCC 7070 isolates were able to tolerate higher concentrations of 31.25-62.5 g/ml. All three strains of P. polymyxa grew at pH 4.75 or lower (Table 5). Indeed JB05-01-1 and ATCC 43865 were able to grow at a lower pH (4.5). Acidity is believed to be the most detrimental factor affecting the growth and viability of probiotic bacteria, growth being slowed down significantly below pH 4.5 (Lankaputhra et al. 1995). P. polymyxa JB05-01-1 should therefore survive in fermented products and perhaps contribute to prolonging product shelf life. No growth was observed for any of the strains in the presence of 0.2% bile salts. The maximum H.sub.2O.sub.2 concentration tolerated by P. polymyxa JB05-01-1 was between 7.3 to 14.6 g/ml.

    TABLE-US-00005 TABLE 5 Tolerance of gastrointestinal factors by Paenibacillus polymyxa Substance Lysozyme Acid Bile salts H.sub.2O.sub.2 Variant or strain (g/ml).sup.1 (HCl).sup.2 (0.2%) (g/ml).sup.1 P. polymyxa JB05-01-1 16.25 4.5 .sup.3 7.3-14.6 P. polymyxa ATCC 43865 31.25-62.5 4.5 14.6 P. polymyxa ATCC 7070 31.25-62.5 4.75 7.3-14.6 .sup.1Minimum inhibitory concentration (MIC) .sup.2Minimum growth pH .sup.3 No growth

    Tolerance to Gastric Acidity and Cell Affinity for Hydrocarbons

    [0178] Exposure of P. polymyxa JB05-01-1, P. polymyxa ATCC 43865 and P. polymyxa ATCC 7070 strains to a simulated gastric buffer containing pepsin at pH 2.0 resulted in a rapid loss of viability (FIG. 9). Viable counts of variant P. polymyxa JB05-01-1 strains decreased from about 6.93 to 1.61 Log CFU per ml within 15 min. P. polymyxa JB05-01-1 displayed higher affinity for both hexadecane and decane than the P. polymyxa ATCC 43865 and P. polymyxa ATCC 7070 (FIG. 8).

    Carbohydrate Utilization and Other Physiological Factors

    [0179] Table 6 shows the carbohydrate utilization profiles, the tolerance of salt or polymyxin B, and the calculated homology based on these 14 traits for the three variants of P. polymyxa. Strain JB05-01-1 displayed a homology of approximately 98%, confirming the high probability that it does indeed belong to the genus Paenibacillus.

    TABLE-US-00006 TABLE 6 Carbohydrate utilization profile, growth in 6.5% NaCl, polymyxin B resistance and homology of three strains of Paenibacillus polymyxa Bacterial strain ATCC ATCC Physiological test JB05-01-1 43865 7070 D-Galactose + + + Maltotriose + + + D-Mannose + + + D-Melezitose + D-Tagatose D-Trehalose + + + Palatinose + + + L-Rhamnose D-Glucose + + + d-Ribose + + + Glycogen + + + Pyruvate + + Growth in 6.5% NaCl + + Tolerance of polymyxin B + + + Homology (%) 98 91 88
    Adhesion of Paenibacillus polymyxa to Caco-2 Cells

    [0180] The quantitative adhesion of P. polymyxa JB05-01-1 and P. polymyxa ATCC 43865 and ATCC 7070 to monolayers of enterocyte-like cells is depicted in Table 7. Starting from initial numbers of about 8.710.sup.6 and 6.810.sup.6 CFU/well, the number of adherent bacterial cells after 1 h of contact was about 3.40.1610.sup.4 CFU/well and 4.80.2610.sup.4 CFU/well respectively for P. polymyxa JB05-01-1 and P. polymyxa ATCC 43865. Starting from initial numbers 100 times smaller, the numbers of adherent bacterial cells were about ten times smaller. In both P. polymyxa JB05-01-1 and P. polymyxa ATCC 43865, adhesion ranged from about 0.35% to about 6.5% of the initial numbers contacted with the enterocytes; the proportion being decreased at the higher initial load suggesting that saturation of the adhesion sites was approached at the higher bacterial load tested. Contact time with the Caco-2 monolayer had little effect on the number of adherent bacterial cells counted.

    TABLE-US-00007 TABLE 7 Adhesion of Paenibacillus polymyxa JB05-01-1, Paenibacillus polymyxa ATCC 43865 and Paenibacillus polymyxa ATCC 7070 to Caco-2 cells Adherent bacteria (CFU/well)* Initial load 15 min 30 min 60 min P. polymyxa 8.7 0.53 10.sup.6 3.1 0.1 10.sup.4 3.1 0.31 10.sup.4 3.4 0.16 10.sup.4 JB05-01-1 8.7 0.45 10.sup.4 5.3 0.22 10.sup.3 4.4 0.68 10.sup.3 4.8 0.42 10.sup.3 P. polymyxa 6.8 0.45 10.sup.6 3.2 0.21 10.sup.4 2.8 0.53 10.sup.4 4.8 0.26 10.sup.4 ATCC 43865 6.8 0.37 10.sup.4 4.4 0.33 10.sup.3 2.4 0.22 10.sup.3 3.7 0.32 10.sup.3 P. polymyxa 7.1 0.65 10.sup.6 3.8 0.21 10.sup.4 3.3 0.13 10.sup.4 4.8 0.46 10.sup.4 ATCC 7070 7.1 0.22 10.sup.4 2.4 0.33 10.sup.2 5.5 0.58 10.sup.2 4.1 0.51 10.sup.2 *Mean S.E. of duplicate analyses

    Example 8: Probiotic Effect on Growth Performance of Broiler Chickens

    [0181] A preparation of JB05-01-1 supernatant (labeled P3) was produced as a dietary supplement for a field trial. A TSB medium with 0.4% yeast extract was prepared for a 1 liter fermentor which was in turn inoculated with the test culture. The culture was grown at 30 C. for 18 hours. The resulting culture was centrifuged at 12,000 g for 15 minutes at 4 C. The centrifuged cultures were then heated to between 80 and 100 C. in a water bath allowing the supernatant to be separated from the pellet. The supernatant was then stored at 4 C. for use in the trial. 500 day-old broiler chicks were divided into five treatment groups, each group containing 4 cohorts of 25 birds. The five different treatment groups of broiler chickens were given different amounts of dietary supplements for a four week period. The treatment regimes were as follows:

    [0182] T1=Normal Diet (control)

    [0183] T2=Normal Diet+1.5 ml RE3 per kg feed

    [0184] T3=Normal Diet+0.5 ml P3 per kg feed

    [0185] T4=Normal Diet+1 ml P3 per kg feed

    [0186] T5=Normal Diet=1.5 ml P3 per kg feed

    Results

    [0187] Summary of results at the end of week 4 are shown in Table 8.

    TABLE-US-00008 TABLE 8 The effect of varying levels of P3 on the growth performance of broiler chickens Dietary treatment T2 T3 T4 T5 1.5 ml 0.5 ml 1 ml 1.5 ml T1 RE3/kg P3/kg P3/kg P3/kg Parameter Control feed feed feed feed Initial weight/bird (g) 47 47 47 47 47 Final weight/bird (g) 1041 1006 1058 1025 1036 Feed intake/bird (g) 1780 1673 1729 1711 1731 Weight gain/bird (g) 994 959 1011 978 989 FCR (intake/gain) 1.79 1.75 1.71 1.75 1.75 Mortality (%) 7 5 5 1 1

    [0188] Addition of dietary supplements RE3 or P3 to chicken feed resulted in a slightly better feed conversion rate (FCR) of the feed than when no dietary supplement is added (control) indicating that addition of these dietary supplements results in a higher weight gain in chickens for equivalent feed intake. Provision of dietary supplements RE3 or P3 to feed also resulted in fewer mortalities, with supplement P3 added at levels of 1 ml or 1.5 ml per kg of feed having the lowest mortality rate.

    Example 9: Genome Assembly and Annotation

    [0189] The genome of Paenibacillus polymyxa JB05-01-1 (JB05-01-1 genome) was sequenced by MiSeq Illumina sequencing (Eurofins MWG, Germany). The size of the genome was 5.9 Mb, with a 45.7% G/C content.

    TABLE-US-00009 TABLE 9 Features of the assembled JB05-01-1 genome Features of the assembled JB05-01-1 genome Contig/Scaffold Overview Sample: P.sub.PJB005 All Large Large Contigs Contigs Scaffolds Scaffolds Total Entries: 70 30 42 5 Total Length: 5961671 5949216 5993163 5981904 Min Length: 173 1029 173 1029 Max Length: 1668666 1668666 5976888 5976888 Mean Length: 85166 198307 142694 1196380 N50: 512780 512780 5976888 5976888 N90: 173989 173989 1561 1561 GC Content: 45.7 45.7 45.7 45.7 #A: 1618632 1615645 1618632 1615858 #T: 1619418 1616533 1619418 1616700 #G: 1358695 1355323 1358695 1355642 #C: 1364926 1361715 1364926 1362143 #N: 0 0 31492 31492 Sample: P.sub.PJB005 Scaffold Length k-mer coverage scf_77 5976888 30.694033 scf_12 1561 87.979660 scf_10 1292 133.208954 scf_41 1134 56.627861 scf_7 1029 373.888641
    The JB05-01-1 genome consists of 70 contigs, ranging from 173 bp to 1 658 666 bp in size, assembled in 5 large scaffolds.

    [0190] The JB05-01-1 genome sequence was compared with available sequenced genomes of five Paenibacillus polymyxa strains (E681, SC2, M1, CR1 et SQR21). The contigs were reordered based on the reference strain E681 with ACT and WebACT. The JB05-01-1 genome was annotated using the RAST server (automated annotation), which identified 5489 coding sequences and 127 RNAs.

    TABLE-US-00010 TABLE 10 Overview of annotated JB05-01-1 genome: gene subsystems and functions Feature Percentage Subsystems Count % Cofactors, Vitamins, Prosthetic 235 7.94 Groups Pigments Cell Wall and Capsule 154 5.20 Virulence, Disease, and Defense 95 3.21 Potassium metabolism 9 0.30 Photosynthesis 0 0.0 Miscellaneous 24 0.81 Phages, Prophages, Transposable 16 0.54 elements, Plasmids Membrane Transport 92 3.11 Iron acquisition and metabolism 35 1.18 RNA Metabolism 161 5.44 Nucleosides and Nucleotides 115 3.88 Protein Metabolism 223 7.53 Cell Division and Cell Cycle 27 0.91 Motility and Chemotaxis 69 2.33 Regulation and Cell signaling 59 1.99 Secondary Metabolism 125 4.22 Fatty acids, Lipids, and Isoprenoids 131 4.42 Nitrogen Metabolism 31 1.05 Dormancy and Sporulation 97 3.28 Respiration 53 1.79 Stress Response 85 2.87 Metabolism & Aromatic compounds 7 0.24 Amino Acids & derivatives 344 11.62 Sulfur Metabolism 51 1.72 Phosphorus Metabolism 67 2.26 Carbohydrates 656 22.15 Total 2961 100.00

    Features of Interest

    [0191] The JB05-01-1 genome contains genes coding for several antibacterial peptides, for example, polymyxin synthesis gene cluster, bacitracin and fusaricidin synthetases. The JB05-01-1 genome also contains multiple antibiotic resistance genes. Genes coding for bacitracin synthetases (annotated as bacitracin synthetase 3 BA3) were identified as follows: [0192] A 23727 bp synthetase (PEG 83, contig 43b 88285-112011), which is 97% identical to the P. Polymyxa E681 bacitracin synthetase 3 [0193] A 7767 bp synthetase (PEG 1749, contig 48 209298-217064), which shares 95% identity with the P. polymyxa M1 non-ribosomal peptide synthase NrsB [0194] A 12543 bp synthetase (PEG1750, contig 48 217075-229617), which is 92% identical to P. polymyxa M1 non-ribosomal peptide synthase NrsC [0195] A 4494 bp gene (PEG1962, contig 48, 460576-456083), which shares 99% identities with a gene annotated as a peptide synthetase in P. polymyxa CR1. [0196] A 3870 bp gene (PEG1977, contig 48, 512190-516059).

    [0197] Another gene of interest was found (PEG 3093, contig 52 6122-17335) coding for a 11214 bp Malonyl CoA-acyl carrier protein transacylase which shares 99% identity with the P. polymyxa CR1 fusaricidin synthetase gene.

    TABLE-US-00011 TABLE11 Primerssequencesforthebacitracinand fusaricidinsynthetasesidentifiedinthe JB05-01-1genome G/C con- Length tent Tm Sequence(5 to3) (bp) (%) ( C.) PEG83_F ATGAATGACATGCAGTTATA 20 30 44 (SEQIDNO:2) PEG83_R TTAGGACAAAATGGGCTTGT 20 40 48 (SEQIDNO:3) PEG1749_F ATGAGAAACGCACTCATTCA 20 40 48 (SEQIDNO:4) PEG1749_R CTAGGAAGATGTATTATTTT 25 24 48 TATAG(SEQIDNO:5) PEG1750_F ATGAGTAAAGATCTGCAAAT 23 31 48 TCA(SEQIDNO:6) PEG1750_R TTACAGAACCGCTGCCCAGC 20 60 56 (SEQIDNO:7) PEG1962_F ATGTTCTATGCATTAACGCA 21 33 47 T(SEQIDNO:8) PEG1962_R TTATTCAAAAAGCAATTCAA 24 21 45 TATC(SEQIDNO:9) PEG1977_F ATGCATTATGAAGGATATGA 20 30 44 (SEQIDNO:10) PEG1977_R TTACCTCAAAAATGTATTCA 20 25 42 (SEQIDNO:11) PEG3093_F TTGAAAGCCTTATTTGAGAA 21 33 47 G(SEQIDNO:12) PEG3093_R TCAAGATTTATGATGTGCCA 20 35 46 (SEQIDNO:13)

    [0198] The 2613 bp lantionine synthetase LanL (PEG 2150, contig 48 697422-700034) was also identified. In addition, two other genes coding for non-ribosomal peptide synthetases were identified: a 1407 bp gene (PEG1966, contig 48, 468244-469650: 1407 bp) and a 2025 bp gene (PEG1971, contig 48, 484672-486696).

    [0199] The JB05-01-1 genome also contains a polymyxin synthesis gene cluster consisting of five genes, sharing high homology with the pmxABCDE genes (95-99% identities). The genes coding for PmxB, PmxC and PmxD located on contig 63 were identified as: [0200] pmxB: PEG5404 (1899 bp, contig 63 10624-8726) annotated as a bacillibactin synthetase component F (97% identical to the pmxB gene in Paenibacillus polymyxa SQR-21) [0201] pmxC: PEG5403 (1827 bp, contig 63 8736-6910) annotated as lipid A export ATP-binding/permease protein MsbA (96% identical to the pmxC gene in P. polymyxa M1 [0202] pmxD: PEG5402 (1734 bp, contig 63 6913-5180) annotated as lipid A export ATP-binding/permease protein MsbA (98% identical to the pmxD gene in P. polymyxa M1).

    TABLE-US-00012 TABLE12 Primersequencesforthepolymyxinsynthesis genesidentifiedintheJB05-01-1genome G/C Length content Tm Sequence(5 to3) (bp) (%) ( C.) PEG5402_F TTGAAAAAGGGCGGATGGC 23 52 57 (6913) TCTC(SEQIDNO:14) PEG5402_R CTAGCCGTACAGCCGGGC 18 72 57 (5180) (SEQIDNO:15) PEG5403_F ATGGAAGCTGACCGGCAG 18 61 53 (8736) (SEQIDNO:16) PEG5403_R TCAAGTGTACGCCACCTCC 19 58 53 (6910) (SEQIDNO:17) PEG5404_F ATGTACGGAGCGCTGCTGT 19 58 53 (10624) (SEQIDNO:18) PEG5404_R TCAGCTTCCATGCAGTACC 19 53 51 (8726) (SEQIDNO:19)

    [0203] The pmxA and pmxE genes in the JB05-01-1 genome were not identified by automated annotation. The pmxA (15 030 bp) and the pmxE (18 940 bp) genes of P. polymyxa M1 were used as references to search the JB05-01-1 genome. Fragments of pmxA were found on contigs 62 (bases 1 to 1619), 60 (1796-2688), 66 (3132-5604), 67 (6075-8553) and 68 (9252-13125, 13659-15033). The pmxE gene appeared to be located on contigs 63 and 61.

    REFERENCES

    [0204] Andersson, A., Granumb, P. E., Ronnera, U. (1998). The adhesion of Bacillus cereus spores to epithelial cells might be an additional virulence mechanism International Journal of Food Microbiology 39, 93-99. [0205] Altschul S F, Gish W, Miller W, Myers E W, Lipman D J. Basic local alignment search tool. J Mol Biol 1990; 215:403-410. [0206] Angioi, A., Zanetyi, S., Sanna, A., Delogu, G., Fadda, G. (1995) Adhesiveness of Bacillus subtilis Strains to Epithelial Cells Cultured in vitro. Microbial Ecology in Health and Disease. 8: 71-77 [0207] Bhunia A K, Johnson M C, Ray, B. Direct detection of an antibacterial peptide of Pediococcus acidilactici in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. J Ind Microbiol 1987; 2:319-322. [0208] Caldwell D R, Bryant M P. Medium without rumen fluid for non selective enumeration and isolation of rumen bacteria. Appl Microbiol 1966; 14:794-801. [0209] Cepeljnik, T., Lah, B., Narat, M., Marinsek-Logar, R. (2007) Adaptation of adhesion test using Caco-2 cells for anaerobic bacterium Pseudobutyrivibrio xylanivorans, a probiotic candidate. Folia Microbiol (Praha). 52:367-73. [0210] Charteris, W. P., Kelly, P. M., Morelli, L., and Collins, J. K. (1998). Development and application of an in vitro methodology to determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in the upper human gastrointestinal tract. Journal of Applied Microbiology, 84, 759-768. [0211] Cleveland J, Montville T J, Nes I F, Chikindas M L. Bacteriocins: Safe, natural antibacterials for food preservation. hit. J. Food Microbiol, 2001; 71:11-20. [0212] Daba H, Lacroix C, Huang J, Simard R E, Lemieux L. Simple method of purification and sequencing of a bacteriocin produced by Pediococcus acidilactici UL5. J Appl Bacteriol 1994; 77:682-688. [0213] Davies E A, Bevis H E, Potter R, Harris J, Williams G C, Delves-Broughton J. The effect of pH on the stability of nisin solution during autoclaving. Lett Appl Microbiol 1998; 27:186-187. [0214] de Man J C, Rogosa M, Sharpe M E. A medium for the cultivation of lactobacilli. J Appl Bacteriol 1960; 23:130-135. [0215] DeCrescenzo H E, Phillips D R, Doran Peterson J B. Polymyxin E production by P. amylolyticus. Letters Appl Microbiol 2007; 45:491-496. [0216] Doyle, R. J., Nedjat-Haiem F. Singh J. S. (1984). Hydrophobic characteristics of Bacillus spores. Current Microbiology. 10: 329-333. [0217] Doyle, R. J., Rosenberg, M. (1995). Measurement of microbial adhesion to hydrophobic substrata. Methods in Enzymology, 253, 542-550. [0218] Du L, Shen B. Identification and characterization of a type II peptidyl carrier protein from the bleomycin producer Streptomyces verticillus ATCC 15003. Chem Biol. 1999; 6:507-517. [0219] Falagas M E, and Kasiakou S K (2005). Colistin: the revival ofpolymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clin Infect Dis. 40:1333-1341. [0220] Falagas M E, Kasiakou S J (2006) Toxicity of polymyxins: a systematic review of the evidence from old and recent studies. Crit Care. 10:R27. [0221] Fangio M F, Roura S I, Fritz R (2010) Isolation and identification of Bacillus spp. and related genera from different starchy foods. J Food Sci. 75:218-221. [0222] Gagnon, M., Kheadr, E., Le Blay G., Fliss, I. (2004) vitro inhibition of Escherichia coli O157:H7 by bifidobacterial strains of human origin. International Journal of Food Microbiology 92, 69-78. [0223] Govaerts C, Orwa J, Van Schepdael A, Roets E, Hoogmartens J (2002) Characterization of polypeptide antibiotics of the polymyxin series by liquid chromatography electrospray ionization ion trap tandem mass spectrometry. J. Pept. Sci. 8:45-55. [0224] He Z, Kisla D, Zhang L, Yuan C, Green-Church K B, YousefAE (2007) Isolation and identification of a Paenibacillus polymyxa strain that coproduces a novel lantibiotic and polymyxin. Appl Env Microbiol. 73:168-178. [0225] He Z, Yuan C, Zhang L, Yousef A E (2008) N-terminal acetylation in paenibacillin, a novel lantibiotic. FEBS Lett. 582:2787-2792. [0226] Jian Li, Milnel R W, Nation R L, Turnidge J D, Smeaton T C, Coulthard K (2004) Pharmacokinetics of colistin methanesulphonate and colistin in rats following an intravenous dose of colistin methanesulphonate J Antimicrobial Chemother. 53: 837-840. [0227] Kane M D, Paulsen L K, Stahl D A. Monitoring the enrichment and isolation of sulfate-reducing bacteria by using oligonucleotide hybridization probes designed from environmentally derived 16S rRNA sequences. Appl Environ Microbiol 1993; 59:682-686. [0228] Kheadr E, Bernoussi N, Lacroix C, Fliss I. Comparison of the sensitivity of commercial strains and infant isolates of bifidobacteria to antibiotics and bacteriocins, Int Dairy J 2004; 14; 273-285. [0229] Klaenhammer T R. Genetics of bacteriocins produced by lactic bacteria. FEMS Microbiol Rev 1993; 12:39-86. [0230] Komura S, Kurahashi K. Biosynthesis of polymyxin E by a cell-free enzyme system. J Biochem 1985; 97:1409-1417. [0231] Koshikawa, T., Yamazaki, M., Yoshimi, M., Ogawa, S., Yamada, A., Watabe, K., Tori, A., (1989) Surface Hydrophobicity of Spores of Bacillus spp. Journal of General Microbiology 135, 2717-2722. [0232] Lampis G, Deidda D, Maullu C, Madeddu M A, Pompei R, Delle Monachie F, Satta G (1995) Sattabacins and sattazolins: new biologically active compounds with antiviral properties extracted from a Bacillus sp. J Antibiot (Tokyo). 48:967-72. [0233] Landman D, Georgescu C, Martin D A, Quale J (2008) Polymyxins Revisited Clinical. Microbiol Rev. 21, 449-465. [0234] Lankaputhra, E. V., Shah, N. P., 1995. Survival of Lactobacillus acidophilus and Bifidobacterium spp. in the presence of acid and bile salts. Cult. Dairy Prod. J. 30, 2-7. [0235] Lenni Fitri and Betty Mauliya Bustam (2010) Screening of antimicrobial producing strains isolated from the soil of grassland rhizosphere in Pocut Meurah Intan Forest Park, Seulawah, Aceh Besar Biodiversitas, 11 129-132. [0236] Lim L M, Ly N, Anderson D, Yang J C, Macander L, Jarkowski A 3rd, Forrest A, Bulitta J B, Tsuji B T (2010) Resurgence of colistin: a review of resistance, toxicity, pharmacodynamics, and dosing. Pharmacotherapy. 30:1279-91. [0237] Liu W T, Marsh T L, Cheng H, Forney L J. Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Appl Environ Microbiol 1997; 63:4516-4522. [0238] Lowry O H, Rosebrough N J, Farr A L, Randall R J. Protein measurement with the Folin phenol reagent. J Biol Chem 1951; 193:267-275. [0239] Marahiel M A, Stachelhaus T, Mootz H D. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem Rev 1997; 97:2651-2673. [0240] Martin N I, Hu H, Moake M M, Churey J J, Whittal R, Worobo R W, Vederas J C. Isolation, structural characterization, and properties of mattacin (polymyxin M), a cyclic peptide antibiotic produced by Paenibacillus kobensis M. J Biol. Chem 2003; 278:13124-13132. [0241] Motta A S, Lorenzini D M, Brandelli A. Purification and partial characterization of an antibacterial peptide produced by a novel Bacillus sp. Isolated from the amazon basin. Curr Microbiol 2007; 54:282-286. [0242] Naghmouchi K, Drider D, Baah J, Teather R (2010) Nisin A and Polymyxin B as Synergistic Inhibitors of Gram-positive and Gram-negative Bacteria. Prob Ant Prot. 2: 98-103. [0243] Naghmouchi K, Drider D, Fliss I. Action of divergicin M35, a class IIa bacteriocin, on liposomes and Listeria. J Appl Microbiol. 2007; 102:1508-17. [0244] Naghmouchi K, Drider D, Hammami R, Fliss I. (2008) Effect of Antimicrobial Peptides Divergicin M35 and Nisin A on Listeria monocytogenes LSD530 Potassium Channels. Current Microbiol 56:609-612. [0245] Nathaniel I M, Hu H, Moake M M, Churey J J, Whittal R, Worobo R W, and Vederas J C (2003) Isolation, Structural Characterization, and Properties of Mattacin (Polymyxin M), a Cyclic Peptide Antibiotic Produced by Paenibacillus kobensis M. J Biol Chem. 278: 13124-13132. [0246] Nes S F, Diep D B, Havarstein L S, Bruberg M B, Eijsink V G, Holo H. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie Leeuwenhock 1996; 70:113-128. [0247] Scheldeman, P. Goossens, K., Rodriguez-Diaz, M, Pil, A., Goris, J., Herman, L., De Vos, P., Logan, N A., Heyndrickx M (2004). Paenibacillus lactis sp. nov., isolated from raw and heat-treated milk. International journal of systematic and evolutionary microbiology 54, 885-891. [0248] Selim S, Negrel J, Govaerts C, Gianinazzi S, van Tuinen D (2005) Isolation and Partial Characterization of Antagonistic Peptides Produced by Paenibacillus sp. Strain B2 Isolated from the Sorghum Mycorrhizosphere. Appl Environ Microbiol. 71: 501-6507. [0249] Suskovic, J., Brkic, B., Matosic, S., Maric, V., 1997. Lactobacillus acidophilus M92 as potential probiotic strain. Milchwissenschaft 52, 430-435. [0250] Svetoch E A, Stern N J, Eruslanov B V, Kovalev Y N, Volodina L I, Perelygin V V, Mitsevich E V, Mitsevich I P, Pokhilenko V D, Borzenkov V N, Levchuk V P, Svetoch O E, Kudriavtseva T Y. Isolation of Bacillus circulans and Paenibacillus polymyxa strains inhibitory to Campylobacter jejuni and characterization of associated bacteriocins. J Food Prot 2005; 68:11-17. [0251] Tagg J R, Dajani A S, Wannamaker L W. Bacteriocins of gram-positive bacteria Bacteriol Rev 1976; 40:722-56. [0252] Wolf C E, Gibbons W R. Improved method for quantification of the bacteriocin nisin. J Appl Bacteriol 1996; 80:453-457. [0253] Zengguo He, Kisla D, Zhang L, Yuan C, Green-Church K B, Yousef A. E. Isolation and identification of a Paenibacillus polymyxa strain that coproduces a novel lantibiotic and polymyxin. Appl Environ Microbiol 2007; 73:168-178. [0254] Zheng G. Yan L Z, Vederas J C, Zuber P. Genes of the sbo-alb locus of Bacillus subtilis are required for production of the antilisterial bacteriocin subtilosin. J Bacteriol 1999; 181:7346-355.

    OTHER EMBODIMENTS

    [0255] The present invention has been described with regard to one or more embodiments. However, it will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims. Accordingly, although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the spirit and scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range, and of sub-ranges encompassed therein. As used herein, the terms comprising, comprises, having or has are used as an open-ended terms, substantially equivalent to the phrase including, but not limited to. Terms such as the, a, and an are to be construed as indicating either the singular or plural. Citation of references herein shall not be construed as an admission that such references are prior art to the present invention. All publications are incorporated herein by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein and as though fully set forth herein. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings.