RUNX2 Transcription Factor Inhibitors and Uses Thereof
20180086696 ยท 2018-03-29
Assignee
- University Of Maryland, Baltimore (Baltimore, MD)
- The United States Of America As Represented By The Department Of Veterans Affairs (Washington, DC)
Inventors
Cpc classification
A61K31/517
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C07C235/82
CHEMISTRY; METALLURGY
C07C2602/42
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07C235/82
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
Provide herein are compounds with a general chemical structure of:
##STR00001##
Substituents R.sub.1 and R.sub.2 independently are H, Cl, F, Br, CH.sub.3, CF.sub.3, SH, N(C.sub.1-3alkyl).sub.2, NHC(O)C.sub.1-3alkyl, or NHC(O)C.sub.5-7cycloalkyl, substituent R.sub.3 is H or C.sub.1-3 alkyl and R4 is a bridged cycloalkene such as a bridged cyclohexene or a bridge-substituted cyclohexene. The compounds are therapeutics to treat a cancer, such as breast cancer, or metastatic cancers, to inhibit RUNX2 activity, such as protein expression, in a cancer cell and to increase survival of a subject with breast cancer.
Claims
1. A compound having the chemical structure ##STR00012## wherein R.sub.1 and R.sub.2 independently are H, Cl, F, Br, CH.sub.3, CF.sub.3, SH, N(C.sub.1-3alkyl).sub.2, NHC(O)C.sub.1-3alkyl, or NHC(O)C.sub.5-7cycloalkyl; R.sub.3 is H or C.sub.1-3 alkyl; and R.sub.4 is ##STR00013## or a pharmaceutically acceptable salt thereof.
2. The compound of claim 1, wherein R.sub.3 is NH.
3. The compound of claim 1, wherein R.sub.1 and R.sub.2 are independently H, Cl, Br, or NHC(O)CH.sub.3, R.sub.3 is NH and R.sub.4 is ##STR00014##
4. The compound of claim 1, wherein R.sub.1 and R.sub.2 are independently H, Cl, CH.sub.3, NHC(O)CH.sub.3, NHC(O)cyclohexane, or N(CH.sub.3).sub.2, R.sub.3 is NH and R.sub.4 is ##STR00015##
5. The compound of claim 1, wherein R.sub.1 and R.sub.2 are each Cl and R.sub.3 is NH.
6. The compound of claim 1, wherein the chemical structure is: ##STR00016## ##STR00017##
7. A pharmaceutical composition comprising the compound of claim 1 and a pharmaceutically acceptable carrier.
8. A method for treating a cancer in a subject, comprising: administering to the subject a dose of one or more compounds of claim 1 effective to inhibit a RUNX2 activity, thereby treating the cancer.
9. The method of claim 8, further comprising administering one or more other cancer drugs.
10. The method of claim 9, wherein the other cancer drugs are Herceptin, Lapatinib, or DECMA1 antibody.
11. The method of claim 8, wherein the cancer is breast cancer, osteosarcoma, ovarian cancer, prostate cancer, melanoma, Ewing sarcoma, pancreatic cancer, thyroid cancer, leukemia, head/neck cancer, colorectal cancer, liver cancer, lung, pituitary cancer, gliomas, esophageal cancer, or multiple myeloma.
12. The method of claim 8, wherein the cancer is a metastatic cancer.
13. A method for inhibiting RUNX2 activity in a cancer cell, comprising: contacting the cancer cell with one or more of the compounds of claim 1.
14. The method of claim 13, wherein the cancer cell comprises a breast cancer, an osteosarcoma, an ovarian cancer, a prostate cancer, a melanoma, a Ewing sarcoma, a pancreatic cancer, a thyroid cancer, a leukemia, a head/neck cancer, a colorectal cancer, a liver cancer, a lung, a pituitary cancer, a gliomas, an esophageal cancer, or a multiple myeloma.
15. A method for treating a metastatic cancer in a subject, comprising: administering to the subject a dose of one or more compounds of claim 1 effective to inhibit a RUNX2 activity, thereby treating the metastatic cancer.
16. The method of claim 15, further comprising administering one or more other cancer drugs.
17. The method of claim 16, wherein the other cancer drugs are Herceptin, Lapatinib, or DECMA1 antibody.
18. The method of claim 15, wherein the metastatic cancer originates from a breast cancer, a lung cancer, a melanoma, a colorectal cancer, a prostate cancer, or a pancreatic cancer.
19. A compound having the chemical structure: ##STR00018## or a pharmaceutically acceptable salt thereof.
20. A pharmaceutical composition comprising the compound of claim 19 and a pharmaceutically acceptable carrier.
21. A method for treating breast cancer in a subject, comprising administering to the subject a dose of one or more compounds of claim 19 effective to inhibit RUNX2, thereby treating the cancer.
22. The method of claim 21, further comprising administering one or more other cancer drugs.
23. The method of claim 22, wherein the other cancer drugs are Herceptin, Lapatinib, or DECMA1 antibody.
24. The method of claim 21, wherein the breast cancer comprises metastases thereof.
25. The method of claim 21, wherein treatment inhibits metastasis of the breast cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] So that the matter in which the above-recited features, advantages and objects of the invention, as well as others which will become clear, are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments thereof which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope.
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
DETAILED DESCRIPTION OF THE INVENTION
[0049] As used herein, the term a or an when used in conjunction with the term comprising in the claims and/or the specification may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one. Some embodiments of the invention may consist of or consist essentially of one or more elements, method steps, and/or methods of the invention. It is contemplated that any method described herein can be implemented with respect to any other method described herein.
[0050] As used herein, the term or in the claims is used to mean and/or unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and and/or.
[0051] As used herein, comprise and its variations, such as comprises and comprising, will be understood to imply the inclusion of a stated item, element or step or group of items, elements or steps but not the exclusion of any other item, element or step or group of items, elements or steps unless the context requires otherwise. Similarly, another or other may mean at least a second or more of the same or different claim element or components thereof.
[0052] As used herein, the term about refers to a numeric value, including, for example, whole numbers, fractions, and percentages, whether or not explicitly indicated. The term about generally refers to a range of numerical values (e.g., +/5-10% of the recited value) that one of ordinary skill in the art would consider equivalent to the recited value (e.g., having the same function or result). In some instances, the term about may include numerical values that are rounded to the nearest significant figure.
[0053] As used herein, the terms compound, inhibitory compound and inhibitor refer to a chemical entity effective to inhibit an activity of RUNX2 in a cancer cell such as, but not limited to, inhibiting RUNX2 protein, inhibiting RUNX2 over expression or inhibiting RUNX2 gene.
[0054] As used herein, the term contacting refers to any suitable method of bringing a compound or a composition into contact with a cell. For in vivo applications, any known method of administration is suitable as described herein.
[0055] As used herein, the term subject refers to any human or non-human recipient of the compounds or pharmaceutical compositions thereof described herein.
[0056] In one embodiment of the present invention there is provided a compound having the chemical structure:
##STR00005##
[0057] where R.sub.1 and R.sub.2 independently are H, Cl, F, Br, CH.sub.3, CF.sub.3, SH, N(C.sub.1-3alkyl).sub.2, NHC(O)C.sub.1-3alkyl, or NHC(O)C.sub.5-7cycloalkyl; R.sub.3 is H or C.sub.1-3 alkyl; and R.sub.4 is
##STR00006##
or a pharmaceutically acceptable salt thereof.
[0058] In one aspect of this embodiment R.sub.3 may be NH. In another aspect R.sub.1 and R.sub.2 R.sub.1 and R.sub.2 independently may be H, Cl, Br, or NHC(O)CH.sub.3, R.sub.3 is NH and R.sub.4 is
##STR00007##
In yet another aspect R.sub.1 and R.sub.2 independently may be H, Cl, CH.sub.3, NHC(O)CH.sub.3, NHC(O)cyclohexane, or N(CH.sub.3).sub.2, R.sub.3 may be NH and R.sub.4 may be
##STR00008##
Particularly, compounds of this embodiment are those depicted in
[0059] In another embodiment of the present invention there is provided a compound having the chemical structure:
##STR00009##
or a pharmaceutically acceptable salt thereof.
[0060] In a related embodiment the present invention provides a pharmaceutical composition comprising the compound as described supra and a pharmaceutically acceptable carrier.
[0061] In yet another embodiment of the present invention there is provided a method for treating a cancer in a subject, comprising administering to the subject a dose of one or more compounds as described supra effective to inhibit a RUNX2 activity, thereby treating the cancer. Further to this embodiment the method comprises administering one or more other cancer drugs. Non-limiting examples of cancer drugs are Herceptin, Lapatinib, or DECMA1 antibody. In both embodiments the cancer may be breast cancer, osteosarcoma, ovarian cancer, prostate cancer, melanoma, Ewing sarcoma, pancreatic cancer, thyroid cancer, leukemia, head/neck cancer, colorectal cancer, liver cancer, lung, pituitary cancer, gliomas, esophageal cancer, or multiple myeloma. Alternatively, the cancer may be a metastatic cancer.
[0062] In a related embodiment the present invention provides a method for treating breast cancer in a subject comprising administering to the subject a dose of one or more compounds as described supra effective to inhibit RUNX2, thereby treating the cancer. A further embodiment comprises administering one or more other cancer drugs as described supra. In these embodiments the breast cancer may comprise metastases thereof.
[0063] In yet another embodiment of the present invention there is provided a method for treating a metastatic cancer in a subject, comprising administering to the subject a dose of one or more compounds of described herein effective to inhibit a RUNX2 activity, thereby treating the metastatic cancer. A further embodiment comprises administering one or more other cancer drugs as described supra. In both embodiments the metastatic cancer may originate from a breast cancer, a lung cancer, a melanoma, a colorectal cancer, a prostate cancer, or a pancreatic cancer.
[0064] In yet another embodiment of the present invention there is provided a method for inhibiting RUNX2 activity in a cancer cell, comprising contacting the cancer cell with one or more of the compounds as described supra. In this embodiment the cancer cells may comprise a breast cancer, an osteosarcoma, an ovarian cancer, a prostate cancer, a melanoma, a Ewing sarcoma, a pancreatic cancer, a thyroid cancer, a leukemia, a head/neck cancer, a colorectal cancer, a liver cancer, a lung, a pituitary cancer, a gliomas, an esophageal cancer, or a multiple myeloma.
[0065] Provided herein are compounds or inhibitory compounds effective to inhibit RUNX2 activity in a cancer. The compounds may have the general chemical structure of:
##STR00010##
or may be a suitable pharmacologically effective salt thereof. Generally, R.sub.1, R.sub.2 and R.sub.3 substituents may comprise independently, hydrogen, a halogen, a haloalkyl, a short chain alkyl, an alkylamide, a cycloalkylamide or an alkylamine. In non-limiting examples the alkyl moiety is a such as a C.sub.1-3 alkyl chain and the cycloalkyl moiety is a such as a C.sub.5-7 ring. The R.sub.4 substituent is a bridged cycloalkenyl ring for example, but not limited to, a cyclohexene ring with a small alkyl bridge, such as a methylene bridge. Optionally, the bridge may be substituted with a small cycloalkyl ring, such as a cyclopropane ring. The compounds of the present invention encompass homologs, bioisosteres and/or positional isomers of the general chemical structure.
[0066] For example, the inhibitory compound may be 3-(N-(3,4-dichlorophenyl)carbamoyl)-5-norbornene-2-carboxylic acid (compound 1) and have the chemical structure of:
##STR00011##
This compound may be utilized as a lead compound to screen for chemically-related analogs, such as, but not limited to, analogs with a high homology. Screening methods for drug analogs are well-known in the art. Particularly, compound 1 of the present invention is depicted in
[0067] Also provided are pharmaceutical compositions of the RUNX2 inhibitory compounds. As is known and standard in the art, the inhibitory compounds are formulated with, although not limited to, a pharmacologically acceptable carrier, diluent or excipient. The phrase pharmaceutically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains an inhibitory compound and/or additional drug will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference.
[0068] These carriers include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, gels (e.g., gelatin), dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
[0069] The inhibitory compounds described herein and other RUNX2 inhibitors may be administered orally or parenterally. An oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. A composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.
[0070] For parenteral administration, in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof.
[0071] The inhibitory compounds and compositions described herein may be used to treat one or more types of cancers. These RUNX2 inhibitory compounds, compositions and methods have one or more benefits over existing treatments. While many of the working examples are described for the treatment of breast cancer, such as luminal breast cancer, a person having ordinary skill in the art would readily understand that the teachings provided herein can be used to treat other types of cancer including but not limited to osteosarcoma, breast, ovarian, prostate, melanoma, Ewing sarcoma, pancreatic, thyroid, leukemia, head/neck, colorectal, liver, lung, pituitary, gliomas, esophageal, and multiple myeloma. Moreover, these inhibitory compounds and compositions may be used to target and treat metastases or metastatic cancers, such as, but not limited to, metastases originating from breast cancer, lung cancer, melanoma, colorectal cancer, prostate cancer, and pancreatic cancer or other. As such, these inhibitory compounds and compositions inhibit or decrease metastasis or the incidence of metastasis by decreasing migration of cancer cells from the cancer.
[0072] The inhibitory compounds and compositions described herein may be administered independently or in combination with one or more known drugs, such as cancer drugs or anti-cancer agents. Examples of cancer drugs are Herceptin, Lapatinib, and DECMA1 antibody. A non-limiting dosage range for compound 1 for example is about 1 mg/kg and 20 mg/kg.
[0073] Generally, it is known in the art that a dosage amount or therapeutically effective amount of an inhibitory compound and/or other known drug or pharmaceutical compositions of the present invention administered to a human or animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of cancer being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0074] The following example(s) are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.
Example 1
Methods and Materials
Cell Culture
[0075] The MCF7 breast cancer cell line with inducible RUNX2 expression (ER+ MCF7) was prepared using the BD Tet-Off System (BD Biosciences). RUNX2 MCF7 cells are ER+ and express wild type p53, PTEN, c-myc, and ras, but do not express p16. MCF7 cells containing tTA (Tetracycline-controlled transactivator) regulatory vector (G418 resistant) were purchased from Clontech (Mountain View, Calif.), infected with retroviral vectors expressing RUNX2, and selected with 200 g/ml hygromycin B. Cells were frozen within three passages and maintained in DMEM (Corning) containing 10% Tet-Approved FBS (Clontech) and the antibiotics G418 (100 g/ml; Sigma), hygromycin B (200 g/ml; Roche), and doxycycline (2 g/ml; Sigma) to repress RUNX2 expression (+Dox). To express RUNX2, cells were grown in the same media but in the absence of doxycycline (Dox) for 72 hours to achieve maximal RUNX2 protein levels. T47D and HCC1428 luminal breast cancer cells were obtained from ATCC (Manassas, Va.) and were a gift from Dr. Stuart Martin (University of Maryland). They were maintained in RPMI (Corning) containing 10% FBS (Gemini; #100-106) with 1% Pen/Strep (Gemini; #400-109). T47D luminal breast cancer cells was also supplemented with 0.2Units/mL bovine insulin (Sigma; #10516). To validate EMT markers, the triple negative Hs578t cells were obtained from ATCC (Manassas, Va.) and maintained in DMEM (Corning) supplemented with 5% FBS (Gemini) and 1% Pen/Strep (Gemini). MDA-MB-231-Luc-Hyg (231-Luc) and MCF7-tet-off-Luc-Puro cells stably expressing firefly luciferase (Luc) were cloned under hygromycin (250 g/ml) and puromycin (0.5 g/ml) selection, respectively. The bioluminescence intensities in 231-Luc and MCF7-tet-off-Luc (Doxy) were over 600 and 900-fold higher than those in parental MDA-231 and MCF7-tet-off (Doxy), respectively indicating that the bioluminescence intensity of these cells was sufficient for in vivo bioluminescence imaging analysis.
Suspension CultureTumorsphere Formation
[0076] MCF7 Tet.OFF cells were grown in the presence (+Dox, RUNX2 negative) or absence (Dox, RUNX2 positive) of doxycycline for 3 days. Cells were then scraped and counted. 60,000 cells were plated in each well of a 6-well ultra-low attachment plate (Corning; 3471) in Promocell Basal Medium (Promocell; c-22211) complete with Supplement Mix (Promocell; c-39216). Cells were then treated with or without 2 ng/mL TGF (R&D Systems; 240-B-002). After growth for 10-15 days, wells were photographed and tumorsphere diameters were measured from photographic images (mm). Colony diameters were calculated using the formula: (L+W)/2. Representative photographs were obtained at 4 magnification. Other treatments included: 50 M compound 1 (ChemBridge Corporation; 5221975), 20 g/mL DECMA-1 (Sigma-Aldrich; U3254), 10 g/mL Herceptin (replenished every 2-3 days; the University of Maryland Marlene and Stuart Greenebaum Cancer Center), and 1 M Lapatinib (kind gift from Dr. Anne Hamburger at the University of Maryland Baltimore). For TAZ siRNA knockdown experiments, TAZ siRNA was transfected (as below) into MCF7 Tet.OFF cells and 24 hr later cells were scraped and placed into suspension as described above. Small-Interfering RNA (siRNA) pool targeting RUNX1, RUNX2, and non-targeting control were purchased from Dharmacon, and transfected into cells using RNAiMAX Reagent (Invitrogen). Western blot analysis was performed 48 hrs after transfection.
Western Blot and Antibody Protocols
[0077] MCF7 cells were grown to subconfluence in the presence or absence of doxycycline for 72 hr in full media as described above. Cells were then treated in minimal DMEM (Sigma, D5030) containing 0.1% BSA, 1% L-glutamine, 2% Tet-Approved FBS, and 1 mM glucose for 16 hours followed by treatment with 2 ng/mL TGF (R&D Systems, 240-B-002) for 48 hours in the presence or absence of EGTA to examine sE-Cad expression levels, TAZ localization, and HER2 expression levels. Cells were washed with PBS and scraped from plates. Cytoplasmic and nuclear lysates were obtained using the Low/High Salt extraction method [50]. Cytoplasmic extracts were obtained by resuspending cells in NP40 containing Hypotonic Buffer (10 mM HEPES pH 7.4, 1.5 mM MgCl.sub.2, 10 mM KCl, 0.5% NP40) followed by a 30 min incubation on ice and centrifugation. Nuclear extracts were obtained by resuspending the nuclear pellet in an equal volume of low salt buffer (10 mM HEPES, 25% glycerol, 1.5 mM MgCl.sub.2, 20 mM KCl, 0.2 mM EDTA) followed by high salt buffer (10 mM HEPES, 25% glycerol, 1.5 mM MgCl.sub.2, 800 mM KCl, 0.2 mM EDTA) followed by vortexing, 30 min incubation on ice, another vortex, and centrifugation. Samples were resolved on 4-12% Bis-Tris polyacrylamide gradient gels (Invitrogen) and transferred to PVDF membranes (Millipore). Membranes were probed with antibodies listed below followed by development with enhanced ECL (Millipore). Proteins were visualized using antibodies recognizing: E-Cadherin (Abcam, HECD-1, ab1416), YAP/TAZ (Cell Signaling, D24E4, #8418), FLAG antibody (from Dr. Chen-Yong Lin at Georgetown University, Washington D.C.), RUNX2 (Cell Signaling, D1L7F, #12556), HER2 (Santa Cruz, C-18, sc-284), ER- (Santa Cruz, G-20, sc-544), N-Cadherin (Abcam, ab18203), Vimentin (Santa Cruz, V9, sc-6260), Histone H2A (Cell Signaling, #2578), -actin (Sigma/Aldrich), GAPDH (Cell Signaling, 14C10, #2118), and YAP (Novus Biologicals). Protein levels were normalized to actin and quantified using NIH Image-J software.
Immunoprecipitation/Co-Immunoprecipitation Assay (IP/Co-IP)
[0078] Conditioned media was collected from MCF7 cells cultured in the presence (RUNX2 negative) or absence (RUNX2 positive) of doxycycline in minimal DMEM (Sigma, D5030) containing 0.1% BSA, 1% L-glutamine, 2% Tet-Approved FBS, and 1 mM glucose for 16 hours followed by treatment with 2 ng/mL TGF (R&D Systems, 240-B-002) for 48 hours. Conditioned Media was carefully removed from cells and remaining cellular debris was pelleted briefly by centrifugation. Conditioned Media protein levels were estimated using the Bradford assay. 200 g of protein was suspended in 200 L Co-IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.5% NP-40) and precleared in 20 L of a 50% slurry of Protein G-Sepharose (GE Healthcare, 17-0618-01) for 30 minutes. Precleared supernatants were then incubated overnight with 0.5 g of E-Cadherin antibody (Abcam, HECD-1, ab1416). Protein G-Sepharose was added for 1 hour and the precipitated complexes were washed with Co-IP buffer. Proteins were eluted from the beads using 0.1M Glycine buffer (pH 2.5), treated with 1SDS loading buffer containing -mercaptoethanol, and heated at 97 C. for 10 min. Samples were resolved on a 4-12% Bis-Tris polyacrylamide gel (Invitrogen) and transferred to PVDF membranes (Millipore). Immunoblots were probed for E-Cadherin (Abcam, HECD-1, ab1416) followed by development with enhanced ECL (Millipore).
[0079] To test for RUNX2 and TAZ protein interaction, nuclear lysates were obtained using NucBuster (Novagen) from MCF7 cells grown in full media or cultured in the presence (RUNX2 negative) or absence (RUNX2 positive) of doxycycline in minimal DMEM (Sigma, D5030) containing 0.1% BSA, 1% L-glutamine, 2% Tet-Approved FBS, and 1 mM glucose and 2 ng/mL TGF for 4 and 24 hours. Briefly, 400 g of protein was resuspended in Co-IP buffer to a final volume of 200 L. Lysates were precleared with 35 L of a 50% slurry of Protein G-Sepharose (GE Healthcare) for 1 hr. Precleared nuclear lysates were then incubated with 4 L of YAP/TAZ antibody (Cell Signaling) overnight. Protein G-Sepharose was added for 1 hour and the precipitated complexes were washed with Co-IP buffer. Proteins were eluted from the beads using 0.1M Glycine buffer (pH 2.5), treated with 1SDS loading buffer containing -mercaptoethanol, and heated at 97 C. for 10 min. Samples were resolved on a 4-12% Bis-Tris polyacrylamide gel (Invitrogen) and transferred to PVDF membranes (Millipore). Immunoblots were probed for RUNX2 (Cell Signaling, D1L7F, #12556), and YAP/TAZ (Cell Signaling, D24E4, #8418) followed by development with enhanced ECL (Millipore). To visualize the TAZ protein band a conformation specific rabbit secondary antibody was used (Cell Signaling, L27A9, #5127). Rabbit IgG and beads alone were used as Co-IP controls.
siRNA Mediated Knockdown of TAZ
[0080] TAZ knockdown was performed in MCF7 Tet.OFF cells using Custom 23mer desalted siRNA oligonucleotides from Sigma and a Universal Scrambled Negative Control siRNA Duplex from Origene (Catalog No. SR30004): TAZ siRNA #1: 5-GACA UGAGAUCCAUCACUAUU-3 (SEQ ID NO: 1), TAZ siRNA #2: 5-GGACAAACACCCAU GAACAUU-3 (SEQ ID NO: 2) and TAZ siRNA #3: 5-AAGCCUAGCUCGUGGCGGAUU-3 (SEQ ID NO: 3). Briefly, MCF7 Tet.OFF cells were grown in the absence or presence of doxycycline for 3 days and then transfected with corresponding siRNA's using Lipofectamine-2000 (Life Technologies). RIPA extracts were obtained 48 hr post transfection and total protein was analyzed by Western blot (see above) and probed for TAZ protein expression. Protein levels were normalized to actin and quantified using NIH Image-J software.
[0081] To assay for sE-Cad levels, MCF7 Tet.OFF cells were grown in the absence or presence of doxycycline for 3 days and then transfected with TAZ siRNA #1 using Lipofectamine-2000. Cells were trypsinized, replated 24 hours later, and allowed to reattach. After 72 hours, nuclear and cytoplasmic extracts were obtained using the High/Low salt extraction method described above and analyzed for sE-Cad, TAZ, and RUNX2. Protein levels were normalized to actin and quantified using NIH Image-J software.
Drug Treatments with Compound 1
[0082] The compound 1 (MF=C.sub.15H.sub.13Cl.sub.2NO.sub.3) has a molecular weight of 326.175, a high Log P value of 3.25 (logarithm of its partition coefficient between n-octanol and water, a measure of the compound's hydrophilicity with low hydrophilicity=high Log P), a low Log SW of 4.35 (measure of aqueous solubility), three rotatable bonds, a hydrogen bonding donor/acceptor ratio of 2/3 (Hdon/Hacc), a polar surface area of 66.4 (tPSA; indicative of good cell membrane permeability), and an IC50 of 10 nM in D-ELISA DNA binding assays. MCF7 Tet.OFF cells were pretreated in the absence or presence of doxycycline for 3 days. RUNX2 transiently transfected T47D or HCC1428 breast cancer cells were grown in media that was then replaced with full media (as listed in the cell culture section) and treated with or without 50 M compound 1. Cells were allowed to grow for 24, 48, and 72 hours. Nuclear and cytoplasmic extracts were obtained using High/Low salt extraction method and protein levels analyzed by Western blot (see above).
Attachment and Invasion Assay
[0083] Tissue culture plates were coated with Fibronectin (1 g/ml), extracellular matrix (ECM; from endothelial cells cultured to confluence and treated with 5 mM EDTA to remove cells), or with confluent endothelial cells (human bone marrow endothelial cells). MCF7.Tet.OFF cells (RUNX2 negative and RUNX2 positive cultured in the presence (+Dox, RUNX2 negative) or absence (Dox, RUNX2 positive) of doxycycline for 3 days) were added to the indicated plates for 120 min in D5030W media (Sigma) containing 0.1% FBS, 5 mM glucose, and 2 ng/ml TGF. The number of cells/field attached to Fibronectin, ECM, or endothelial monolayer was counted from 3-4 fields/well.
TCGA RUNX2 Protein Analysis
[0084] The Cancer Genome Atlas (TCGA) data was obtained from the online cbioportal (cbioportal.org/public-portal). The results shown represent protein expression and are based upon data generated by the TCGA Research Network (cancergenome.nih.gov). Briefly, cellular proteins were extracted and denatured in SDS sample buffer. After serial dilution of each sample, cell lysates were arrayed on nitrocellulose-coated slides and probed with specific RUNX2 and HRP-coupled antibodies to detect a signal by DAB colorimetric reaction. Spot densities were determined by MiroVigene, (automatic spot finding and background subtraction) and protein concentrations were determined by super curve fitting and normalized for protein loading.
DNA-Binding Enzyme-Linked Immunosorbent Assay (D-ELISA)
[0085] A microtiter plate-based D-ELISA was performed as described. Briefly, nuclear proteins were isolated from HBME-1 cells that express all three RUNX proteins and bound to double-stranded DNA oligonucleotides of human osteocalcin and MMP13 (forward primer: 5-TTC TAC CAC AAA CCA CAC TCG TTC TAC CAC AAA CCA CAC TCG TTC TAC CAC AAA CCA CAC TCG-Biotin-3, SEQ ID NO: 4 and reverse primer: 5-CGA GTG TGG TTT GTG GTA GAA CGA GTG TGG TTT GTG GTA GAA CGA GTG TGG TTT GTG GTA GAA-Biotin-3, SEQ ID NO: 5). Vehicle (0.05% DMSO) or compound 1 at different concentrations were incubated with the proteins and DNA oligonucleotide mixture in Avidin-coated 96-well plates. DNA-bound RUNX proteins were captured with specific antibodies (Cell Signaling Technologies). Primary and secondary antibody dilution was 1:500 and 1:10,000, respectively.
Chromatin Immunoprecipitation (ChIP) Assay
[0086] ChIP was performed using a kit (Cell Signaling Technologies) as per manufacturer's instructions. Briefly, cells were crosslinked with 1% formaldehyde and 1.5 mmol/L ethylene glycol bis[succinimidylsuccinate] at room temperature. Crosslinked chromatin was subsequently harvested, sheared, and precipitated with RUNX2 antibody or nonspecific IgG control (Cell Signaling Technologies). Precipitated DNA was treated with proteinase K, purified and processed for PCR, and amplified PCR products (99 bp) were visualized in 4% agarose gel. Fold enrichment of precipitated DNA over input chromatin was determined in triplicate by quantitative-PCR. PCR primers were designed to amplify regions on the MMP13 proximal promoter region adjacent to the TSS where the Runt binding element resides. Forward primer: 5-GGT TTT GAG ACC CTG CTG AA-3, SEQ ID NO: 6 (229 bp209 bp) and Reverse primer: 5-CGT GGC GAC TTT TTC TTT TC-3, SEQ ID NO: 7, (150 bp131 bp).
Cell Growth Assay
[0087] Cells were plated on 96-well (30,000 cells/well) or 24-well plates (50,000 cells/well). After CADD522 (0100 M) addition, cells were incubated for 2472 hrs. Cells were stained with crystal violet (0.5% in Methanol:Acetic Acid=3:1) and washed with PBS. Crystal violet was solubilized in DMSO and measured in a microplate reader at 592 nm.
Cell Cycle Analysis
[0088] Cells (110.sup.6 cells/ml) were starved in serum-free medium for 24 hrs, and released in 10% serum-medium with or without compound 1 (50 M) for 1624 hrs for cell cycle transition. Cells were then fixed in 70% ethanol at 4 C. for 1 hr, resuspended in 1 ml PBS containing 20 g/ml propidium iodide, 20 g/ml RNase A, incubated for 30 min at room temperature, and analyzed with a Becton Dickinson LSR-II at the Flow Cytometry Core Laboratory at the University of Maryland. Ten thousand events per sample were collected and analyzed using the Cell-Quest (BD Biosciences).
Caspase 3/7 Assay
[0089] Cells were cultured in 96-well plates (30,000 cells/well). After compound 1 treatment for 2472 hrs, cellular apoptosis was analyzed using the Caspase-Glo 3/7 Assay kit (Promega) according to the manufacturer's instructions.
Clonogenic Survival Assay
[0090] Cells were plated on 6-well plates (200500 cells/well). After compound 1 (50 M) treatment, cells were incubated for 23 weeks without changing media. Colonies were fixed in Methanol-Acetic Acid solution (3:1) and stained with crystal violet (0.5%). After washing, colonies were photographed and counted.
Anchorage-Independent Cell Growth Assay
[0091] Cells (10,000) were mixed in 1 ml of 0.3% low-melting agarose over a 0.6% agar bottom layer in normal growth media. The medium (600 l) with or without compound 1 (50 M) on soft agar was changed three times a week for 23 weeks. Images of MDA-231 and MCF7 were taken using Nikon Eclipse TE-2000S microscope with Zen Pro image software, and of MDA-468 using Olympus CKX41 microscope with Q-Capture Pro 7 image software at indicated magnifications under the same exposure settings for corresponding vehicle and drug treatments.
Tumorsphere Assay
[0092] Single cell suspensions (100,000 cells/well) were plated in 6-well ultra-low attachment plates (Corning) with 5 ml of EGM-2 supplemented with bullet kit (Lonza) and 2% FBS. compound 1 (50 M) was added at the day of the plating or 4 days after plating. Tumorspheres were continuously photographed for 18 days and counted at the final day. Spheres were counted at 9 fields per well and averaged from triplicate.
Cell Invasion Assay
[0093] MCF7-tet-off cells were grown in the media with (+Doxy) or without doxycycline (Dox) for 72 hours. Cells were then treated with compound 1 (50 M) for 24 hrs, and trypsinized and suspended in serum-free media. Cells were re-plated in the top chamber precoated with 0.1BME (Cultrex), and growth medium supplemented with 10% FBS was used as a chemoattractant in the bottom chamber. compound 1 was added to both chambers and incubated for 16 hrs. Cellular invasion was analyzed according to the 96 Well BME Cell Invasion Assay protocol (Cultrex).
Cell-Electrode Impedance Invasion Assay (xCELLigence System)
[0094] Real-time monitoring of cellular invasion was examined using an electrical impedance assay with an xCELLigence RTCA SP real-time cell-sensing device (Roche Applied Science). Matrigel (20 l of 0.5 mg/ml) was pre-coated in the upper chamber of CIM plates and polymerized for 4 h and MDA-231 cells (75,000) were seeded onto wells containing growth medium with vehicle (0.1% DMSO) or compound 1 (50 M). Impedance-based signals were measured every 5 minutes for 48 hrs according to the manufacturer's instructions. The invasive activity is expressed as the cell index (meanSD) of duplicate wells. Three independent experiments were performed. In parallel, MDA-231 cells were plated onto wells with serum-free medium and the assay was performed.
Luciferase-Promoter Reporter Assays
[0095] Cells were plated in 96-well plates (30,000 cells/well) and incubated overnight. Cells were co-transfected with indicated luciferase-reporter plasmids (25 ng/well) and pSV-Renilla-Luc (Promega) (15 ng/well) for 6 hrs and compound 1 (0100 mM) was further treated for 1848 hrs. COX-2 (P2-274)-Luc (170 bp+104 bp) and control plasmids (PXP2-Luc) were kindly provided by Dr. Miguel A. Iiguez (Universidad Autnoma de Madrid, Spain), and pNF-kb-Luc was from Dr. Hancai Dan (University of Maryland). Luciferase assay was performed using the Dual-Glo Luciferase Assay Systems as per manufacturer's recommendation (Promega).
Quantitative Real Time-RT-PCR (Q-RT-PCR)
[0096] Total RNA was extracted using TRIzol (Life Technologies). One g of total RNA was reverse transcribed with oligo-(dT) primer using the SuperScript first-strand synthesis system (Invitrogen) to synthesize cDNA. One l of each cDNA was used for real-time RT-PCR using QuantiFast SYBR Green PCR Kit (Promega). mRNA expression of gene of interest relative to -actin was calculated based on the threshold cycle (C.sub.t) as 2.sup.D(DCt) method. Primer sequences are listed in Table 1.
TABLE-US-00001 TABLE1 Q-RT-PCRPrimers Forward(5-3) Reverse(5-3) RUNX1 TGTCGGTCGAAGTGGAAGAGGGAA AGCTCCCGGGCTTGGTCTGA (SEQIDNO:8) (SEQIDNO:9) RUNX2 TGCCTGCCTGGGGTCTGTA CGGGCCCTCCCTGAACTCT (SEQIDNO:10) (SEQIDNO:11) VEGF CTTGCCTTGCTGCTCTAC TGGCTTGAAGATGTACTCG (SEQIDNO:12) (SEQIDNO:13) Glut-1 CGGGCCAAGAGTGTGCTAAA TGACGATACCGGAGCCAATG (SEQIDNO:14) (SEQIDNO:15) LDHA ATTCAGCCCGATTCCGTTAC GACACCAGCAACATTCATTCC (SEQIDNO:16) (SEQIDNO:17) SIRT6 AAGTTCGACACCACCTTTGAGAGC ACGTACTGCGTCTTACACTTGGCA (SEQIDNO:18) (SEQIDNO:19) MT1- CTAAGACCTTGGGAGGAAAAC AAGCCCCATCCAAGGCTAACA MMP (SEQIDNO:20) (SEQIDNO:21) MMP2 CTTCTTCAAGGACCGGTTCAT GCTGGCTGAGTAGATCCAGTA (SEQIDNO:22) (SEQIDNO:23) MMP9 GGGACGCAGACATCGTCATC TCGTCATCGTCGAAATGGGC (SEQIDNO:24) (SEQIDNO:25) MMP13 TAACCGTATTGTTCGCGTCA TCCAGCCACGCATAGTCATA (SEQIDNO:26) (SEQIDNO:27) BSP AAAGTGAGAACGGGGAACCTR GATGCAAAGCCAGAATGGAT (SEQIDNO:28) (SEQIDNO:29) OC ACACTCCTCGCCCTATTG GATGTGGTCAGCCAACTC (SEQIDNO:30) (SEQIDNO:31) OPN TTGCAGTGATTTGCTTTTGC GTCATGGCTTTCGTTGGACT (SEQIDNO:32) (SEQIDNO:33) -actin TGGCACCACACCTCTACAATGAGC GCACAGCTTCTCCTTAATGTCACGC (SEQIDNO:34) (SEQIDNO:35)
Western Blot Analysis
[0097] Whole cell lysates extracted in RIPA buffer (Upstate) were separated on 4-12% gradient SDS-PAGE and transferred to nitrocellulose membrane. The blots were incubated with specific antibodies for each protein overnight at 4 C. After antibody washing, the blots were reacted with their respective secondary antibody and detected with enhanced chemiluminescence reagents (Millipore) according to the supplier's protocol. Antibodies for proteins were purchased as below. RUNX1, RUNX2, CBF-, ubiquitin and caspase-3 (Cell Signaling Technologies), S451-p-RUNX2 (Bioss Gentaur, Belgium), RUNX3 and Glut-1 (Millipore, CA), -actin and RUNX2 antibody for IHC (Sigma-Aldrich), and Ki-67 for IHC (Bethyl Laboratories, Inc, TX).
Glucose Consumption and Lactate Production
[0098] For measurement of glucose level, cells (100,000/well) were plated in 24-well plates and incubated overnight. Cells were treated with compound 1 (50 M) in phenol red-free growth medium and further incubated for 6 hrs or 24 hrs. The culture medium was collected and filtered through a 0.22 m pore membrane. Glucose level in the medium was measured using Amplex Red Glucose/Glucose Oxidase Assay Kit (Invitrogen) as per manufacturer's instructions. For lactate level, cells were treated with compound 1 for 24 hrs, and the medium was washed and replaced with HEPES-buffered Krebs-Ringer solution (Boston BioProducts) supplemented with 10 mM Glucose. Cells were incubated for 30 min, and the medium was collected and filtered through a 0.22 m pore membrane. Lactate level in the medium was measured using Lactate Assay Kit (Sigma-Aldrich) as per manufacturer's instructions. Cell growth assays using crystal violet staining were performed to verify equal number of cells and no significant difference was found in 24 hrs of compound 1 treatment (data not shown).
In Vivo Animal Studies and Immunohistochemical (IHC) Analysis
[0099] Animal maintenance and experimental protocols are in accordance with the guidelines of the University of Maryland's Institutional Animal Care and Use Committee. Results from the maximum tolerated dose (MTD) test performed prior to the in vivo study showed that doses of compound 1 up to 20 mg/kg mice for 2 weeks in athymic nude mice had no detectable influence on body weight or the general health of animals (data not shown).
[0100] For the MMTV polyoma middle T antigen (PyMT) mouse model, female mice were purchased from Jackson Laboratory. As mice developed first palpable mammary tumors after 5 weeks of age, mice were randomly assigned to 4 treatment groups at 6 weeks of age and received i.p. injections of compound 1 (1, 5 and 20 mg/kg/group) or equivalent volumes of vehicle (10% DMSO/90% PBS) (200 l) twice a week. Palpable tumors were monitored every 1 to 2 days until 12 weeks of age to determine tumor incidence (number of tumors per mouse) and onset (the age of palpable tumors). Tumor weight was quantified at the final day after mice were euthanized and tumors were excised. Tumor volume [(lengthwidth.sup.2)/2] was measured by caliper.
[0101] For the PDX models, Br-001 tumor fragments derived from a patient with TNBC (University of Maryland, Translational Core Facility) were inoculated subcutaneously in female NOD scid gamma (NSG) mice (P1). After P1 tumors were grown, tumors were excised, fragmented and inoculated to a new group of NSG mice (P2). After P2 tumors were grown, they were excised, fragmented, and inoculated into nude mice (P3). When the size of the tumors reached 200250 mm.sup.3, mice were randomized into two groups, and received i.p. injection of vehicle or compound 1 (10 mg/kg) twice a week for 11 days.
[0102] To compare RUNX2 expression, protein lysates of normal mammary gland and mammary tumor samples were isolated from age-matched wild-type and MMTV-PyMT transgenic mice, respectively. Tumor tissues were dissected and processed for preparation of FFPE sections. After hematoxylin and eosin (H&E) staining was performed on each sample, IHC analysis was performed with specific antibodies recognizing RUNX2, Ki-67 (proliferation), caspase-3 (apoptosis), and Vector ABC kit (avidin-biotin-HRP) was used for detection.
[0103] For in vivo lung metastasis assay, MCF7-tet-off-Luc cells were grown for 3 days in the absence of Doxycyclin (Doxy) and injected into the tail vein of the 8 week-old female NSG mice (110.sup.6 cells/200 l of PBS). After inoculation, the mice were randomly assigned to vehicle control and treatment groups. Vehicle (10% DMSO/90% PBS) and compound 1 (10 mg/kg) were injected i.p. 2 hrs after inoculation. The retention of the cells in the lung was monitored by noninvasive bioluminescence imaging for 24 hrs. For luciferase detection, 150 mg/mL D-luciferin (Caliper Life Sciences) in PBS was injected i.p. before imaging. Photometric measurement of metastasis was done by living Image software (Xenogen). In separate groups of mice, 231-Luc cells (110.sup.6/200 l of PBS) were injected, and the metastasis burden in the lung was quantified for 3 weeks.
Statistical Analysis
[0104] Results from cell culture assays were expressed as the meanSD from at least three independent experiments. Comparisons of quantitative data between two groups were analyzed using the two-tailed Student's t-test. For in vivo study, data were expressed as the meanSE. Multiple comparisons were followed by Mann-Whitney non parametrical tests. All statistical analyses were conducted using STATA version 14 (STATA Inc., College Station, Tex.). P values less than 0.05 were considered significant.
Example 2
RUNX2 Inhibitor Compounds and Analogs
[0105] The lead compound 1, 3-(N-(3,4-Dichlorophenyl)Carbamoyl)-5-Norbornene-2-Carboxylic Acid (
[0106] Ten 3D analogs (
[0107] Compound 1 was validated in DNA binding assays to inhibit RUNX2 binding to its cognate DNA-binding domain It exhibits an IC50=10 nM in D-ELISA DNA binding assays. A best-fit model predicts interaction with the tail, wing, and other adjacent residues of the Runx2 DNA-binding (Runt) domain (
Example 3
RUNX2 Activity in MCF7 Breast Cancer Cells
RUNX2 Protein Levels in Breast Cancer Patients
[0108] RUNX2 protein levels were examined in patients diagnosed with early stage luminal breast cancer (
Oncogenic Function of RUNX2
[0109] RUNX2 was expressed in the luminal breast cancer cell line, MCF7, under the control of a Tet.OFF promoter. RUNX2 expression increased attachment to extracellular matrix and fibronectin, and invasion through an endothelial cell monolayer (
Example 4
Compound 1 Suppresses In Vitro Breast Cancer (BC) Cell Growth and Survival
[0110] To determine the effect of compound 1 on cell viability and growth, breast cancer cells (MDA-MB-468, and MCF7) as well as non-malignant cells (MCF10A untransformed human mammary epithelial cells, IEC-6 undifferentiated rat intestinal cells, and GES-1 human gastric mucosal cells, and C2C12 murine myoblast cells) were treated with compound 1 (0100 M) for 2472 hrs. There was no significant inhibition in cell viability over 24 hrs (data not shown), while compound 1 displayed a dose- and time-dependent cell growth inhibition over 72 hrs (
[0111] When ectopic RUNX2-expressing MCF7 and T47D cells were treated with compound 1 for 7 days, a dramatic decrease in cell proliferation relative to vehicle controls
[0112] The effect of compound 1 on long term cell survival was further investigated in BC cells in the presence or absence of compound 1 (50 M) for 23 weeks. As shown in
[0113] Moreover, compound 1 strongly inhibited anchorage-independent cell growth of BC cells (
Example 5
Compound 1 Inhibits Tumorsphere Formation and In Vitro Invasion of Breast Cancer (BC) Cells
Tumorsphere Growth is RUNX2 Dependent
[0114] Compound 1 was used to treat MCF7 cells in suspension. Compound 1 significantly decreased the diameter of RUNX2 positive MCF7 tumorspheres (17.215.28 to 4.831.87; p<0.001), an almost 4-fold inhibition relative to vehicle-treated cells (
Compound 1 Reduces Tumorsphere Size and Number
[0115] Even without TGF-, MCF7-tet-off (Doxy) cells (
Compound 1 Reduces Breast Cancer Cell Invasiveness
[0116] To investigate if compound 1 impairs the invasive phenotype of the BC cells, in vitro cell invasion assays in 3D-culture were performed using both 96-well basement membrane extract (BME) cell invasion assay and xCELLigence System (the cell-electrode impedance invasion assay). The MCF7-tet-off (+Doxy) and -off (Doxy) cells were plated on BME-coated wells and incubated in the presence or absence of compound 1 for 24 hrs. Cellular invasion was promoted by RUNX2 induced by removal of Doxycycline (Doxy). However, compound 1 almost abrogated the invasiveness of both MCF7-tet-off (+Doxy) and MCF7-tet-off (Doxy) cells (
Example 6
Compound 1 Inhibits RUNX2 Transcriptional Activity
Inhibition of Activity in RUNX2 Expressing Breast Cancer Cells
[0117] Compound 1 treatment of ectopic RUNX2-expressing BC cells (T47D-RUNX2 and MCF7-RUNX2) resulted in a dramatic decrease of the promoter-luciferase (Luc) activities of RUNX2 downstream target genes such as MMP13 and VEGF (metastasis markers) (
[0118] To determine if compound 1 could inhibit transcriptional activities of other transcription factors that do not belong to the RUNX family, the gene reporter analysis was performed with COX-2 and NF-b promoter constructs without Runt binding sequences. The activity of the COX-2 P2-274-Luc showed 2-fold increase in MCF7-RUNX2 cells compared to MCF7-Empty cells, which might be through indirect action of RUNX2 (
Compound 1 Inhibits RUNX2-DNA Binding
[0119] Consistent with these observations, compound 1 modulated the mRNA levels of RUNX2 responsive genes such as Glut-1, LDHA, and Sirt6 that regulate glucose metabolism, MMP-2, MMP-9, MMP13 and MT1-MMP that regulate tumor invasion/metastasis, and BSP, OPN and OC that regulate osteogenic differentiation. As shown in
Compound 1 and Inhibition of Glut-1 Expression in Breast Cancer Cells
[0120] RUNX2 promoted glucose metabolism during BC progression by increasing glucose uptake and expression of genes regulating glycolytic pathways such as Glut-1. To examine if compound 1 modulates glycolytic phenotypes of BC cells, the levels of glucose and lactate in the cell culture medium were examined. Glucose levels significantly decreased in the medium collected from MCF7-RUNX2 and T47D-RUNX2 cells compared to those in Empty controls (i.e., increased glucose consumption/uptake) (
Example 7
Compound 1 Upregulates RUNX2 Levels Through Increased RUNX2 Stability
[0121] The RUNX1 levels from the sample sets prepared from the same batches of cDNAs and protein lysates in which the determined RUNX2 levels were examined. As shown in
[0122] Since compound 1 inhibited the transcriptional activation of RUNX2 downstream genes, it is contemplated that compound 1 alters RUNX1 and/or RUNX2 levels. T47D-RUNX2 and MCF7-RUNX2 cells were treated with compound 1 (50 M) for 72 hrs and Western blot analysis was run to determine RUNX2 expression. Unexpectedly, compound 1 further enhanced both mRNA and protein expression of RUNX2 (
[0123] Studies have suggested that the non-DNA-binding subunit of mammalian core binding factor CBF- stabilizes the RUNX proteins in a conformation that is favorable for DNA binding, which facilitates RUNX-mediated gene transcription. Therefore, compound 1 might regulate CBF- expression to inhibit transcriptional activity of RUNX2. The protein level of CBF- decreased in Hs578t (55.5) and MDA-231 cells with RUNX2 KD compared to the non-targeting controls, whereas the level did not change in MDA-231 and BT474 cells with RUNX1 KD (
[0124] Whether compound 1 could alter RUNX2 stability was examined. MDA-468 and MDA-231 cells were treated with cycloheximide (CHX), a protein synthesis inhibitor, in the presence or absence of compound 1 (50 M). Compound 1 increased RUNX2 stability in both MDA-468 and MDA-231 cells by delaying protein degradation (
[0125] Phosphorylation is an important post-translational mechanism for regulation of RUNX2 stability and activity. It has been shown that the alanine substitution at the S451 residue (S451A) of RUNX2 reduces phosphorylation, leading to decreased DNA binding activity. cdc2 (CDK1) is known to phosphorylate RUNX2 on Ser-451 in vitro, but little is known about the functional significance and regulation of the S451 phosphorylation of RUNX2 in BC. RUNX2 KD cells (55.5) expressed higher level of S451 phosphorylation compared to the non-targeting controls (
Example 8
[0126] Therapeutic Targeting in Hippo Pathway with Compound 1
RUNX2 Inactivates the Hippo Tumor Suppressor Pathway in Luminal Breast Cancer
[0127] The Hippo tumor suppressor pathway is active in the context of stable E-Cadherin interactions that promote epithelial cell:cell polarity. Under these conditions, E-Cadherin signaling maintains TAZ localization to 14-3-3 complexes in the cytosol and eventual ubiquitination and degradation. Upon induction of oncogenic events, which include sE-Cad production and cooperation with HER2 receptors, the Hippo pathway is inactivated and in this context TGF signaling promotes TAZ translocation to the nucleus where it can interact with transcription factors, such as RUNX2, which are responsible for activation of genes that promote cell invasion, survival, and tumorsphere formation.
[0128] RUNX2 expression supported a TGF-driven oncogenic signaling pathway that involves TAZ-mediated activation of tumorsphere formation, the production of soluble E-cadherin (sE-Cad), and cooperation with HER2, which was increased in RUNX2 expressing cells. The data indicate that E-Cad stabilizes HER2 and sensitizes breast cancer cells to HER2 targeted drugs and that luminal breast cancer cells expressing RUNX2 rely on HER2 signaling to potentiate their tumorigenic phenotype. The effects on tumorsphere formation are consistent with known roles for RUNX2 and TAZ in tumor-initiating functions. These results have identified several therapeutic targets that converge on RUNX2:TAZ transcriptional regulation in breast cancer cells. The combined signaling pathways may be responsible for a transcriptional program that mediates breast cancer tumorsphere formation and anchorage-independent growth (
Role of RUNX2 Cofactor TAZ in Anchorage Independent Growth
[0129] The Hippo signaling effectors, TAZ and YAP, are important RUNX2 transcriptional cofactors that interacts with the RUNX2 C-terminal domain. YAP expression in MCF7 cells was low and levels in response to RUNX2 expression did not change in these cells (
Production of Oncogenic E-Cadherin Ectodomain (sE-Cad) is Dependent on RUNX2 and TAZ
[0130] The EMT can be regulated by RUNX2 in some breast cancer cells. However, in luminal breast cancer cells, RUNX2 did not promote the loss of E-Cadherin, the downregulation of ER or the expression of N-Cadherin and Vimentin, which are indicative of an EMT progression (
Therapeutic Targeting of sE-Cad/HER2 Signaling in RUNX2-Expressing Luminal BC Cells
[0131] The ErbB2/HER2 receptor family member is expressed in a subset of luminal breast cancer cells in the absence of gene amplification and HER2 is one of the main targets of sE-Cad. HER2 interacts with sE-Cad to promote ligand-independent cell signaling in triple negative breast cancer cells, but its role in luminal breast cancers (in the absence of gene amplification) is undefined. After 48 hr treatment with TGF, RUNX2 positive MCF7 cells expressed 2-fold higher HER2 levels than RUNX2-negative cells (
[0132] To test for functional HER2, the effect of HER2-targeted agents on tumorsphere formation was determined. The Herceptin monoclonal antibody binds the extracellular domain of HER2 and promotes receptor internalization and degradation, prevents homo/heterodimerization, and mediates antibody-dependent cellular cytotoxicity. Herceptin inhibited tumorsphere formation in RUNX2 positive MCF7 cells by 2-fold (11.914.65 to 5.762.83; p<0.001), without affecting tumorsphere formation in RUNX2 negative cells (6.252.68 to 7.23.27; p=0.145) (
Hippo Tumor Suppressor Pathway Activated by Compound 1 in Luminal Breast Cancer Cells
[0133] It was demonstrated that RUNX2 inactivates and RUNX2 inhibitors (compound 1) activate the tumor suppressor pathway Hippo signaling (
Example 9
RUNX2 Oncogenic Function Reversed and Mitochondrial Enzyme Activity Restored by Compound 1
Compound 1 Increases Pyruvate Dehydrogenase Activity (PDH)
[0134] It was shown in an antibody-specific microtiter plate assay that there is an increase in PDH activity in RUNX2 knockdown cells (
Compound 1 Increases Complex I Activity
[0135] Complex I is a rate-limiting step in oxidative phosphorylation. It was demonstrated that compound 1 increased Complex I activity in MDA-468 and MCF7 cells (
Compound 1 Increases Mitochondrial Reactive Oxygen Species (ROS) Production
[0136] The ability of mitochondria to produce reactive oxygen species is a measure of increased electron flow through the electron transport chain. It was demonstrated that MDA-231, MDA-468, MCF7 and BT474 breast cancer cells treated with compound 1 showed an increase in mitochondrial ROS production (
Example 10
Compound 1 Suppresses In Vivo Tumor Growth and Metastasis
[0137] To assess the in vivo activity of compound 1, the MMTV-PyMT transgenic model was used, in which the polyoma middle-T oncogene is activated under control of the mouse mammary tumor virus promoter (MMTV-PyMT). This model was suitable since it mimics human breast cancer from the stages of initial hyperplasia to ductal carcinoma in situ and invasive ductal carcinoma. Conditional RUNX2 deletion in the MMTV-PyMT transgenic mouse model of BC has been shown to delay tumor incidence and enhance overall survival. MMTV-PyMT females developed palpable mammary gland tumors at approximately 56 weeks of age, and high levels of RUNX2 were expressed in tumor tissues compared to normal mammary gland in age-matched control mice over 10 weeks of observation (
Cancer Cell Migration Inhibited by Compound 1
[0138] Compound 1-treated MMTV-PyMT mice exhibited significant decrease in tumor incidence compared to vehicle control animals. The incidence per mouse at the final day was 6.631.05 (meanSEM) in vehicle-treated mice, 4.140.88 in 1 mg/Kg, 3.052.57 in 5 mg/Kg (P=0.037), and 2.570.72 in 20 mg/Kg compound 1-treated group (P=0.008) (
[0139] Patient-derived tumor xenografts (PDX) are powerful pre-clinical models to recapitulate the diversity of human tumors. In a TNBC-PDX Br-001 model, RUNX2 expression was positive during continuous passage from P1 to P3 (
[0140] Bioluminescence Imaging (BLI) analysis is useful for sensitive in vivo tumor detection and quantification, and permits earlier detection of tumor growth and metastasis. To further examine the effects of compound 1 on the metastasis of breast cancer, BLI analysis was performed using BC cell lines stably expressing firefly luciferase (MCF7-tet-off-Luc (Doxy) and 231-Luc) after intravenous delivery of cells into NSG mice. MCF7-tet-off-Luc (Doxy) cells express RUNX2 when the cells are maintained without Doxycycline (Doxy). compound 1 had no influence on metastatic homing of the MCF7-tet-off-Luc (Doxy) cells to the mouse lungs (
Example 11
Combination Compound 1 and CDK Inhibitors Therapy
[0141] MDA-231 cells, which are modestly resistant to compound 1, were treated with compound 1 and the combination of a CDK2 inhibitor (SU99516), CDK4 inhibitor NSC625987 (Cdk4.I-II) or the CDK4/6 inhibitor Paloma/palbociclib (
[0142] Interestingly, MDA-468 (TNBC) cells, although very sensitive to compound 1, were resistant to CDK inhibition (
Combination Therapy with Compound 1 Analogs
[0143] To determine which compounds to choose for in vivo combination chemotherapy with CDK inhibitors, a BC cell panel of ER+ BC (MCF7; T47D) or TNBC (MDA231; Hs578t; HCC70) (Table 2) and CDK inhibitors at defined doses: CDK2i (0.1-10 M; 24-72 hr) or CDK4i (0.1-10 M; 24-48 hr) or CDK4/6i Palbociclib or Trilaciclib (0.01-1.0 M; 24-48 hr) are used. Proliferation (24-96 hr), viability (24-96 hr; Luciferase label), cell death (24-96 hr; caspase or PARP cleavage), clonogenic assays (7-14 days), and metastatic potential (invasion; 6-24 hr) are measured. MCF7 and T47D cells are used to test the effect of RUNX2 (wild-type; mutant) overexpression on GLUT1. MDA-MB-231, Hs578t, and MDA-MB-468 cells are used for RUNX2 gene knockdown approaches. MDA-MB-231 also are used for lung metastasis assays.
TABLE-US-00002 TABLE 2 Clinically relevant cell lines for testing combination therapy BC Type: Luminal TNBC HER2+ ER+ ER+ ER RUNX2.sup.Low RUNX2+ RUNX2++ RUNX2+/ Cells: MCF7 HCC1428 MDA-MB-231 BT474 (ER+) T47D MDA-MB-468 SkBr3 (ERneg) Hs578t; MDA-MB-361 HCC1937 (ER+) HCC70; BT20; BT549
[0144] Specific single doses of the CDKi are tested in combination with compound 1 or analog compound dose responses. If the IC50 of a particular compound=x, 0, 0.25, 0.5, 1, 2.5, 5 dose increments are chosen for combination treatments. Quantitative measurements of cell number over time for each compound analog dose are determined in triplicate SD and p-values <0.05 are considered significant. Data analysis considers synergistic versus additive or antagonistic criteria The CompuSyn program evaluates drug response in translational studies using these criteria. p.RUNX2, CBF levels, and pRb are monitored to confirm that drug treatments alter RUNX2 activity and pRb phosphorylation, which is a substrate of CDK4/6 kinases.
[0145] CDK4/6 inhibitors Palbociclib or Trilaciclib (G1T28) are administered to athymic nude mice bearing BC PDX tumors by oral gavage (25-200 mg/kg formulated in vehicle, 2/wk). Compound 1 and compound analogs 2-10 (1-20 mg/kg, 5/wk, i.p.) selected from cell culture experiments also are administered for treatment. The University of Maryland collection (UMD-PDX) currently consists of three TNBC (Br-001, Br-002, Br-003) and one ER+/PR+/HER2+specimen (Br-004, luminal B) banked from tumors grown in mammary fat pads of NSG mice. Five Huntsman Cancer Institute tumors (HCl-PDX) consist of: HCl-001 (TNBC basal-like), HCl-003 (luminal B, ER+, HER2neg), HCl-004 (TNBC basal-like), HCl-008 (basal-like, HER2+), HCl-009 (TNBC) and are maintained at the University of Maryland. The Champions Oncology (CO-PDX) samples are from a collection of eleven TNBC, five HER2+, and three ER+available tumors (Champions Oncology; Baltimore, Md.). These different PDX experiments are used to examine if compound 1 analogs are predictive of clinical response. CADD compounds (2-10 mg/kg) will be administered i.p. 3-5 times weekly for up to 8 weeks. Tumors will be monitored by caliper measurements and isolated, weighed, and processed at the end of the experiment for IHC and Western blotting with specific antibodies (Ki67, RUNX2, p.RUNX2, GLUT1 (membrane, intracellular)5, MMP13, cleaved caspase-3 (Cell Signaling; #9661), and pRb (CDK biomarker)). As observed for both PDX and PyMT models, proliferative index (Ki67 expression) and RUNX2 levels in vivo, will evaluate drug efficacy.
[0146] ER+ BC cells overexpressing RUNX2 (MCF7.RUNX2, T47D.RUNX2) are more invasive than cells expressing low levels of RUNX2. Therefore, these ER+ and the TNBC expressing RUNX2 (MDA-231, Hs578t, HCC70) are useful to examine the effects of drug combinations on in vitro invasion with chambers or the continuously monitored xCELLigence system (Acea Biosciences, Inc). Dosing profiles are as for proliferation assays. Selected compounds from compounds 1-10 combined with Palbociclib or Trilaciclib are tested in the PyMT-GEM model of BC, which allows assessment of spontaneous ER+ BC tumor growth and lung metastasis. As defined for PDX tumors, the ability of the combination treatments to inhibit MDA-231 (TNBC) and MCF7.RUNX2 (ER+) lung metastatic potential (Luciferase-labeled cells) is quantified via tail-vein experimental metastasis assays. Since Palbociclib (CDK4/6 inhibitor) is indicated clinically for ER+tumors, the ER+metastatic model provides an accurate baseline for the efficacy of combination CDK and RUNX2 targeted treatments relative to TNBC cells.
[0147] The following references were cited herein. [0148] 1. Eroles et al., Cancer Treat Rev 2012; 38:698-707. [0149] 2. Cadoo et al., Q J Nucl Med Mol Imaging 2013; 57:312-321. [0150] 3. Siegel et al., 2013. CA Cancer J Clin 2013; 63:11-30. [0151] 4. Foley et al., Semin Cell Dev Biol 2010; 21:951-960. [0152] 5. Ganapathy et al., Clin Exp Metastasis 2012; 29: 493-509. [0153] 6. Ithimakin et al., Cancer Res 2013; 73:1635-1646. [0154] 7. Ferrari et al., J Cell Physiol 2013; 228:1137-1142. [0155] 8. McDonald et al., Dis Model Mech 2014. [0156] 9. Das et al., Eur J Cancer 2009; 45:2239-2248. [0157] 10. Onodera et al., Cancer Sci 2010; 101:2670-2675. [0158] 11. Barnes et al., Cancer Res 2004; 64:4506-4513. [0159] 12. Pratap et al., Mol Cell Biol 2005; 25:8581-8591. [0160] 13. Pratap et al., Cancer Metastasis Rev 2006; 25:589-600. [0161] 14. Yagi et al., Embo J 1999; 18:2551-2562. [0162] 15. Cui et al., Mol Cell Biol 2003; 23:1004-1013. [0163] 16. Vitolo et al., Cancer Biol Ther 2007; 6:856-863. [0164] 17. Varelas et al., Nat Cell Biol 2008; 10:837-848. [0165] 18. Cordenonsi et al., Cell 2011; 147:759-772. [0166] 19. Hiemer et al., J Biol Chem 2014; Mar. 27. [0167] 20. Kim J et al., Proc Natl Acad Sci USA 2012; 109:6124-6129. [0168] 21. Liu et al., Int J Biochem Mol Biol 2011; 2:247-256. [0169] 22. Chan et al., Cancer Res 2008; 68:2592-2598. [0170] 23. Lei et al., Mol Cell Biol 2008; 28:2426-2436. [0171] 24. Matteucci et al., Eur J Cancer 2013; 49:231-244. [0172] 25. Lee et al., J Cell Biol 2006; 172:973-981. [0173] 26. Thiery et al., Cell 2009; 139:871-890. [0174] 27. Valastyan et al., Cell 2011; 147: 275-292. [0175] 28. Hollestelle et al., Breast Cancer Res Treat 2013; 138: 47-57. [0176] 29. David et al., Cancer Res 2012; 72:2917-2923. [0177] 30. Grabowska et al., Front Biosci (Landmark Ed) 2012; 17:1948-1964. [0178] 31. Chunthapong et al., J Cell Biochem 2004; 91 649-661. [0179] 32. Inge et al., Exp Cell Res 2011; 317:838-848. [0180] 33. Kuefer et al., Clin Cancer Res 2003; 9:6447-6452. [0181] 34. Najy et al., J Biol Chem 2008; 283:18393-18401. [0182] 35. Brouxhon et al., Clin Cancer Res 2013; 19:3234-3246. [0183] 36. Brouxhon et al., Mol Carcinog 2013. [0184] 37. Hofmann et al., Clin Biochem 2013; 46:1585-1589. [0185] 38. Kuefer et al., Br J Cancer 2005; 92:2018-2023. [0186] 39. Turner et al., Semin Cancer Biol 2012; 22:374-378. [0187] 40. Underwood et al., J Vis Exp 2013; Issue 78. [0188] 41. Qiao et al., J Biol Chem 2006; 281:7118-7128. [0189] 42. Rajgopal et al., J Cell Biochem 2007; 100:1509-1517. [0190] 43. Chimge et al., Breast Cancer Res 2011; 13:R127. [0191] 44. St. Croix et al., J Cell Biol 1998; 142:557-571. [0192] 45. Nahta et al., Nat Clin Pract Oncol 2006; 3:269-280. [0193] 46. Berman et al., Cancer Prev Res (Phila) 2010; 3:579-587. [0194] 47. Chimge et al., Clin Cancer Res 2012; 18:901-911. [0195] 48. Chimge et al., Oncogene 2013; 32:2121-2130. [0196] 49. Yeh et al., Curr Opin Oncol 2013; 25:652-658. [0197] 50. Underwood et al., J Bone Min Res 2012; 27:913-925. [0198] 51. Frangou et al., Oncotarget 2014; 5: 2166-12176. [0199] 52. Onder et al., Cancer Res 2008; 68:3645-3654. [0200] 53. Choe et al., J Cell Biochem. 2015; 116: 2210-2226.
[0201] In the foregoing specification the invention has been described with reference to specific embodiments thereof. It will, however, be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention. The specification and drawings are, accordingly, to be regarded in an illustrative rather than a restrictive sense.