Yeast organism producing isobutanol at a high yield
09926577 ยท 2018-03-27
Assignee
Inventors
- Reid M. Renny Feldman (San Marino, CA, US)
- Uvini GUNAWARDENA (Irvine, CA, US)
- Jun Urano (Aurora, CO)
- Peter Meinhold (Denver, CO)
- Aristos Aristidou (Highlands Ranch, CO)
- Catherine Asleson Dundon (Englewood, CO)
- Christopher SMITH (Englewood, CO, US)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y101/01008
CHEMISTRY; METALLURGY
C12Y101/05003
CHEMISTRY; METALLURGY
C12N9/1022
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12Y402/01009
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides recombinant microorganisms comprising an isobutanol producing metabolic pathway and methods of using said recombinant microorganisms to produce isobutanol. In various aspects of the invention, the recombinant microorganisms may comprise a modification resulting in the reduction of pyruvate decarboxylase and/or glycerol-3-phosphate dehydrogenase activity. In various embodiments described herein, the recombinant microorganisms may be microorganisms of the Saccharomyces clade, Crabtree-negative yeast microorganisms, Crabtree-positive yeast microorganisms, post-WGD (whole genome duplication) yeast microorganisms, pre-WGD (whole genome duplication) yeast microorganisms, and non-fermenting yeast microorganisms.
Claims
1. A recombinant yeast microorganism for producing isobutanol, the recombinant yeast microorganism comprising an isobutanol producing metabolic pathway, wherein said isobutanol producing metabolic pathway comprises the following substrate to product conversions: (i) pyruvate to acetolactate; (ii) acetolactate to 2,3-dihydroxyisovalerate; (iii) 2,3-dihydroxyisovalerate to -ketoisovalerate; (iv) -ketoisovalerate to isobutyraldehyde; and (v) isobutyraldehyde to isobutanol; wherein the recombinant yeast microorganism expresses (a) a heterologous acetolactate synthase (ALS) to catalyze the conversion of pyruvate to acetolactate; (b) a heterologous ketol-acid reductoisomerase to catalyze the conversion of acetolactate to 2,3-dihydroxyisovalerate; (c) a heterologous dihydroxyacid dehydratase to catalyze the conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate; (d) an heterologous -ketoisovalerate decarboxylase to catalyze the conversion of -ketoisovalerate to isobutyraldehyde; and (e) an heterologous alcohol dehydrogenase to catalyze the conversion of isobutyraldehyde to isobutanol; wherein the recombinant yeast microorganism has been engineered to: (A) disrupt, mutate, or delete one or more endogenous pyruvate decarboxylase (PDC) genes, wherein said recombinant yeast microorganism has reduced endogenous PDC activity as compared to the corresponding yeast microorganism that has not been engineered to have reduced endogenous PDC activity; and (B) disrupt, mutate, or delete one or more endogenous glycerol-3-phosphate dehydrogenase (GPD) genes, wherein said recombinant yeast microorganism has reduced endogenous GPD activity as compared to the corresponding yeast microorganism that has not been engineered to have reduced endogenous GPD activity; and wherein the recombinant yeast microorganism produces isobutanol at a yield which is at least 70% of the theoretical yield of isobutanol from glucose.
2. The recombinant yeast microorganism of claim 1, wherein all endogenous PDC genes and all endogenous GPD genes are disrupted, mutated, or deleted.
3. The recombinant yeast microorganism of claim 1, wherein said one or more endogenous PDC genes are selected from the group consisting of PDC1, PDC2, PDC5, and PDC6.
4. The recombinant yeast microorganism of claim 1, wherein said one or more endogenous GPD genes are selected from the group consisting of GPD1 and GPD2.
5. The recombinant yeast microorganism of claim 1, wherein said acetolactate synthase (ALS) is a cytosolically-localized acetolactate synthase (ALS).
6. The recombinant yeast microorganism of claim 5, wherein said cytosolically-localized acetolactate synthase (ALS) is encoded by the Lactococcus lactis alsS gene.
7. The recombinant yeast microorganism of claim 5, wherein said cytosolically-localized acetolactate synthase (ALS) is encoded by the Bacillus subtilis alsS gene.
8. The recombinant yeast microorganism of claim 1, wherein said recombinant yeast microorganism has been engineered to disrupt or delete an endogenous pyruvate dehydrogenase (PDH) gene.
9. The recombinant yeast microorganism of claim 1, wherein said heterologous -ketoisovalerate decarboxylase is obtained from Lactococcus lactis.
10. The recombinant yeast microorganism of claim 1, wherein said recombinant yeast microorganism is a yeast of a genus selected from the group consisting of Saccharomyces, Kluyveromyces, Candida, Pichia, Hansenula, and Schizosaccharomyces.
11. The recombinant yeast microorganism of claim 1, wherein said ketol-acid reductoisomerase is an NADH-dependent ketol-acid reductoisomerase.
12. The recombinant yeast microorganism of claim 1, wherein said recombinant yeast microorganism has an increased capacity to produce acetolactate as compared to the corresponding yeast microorganism that has not been engineered to have reduced endogenous PDC activity and reduced endogenous GPD activity.
13. The recombinant yeast microorganism of claim 1, wherein said alcohol dehydrogenase is an NADH-dependent alcohol dehydrogenase.
14. A method of producing isobutanol, comprising: (a) providing a recombinant yeast microorganism according to claim 1; (b) cultivating the microorganism in a culture medium containing a feedstock providing the carbon source, until the isobutanol is produced; and (c) recovering the isobutanol.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1) Illustrative embodiments of the invention are illustrated in the drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
DETAILED DESCRIPTION
(43) As used herein and in the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a polynucleotide includes a plurality of such polynucleotides and reference to the microorganism includes reference to one or more microorganisms, and so forth.
(44) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.
(45) Any publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.
(46) The term microorganism includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms microbial cells and microbes are used interchangeably with the term microorganism.
(47) Bacteria, or eubacteria, refers to a domain of prokaryotic organisms. Bacteria include at least 11 distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (Actinomycetes, Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic+non-photosynthetic Gram-negative bacteria (includes most common Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant micrococci and relatives; (11) Thermotoga and Thermosipho thermophiles.
(48) Gram-negative bacteria include cocci, nonenteric rods, and enteric rods. The genera of Gram-negative bacteria include, for example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia, Francisella, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides, Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirilla, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and Fusobacterium.
(49) Gram positive bacteria include cocci, nonsporulating rods, and sporulating rods. The genera of gram positive bacteria include, for example, Actinomyces, Bacillus, Clostridium, Corynebacterium, Erysipelothrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus, and Streptomyces.
(50) The term genus is defined as a taxonomic group of related species according to the Taxonomic Outline of Bacteria and Archaea (Garrity, G. M., Lilburn, T. G., Cole, J. R., Harrison, S. H., Euzeby, J., and Tindall, B. J. (2007) The Taxonomic Outline of Bacteria and Archaea. TOBA Release 7.7, March 2007. Michigan State University Board of Trustees.
(51) The term species is defined as a collection of closely related organisms with greater than 97% 16S ribosomal RNA sequence homology and greater than 70% genomic hybridization and sufficiently different from all other organisms so as to be recognized as a distinct unit.
(52) The term recombinant microorganism, modified microorganism, and recombinant host cell are used interchangeably herein and refer to microorganisms that have been genetically modified to express or over-express endogenous polynucleotides, or to express heterologous polynucleotides, such as those included in a vector, or which have an alteration in expression of an endogenous gene. By alteration it is meant that the expression of the gene, or level of a RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or activity of one or more polypeptides or polypeptide subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the alteration. For example, the term alter can mean inhibit, but the use of the word alter is not limited to this definition.
(53) The term expression with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein results from transcription and translation of the open reading frame sequence. The level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired product encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantitated by PCR or by northern hybridization (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). Protein encoded by a selected sequence can be quantitated by various methods, e.g., by ELISA, by assaying for the biological activity of the protein, or by employing assays that are independent of such activity, such as western blotting or radioimmunoassay, using antibodies that are recognize and bind reacting the protein. See Sambrook et al., 1989, supra. The polynucleotide generally encodes a target enzyme involved in a metabolic pathway for producing a desired metabolite. It is understood that the terms recombinant microorganism and recombinant host cell refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
(54) The term wild-type microorganism describes a cell that occurs in nature, i.e. a cell that has not been genetically modified. A wild-type microorganism can be genetically modified to express or overexpress a first target enzyme. This microorganism can act as a parental microorganism in the generation of a microorganism modified to express or overexpress a second target enzyme. In turn, the microorganism modified to express or overexpress a first and a second target enzyme can be modified to express or overexpress a third target enzyme.
(55) Accordingly, a parental microorganism functions as a reference cell for successive genetic modification events. Each modification event can be accomplished by introducing a nucleic acid molecule in to the reference cell. The introduction facilitates the expression or overexpression of a target enzyme. It is understood that the term facilitates encompasses the activation of endogenous polynucleotides encoding a target enzyme through genetic modification of e.g., a promoter sequence in a parental microorganism. It is further understood that the term facilitates encompasses the introduction of heterologous polynucleotides encoding a target enzyme in to a parental microorganism
(56) The term engineer refers to any manipulation of a microorganism that result in a detectable change in the microorganism, wherein the manipulation includes but is not limited to inserting a polynucleotide and/or polypeptide heterologous to the microorganism and mutating a polynucleotide and/or polypeptide native to the microorganism. The term metabolically engineered or metabolic engineering involves rational pathway design and assembly of biosynthetic genes, genes associated with operons, and control elements of such polynucleotides, for the production of a desired metabolite. Metabolically engineered can further include optimization of metabolic flux by regulation and optimization of transcription, translation, protein stability and protein functionality using genetic engineering and appropriate culture condition including the reduction of, disruption, or knocking out of, a competing metabolic pathway that competes with an intermediate leading to a desired pathway.
(57) The terms metabolically engineered microorganism and modified microorganism are used interchangeably herein and refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
(58) The term mutation as used herein indicates any modification of a nucleic acid and/or polypeptide which results in an altered nucleic acid or polypeptide. Mutations include, for example, point mutations, deletions, or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genetic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, an insertion, or a deletion of part or all of a gene. In addition, in some embodiments of the modified microorganism, a portion of the microorganism genome has been replaced with a heterologous polynucleotide. In some embodiments, the mutations are naturally-occurring. In other embodiments, the mutations are the results of artificial selection pressure. In still other embodiments, the mutations in the microorganism genome are the result of genetic engineering.
(59) The term biosynthetic pathway, also referred to as metabolic pathway, refers to a set of anabolic or catabolic biochemical reactions for converting one chemical species into another. Gene products belong to the same metabolic pathway if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate (i.e., metabolite) between the same substrate and metabolite end product.
(60) The term heterologous as used herein with reference to molecules and in particular enzymes and polynucleotides, indicates molecules that are expressed in an organism other than the organism from which they originated or are found in nature, independently of the level of expression that can be lower, equal or higher than the level of expression of the molecule in the native microorganism.
(61) On the other hand, the term native or endogenous as used herein with reference to molecules, and in particular enzymes and polynucleotides, indicates molecules that are expressed in the organism in which they originated or are found in nature, independently of the level of expression that can be lower equal or higher than the level of expression of the molecule in the native microorganism. It is understood that expression of native enzymes or polynucleotides may be modified in recombinant microorganisms.
(62) The term feedstock is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. For example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a biofuel in a fermentation process. However, a feedstock may contain nutrients other than a carbon source.
(63) The term substrate or suitable substrate refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term substrate encompasses not only compounds that provide a carbon source suitable for use as a starting material, such as any biomass derived sugar, but also intermediate and end product metabolites used in a pathway associated with a metabolically engineered microorganism as described herein.
(64) The term C2-compound as used as a carbon source for engineered yeast microorganisms with mutations in all pyruvate decarboxylase (PDC) genes resulting in a reduction of pyruvate decarboxylase activity of said genes refers to organic compounds comprised of two carbon atoms, including but not limited to ethanol and acetate.
(65) The term fermentation or fermentation process is defined as a process in which a microorganism is cultivated in a culture medium containing raw materials, such as feedstock and nutrients, wherein the microorganism converts raw materials, such as a feedstock, into products. The term cell dry weight or CDW refers to the weight of the microorganism after the water contained in the microorganism has been removed using methods known to one skilled in the art. CDW is reported in grams.
(66) The term biofuel refers to a fuel in which all carbon contained within the fuel is derived from biomass and is biochemically converted, at least in part, in to a fuel by a microorganism. A biofuel is further defined as a non-ethanol compound which contains less than 0.5 oxygen atoms per carbon atom. A biofuel is a fuel in its own right, but may be blended with petroleum-derived fuels to generate a fuel. A biofuel may be used as a replacement for petrochemically-derived gasoline, diesel fuel, or jet fuel.
(67) The term volumetric productivity or production rate is defined as the amount of product formed per volume of medium per unit of time. Volumetric productivity is reported in gram per liter per hour (g/L/h).
(68) The term specific productivity or specific production rate is defined as the amount of product formed per volume of medium per unit of time per amount of cells. Volumetric productivity is reported in gram or milligram per liter per hour per OD (g/Lh/OD).
(69) The term yield is defined as the amount of product obtained per unit weight of raw material and may be expressed as g product per g substrate (g/g). Yield may be expressed as a percentage of the theoretical yield. Theoretical yield is defined as the maximum amount of product that can be generated per a given amount of substrate as dictated by the stoichiometry of the metabolic pathway used to make the product. For example, the theoretical yield for one typical conversion of glucose to isobutanol is 0.41 g/g. As such, a yield of isobutanol from glucose of 0.39 gig would be expressed as 95% of theoretical or 95% theoretical yield.
(70) The term titer is defined as the strength of a solution or the concentration of a substance in solution. For example, the titer of a biofuel in a fermentation broth is described as g of biofuel in solution per liter of fermentation broth (g/L).
(71) A facultative anaerobic organism or a facultative anaerobic microorganism is defined as an organism that can grow in either the presence or in the absence of oxygen.
(72) A strictly anaerobic organism or a strictly anaerobic microorganism is defined as an organism that cannot grow in the presence of oxygen and which does not survive exposure to any concentration of oxygen.
(73) An anaerobic organism or an anaerobic microorganism is defined as an organism that cannot grow in the presence of oxygen.
(74) Aerobic conditions are defined as conditions under which the oxygen concentration in the fermentation medium is sufficiently high for an aerobic or facultative anaerobic microorganism to use as a terminal electron acceptor.
(75) In contrast, Anaerobic conditions are defined as conditions under which the oxygen concentration in the fermentation medium is too low for the microorganism to use as a terminal electron acceptor. Anaerobic conditions may be achieved by sparging a fermentation medium with an inert gas such as nitrogen until oxygen is no longer available to the microorganism as a terminal electron acceptor. Alternatively, anaerobic conditions may be achieved by the microorganism consuming the available oxygen of the fermentation until oxygen is unavailable to the microorganism as a terminal electron acceptor. Methods for the production of isobutanol under anaerobic conditions are described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527), the disclosures of which are herein incorporated by reference in their entireties for all purposes.
(76) Aerobic metabolism refers to a biochemical process in which oxygen is used as a terminal electron acceptor to make energy, typically in the form of ATP, from carbohydrates. Aerobic metabolism occurs e.g. via glycolysis and the TCA cycle, wherein a single glucose molecule is metabolized completely into carbon dioxide in the presence of oxygen.
(77) In contrast, anaerobic metabolism refers to a biochemical process in which oxygen is not the final acceptor of electrons contained in NADH. Anaerobic metabolism can be divided into anaerobic respiration, in which compounds other than oxygen serve as the terminal electron acceptor, and substrate level phosphorylation, in which the electrons from NADH are utilized to generate a reduced product via a fermentative pathway.
(78) In fermentative pathways, NAD(P)H donates its electrons to a molecule produced by the same metabolic pathway that produced the electrons carried in NAD(P)H. For example, in one of the fermentative pathways of certain yeast strains, NAD(P)H generated through glycolysis transfers its electrons to acetaldehyde, yielding ethanol. Fermentative pathways are usually active under anaerobic conditions but may also occur under aerobic conditions, under conditions where NADH is not fully oxidized via the respiratory chain. For example, above certain glucose concentrations, Crabtree-positive yeasts produce large amounts of ethanol under aerobic conditions.
(79) The term byproduct or by-product means an undesired product related to the production of a biofuel or biofuel precursor. Byproducts are generally disposed as waste, adding cost to a production process.
(80) The term substantially free when used in reference to the presence or absence of enzymatic activities (PDC, GPD, PDH, etc.) in carbon pathways that compete with the desired metabolic pathway (e.g. an isobutanol-producing metabolic pathway) means the level of the enzyme is substantially less than that of the same enzyme in the wild-type host, wherein less than about 50% of the wild-type level is preferred and less than about 30% is more preferred. The activity may be less than about 20%, less than about 10%, less than about 5%, or less than about 1% of wild-type activity.
(81) The term non-fermenting yeast is a yeast species that fails to demonstrate an anaerobic metabolism in which the electrons from NADH are utilized to generate a reduced product via a fermentative pathway such as the production of ethanol and CO.sub.2 from glucose. Non-fermentative yeast can be identified by the Durham Tube Test (J. A. Bamett, R. W. Payne, and D. Yarrow. 2000. Yeasts Characteristics and Identification. 3 edition. p. 28-29. Cambridge University Press, Cambridge, UK.) or by monitoring the production of fermentation productions such as ethanol and CO.sub.2.
(82) The term polynucleotide is used herein interchangeably with the term nucleic acid and refers to an organic polymer composed of two or more monomers including nucleotides, nucleosides or analogs thereof, including but not limited to single stranded or double stranded, sense or antisense deoxyribonucleic acid (DNA) of any length and, where appropriate, single stranded or double stranded, sense or antisense ribonucleic acid (RNA) of any length, including siRNA. The term nucleotide refers to any of several compounds that consist of a ribose or deoxyribose sugar joined to a purine or a pyrimidine base and to a phosphate group, and that are the basic structural units of nucleic acids. The term nucleoside refers to a compound (as guanosine or adenosine) that consists of a purine or pyrimidine base combined with deoxyribose or ribose and is found especially in nucleic acids. The term nucleotide analog or nucleoside analog refers, respectively, to a nucleotide or nucleoside in which one or more individual atoms have been replaced with a different atom or with a different functional group. Accordingly, the term polynucleotide includes nucleic acids of any length, DNA, RNA, analogs and fragments thereof. A polynucleotide of three or more nucleotides is also called nucleotidic oligomer or oligonucleotide.
(83) It is understood that the polynucleotides described herein include genes and that the nucleic acid molecules described herein include vectors or plasmids. Accordingly, the term gene, also called a structural gene refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise all or part of one or more proteins or enzymes, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. The transcribed region of the gene may include untranslated regions, including introns, 5-untranslated region (UTR), and 3-UTR, as well as the coding sequence.
(84) The term operon refers to two or more genes which are transcribed as a single transcriptional unit from a common promoter. In some embodiments, the genes comprising the operon are contiguous genes. It is understood that transcription of an entire operon can be modified (i.e., increased, decreased, or eliminated) by modifying the common promoter. Alternatively, any gene or combination of genes in an operon can be modified to alter the function or activity of the encoded polypeptide. The modification can result in an increase in the activity of the encoded polypeptide. Further, the modification can impart new activities on the encoded polypeptide. Exemplary new activities include the use of alternative substrates and/or the ability to function in alternative environmental conditions.
(85) A vector is any means by which a nucleic acid can be propagated and/or transferred between organisms, cells, or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), and the like, that are episomes, that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as an agrobacterium or a bacterium.
(86) Transformation refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a number of means including chemical transformation (e.g. lithium acetate transformation), electroporation, microinjection, biolistics (or particle bombardment-mediated delivery), or agrobacterium mediated transformation.
(87) The term enzyme as used herein refers to any substance that catalyzes or promotes one or more chemical or biochemical reactions, which usually includes enzymes totally or partially composed of a polypeptide, but can include enzymes composed of a different molecule including polynucleotides.
(88) The term protein, peptide, or polypeptide as used herein indicates an organic polymer composed of two or more amino acidic monomers and/or analogs thereof. As used herein, the term amino acid or amino acidic monomer refers to any natural and/or synthetic amino acids including glycine and both D or L optical isomers.
(89) The term amino acid analog refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, or with a different functional group. Accordingly, the term polypeptide includes amino acidic polymer of any length including full length proteins, and peptides as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called a protein oligomer or oligopeptide
(90) The term homolog, used with respect to an original enzyme or gene of a first family or species, refers to distinct enzymes or genes of a second family or species which are determined by functional, structural or genomic analyses to be an enzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Most often, homologs will have functional, structural or genomic similarities. Techniques are known by which homologs of an enzyme or gene can readily be cloned using genetic probes and PCR. Identity of cloned sequences as homolog can be confirmed using functional assays and/or by genomic mapping of the genes.
(91) A protein has homology or is homologous to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has homology to a second protein if the two proteins have similar amino acid sequences. (Thus, the term homologous proteins is defined to mean that the two proteins have similar amino acid sequences).
(92) The term analog or analogous refers to nucleic acid or protein sequences or protein structures that are related to one another in function only and are not from common descent or do not share a common ancestral sequence. Analogs may differ in sequence but may share a similar structure, due to convergent evolution. For example, two enzymes are analogs or analogous if the enzymes catalyze the same reaction of conversion of a substrate to a product, are unrelated in sequence, and irrespective of whether the two enzymes are related in structure.
(93) As used herein and as would be understood by one of ordinary skill in the art, reduced activity and/or expression of an endogenous protein such an enzyme can mean either a reduced specific catalytic activity of the protein (e.g. reduced activity) and/or decreased concentrations of the protein in the cell (e.g. reduced expression), while deleted activity and/or expression of an endogenous protein such an enzyme can mean either no or negligible specific catalytic activity of the enzyme (e.g. deleted activity) and/or no or negligible concentrations of the enzyme in the cell (e.g. deleted expression).
(94) The term reduced pyruvate decarboxylase activity means either a decreased concentration of the pyruvate decarboxylase enzyme in the cell or reduced or no specific catalytic activity of the pyruvate decarboxylase enzyme.
(95) The term reduced glycerol-3-phosphate dehydrogenase activity means either a decreased concentration of the glycerol-3-phosphate dehydrogenase enzyme in the cell or reduced or no specific catalytic activity of the glycerol-3-phosphate dehydrogenase enzyme.
(96) The term reduced pyruvate dehydrogenase activity means either a decreased concentration of the pyruvate dehydrogenase enzyme in the cell or reduced or no specific catalytic activity of the pyruvate dehydrogenase enzyme.
(97) The term reduced xylose reductase activity means either a decreased concentration of the xylose reductase enzyme in the cell or reduced or no specific catalytic activity of the xylose reductase enzyme.
(98) The term reduced xylitol dehydrogenase activity means either a decreased concentration of xylitol dehydrogenase enzyme in the cell or reduced or no specific catalytic activity of the xylitol dehydrogenase enzyme.
(99) The Microorganism in General
(100) Native producers of 1-butanol, such as Clostridium acetobutylicum, are known, but these organisms also generate byproducts such as acetone, ethanol, and butyrate during fermentations. Furthermore, these microorganisms are relatively difficult to manipulate, with significantly fewer tools available than in more commonly used production hosts such as E. coli and yeast (e.g. S. cerevisiae).
(101) Yeast cells produce pyruvate from sugars, which is then utilized in a number of pathways of cellular metabolism. Yeast cells can be engineered to produce a number of desirable products with the initial biosynthetic pathway step being conversion of endogenous pyruvate to acetolactate. The present inventors have observed that by combining the expression of a cytosolically localized acetolactate synthase enzyme with reduced pyruvate decarboxylase (PDC) activity and/or reduced glycerol-3-phosphate dehydrogenase (GPD) activity, an unexpectedly high flux from pyruvate to acetolactate can be achieved. Thus, the invention provides yeast cells that are engineered to exhibit an efficient conversion of pyruvate to acetolactate in the cytoplasm due to suppression of competing metabolic pathways. Therefore, as would be understood in the art, the present invention has utility for the production of any acetolactate-derived product, including, but not limited to, isobutanol, 2-butanol, 1-butanol, 2-butanone, 2,3-butanediol, valine, leucine, and 3-methyl-1-butanol.
(102) Engineered biosynthetic pathways for synthesis of isobutanol are described in commonly owned and co-pending applications U.S. Ser. No. 12/343,375 (published as US 2009/0226991), U.S. Ser. No. 12/696,645, U.S. Ser. No. 12/610,784, PCT/US09/62952 (published as WO/2010/051527), and PCT/US09/69390, all of which are herein incorporated by reference in their entireties for all purposes. Additional pathways have been described for the synthesis of 1-butanol (See, e.g., commonly owned U.S. Provisional Application Nos. 60/940,877 and 60/945,576, as well as WO/2010/017230 and WO/2010/031772), 2-butanol (See, e.g., WO/2007/130518, WO/2007/130521, and WO/2009/134276), 2-butanone (See, e.g., WO/2007/130518, WO/2007/130521, and WO/2009/134276), 2,3-butanediol (See, e.g., WO/2007/130518, WO/2007/130521, and WO/2009/134276), valine (See, e.g., WO/2001/021772, and McCourt et al., 2006, Amino Acids 31: 173-210), leucine (See, e.g., WO/2001/021772, and McCourt et al., 2006, Amino Acids 31: 173-210), pantothenic acid (See, e.g., WO/2001/021772), and 3-methyl-1-butanol (See, e.g., WO/2008/098227, Atsumi et al., 2008, Nature 451: 86-89, and Connor et al., 2008, Appl. Environ. Microbiol. 74: 5769-5775). Each of these pathways shares the common intermediate acetolactate. Therefore, the product yield from these biosynthetic pathways will in part depend upon the amount of acetolactate that is available to downstream enzymes of said biosynthetic pathways.
(103) In various embodiments described herein, the present invention provides recombinant microorganisms that comprise an isobutanol producing metabolic pathway. Recombinant microorganisms provided herein can express a plurality of heterologous and/or native target enzymes involved in pathways for the production isobutanol from a suitable carbon source.
(104) Accordingly, metabolically engineered or modified microorganisms are produced via the introduction of genetic material into a host or parental microorganism of choice and/or by modification of the expression of native genes, thereby modifying or altering the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material and/or the modification of the expression of native genes the parental microorganism acquires new properties, e.g. the ability to produce a new, or greater quantities of, an intracellular metabolite. As described herein, the introduction of genetic material into and/or the modification of the expression of native genes in a parental microorganism results in a new or modified ability to produce isobutanol. The genetic material introduced into and/or the genes modified for expression in the parental microorganism contains gene(s), or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of isobutanol and may also include additional elements for the expression and/or regulation of expression of these genes, e.g. promoter sequences.
(105) In addition to the introduction of a genetic material into a host or parental microorganism, an engineered or modified microorganism can also include alteration, disruption, deletion or knocking-out of a gene or polynucleotide to alter the cellular physiology and biochemistry of the microorganism. Through the alteration, disruption, deletion or knocking-out of a gene or polynucleotide the microorganism acquires new or improved properties (e.g., the ability to produce a new metabolite or greater quantities of an intracellular metabolite, improve the flux of a metabolite down a desired pathway, and/or reduce the production of byproducts).
(106) Recombinant microorganisms provided herein may also produce metabolites in quantities not available in the parental microorganism. A metabolite refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g., isobutanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.
(107) Exemplary metabolites include glucose, pyruvate, and isobutanol. The metabolite isobutanol can be produced by a recombinant microorganism metabolically engineered to express or over-express a metabolic pathway that converts pyruvate to isobutanol. An exemplary metabolic pathway that converts pyruvate to isobutanol may be comprised of an acetohydroxy acid synthase (ALS), a ketolacid reductoisomerase (KARI), a dihyroxy-acid dehydratase (DHAD), a 2-keto-acid decarboxylase (KIVD), and an alcohol dehydrogenase (ADH). Exemplary metabolic pathways that convert pyruvate to isobutanol are disclosed in WO/2007/050671, WO/2008/098227, and Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9.
(108) Accordingly, provided herein are recombinant microorganisms that produce isobutanol and in some aspects may include the elevated expression of target enzymes such as ALS, KARI, DHAD, KIVD, and ADH.
(109) The disclosure identifies specific genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutation and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme using methods known in the art.
(110) Due to the inherent degeneracy of the genetic code, other polynucleotides which encode substantially the same or functionally equivalent polypeptides can also be used to clone and express the polynucleotides encoding such enzymes.
(111) As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Codons can be substituted to reflect the preferred codon usage of the host, a process sometimes called codon optimization or controlling for species codon bias.
(112) Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host (see also, Murray et al. (1989) Nucl. Acids Res. 17:477-508) can be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. coli commonly use UAA as the stop codon (Dalphin et al. (1996) Nucl. Acids Res. 24: 216-218). Methodology for optimizing a nucleotide sequence for expression in a plant is provided, for example, in U.S. Pat. No. 6,015,891, and the references cited therein.
(113) Those of skill in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA compounds differing in their nucleotide sequences can be used to encode a given enzyme of the disclosure. The native DNA sequence encoding the biosynthetic enzymes described above are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes utilized in the methods of the disclosure. In similar fashion, a polypeptide can typically tolerate one or more amino acid substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity. The disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as they modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein merely illustrate embodiments of the disclosure.
(114) In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein.
(115) As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences have at least about 30%, 40%, 50% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In one embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, typically at least 40%, more typically at least 50%, even more typically at least 60%, and even more typically at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid identity is equivalent to amino acid or nucleic acid homology). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
(116) When homologous is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A conservative amino acid substitution is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art (see, e.g., Pearson W. R. Using the FASTA program to search protein and DNA sequence databases, Methods in Molecular Biology, 1994, 25:365-89, hereby incorporated herein by reference).
(117) The following six groups each contain amino acids that are conservative substitutions for one another: 1) Serine (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
(118) Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using measure of homology assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG contains programs such as Gap and Bestfit which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild type protein and a mutant protein thereof. See, e.g., GCG Version 6.1.
(119) A typical algorithm used comparing a molecule sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul, S. F., et al. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-410; Gish, W. and States, D. J. (1993) Identification of protein coding regions by database similarity search. Nature Genet. 3:266-272; Madden, T. L., et al. (1996) Applications of network BLAST server Meth. Enzymol. 266:131-141; Altschul, S. F., et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402; Zhang, J. and Madden, T. L. (1997) PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation. Genome Res. 7:649-656), especially blastp or tblastn (Altschul, S. F., et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402). Typical parameters for BLASTp are: Expectation value: 10 (default); Filter: seg (default); Cost to open a gap: 11 (default); Cost to extend a gap: 1 (default); Max. alignments: 100 (default); Word size: 11 (default); No. of descriptions: 100 (default); Penalty Matrix: BLOWSUM62.
(120) When searching a database containing sequences from a large number of different organisms, it is typical to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms other than blastp known in the art. For instance, polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, W. R. (1990) Rapid and Sensitive Sequence Comparison with FASTP and FASTA Meth. Enzymol. 183:63-98). For example, a percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix), as provided in GCG Version 6.1, hereby incorporated herein by reference.
(121) The disclosure provides metabolically engineered microorganisms comprising a biochemical pathway for the production of isobutanol from a suitable substrate at a high yield. A metabolically engineered microorganism of the disclosure comprises one or more recombinant polynucleotides within the genome of the organism or external to the genome within the organism. The microorganism can comprise a reduction, disruption or knockout of a gene found in the wild-type organism and/or introduction of a heterologous polynucleotide and/or expression or overexpression of an endogenous polynucleotide.
(122) In one aspect, the disclosure provides a recombinant microorganism comprising elevated expression of at least one target enzyme as compared to a parental microorganism or encodes an enzyme not found in the parental organism. In another or further aspect, the microorganism comprises a reduction, disruption or knockout of at least one gene encoding an enzyme that competes with a metabolite necessary for the production of isobutanol. The recombinant microorganism produces at least one metabolite involved in a biosynthetic pathway for the production of isobutanol. In general, the recombinant microorganisms comprises at least one recombinant metabolic pathway that comprises a target enzyme and may further include a reduction in activity or expression of an enzyme in a competitive biosynthetic pathway. The pathway acts to modify a substrate or metabolic intermediate in the production of isobutanol. The target enzyme is encoded by, and expressed from, a polynucleotide derived from a suitable biological source. In some embodiments, the polynucleotide comprises a gene derived from a prokaryotic or eukaryotic source and recombinantly engineered into the microorganism of the disclosure. In other embodiments, the polynucleotide comprises a gene that is native to the host organism.
(123) It is understood that a range of microorganisms can be modified to include a recombinant metabolic pathway suitable for the production of isobutanol. In various embodiments, microorganisms may be selected from yeast microorganisms. Yeast microorganisms for the production of isobutanol may be selected based on certain characteristics:
(124) One characteristic may include the property that the microorganism is selected to convert various carbon sources into isobutanol. The term carbon source generally refers to a substance suitable to be used as a source of carbon for prokaryotic or eukaryotic cell growth. Carbon sources include, but are not limited to, biomass hydrolysates, starch, sucrose, cellulose, hemicellulose, xylose, and lignin, as well as monomeric components of these substrates. Carbon sources can comprise various organic compounds in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, etc. These include, for example, various monosaccharides such as glucose, dextrose (D-glucose), maltose, oligosaccharides, polysaccharides, saturated or unsaturated fatty acids, succinate, lactate, acetate, ethanol, etc., or mixtures thereof. Photosynthetic organisms can additionally produce a carbon source as a product of photosynthesis. In some embodiments, carbon sources may be selected from biomass hydrolysates and glucose. The term biomass as used herein refers primarily to the stems, leaves, and starch-containing portions of green plants, and is mainly comprised of starch, lignin, cellulose, hemicellulose, and/or pectin. Biomass can be decomposed by either chemical or enzymatic treatment to the monomeric sugars and phenols of which it is composed (Wyman, C. E. 2003 Biotechnological Progress 19:254-62). This resulting material, called biomass hydrolysate, is neutralized and treated to remove trace amounts of organic material that may adversely affect the biocatalyst, and is then used as a feed stock for fermentations using a biocatalyst.
(125) Accordingly, in one embodiment, the recombinant microorganism herein disclosed can convert a variety of carbon sources to products, including but not limited to glucose, galactose, mannose, xylose, arabinose, lactose, sucrose, and mixtures thereof.
(126) The recombinant microorganism may thus further include a pathway for the fermentation of isobutanol from five-carbon (pentose) sugars including xylose. Most yeast species metabolize xylose via a complex route, in which xylose is first reduced to xylitol via a xylose reductase (XR) enzyme. The xylitol is then oxidized to xylulose via a xylitol dehydrogenase (XDH) enzyme. The xylulose is then phosphorylated via a xylulokinase (XK) enzyme. This pathway operates inefficiently in yeast species because it introduces a redox imbalance in the cell. The xylose-to-xylitol step uses NADH as a cofactor, whereas the xylitol-to-xylulose step uses NADPH as a cofactor. Other processes must operate to restore the redox imbalance within the cell. This often means that the organism cannot grow anaerobically on xylose or other pentose sugar. Accordingly, a yeast species that can efficiently ferment xylose and other pentose sugars into a desired fermentation product is therefore very desirable.
(127) Thus, in one embodiment, the recombinant is engineered to express a functional exogenous xylose isomerase. Exogenous xylose isomerases functional in yeast are known in the art. See, e.g., Rajgarhia et al, US20060234364, which is herein incorporated by reference in its entirety. In another embodiment, the exogenous xylose isomerase gene is operatively linked to promoter and terminator sequences that are functional in the yeast cell.
(128) In another embodiment, the recombinant microorganism has a deletion or disruption of a native gene that encodes for an enzyme (e.g. XR and/or XDH) that catalyzes the conversion of xylose to xylitol. Thus, in one embodiment, the recombinant microorganism is engineered to exhibit reduced xylose reductase (XR) activity. In another embodiment, the recombinant microorganism is engineered to exhibit reduced xylitol dehydrogenase (XDH) activity. In yet another embodiment, the recombinant microorganism also contains a functional, exogenous xylulokinase (XK) gene operatively linked to promoter and terminator sequences that are functional in the yeast cell. In one embodiment, the xylulokinase (XK) gene is overexpressed.
(129) In one embodiment, the microorganism has reduced or no pyruvate decarboxylase (PDC) activity. PDC catalyzes the decarboxylation of pyruvate to acetaldehyde, which is then reduced to ethanol by ADH via an oxidation of NADH to NAD+. Ethanol production is the main pathway to oxidize the NADH from glycolysis. Deletion of this pathway increases the pyruvate and the reducing equivalents (NADH) available for the isobutanol pathway. Accordingly, deletion of PDC genes further increases the yield of isobutanol.
(130) In another embodiment, the microorganism has reduced or no glycerol-3-phosphate dehydrogenase (GPD) activity. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) via the oxidation of NADH to NAD+. Glycerol is then produced from G3P by Glycerol-3-phosphatase (GPP). Glycerol production is a secondary pathway to oxidize excess NADH from glycolysis. Reduction or elimination of this pathway increases the pyruvate and reducing equivalents (NADH) available for the isobutanol pathway. Thus, deletion of GPD genes further increases the yield of isobutanol.
(131) In yet another embodiment, the microorganism has reduced or no PDC activity and reduced or no GPD activity.
(132) Another characteristic may include the property that the wild-type or parental microorganism is non-fermenting. In other words, it cannot metabolize a carbon source anaerobically while the yeast is able to metabolize a carbon source in the presence of oxygen. Non-fermenting yeast refers to both naturally occurring yeasts as well as genetically modified yeast. During anaerobic fermentation with fermentative yeast, the main pathway to oxidize the NADH from glycolysis is through the production of ethanol. Ethanol is produced by alcohol dehydrogenase (ADH) via the reduction of acetaldehyde, which is generated from pyruvate by pyruvate decarboxylase (PDC). Thus, in one embodiment, a fermentative yeast can be engineered to be non-fermentative by the reduction or elimination of the native PDC activity. Thus, most of the pyruvate produced by glycolysis is not consumed by PDC and is available for the isobutanol pathway. Deletion of this pathway increases the pyruvate and the reducing equivalents available for the isobutanol pathway. Fermentative pathways contribute to low yield and low productivity of isobutanol. Accordingly, deletion of PDC may increase yield and productivity of isobutanol.
(133) A third characteristic may include the property that the biocatalyst is selected to convert various carbon sources into isobutanol.
(134) In one embodiment, the yeast microorganisms may be selected from the Saccharomyces Yeast Clade, defined as an ascomycetous yeast taxonomic class by Kurtzman and Robnett in 1998 (Identification and phylogeny of ascomycetous yeast from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73: 331-371, See FIG. 2 of Leeuwenhoek reference). They were able to determine the relatedness of approximately 500 yeast species by comparing the nucleotide sequence of the D1/D2 domain at the 5 end of the gene encoding the large ribosomal subunit 26S. In pair-wise comparisons of the D1/D2 nucleotide sequences of S. cerevisiae and the two most distant yeast from S. cerevisiae, K. lactis and K. marxianus, share greater than 80% identity.
(135) The term Saccharomyces sensu stricto taxonomy group is a cluster of yeast species that are highly related to S. cerevisiae (Rainieri, S. et at 2003. Saccharomyces Sensu Stricto: Systematics, Genetic Diversity and Evolution. J. Biosci Bioengin 96(1)1-9. Saccharomyces sensu stricto yeast species include but are not limited to S. cerevisiae, S. cerevisiae, S. kudriavzevii, S. mikatae, S. bayanus, S. uvarum, S. carocanis and hybrids derived from these species (Masneuf et al. 1998. New Hybrids between Saccharomyces Sensu Stricto Yeast Species Found Among Wine and Cider Production Strains. Yeast 7(1)61-72).
(136) An ancient whole genome duplication (WGD) event occurred during the evolution of the hemiascomycete yeast and was discovered using comparative genomic tools (Kellis et al 2004 Proof and evolutionary analysis of ancient genome duplication in the yeast S. cerevisiae. Nature 428:617-624. Dujon et al 2004 Genome evolution in yeasts. Nature 430:35-44. Langkjaer et al 2003 Yeast genome duplication was followed by asynchronous differentiation of duplicated genes. Nature 428:848-852. Wolfe and Shields 1997 Molecular evidence for an ancient duplication of the entire yeast genome. Nature 387:708-713.) Using this major evolutionary event, yeast can be divided into species that diverged from a common ancestor following the WGD event (termed post-WGD yeast herein) and species that diverged from the yeast lineage prior to the WGD event (termed pre-WGD yeast herein).
(137) Accordingly, in one embodiment, the yeast microorganism may be selected from a post-WGD yeast genus, including but not limited to Saccharomyces and Candida. The favored post-WGD yeast species include: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, and C. glabrata.
(138) In another embodiment, the yeast microorganism may be selected from a pre-whole genome duplication (pre-WGD) yeast genus including but not limited to Saccharomyces, Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomyces, Hansenula, Yarrowia and, Schizosaccharomyces. Representative pre-WGD yeast species include: S. kluyveri, K. thermotolerans, K. marxianus, K. waltii, K. lactis, C. tropicalis, P. pastoris, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, D. hansenii, H. anomala, Y. lipolytica, and S. pombe.
(139) A yeast microorganism may be either Crabtree-negative or Crabtree-positive. A yeast cell having a Crabtree-negative phenotype is any yeast cell that does not exhibit the Crabtree effect. The term Crabtree-negative refers to both naturally occurring and genetically modified organisms. Briefly, the Crabtree effect is defined as the inhibition of oxygen consumption by a microorganism when cultured under aerobic conditions due to the presence of a high concentration of glucose (e.g., 50 g-glucose L.sup.1). In other words, a yeast cell having a Crabtree-positive phenotype continues to ferment irrespective of oxygen availability due to the presence of glucose, while a yeast cell having a Crabtree-negative phenotype does not exhibit glucose mediated inhibition of oxygen consumption.
(140) Accordingly, in one embodiment the yeast microorganism may be selected from yeast with a Crabtree-negative phenotype including but not limited to the following genera: Kluyveromyces, Pichia, Issatchenkia, Hansenula, and Candida. Crabtree-negative species include but are not limited to: K. lactis, K. marxianus, P. anomala, P. stipitis, I. orientalis, I. occidentalis, I. scutulata, H. anomala, and C. utilis.
(141) In another embodiment, the yeast microorganism may be selected from a yeast with a Crabtree-positive phenotype, including but not limited to Saccharomyces, Kluyveromyces, Zygosaccharomyces, Debaryomyces, Pichia and Schizosaccharomyces. Crabtree-positive yeast species include but are not limited to: S. cerevisiae, S. uvarum, S. bayanus, S. paradoxus, S. castelli, S. kluyveri, K. thermotolerans, C. glabrata, Z. bailli, Z. rouxii, D. hansenii, P. pastorius, and S. pombe.
(142) In some embodiments, the recombinant microorganisms may be microorganisms that are non-fermenting yeast microorganisms, including, but not limited to those, classified into a genera selected from the group consisting of Tricosporon, Rhodotorula, or Myxozyma.
(143) In one embodiment, a yeast microorganism is engineered to convert a carbon source, such as glucose, to pyruvate by glycolysis and the pyruvate is converted to isobutanol via an engineered isobutanol pathway (See, e.g., WO/2007/050671, WO/2008/098227, and Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9). Alternative pathways for the production of isobutanol have been described in WO/2007/050671 and in Dickinson et al., Journal of Biological Chemistry 273:25751-15756 (1998).
(144) Accordingly, in one embodiment, the engineered isobutanol pathway to convert pyruvate to isobutanol can be comprised of the following reactions:
(145) 1. 2 pyruvate.fwdarw.acetolactate+CO.sub.2
(146) 2. acetolactate+NAD(P)H.fwdarw.2,3-dihydroxyisovalerate+NAD(P).sup.+
(147) 3. 2,3-dihydroxyisovalerate.fwdarw.alpha-ketoisovalerate
(148) 4. alpha-ketoisovalerate.fwdarw.isobutyraldehyde+CO.sub.2
(149) 5. isobutyraldehyde+NAD(P)H.fwdarw.isobutanol+NAD(P).sup.+
(150) These reactions are carried out by the enzymes 1) Acetolactate Synthase (ALS), 2) Keto-acid Reducto-Isomerase (KARI), 3) Dihydroxy-acid dehydratase (DHAD), 4) Keto-isovalerate decarboxylase (KIVD), and 5) an Alcohol dehydrogenase (ADH).
(151) In another embodiment, the yeast microorganism is engineered to overexpress these enzymes. For example, these enzymes can be encoded by native genes. Alternatively, these enzymes can be encoded by heterologous genes. For example, ALS can be encoded by the alsS gene of B. subtilis, alsS of L. lactis, or the ilvK gene of K. pneumonia. For example, KARI can be encoded by the ilvC genes of E. coli, C. glutamicum, M. maripaludis, or Piromyces sp E2. For example, DHAD can be encoded by the ilvD genes of E. coli, C. glutamicum, or L. lactis. KIVD can be encoded by the kivD gene of L. lactis. ADH can be encoded by ADH2, ADH6, or ADH7 of S. cerevisiae.
(152) In one embodiment, pathway steps 2 and 5 may be carried out by KARI and ADH enzymes that utilize NADH (rather than NADPH) as a co-factor. Such enzymes are described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527), which are herein incorporated by reference in their entireties for all purposes. The present inventors have found that utilization of NADH-dependent KARI and ADH enzymes to catalyze pathway steps 2 and 5, respectively, surprisingly enables production of isobutanol under anaerobic conditions. Thus, in one embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent KARI to catalyze the conversion of acetolactate (+NADH) to produce 2,3-dihydroxyisovalerate. In another embodiment, the recombinant microorganisms of the present invention may use an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde (+NADH) to produce isobutanol. In yet another embodiment, the recombinant microorganisms of the present invention may use both an NADH-dependent KARI to catalyze the conversion of acetolactate (+NADH) to produce 2,3-dihydroxyisovalerate, and an NADH-dependent ADH to catalyze the conversion of isobutyraldehyde (+NADH) to produce isobutanol.
(153) The yeast microorganism of the invention may be engineered to have increased ability to convert pyruvate to isobutanol. In one embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to isobutyraldehyde. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to keto-isovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to 2,3-dihydroxyisovalerate. In another embodiment, the yeast microorganism may be engineered to have increased ability to convert pyruvate to acetolactate.
(154) Furthermore, any of the genes encoding the foregoing enzymes (or any others mentioned herein (or any of the regulatory elements that control or modulate expression thereof)) may be optimized by genetic/protein engineering techniques, such as directed evolution or rational mutagenesis, which are known to those of ordinary skill in the art. Such action allows those of ordinary skill in the art to optimize the enzymes for expression and activity in yeast.
(155) In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed for the modulation of this pathway. A variety of organisms could serve as sources for these enzymes, including, but not limited to, Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis, and K. marxianus, Pichia spp., Hansenula spp., including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. stipitis, Torulaspora spp, including T. pretoriensis, Schizosaccharomyces spp., including S. pombe, Cryptococcus spp., Aspergillus spp., Neurospora spp., or Ustilago spp. Sources of genes from anaerobic fungi include, but not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Sources of prokaryotic enzymes that are useful include, but not limited to, Escherichia coli, Zymomonas mobilis, Staphylococcus aureus, Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp., and Salmonella spp.
(156) Methods in General
(157) Identification of PDC in a Yeast Microorganism
(158) Any method can be used to identify genes that encode for enzymes with pyruvate decarboxylase (PDC) activity. PDC catalyzes the decarboxylation of pyruvate to form acetaldehyde. Generally, homologous or similar PDC genes and/or homologous or similar PDC enzymes can be identified by functional, structural, and/or genetic analysis. In most cases, homologous or similar PDC genes and/or homologous or similar PDC enzymes will have functional, structural, or genetic similarities. Techniques known to those skilled in the art may be suitable to identify homologous genes and homologous enzymes. Generally, analogous genes and/or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a PDC gene by PCR using primers based on a published sequence of a gene/enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among PDC genes. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic activity of an enzyme through in vitro enzyme assays for said activity, then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or similar genes and/or homologous or similar enzymes, analogous genes and/or analogous enzymes or proteins, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein. Furthermore, PDC activity can be determined phenotypically. For example, ethanol production under fermentative conditions can be assessed. A lack of ethanol production may be indicative of a yeast microorganism with no PDC activity. Examples of yeast pyruvate decarboxylase genes that may be targeted for disruption may be found in U.S. Pat. No. 7,326,550. Target genes for disruption include, but are not limited, to PDC1 (GenBank Accession No. CAA97573.1), PDC5 (GenBank Accession No. CAA97705.1), and PDC6 (GenBank Accession No. CAA97089.1) from S. cerevisiae, as well as genes encoding pyruvate decarboxylases from K. lactis (GenBank Accession No. CAA59953.1), K. marxianus(AAA35267.1), P. stipitis (GenBank Accession No. AAC03164.3), C. glabrata (AAN77243.1), S. pombe (GenBank Accession No. NP_592796.2), and Y. lipolytica (CAG80835.1). Other target genes, such as those encoding pyruvate decarboxylase proteins having at least about 50-55%, 55%-60%, 60-65%, 65%-70%, 75-80%, 80-85%, 85%-90%, 90%-95%, or at least about 98% sequence identity to the S. cerevisiae pyruvate decarboxylases may be identified in the literature and in bioinformatics databases well known to the skilled person.
(159) Identification of GPD in a Yeast Microorganism
(160) Any method can be used to identify genes that encode for enzymes with glycerol-3-phosphate dehydrogenase (GPD) activity. GPD catalyzes the reduction of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P) with the corresponding oxidation of NADH to NAD+. Generally, homologous or similar GPD genes and/or homologous or similar GPD enzymes can be identified by functional, structural, and/or genetic analysis. In most cases, homologous or similar GPD genes and/or homologous or similar GPD enzymes will have functional, structural, or genetic similarities. Techniques known to those skilled in the art may be suitable to identify homologous genes and homologous enzymes. Generally, analogous genes and/or analogous enzymes can be identified by functional analysis and will have functional similarities. Techniques known to those skilled in the art may be suitable to identify analogous genes and analogous enzymes. For example, to identify homologous or analogous genes, proteins, or enzymes, techniques may include, but not limited to, cloning a GPD gene by PCR using primers based on a published sequence of a gene/enzyme or by degenerate PCR using degenerate primers designed to amplify a conserved region among GPD genes. Further, one skilled in the art can use techniques to identify homologous or analogous genes, proteins, or enzymes with functional homology or similarity. Techniques include examining a cell or cell culture for the catalytic activity of an enzyme through in vitro enzyme assays for said activity, then isolating the enzyme with said activity through purification, determining the protein sequence of the enzyme through techniques such as Edman degradation, design of PCR primers to the likely nucleic acid sequence, amplification of said DNA sequence through PCR, and cloning of said nucleic acid sequence. To identify homologous or similar genes and/or homologous or similar enzymes, analogous genes and/or analogous enzymes or proteins, techniques also include comparison of data concerning a candidate gene or enzyme with databases such as BRENDA, KEGG, or MetaCYC. The candidate gene or enzyme may be identified within the above mentioned databases in accordance with the teachings herein. Furthermore, GPD activity can be determined phenotypically. For example, glycerol production under fermentative conditions can be assessed. A lack of glycerol production may be indicative of a yeast microorganism with no GPD activity. Examples of yeast glycerol-3-phosphate dehydrogenase genes that may be targeted for disruption may be found in US 2009/0053782. Other target genes, such as those encoding glycerol-3-phosphate dehydrogenase proteins having at least about 50-55%, 55%-60%, 60-65%, 65%-70%, 75-80%, 80-85%, 85%-90%, 90%-95%, or at least about 98% sequence identity to the S. cerevisiae glycerol-3-phosphate dehydrogenases may be identified in the literature and in bioinformatics databases well known to the skilled person.
(161) Genetic Insertions and Deletions
(162) Any method can be used to introduce a nucleic acid molecule into yeast and many such methods are well known. For example, transformation and electroporation are common methods for introducing nucleic acid into yeast cells. See, e.g., Gietz et al., Nucleic Acids Res. 27:69-74 (1992); Ito et al., J. Bacteriol. 153:163-168 (1983); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991).
(163) In an embodiment, the integration of a gene of interest into a DNA fragment or target gene of a yeast microorganism occurs according to the principle of homologous recombination. According to this embodiment, an integration cassette containing a module comprising at least one yeast marker gene and/or the gene to be integrated (internal module) is flanked on either side by DNA fragments homologous to those of the ends of the targeted integration site (recombinogenic sequences). After transforming the yeast with the cassette by appropriate methods, a homologous recombination between the recombinogenic sequences may result in the internal module replacing the chromosomal region in between the two sites of the genome corresponding to the recombinogenic sequences of the integration cassette. (Orr-Weaver et al., Proc Natl Acad Sci USA 78:6354-6358 (1981))
(164) In an embodiment, the integration cassette for integration of a gene of interest into a yeast microorganism includes the heterologous gene under the control of an appropriate promoter and terminator together with the selectable marker flanked by recombinogenic sequences for integration of a heterologous gene into the yeast chromosome. In an embodiment, the heterologous gene includes an appropriate native gene desired to increase the copy number of a native gene(s). The selectable marker gene can be any marker gene used in yeast, including but not limited to, HIS3, TRP1, LEU2, URA3, bar, ble, hph, and kan. The recombinogenic sequences can be chosen at will, depending on the desired integration site suitable for the desired application.
(165) In another embodiment, integration of a gene into the chromosome of the yeast microorganism may occur via random integration (Kooistra, R., Hooykaas, P. J. J., Steensma, H. Y. 2004. Yeast 21: 781-792).
(166) Additionally, in an embodiment, certain introduced marker genes are removed from the genome using techniques well known to those skilled in the art. For example, URA3 marker loss can be obtained by plating URA3 containing cells in FOA (5-fluoro-orotic acid) containing medium and selecting for FOA resistant colonies (Boeke, J. et al, 1984, Mol. Gen. Genet, 197, 345-47).
(167) The exogenous nucleic acid molecule contained within a yeast cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the cell or maintained in an episomal state that can stably be passed on (inherited) to daughter cells. Such extra-chromosomal genetic elements (such as plasmids, etc.) can additionally contain selection markers that ensure the presence of such genetic elements in daughter cells. Moreover, the yeast cells can be stably or transiently transformed. In addition, the yeast cells described herein can contain a single copy, or multiple copies of a particular exogenous nucleic acid molecule as described above.
(168) Reduction of Enzymatic Activity
(169) Yeast microorganisms within the scope of the invention may have reduced enzymatic activity such as reduced pyruvate decarboxylase activity. The term reduced as used herein with respect to a particular enzymatic activity refers to a lower level of enzymatic activity than that measured in a comparable yeast cell of the same species. The term reduced also refers to the elimination of enzymatic activity than that measured in a comparable yeast cell of the same species. Thus, yeast cells lacking pyruvate decarboxylase activity are considered to have reduced pyruvate decarboxylase activity since most, if not all, comparable yeast strains have at least some pyruvate decarboxylase activity. Such reduced enzymatic activities can be the result of lower enzyme concentration, lower specific activity of an enzyme, or a combination thereof. Many different methods can be used to make yeast having reduced enzymatic activity. For example, a yeast cell can be engineered to have a disrupted enzyme-encoding locus using common mutagenesis or knock-out technology. See, e.g., Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Stems, Cold Spring Harbor Press (1998). In addition, certain point-mutation(s) can be introduced which results in an enzyme with reduced activity.
(170) Alternatively, antisense technology can be used to reduce enzymatic activity. For example, yeast can be engineered to contain a cDNA that encodes an antisense molecule that prevents an enzyme from being made. The term antisense molecule as used herein encompasses any nucleic acid molecule that contains sequences that correspond to the coding strand of an endogenous polypeptide. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA.
(171) Yeast having a reduced enzymatic activity can be identified using many methods. For example, yeast having reduced pyruvate decarboxylase activity can be easily identified using common methods, which may include, for example, measuring ethanol formation via gas chromatography.
(172) Overexpression of Heterologous Genes
(173) Methods for overexpressing a polypeptide from a native or heterologous nucleic acid molecule are well known. Such methods include, without limitation, constructing a nucleic acid sequence such that a regulatory element promotes the expression of a nucleic acid sequence that encodes the desired polypeptide. Typically, regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Thus, regulatory elements include, without limitation, promoters, enhancers, and the like. For example, the exogenous genes can be under the control of an inducible promoter or a constitutive promoter. Moreover, methods for expressing a polypeptide from an exogenous nucleic acid molecule in yeast are well known. For example, nucleic acid constructs that are used for the expression of exogenous polypeptides within Kluyveromyces and Saccharomyces are well known (see, e.g., U.S. Pat. Nos. 4,859,596 and 4,943,529, for Kluyveromyces and, e.g., Gellissen et al., Gene 190(1):87-97 (1997) for Saccharomyces). Yeast plasmids have a selectable marker and an origin of replication. In addition certain plasmids may also contain a centromeric sequence. These centromeric plasmids are generally a single or low copy plasmid. Plasmids without a centromeric sequence and utilizing either a 2 micron (S. cerevisiae) or 1.6 micron (K. lactis) replication origin are high copy plasmids. The selectable marker can be either prototrophic, such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic resistance, such as, bar, ble, hph, or kan.
(174) In another embodiment, heterologous control elements can be used to activate or repress expression of endogenous genes. Additionally, when expression is to be repressed or eliminated, the gene for the relevant enzyme, protein or RNA can be eliminated by known deletion techniques.
(175) As described herein, any yeast within the scope of the disclosure can be identified by selection techniques specific to the particular enzyme being expressed, over-expressed or repressed. Methods of identifying the strains with the desired phenotype are well known to those skilled in the art. Such methods include, without limitation, PCR, RT-PCR, and nucleic acid hybridization techniques such as Northern and Southern analysis, altered growth capabilities on a particular substrate or in the presence of a particular substrate, a chemical compound, a selection agent and the like. In some cases, immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid by detecting the expression of the encoded polypeptide. For example, an antibody having specificity for an encoded enzyme can be used to determine whether or not a particular yeast cell contains that encoded enzyme. Further, biochemical techniques can be used to determine if a cell contains a particular nucleic acid molecule encoding an enzymatic polypeptide by detecting a product produced as a result of the expression of the enzymatic polypeptide. For example, transforming a cell with a vector encoding acetolactate synthase and detecting increased acetolactate concentrations compared to a cell without the vector indicates that the vector is both present and that the gene product is active. Methods for detecting specific enzymatic activities or the presence of particular products are well known to those skilled in the art. For example, the presence of acetolactate can be determined as described by Hugenholtz and Starrenburg, Appl. Microbiol. Biotechnol. 38:17-22 (1992).
(176) Increase of Enzymatic Activity
(177) Yeast microorganisms of the invention may be further engineered to have increased activity of enzymes. The term increased as used herein with respect to a particular enzymatic activity refers to a higher level of enzymatic activity than that measured in a comparable yeast cell of the same species. For example, overexpression of a specific enzyme can lead to an increased level of activity in the cells for that enzyme. Increased activities for enzymes involved in glycolysis or the isobutanol pathway would result in increased productivity and yield of isobutanol.
(178) Methods to increase enzymatic activity are known to those skilled in the art. Such techniques may include increasing the expression of the enzyme by increased copy number and/or use of a strong promoter, introduction of mutations to relieve negative regulation of the enzyme, introduction of specific mutations to increase specific activity and/or decrease the Km for the substrate, or by directed evolution. See, e.g., Methods in Molecular Biology (vol. 231), ed. Arnold and Georgiou, Humana Press (2003).
(179) Carbon Source
(180) The biocatalyst herein disclosed can convert various carbon sources into isobutanol. The term carbon source generally refers to a substance suitable to be used as a source of carbon for prokaryotic or eukaryotic cell growth. Carbon sources include, but are not limited to, biomass hydrolysates, starch, sucrose, cellulose, hemicellulose, xylose, and lignin, as well as monomeric components of these substrates. Carbon sources can comprise various organic compounds in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, etc. These include, for example, various monosaccharides such as glucose, dextrose (D-glucose), maltose, oligosaccharides, polysaccharides, saturated or unsaturated fatty acids, succinate, lactate, acetate, ethanol, etc., or mixtures thereof. Photosynthetic organisms can additionally produce a carbon source as a product of photosynthesis. In some embodiments, carbon sources may be selected from biomass hydrolysates and glucose.
(181) The term C2-compound as used as a carbon source for engineered yeast microorganisms with mutations in all pyruvate decarboxylase (PDC) genes resulting in a reduction of pyruvate decarboxylase activity of said genes refers to organic compounds comprised of two carbon atoms, including but not limited to ethanol and acetate
(182) The term feedstock is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. For example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a biofuel in a fermentation process. However, a feedstock may contain nutrients other than a carbon source.
(183) The term traditional carbohydrates refers to sugars and starches generated from specialized plants, such as sugar cane, corn, and wheat. Frequently, these specialized plants concentrate sugars and starches in portions of the plant, such as grains, that are harvested and processed to extract the sugars and starches. Traditional carbohydrates are used as food and also to a lesser extent as carbon sources for fermentation processes to generate biofuels, such as and chemicals
(184) The term biomass as used herein refers primarily to the stems, leaves, and starch-containing portions of green plants, and is mainly comprised of starch, lignin, cellulose, hemicellulose, and/or pectin. Biomass can be decomposed by either chemical or enzymatic treatment to the monomeric sugars and phenols of which it is composed (Wyman, C. E. 2003 Biotechnological Progress 19:254-62). This resulting material, called biomass hydrolysate, is neutralized and treated to remove trace amounts of organic material that may adversely affect the biocatalyst, and is then used as a feed stock for fermentations using a biocatalyst.
(185) The term starch as used herein refers to a polymer of glucose readily hydrolyzed by digestive enzymes. Starch is usually concentrated in specialized portions of plants, such as potatoes, corn kernels, rice grains, wheat grains, and sugar cane stems.
(186) The term lignin as used herein refers to a polymer material, mainly composed of linked phenolic monomeric compounds, such as p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol, which forms the basis of structural rigidity in plants and is frequently referred to as the woody portion of plants. Lignin is also considered to be the non-carbohydrate portion of the cell wall of plants.
(187) The term cellulose as used herein refers is a long-chain polymer polysaccharide carbohydrate of beta-glucose of formula (C6H10O5)n, usually found in plant cell walls in combination with lignin and any hemicellulose.
(188) The term hemicellulose refers to a class of plant cell-wall polysaccharides that can be any of several heteropolymers. These include xylane, xyloglucan, arabinoxylan, arabinogalactan, glucuronoxylan, glucomannan and galactomannan. Monomeric components of hemicellulose include, but are not limited to: D-galactose, L-galactose, D-mannose, L-rhamnose, L-fucose, D-xylose, L-arabinose, and D-glucuronic acid. This class of polysaccharides is found in almost all cell walls along with cellulose. Hemicellulose is lower in weight than cellulose and cannot be extracted by hot water or chelating agents, but can be extracted by aqueous alkali. Polymeric chains of hemicellulose bind pectin and cellulose in a network of cross-linked fibers forming the cell walls of most plant cells.
(189) Microorganism Characterized by Producing Isobutanol at High Yield
(190) For a biocatalyst to produce isobutanol most economically, it is desired to produce a high yield. Preferably, the only product produced is isobutanol. Extra products lead to a reduction in product yield and an increase in capital and operating costs, particularly if the extra products have little or no value. Extra products also require additional capital and operating costs to separate these products from isobutanol.
(191) The microorganism may convert one or more carbon sources derived from biomass into isobutanol with a yield of greater than 5% of theoretical. In one embodiment, the yield is greater than 10%. In one embodiment, the yield is greater than 50% of theoretical. In one embodiment, the yield is greater than 60% of theoretical. In another embodiment, the yield is greater than 70% of theoretical. In yet another embodiment, the yield is greater than 80% of theoretical. In yet another embodiment, the yield is greater than 85% of theoretical. In yet another embodiment, the yield is greater than 90% of theoretical. In yet another embodiment, the yield is greater than 95% of theoretical. In still another embodiment, the yield is greater than 97.5% of theoretical.
(192) More specifically, the microorganism converts glucose, which can be derived from biomass into isobutanol with a yield of greater than 5% of theoretical. In one embodiment, the yield is greater than 10% of theoretical. In one embodiment, the yield is greater than 50% of theoretical. In one embodiment the yield is greater than 60% of theoretical. In another embodiment, the yield is greater than 70% of theoretical. In yet another embodiment, the yield is greater than 80% of theoretical. In yet another embodiment, the yield is greater than 85% of theoretical. In yet another embodiment the yield is greater than 90% of theoretical. In yet another embodiment, the yield is greater than 95% of theoretical. In still another embodiment, the yield is greater than 97.5% of theoretical
(193) Microorganism Expressing a Cytosolically Localized Acetolactate Synthase (ALS)
(194) In yeasts such as S. cerevisiae, the native acetolactate synthase, encoded in S. cerevisiae by the ILV2 gene, is naturally expressed in the yeast mitochondria. Unlike the endogenous acetolactate synthase of yeast, expression of heterologous, acetolactate synthases such as the B. subtilis alsS and the L. lactis alsS in yeast occurs in the yeast cytosol (i.e. cytosolically-localized). Thus, cytosolic expression of acetolactate synthase is achieved by transforming a yeast with a gene encoding an acetolactate synthase protein (EC 2.2.1.6).
(195) ALS homologs that could be cytosolically expressed and localized in yeast are predicted to lack a mitochondrial targeting sequence as analyzed using mitoprot (Claros et al., 1996, Eur. J. Biochem 241: 779-86). Such cytosolically localized ALS proteins can be used as the first step in the isobutanol pathway. ALS homologs include, but are not limited to, the following: the Serratia marcescens ALS (GenBank Accession No. ADH43113.1) (probability of mitochondrial localization 0.07), the Enterococcus faecalis ALS (GenBank Accession No. NP_814940) (probability of mitochondrial localization 0.21), the Leuconostoc mesenteroides (GenBank Accession No. YP_818010.1) (probability of mitochondrial localization 0.21), the Staphylococcus aureus ALS (GenBank Accession No. YP_417545) (probability of mitochondrial localization 0.13), the Burkholderia cenocepacia ALS (GenBank Accession No. YP_624435) (probability of mitochondrial localization 0.15), Trichoderma atroviride ALS (SEQ ID NO: 77) probability of mitochondrial localization 0.19), Talaromyces stipitatus ALS (SEQ ID NO: 78) (probability of mitochondrial localization 0.19), and Magnaporthe grisea ALS (GenBank Accession No. EDJ99221) (probability of mitochondrial localization 0.02).
(196) In alternative embodiments described herein, an ALS enzyme that is predicted to be mitochondrially localized may be mutated or modified to remove or modify an N-terminal mitochondrial targeting sequence (MTS) to remove or eliminate its ability to target the ALS enzyme to the mitochondria. Removal of the MTS can increase cytosolic localization of the ALS and/or increase the cytosolic activity of the ALS as compared to the parental ALS.
(197) Methods for gene expression in yeasts are known in the art (See, e.g., Methods in Enzymology, 2004, Vol 194, Guide to Yeast Genetics and Molecular and Cell Biology). As is understood in the art, the expression of heterologous, prokaryotic genes in yeast typically requires a promoter, operably linked to a coding region of interest, and a transcriptional terminator. A number of yeast promoters can be used in constructing expression cassettes for genes encoding an acetolactate synthase, including, but not limited to constitutive promoters FBA, GPD1, ADH1, and GPM, and the inducible promoters GAL1, GAL10, and CUP1. Suitable transcriptional terminators include, but are not limited to FBA, GPD, GPM, ERG10, GAL1, CYC1, and ADH1.
(198) Microorganism Characterized by Production of Isobutanol from Pyruvate Via an Overexpressed Isobutanol Pathway and a Pdc-Minus Phenotype
(199) In yeast, the conversion of pyruvate to acetaldehyde is a major drain on the pyruvate pool (
(200) Reduction of PDC activity can be accomplished by 1) mutation or deletion of a positive transcriptional regulator for the structural genes encoding for PDC or 2) mutation or deletion of all PDC genes in a given organism. The term transcriptional regulator can specify a protein or nucleic acid that works in trans to increase or to decrease the transcription of a different locus in the genome. For example, in S. cerevisiae, the PDC2 gene, which encodes for a positive transcriptional regulator of PDC1,5,6 genes can be deleted; a S. cerevisiae in which the PDC2 gene is deleted is reported to have only 10% of wildtype PDC activity (Hohmann, Mol Gen Genet, 241:657-666 (1993)). Alternatively, for example, all structural genes for PDC (e.g. in S. cerevisiae, PDC1, PDC5, and PDC6, or in K. lactis, PDC1) are deleted.
(201) Crabtree-positive yeast strains such as S. cerevisiae strain that contains disruptions in all three of the PDC alleles no longer produce ethanol by fermentation. However, a downstream product of the reaction catalyzed by PDC, acetyl-CoA, is needed for anabolic production of necessary molecules. Therefore, the Pdc-mutant is unable to grow solely on glucose, and requires a two-carbon carbon source, either ethanol or acetate, to synthesize acetyl-CoA. (Flikweert M T, de Swaaf M, van Dijken J P, Pronk J T. FEMS Microbiol Lett. 1999 May 1; 174(1):73-9. PMID:10234824 and van Maris A J, Geertman J M, Vermeulen A, Groothuizen M K, Winkler A A, Piper M D, van Dijken J P, Pronk J T. Appl Environ Microbiol. 2004 January; 70(1):159-66. PMID: 14711638).
(202) Thus, in an embodiment, such a Crabtree-positive yeast strain may be evolved to generate variants of the PDC mutant yeast that do not have the requirement for a two-carbon molecule and has a growth rate similar to wild type on glucose. Any method, including chemostat evolution or serial dilution may be utilized to generate variants of strains with deletion of three PDC alleles that can grow on glucose as the sole carbon source at a rate similar to wild type (van Maris et al., Directed Evolution of Pyruvate Decarboxylase-Negative Saccharomyces cerevisiae, Yielding a C2-Independent, Glucose-Tolerant, and Pyruvate-Hyperproducing Yeast, Applied and Environmental Microbiology, 2004, 70(1), 159-166).
(203) Microorganism Characterized by Production of Isobutanol from Pyruvate Via an Overexpressed Isobutanol Pathway and a PDC-Minus GPD-Minus Phenotype
(204) Another pathway for NADH oxidation is through the production of glycerol. Dihydroxyacetone-phosphate, an intermediate of glycolysis is reduced to glycerol 3-phosphate by glycerol 3-phosphate dehydrogenase (GPD). Glycerol 3-phosphatase (GPP) converts glycerol 3-phosphate to glycerol. This pathway consumes carbon from glucose as well as reducing equivalents (NADH) resulting in less pyruvate and reducing equivalents available for the isobutanol pathway. These pathways contribute to low yield and low productivity of isobutanol. Accordingly, deletions of PDC and GPD would increase yield and productivity of isobutanol. As exemplified in Examples 9 and 13, the yield may increase to 70% by the additional deletion of GPD. In an embodiment, a yeast microorganism may include a recombinant microorganism having an engineered pathway to convert a carbon source, such as glucose, to isobutanol.
(205) Looking at
(206) Yield of isobutanol can be increased also by reduction of the glycerol 3-phosphate dehydrogenase (GPD, EC1.1.1.8) activity, which is involved in the production of glycerol (
(207) Additionally, activities of other gene products may function as drains on metabolic intermediates. For example, reductions of the following activities may increase yield of isobutanol. Pyruvate dehydrogenase (PDH) activity, supplied by a multi-gene product complex, represents another route of pyruvate dissimilation. Reduction of PDH activity may increase pyruvate availability. Branched-chain amino acid transaminase (EC 2.6.1.42) interconverts valineketo-isovalerate in the cytosol, and may therefore reduce or limit available keto-isovalerate to isobutanol pathway. 3-methyl-2-oxobutanoate hydroxymethyltransferase (EC 2.1.2.11) directs the isobutanol pathway intermediate, keto-isovalerate, to the coenzyme A synthesis pathway. Alphaisopropylmalate isomerase (EC 4.1.3.12) directs the isobutanol pathway intermediate, keto-isovalerate, to the synthesis of leucine. Therefore, all of these enzymatic activities represent possible additional targets for disruption, deletion, or both.
(208) Microorganism Characterized by Production of Isobutanol from Pyruvate Via an Overexpressed Balanced Isobutanol Pathway and a PDC-Minus GPD-Minus Phenotype
(209) To further increase yield from the pathway the imbalance in the use of reducing equivalents need to be corrected. Glycolysis generates 2 moles NADHs and 2 moles of pyruvate per mole of glucose, while the isobutanol pathway consumes either 2 NADPHs or 1 NADH and 1 NADPH for every 2 moles of pyruvate utilized. KARI enzymes typically use NADPH. There exists both an NADH and NADPH dependent alcohol dehydrogenase that can be used for the isobutanol pathway. For example, S. cerevisiae Adh2p is an NADH-dependent enzyme that is able to reduce isobutyraldehyde to isobutanol. Alternatively, this conversion can be performed by S. cerevisiae Adh6p or Adh7p, which are NADPH-dependent alcohol dehydrogenases. The additional NADPH can be obtained from the pentose phosphate pathway, but this results in a reduced yield as only 5 moles of pyruvate is generated from 3 moles of glucose, while glycolysis generates 6 moles of pyruvate from 3 moles of glucose.
(210) This imbalance can be balanced in several ways. In one embodiment, glycolysis can be engineered to generate NADPH instead of NADH. This is accomplished by replacing the endogenous NAD+-dependent glyceraldehydes 3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12) with an NADP+-dependent GAPDH (EC 1.2.1.13). Such NADP+-dependent GAPDHs have been identified in bacteria (i.e. gapB in B. subtilis), yeast (GDPI in K. lactis) and plants. (Fillinger et al., J Biol Chem. 275:14031-14037, Verho et al., Biochemistry, 41:13833-13838) This may result in glycolysis producing 2 moles of NADPH which balances the 2 moles of NADPH that are consumed by the isobutanol pathway utilizing an NADPH-dependent alcohol dehydrogenase. See, for example, Richard, et al, U.S. Patent Application Publication Number US 2005/0106734 A1. In addition to balancing the pathway, this method may result in the reduction of available NADH and hence a reduction in the ability of the glycerol 3-phosphate dehydrogenase to generate glycerol.
(211) In a second embodiment, an NADP.sup.+-dependent GAPDH is co-expressed with the endogenous NAD+-dependent GAPDH. This may allow the production of both NADPH and NADH from glycolysis and balance the consumption of 1 mole of NADPH and 1 mole of NADH by an isobutanol pathway utilizing an NADH-dependent alcohol dehydrogenase.
(212) In yet another embodiment, the NADPH-dependent KARI enzyme in the pathway is engineered to use NADH. This has been shown with the E. coli KARI (ilvC) (Rane M J and Calvo K C, Arch Biochem Biophys., 338(1):83-89). Alternatively, a KARI from Methanococcus species can be used. These KARI enzymes have been reported to be able to utilize NADH with roughly 60% the activity with NADPH (Xing et al., Journal of Bacteriology 1990). The use of these NADH-utilizing ilvC in combination with an NADH-dependent alcohol dehydrogenase also balances the NADH/NADPH imbalance.
(213) Furthermore any of the genes encoding the foregoing enzymes (or any others mentioned herein (or any of the regulatory elements that control or modulate expression thereof) may be subject to directed evolution using methods known to those of skill in the art. Such action allows those of skill in the art to optimize the enzymes for expression and activity in yeast.
(214) In addition, genes encoding these enzymes can be identified from other fungal and bacterial species and can be expressed for the modulation of this pathway. A variety of organisms could serve as sources for these enzymes, including, but not limited to, Saccharomyces spp., including S. cerevisiae and S. uvarum, Kluyveromyces spp., including K. thermotolerans, K. lactis, and K. marxianus, Pichia spp., Hansenula spp., including H. polymorpha, Candida spp., Trichosporon spp., Yamadazyma spp., including Y. stipitis, Torulaspora pretoriensis, Schizosaccharomyces spp., incl. Schizosaccharomyces pombe, Cryptococcus spp., Aspergillus spp., Neurospora spp. or Ustilago spp. Sources of genes from anaerobic fungi include, but not limited to, Piromyces spp., Orpinomyces spp., or Neocallimastix spp. Sources of prokaryotic enzymes that are useful include, but not limited to, Escherichia coli, Zymomonas mobilis, Staphylococcus aureus, Bacillus spp., Clostridium spp., Corynebacterium spp., Pseudomonas spp., Lactococcus spp., Enterobacter spp., and Salmonella spp.
(215) Microorganism Characterized by Balanced Isobutanol Pathway
(216) In the various embodiments described herein, the engineered metabolic pathway may be balanced with respect to NADH and NADPH as compared to a native or unmodified metabolic isobutanol pathway from a corresponding parental microorganism, wherein the native or unmodified metabolic pathway is not balanced with respect to NADH and NADPH.
(217) The ideal production microorganism produces a desirable product at close to theoretical yield. For example the ideal isobutanol producing organism produces isobutanol according to the following equation: 1 glucose.fwdarw.isobutanol+2 CO.sub.2+H.sub.2O.
(218) Accordingly, 66% of the glucose carbon results in isobutanol, while 33% is lost as CO.sub.2. In exemplary metabolic pathways for the conversion of pyruvate to isobutanol described by Atsumi et al. (WO/2008/098227, and Atsumi et al., Nature, 2008 Jan. 3; 451(7174):86-9), two of the five enzymes used to convert pyruvate into isobutanol according to the metabolic pathway outlined in
(219) Even if competing pathways can be eliminated or reduced in activity by metabolic engineering, yield is limited to about 83% of theoretical. Carbon loss to carbon dioxide (CO.sub.2) remains the main limitation on yield in the aforementioned metabolic pathway for the production of isobutanol. Reducing the oxygen uptake rate (OUR) of the cells should decrease the loss of carbon to CO.sub.2 because it decreases the metabolic flux through the CO.sub.2-generating tricarboxylic acid (TCA) cycle and/or pentose phosphate pathway (PPP). However, a modified microorganism utilizing the aforementioned metabolic pathway for the production of isobutanol exhibits drastically decreased specific productivity under conditions where the OUR is decreased and isobutanol production under anaerobic conditions may not be possible.
(220) The decreased yield and the loss of productivity upon O.sub.2 limitation indicate that the strain uses one or more metabolic pathways to generate the NADPH needed to support isobutanol production. In a modified cell utilizing the aforementioned metabolic pathway the production of isobutanol from glucose results in an imbalance between the cofactors reduced during glycolysis and the cofactors oxidized during the conversion of pyruvate to isobutanol. While glycolysis produces two moles of NADH, the isobutanol pathway consumes two moles of NADPH. This leads to a deficit of two moles of NADPH and overproduction of two moles of NADH per isobutanol molecule produced, a state described henceforth as cofactor imbalance.
(221) The terms cofactor balance or balanced with respect to cofactor usage refer to a recombinant microorganism comprising a metabolic pathway converting a carbon source to a fermentation product and a modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing said fermentation product from a carbon source and wherein the re-oxidation or re-reduction of said redox cofactors does not require the pentose phosphate pathway, the TCA cycle or the generation of additional fermentation products.
(222) Stated another way, the terms cofactor balance or balanced with respect to cofactor usage can refer to an advantageous modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing a fermentation product from a carbon source and wherein said re-oxidation or re-reduction of all redox cofactors does not require the production of byproducts or co-products.
(223) Stated another way, the terms cofactor balance or balanced with respect to cofactor usage can refer to an advantageous modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing a fermentation product from a carbon source under anaerobic conditions and wherein the production of additional fermentation products is not required for re-oxidation or re-reduction of redox cofactors.
(224) Stated another way, the terms cofactor balance or balanced with respect to cofactor usage can refer to an advantageous modification that leads to the regeneration of all redox cofactors within the recombinant microorganism producing a fermentation product from a carbon source and wherein said modification increases production of said fermentation product under anaerobic conditions compared to the parental or wild type microorganism and wherein additional fermentation products are not required for the regeneration of said redox cofactors.
(225) The cell has several options for resolving a cofactor imbalance. One is to change the relative fluxes going from glucose through glycolysis and through the pentose phosphate pathway (PPP). For each glucose molecule metabolized through the PPP, two moles of NADPH are generated in addition to the two moles of NADH that are generated through glycolysis (a total of 4 reducing equivalents). Therefore, use of the PPP results in the generation of excess reducing equivalents since only two moles are consumed during the production of isobutanol. Under anaerobic conditions, and without an alternate electron acceptor, the cell has no way to reoxidize or regenerate these extra cofactors to NADP.sup.+ and metabolism thus stops. The excess reducing equivalents must instead be utilized for energy production through aerobic respiration which is only possible under aerobic conditions or for the production of byproducts. Another result of the flux through the PPP is that one additional molecule of CO.sub.2 is lost per molecule of glucose consumed, which limits the yield of isobutanol that can be achieved under aerobic conditions.
(226) Another way the cell can generate NADPH is via the TCA cycle. Flux through the TCA cycle results in carbon loss through CO.sub.2 and in production of NADH in addition to the NADPH required for the isobutanol pathway. The NADH would have to be utilized for energy production through respiration under aerobic conditions (and without an alternate electron acceptor) or for the production of byproducts. In addition, the TCA cycle likely is not functional under anaerobic conditions and is therefore unsuitable for the production of stoichiometric amounts of NADPH in an anaerobic isobutanol process.
(227) An economically competitive isobutanol process requires a high yield from a carbon source. Lower yield means that more feedstock is required to produce the same amount of isobutanol. Feedstock cost is the major component of the overall operating cost, regardless of the nature of the feedstock and its current market price. From an economical perspective, this is important because the cost of isobutanol is dependent on the cost of the biomass-derived sugars. An increase in feedstock cost results in an increase in isobutanol cost. Thus, it is desirable to utilize NADH-dependent enzymes for the conversion of pyruvate to isobutanol.
(228) An enzyme is NADH-dependent if it catalyzes the reduction of a substrate coupled to the oxidation of NADH with a catalytic efficiency that is greater than the reduction of the same substrate coupled to the oxidation of NADPH at equal substrate and cofactor concentrations.
(229) Thus, in one embodiment of the invention, a microorganism is provided in which cofactor usage is balanced during the production of a fermentation product.
(230) In a specific aspect, a microorganism is provided in which cofactor usage is balanced during the production of isobutanol, in this case, production of isobutanol from pyruvate utilizes the same cofactor that is produced during glycolysis.
(231) In another embodiment, a microorganism is provided in which cofactor usage is balanced during the production of a fermentation product and the microorganism produces the fermentation product at a higher yield compared to a modified microorganism in which the cofactor usage in not balanced.
(232) In a specific aspect, a microorganism is provided in which cofactor usage is balanced during the production of isobutanol and the microorganism produces isobutanol at a higher yield compared to a modified microorganism in which the cofactor usage in not balanced.
(233) In yet another embodiment, a modified microorganism in which cofactor usage is balanced during the production of a fermentation product may allow the microorganism to produce said fermentation product under anaerobic conditions at higher rates, and yields as compared to a modified microorganism in which the cofactor usage in not balanced during production of a fermentation product.
(234) In a specific aspect, a modified microorganism in which cofactor usage is balanced during the production of isobutanol may allow the microorganism to produce isobutanol under anaerobic conditions at higher rates, and yields as compared to a modified microorganism in which the cofactor usage is not balanced during production of isobutanol.
(235) One compound to be produced by the recombinant microorganism according to the present invention is isobutanol. However, the present invention is not limited to isobutanol. The invention may be applicable to any metabolic pathway that is imbalanced with respect to cofactor usage. One skilled in the art is able to identify pathways that are imbalanced with respect to cofactor usage and apply this invention to provide recombinant microorganisms in which the same pathway is balanced with respect to cofactor usage. One skilled in the art will recognize that the identified pathways may be of longer or shorter length, contain more or fewer genes or proteins, and require more or fewer cofactors than the exemplary isobutanol pathway. Further, one skilled in the art will recognize that in certain embodiments, such as a recombinant microbial host that produces an excess of NADPH, certain embodiments of the present invention may be adapted to convert NADPH to NADH.
(236) Microorganisms Characterized by Providing Cofactor Balance Via Engineered Enzymes
(237) Conversion of one mole of glucose to two moles of pyruvate via glycolysis leads to the production of two moles of NADH. A metabolic pathway that converts pyruvate to a target product that consumes either two moles of NADPH or one mole of NADH and one mole of NADPH leads to cofactor imbalance. One example of such a metabolic pathway is the isobutanol metabolic pathway described by Atsumi et al. (Atsumi et al., 2008, Nature 451: 86-9), which converts two moles of pyruvate to one mole of isobutanol. In this five enzyme pathway, two enzymes are dependent upon NADPH: (1) KARI and (2) ADH, encoded by the E. coli ilvC and E. coli yqhD, respectively.
(238) To resolve this cofactor imbalance, the present invention provides a recombinant microorganism in which the NADPH-dependent enzymes KARI and ADH are replaced with enzymes that preferentially depend on NADH (i.e. KARI and ADH enzymes that are NADH-dependent).
(239) To further resolve this cofactor imbalance, the present invention in another embodiment provides recombinant microorganisms wherein the NADH-dependent KARI and ADH enzymes are overexpressed.
(240) In one aspect, such enzymes may be identified in nature. In an altemative aspect, such enzymes may be generated by protein engineering techniques including but not limited to directed evolution or site-directed mutagenesis.
(241) In one embodiment, the two NADPH-dependent enzymes within an isobutanol biosynthetic pathway that converts pyruvate to isobutanol may be replaced with ones that utilize NADH. These two enzymes may be KARI and an alcohol dehydrogenase (ADH).
(242) In another embodiment, two NADH-dependent enzymes that catalyze the same reaction as the NADH-dependent enzymes are overexpressed. These two enzymes may be KARI and an alcohol dehydrogenase.
(243) In one aspect, NADH-dependent KARI and ADH enzymes are identified in nature. In another aspect, the NADPH-dependent KARI and ADH enzymes may be engineered using protein engineering techniques including but not limited to directed evolution and site-directed mutagenesis.
(244) There exist two basic options for engineering NADH-dependent isobutyraldehyde dehydrogenases or ketol-acid reductoisomerases: (1) increase the NADH-dependent activity of an NADPH-dependent enzyme that is active towards the substrate of interest and/or (2) increase the activity of an NADH-dependent enzyme that is not sufficiently active towards the substrate of interest.
(245) There exist two basic options for engineering NADH-dependent isobutyraldehyde dehydrogenases or ketol-acid reductoisomerases: (1) increase the NADH-dependent activity of an NADPH-dependent enzyme that is active towards the substrate of interest and/or (2) increase the activity of an NADH-dependent enzyme that is not sufficiently active towards the substrate of interest.
(246) NADH-Dependent KARI Enzymes
(247) As shown in
(248) Other biosynthetic pathways utilize KARI enzymes for the conversion of acetolactate to 2,3-dihydroxyisovalerate. For example, KARI enzymes convert acetolactate to 2,3-dihydroxyisovalerate as part of the biosynthetic pathway for the production of 3-methyl-1-butanol (Atsumi et al., 2008, Nature 45: 86-9).
(249) Yet other biosynthetic pathways utilize KARI to convert 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate. This reaction is part of the biosynthetic pathway for the production of 2-methyl-1-butanol. (Atsumi et al., 2008, Nature 45: 86-9).
(250) As used herein, the term KARI or KARI enzyme or ketol-acid reductoisomerase are used interchangeably herein to refer to an enzyme that catalyzes the conversion of acetolactate to 2,3-dihydroxyisovalerate and/or the conversion of 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate. Moreover, these terms can be used interchangeably herein with the terms acetohydroxy acid isomeroreductase and acetohydroxy acid reductoisomerase.
(251) Enzymes for use in the compositions and methods of the invention include any enzyme having the ability to convert acetolactate to 2,3-dihydroxyisovalerate and/or the ability to convert 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate. Such enzymes include, but are not limited to, the E. coli ilvC gene product and the S. cerevisiae ILV5 gene product, and the KARI enzyme from Piromyces sp, Buchnera aphidicola, Spinacia oleracea, Oryza sativa, Chlamydomonas reinhardtii, Neurospora crassa, Schizosaccharomyces pombe, Laccaria bicolor, Ignicoccus hospitalis, Picrophilus torridus, Acidiphilium cryptum, Cyanobacteria/Synechococcus sp., Zymomonas mobilis, Bacteroides thetaiotaomicron, Methanococcus maripaludis, Vibrio fischen, Shewanella sp, Gramella forsetti, Psychromonas ingrhamaii, and Cytophaga hutchinsonii.
(252) KARI sequences are available from a vast array of microorganisms, including, but not limited to, Escherichia coli (GenBank Nos: NP_418222 and NC_000913, Saccharomyces cerevisiae (GenBank Nos: NP_013459 and NC_001144, Methanococcus maripaludis (GenBank Nos: CAF30210 and BX957220, and Bacillus subtilis (GenBank Nos: CAB14789 and Z99118) and the KARI enzymes from Piromyces sp (GenBank No: CAA76356), Buchnera aphidicola (GenBank No: AAF13807), Spinacia oleracea (GenBank Nos: Q01292 and CAA40356), Oryza sativa (GenBank No: NP_001056384) Chlamydomonas reinhardtii (GenBank No: XP_001702649), Neurospora crassa (GenBank No: XP_961335), Schizosaccharomyces pombe (GenBank No: NP_001018845), Laccaria bicolor (GenBank No: XP_001880867), Ignicoccus hospitalis (GenBank No: YP_001435197), Picrophilus torridus (GenBank No: YP_023851), Acidiphilium cryptum (GenBank No: YP_001235669), Cyanobacteria/Synechococcus sp. (GenBank No: YP_473733), Zymomonas mobilis (GenBank No: YP_162876), Bacteroides thetaiotaomicron (GenBank No: NP_810987), Methanococcus maripaludis (GenBank No: YP_001097443), Vibrio fischeri (GenBank No: YP_205911), Shewanella sp (GenBank No: YP_732498), Gramella forsetti (GenBank No: YP_862142), Psychromonas ingrhamaii (GenBank No: YP_942294), and Cytophaga hutchinsonii (GenBank No: YP_677763).
(253) As will be understood by one of ordinary skill in the art, modified KARI enzymes may be obtained by recombinant or genetic engineering techniques that are routine and well-known in the art. Mutant KARI enzymes can, for example, be obtained by mutating the gene or genes encoding the KARI enzyme of interest by site-directed or random mutagenesis. Such mutations may include point mutations, deletion mutations and insertional mutations. For example, one or more point mutations (e.g., substitution of one or more amino acids with one or more different amino acids) may be used to construct mutant KARI enzymes of the invention.
(254) Ketol-acid reductoisomerase (KARI) catalyzes the reduction of acetolactate to 2,3-dihydroxyisovalerate. The two-step reaction involves an alkyl migration and a ketone reduction that occurs at a single active site on the enzyme without dissociation of any reaction intermediates. The enzyme is NADPH-dependent. The cofactor specificity may be expanded or switched so that it will utilize both cofactors and preferentially NADH during the production of isobutanol. A study published in 1997 (Rane, M. J. and K. C. Calvo, Archives of Biochemistry and Biophysics, 1997. 338: p. 83-89) describes a supposed cofactor-switched KARI quadruplet variant of the E. coli ilvC gene product with mutations R68D, K69L, K75V and R76D). However, in-house studies indicate that although the ratio NADH/NADPH was 2.5, the specific activity of this variant on NADH was actually worse than wildtype, rendering this enzyme not suited for the purpose of this disclosure.
(255) Modified or Mutated KARI Enzymes
(256) In accordance with the invention, any number of mutations can be made to the KARI enzymes, and in a preferred aspect, multiple mutations can be made to result in an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. Such mutations include point mutations, frame shift mutations, deletions, and insertions, with one or more (e.g., one, two, three, or four, etc.) point mutations preferred.
(257) Mutations may be introduced into the KARI enzymes of the present invention using any methodology known to those skilled in the art. Mutations may be introduced randomly by, for example, conducting a PCR reaction in the presence of manganese as a divalent metal ion cofactor. Alternatively, oligonucleotide directed mutagenesis may be used to create the mutant KARI enzymes which allows for all possible classes of base pair changes at any determined site along the encoding DNA molecule. In general, this technique involves annealing an oligonucleotide complementary (except for one or more mismatches) to a single stranded nucleotide sequence coding for the KARI enzyme of interest. The mismatched oligonucleotide is then extended by DNA polymerase, generating a double-stranded DNA molecule which contains the desired change in sequence in one strand. The changes in sequence can, for example, result in the deletion, substitution, or insertion of an amino acid. The double-stranded polynucleotide can then be inserted into an appropriate expression vector, and a mutant or modified polypeptide can thus be produced. The above-described oligonucleotide directed mutagenesis can, for example, be carried out via PCR.
(258) The invention further includes homologous KARI enzymes which are 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level to a wild-type KARI enzyme (e.g., encoded by the Ec_ilvC gene or S. cerevisiae ilv5 gene) and exhibit an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. Also included within the invention are KARI enzymes which are 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level to a KARI enzyme comprising the amino acid sequence set out in SEQ ID NO: 56 and exhibit an increased ability to utilize NADH for the conversion of acetolactate to 2,3-dihydroxyisovalerate. The invention also includes nucleic acid molecules which encode the above described KARI enzymes.
(259) The invention also includes fragments of KARI enzymes which comprise at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acid residues and retain one or more activities associated with KARI enzymes. Such fragments may be obtained by deletion mutation, by recombinant techniques that are routine and well-known in the art, or by enzymatic digestion of the KARI enzyme(s) of interest using any of a number of well-known proteolytic enzymes. The invention further includes nucleic acid molecules which encode the above described mutant KARI enzymes and KARI enzyme fragments.
(260) By a protein or protein fragment having an amino acid sequence at least, for example, 50% identical to a reference amino acid sequence it is intended that the amino acid sequence of the protein is identical to the reference sequence except that the protein sequence may include up to 50 amino acid alterations per each 100 amino acids of the amino acid sequence of the reference protein. In other words, to obtain a protein having an amino acid sequence at least 50% identical to a reference amino acid sequence, up to 50% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 50% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino (N) and/or carboxy (C) terminal positions of the reference amino acid sequence and/or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence and/or in one or more contiguous groups within the reference sequence. As a practical matter, whether a given amino acid sequence is, for example, at least 50% identical to the amino acid sequence of a reference protein can be determined conventionally using known computer programs such as those described above for nucleic acid sequence identity determinations, or using the CLUSTAL W program (Thompson, J. D., et al., Nucleic Acids Res. 22:4673 4680 (1994)).
(261) In one aspect, amino acid substitutions are made at one or more of the above identified positions (i.e., amino acid positions equivalent or corresponding to A71, R76, S78, or Q110 of E. coli llvC). Thus, the amino acids at these positions may be substituted with any other amino acid including Ala, Asn, Arg, Asp, Cys, Gin, Glu, Gly, His, lle, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val. A specific example of a KARI enzyme which exhibits an increased ability to utilize NADH includes an E. coli llvC KARI enzyme in which (1) the alanine at position 71 has been replaced with a serine, (2) the arginine at position 76 has been replaced with an aspartic acid, (3) the serine at position 78 has been replaced with an aspartic acid, and/or (4) the glutamine at position 110 has been replaced with valine (as described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527).
(262) Polypeptides having the ability to convert acetolactate to 2,3-dihydroxyisovalerate and/or 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate for use in the invention may be isolated from their natural prokaryotic or eukaryotic sources according to standard procedures for isolating and purifying natural proteins that are well-known to one of ordinary skill in the art (see, e.g., Houts, G. E., et al., J. Virol. 29:517 (1979)). In addition, polypeptides having the ability to convert acetolactate to 2,3-dihydroxyisovalerate and/or 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate may be prepared by recombinant DNA techniques that are familiar to one of ordinary skill in the art (see, e.g., Kotewicz, M. L., et al., Nucl. Acids Res. 16:265 (1988); Soltis, D. A., and Skalka, A. M., Proc. Natl. Acad. Sci. USA 85:3372 3376 (1988)).
(263) In accordance with the invention, one or more mutations may be made in any KARI enzyme of interest in order to increase the ability of the enzyme to utilize NADH, or confer other properties described herein upon the enzyme, in accordance with the invention. Such mutations include point mutations, frame shift mutations, deletions and insertions. Preferably, one or more point mutations, resulting in one or more amino acid substitutions, are used to produce KARI enzymes having an enhanced or increased ability to utilize NADH, particularly to facilitate the conversion of acetolactate to 2,3-dihydroxyisovalerate and/or the conversion of 2-aceto-2-hydroxy-butyrate to 2,3-dihydroxy-3-methylvalerate. In a preferred aspect of the invention, one or more mutations at positions equivalent or corresponding to position A71 (e.g., A71S), R76 (e.g., R76D), S78 (e.g. S78D), and/or Q110 (e.g. Q110V) and/or D146 (e.g. D146G), and/or G185 (e.g. G185R) and/or K433 (e.g. K433E) of the E. coli llvC KARI enzyme may be made to produce the desired result in other KARI enzymes of interest.
(264) The corresponding positions of the KARI enzymes identified herein (e.g. E. coli llvC may be readily identified for other KARI enzymes by one of skill in the art. Thus, given the defined region and the assays described in the present application, one with skill in the art can make one or a number of modifications which would result in an increased ability to utilize NADH, particularly for the conversion of acetolactate to 2,3-dihydroxyisovalerate, in any KARI enzyme of interest.
(265) In a preferred embodiment, the modified or mutated KARI enzymes have from 1 to 4 amino acid substitutions in amino acid regions involved in cofactor specificity as compared to the wild-type KARI enzyme proteins. In other embodiments, the modified or mutated KARI enzymes have additional amino acid substitutions at other positions as compared to the respective wild-type KARI enzymes. Thus, modified or mutated KARI enzymes may have at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 different residues in other positions as compared to the respective wild-type KARI enzymes. As will be appreciated by those of skill in the art, the number of additional positions that may have amino acid substitutions will depend on the wild-type KARI enzyme used to generate the variants. Thus, in some instances, up to 50 different positions may have amino acid substitutions.
(266) The nucleotide sequences for several KARI enzymes are known. For instance, the sequences of KARI enzymes are available from a vast array of microorganisms, including, but not limited to, Escherichia coli (GenBank No: NP_418222), Saccharomyces cerevisiae (GenBank Nos: NP_013459, Methanococcus maripaludis (GenBank No: YP_001097443), Bacillus subtilis (GenBank Nos: CAB14789), and the KARI enzymes from Piromyces sp (GenBank No: CAA76356), Buchnera aphidicola (GenBank No: AAF13807), Spinacia oleracea (GenBank Nos: Q01292 and CAA40356), Oryza sativa (GenBank No: NP_001056384) Chlamydomonas reinhardtii (GenBank No: XP_001702649), Neurospora crassa(GenBank No: XP_961335), Schizosaccharomyces pombe (GenBank No: NP_001018845), Laccaria bicolor (GenBank No: XP_001880867), Ignicoccus hospitalis (GenBank No: YP_001435197), Picrophilus torridus (GenBank No: YP_023851), Acidiphilium cryptum (GenBank No: YP_001235669), Cyanobacteria/Synechococcus sp. (GenBank No: YP_473733), Zymomonas mobilis (GenBank No: YP_162876), Bacteroides thetaiotaomicron (GenBank No: NP_810987), Methanococcus maripaludis (GenBank No: YP_001097443), Vibrio fischeri (GenBank No: YP_205911), Shewanella sp (GenBank No: YP_732498), Gramella forsetti (GenBank No: YP_862142), Psychromonas ingrhamaii (GenBank No: YP_942294), and Cytophaga hutchinsonii (GenBank No: YP_677763)
(267) Improved NADH-Dependent Activity
(268) In one aspect, the NADH-dependent activity of the modified or mutated KARI enzyme is increased.
(269) In a preferred embodiment, the catalytic efficiency of the modified or mutated KARI enzyme is improved for the cofactor NADH. Preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 5% as compared to the wild-type or parental KARI for NADH. More preferably the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 15% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 25% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 50% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 75% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 100% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 300% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 500% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 1000% as compared to the wild-type or parental KARI for NADH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is improved by at least about 5000% as compared to the wild-type or parental KARI for NADH.
(270) In a preferred embodiment, the catalytic efficiency of the modified or mutated KARI enzyme with NADH is increased with respect to the catalytic efficiency of the wild-type or parental enzyme with NADPH. Preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 10% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 25% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 50% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH. More preferably, the catalytic efficiency of the modified or mutated KARI enzyme is at least about 75%, 85%, 95% of the catalytic efficiency of the wild-type or parental KARI enzyme for NADPH.
(271) In a preferred embodiment, the K.sub.M of the KARI enzyme for NADH is decreased relative to the wild-type or parental enzyme. A change in K.sub.M is evidenced by at least a 5% or greater increase or decrease in K.sub.M compared to the wild-type KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 10 times decreased K.sub.M for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 30 times decreased K.sub.M for NADH compared to the wild-type or parental KARI enzyme.
(272) In a preferred embodiment, the k.sub.cat of the KARI enzyme with NADH is increased relative to the wild-type or parental enzyme. A change in k.sub.cat is evidenced by at least a 5% or greater increase or decrease in K.sub.M compared to the wild-type KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 50% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 100% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 200% increased k.sub.cat for NADH compared to the wild-type or parental KARI enzyme.
(273) Cofactor Switch
(274) In preferred embodiments, the cofactor specificity of the modified or mutated KARI enzyme is altered such that there is a cofactor switch from NADPH to NADH. In other words, these modified or mutated KARI enzymes will have an increase in NADH-dependent activity and a substantially simultaneous decrease in NADPH dependent activity. Thus, the methods of the present invention can be used to change the cofactor preference from NADPH to NADH.
(275) Cofactor specificity is a measure of the specificity of an enzyme for one cofactor over another. Thus, the methods of the present invention may be used to alter the cofactor preference of the target enzyme, such that the preference for the less favored cofactor is increased by 20%, 50%, 100%, 300%, 500%, 1000%, up to 2000%. For example, a number of reductase enzymes have been described that favor NADPH over NADH (see WO/2002/022526; WO/2002/029019; Mittl et al., 1994, Protein Sci., 3: 1504-14; Banta et al., (2002) Protein Eng., 15: 131-140; all of which are hereby incorporated by reference in their entirety). As the availability of NADPH is often limiting, both in vivo and in vitro, the overall activity of the target protein is often limited. For target proteins that prefer NADPH as a cofactor, it would be desirable to alter the cofactor specificity of the target protein (e.g. a KARI enzyme) to a cofactor that is more readily available, such as NADH.
(276) In a preferred embodiment, the cofactor specificity of the KARI enzyme is switched. By switched herein is meant, that the cofactor preference (in terms of catalytic efficiency (k.sub.cat/K.sub.M) of the KARI enzyme is changed to another cofactor Preferably, in one embodiment, by switching cofactor specificity, activity in terms of catalytic efficiency (k.sub.cat/K.sub.M) with the cofactor preferred by the wild-type KARI enzyme is reduced, while the activity with the less preferred cofactor is increased. This can be achieved, for example by increasing the k.sub.cat for less preferred cofactor over the preferred cofactor or by decreasing K.sub.M for the less preferred cofactor over the preferred cofactor or both.
(277) In a preferred embodiment, the KARI enzyme is modified or a mutated to become NADH-dependent. The term NADH-dependent refers to the property of an enzyme to preferentially use NADH as the redox cofactor. An NADH-dependent enzyme has a higher catalytic efficiency (k.sub.cat/K.sub.M) with the cofactor NADH than with the cofactor NADPH as determined by in vitro enzyme activity assays. Accordingly, the term NADPH-dependent refers to the property of an enzyme to preferentially use NADPH as the redox cofactor. An NADPH dependent enzyme has a higher catalytic efficiency (k.sub.cat/K.sub.M) with the cofactor NADPH than with the cofactor NADH as determined by in vitro enzyme activity assays.
(278) In a preferred embodiment, the catalytic efficiency of the KARI enzyme for NADH is enhanced relative to the catalytic efficiency with NADPH. The term catalytic efficiency describes the ratio of the rate constant k.sub.cat over the Michaelis-Menten constant K.sub.M. In one embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:10 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In another embodiment, the modified or mutated KARI enzyme exhibits at least about a 1:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In yet another embodiment, the modified or mutated KARI enzyme exhibits at least about a 10:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In yet another embodiment, the modified or mutated KARI enzyme exhibits at least about a 100:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH. In an exemplary embodiment, the modified or mutated KARI enzyme exhibits at least about a 100:1 ratio of catalytic efficiency (k.sub.cat/K.sub.M) with NADH over catalytic efficiency with NADPH.
(279) In a preferred embodiment, the K.sub.M of the KARI enzyme for NADH is decreased relative to the K.sub.M of the KARI enzyme for NADPH. In one embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 10:1 ratio of K.sub.M for NADH over K.sub.M for NADPH. In one embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:1 ratio of K.sub.M for NADH over K.sub.M for NADPH. In a preferred embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:10 ratio of K.sub.M for NADH over K.sub.M for NADPH. In yet another embodiment, the invention is directed to a modified or mutated KARI enzyme that exhibits at least about a 1:20, 1:100, 1:1000 ratio of K.sub.M for NADH over K.sub.M for NADPH.
(280) In another preferred embodiment, the k.sub.cat of the KARI enzyme with NADH is increased relative to k.sub.cat with NADPH. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 0.8:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 1:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH. In a preferred embodiment, modified or mutated KARI enzymes of the present invention may show greater than 10:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH. In certain embodiments, modified or mutated KARI enzymes of the present invention may show greater than 100:1 ratio of k.sub.cat with NADH over k.sub.cat with NADPH.
(281) Identification of Corresponding Amino Acid Substitutions in Homologous Enzymes
(282) An amino acid sequence alignment of 22 KARIs (including E. coli llvC, spinach KARI and rice KARI) was described in commonly owned and co-pending applications U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527). Various KARIs aligned with the E. coli KARI sequence at amino acid positions 71, 76, 78, and 110 and this allows to conclude that the beneficial mutations found for E. coli KARI confer the same effects in these KARI enzymes.
(283) A structure alignment of E. coli KARI (PDB ID NO. 1YRL) with rice KARI (PDB ID NO. 3FR8) as a representative of the shorter loop group has been performed and the sites of useful mutations in the E. coli context corresponded reasonably well with specific residues in the context of the shorter loop: Ser165, Lys166, and Ser167. Ser165 of (corresponding to A71 in E. coli) therefore may be substituted with aspartate. A charge reversal at position K166 (corresponding to position R76D) may yield the same result. Ser167 may correspond to Ser78 and a mutation to aspartate corresponds to a beneficial mutation at Q110, and thus can be transferable in the aligned KARIs.
(284) NADH-Dependent ADH Enzymes
(285) Several alcohol dehydrogenases may be suitable candidates for conversion into an NADH-dependent isobutyraldehyde dehydrogenase. Among the exemplary enzymes for conversion are S. cerevisiae ADH1, Zymomonas mobilis ADHII, E. coli YqhD, herein referred to as Ec_YqhD, and S. cerevisiae ADH7.
(286) As described in WO/2008/098227, the S. cerevisiae ADH2 gene is expected to be functionally expressed from pSA55 and required for catalyzing the final step of the isobutanol biosynthetic pathway, namely the conversion of isobutyraldehyde to isobutanol. Thus, no isobutanol should be produced with the plasmid combination lacking ADH2 as adhE is deleted in JCL260. However, the results of a fermentation using a strain without overexpression of any gene encoding an enzyme with ADH activity for the conversion of isobutyraldehyde to isobutanol showed that overexpression of an ADH enzyme is not required for isobutanol production in E. coli. In fact, isobutanol production for the system lacking ADH2 was higher than for the system with ADH2 expression. Volumetric productivity and titer showed 42% increase, specific productivity showed 18% increase and yield 12% increase. This suggests strongly that a native E. coli dehydrogenase is responsible for the conversion of isobutyraldehyde to isobutanol.
(287) Surprisingly, this last step of the isobutanol biosynthetic pathway was found to be carried out by a native E. coli dehydrogenase. Approximately 80% of the isobutyraldehyde reduction activity is due to Ec_YqhD under certain culture conditions. Available literature on Ec_YqhD suggests that while it does prefer long-chain alcohols, it also utilizes NADPH (versus NADH) (Perez et al., 2008, J. Biol. Chem. 283: 7346-53).
(288) Switching the cofactor specificity of an NADPH-dependent alcohol dehydrogenase may be complicated by the fact that cofactor binding induces a conformational change, resulting in an anhydrous binding pocket that facilitates hydride transfer from the reduced cofactor to the aldehyde (Leskovac et al., 2002, Ferns Yeast Research, 2: 481-94; Reid et al., 1994, Critical Reviews in Microbiology, 20: p. 13-56). Mutations that are beneficial for binding NADH may have deleterious effects with respect to this conformational change.
(289) Alternatively, isobutyraldehyde reduction activity of an NADH-dependent enzyme with little native activity towards this substrate may be increased. This approach has the advantages that (1) several specialized enzymes exist in nature that are highly active under fermentative conditions, (2) the binding sites of several of these enzymes are known, (3) mutational studies indicate that substrate specificity can easily be altered to achieve high activity on a new substrate.
(290) Several alcohol dehydrogenase enzymes may be suitable candidates for conversion into an NADH-dependent isobutyraldehyde dehydrogenase: S. cerevisiae ADH1 and Zymomonas mobilis ADHII are NADH-dependent enzymes responsible for the conversion of acetaldehyde to ethanol under anaerobic conditions. These enzymes are highly active. The substrate specificity for these enzymes has been analyzed (Leskovac et al., 2002, Ferns Yeast Research, 2: 481-94; Rellos et al., 1997, Protein Expression and Purification, 9: 89-90), the amino acid residues comprising the substrate binding pocket are known (Leskovac et al., 2002, Ferns Yeast Research, 2: 481-94; Rellos et al., 1997, Protein Expression and Purification, 9: 89-90), and attempts to alter the substrate specificity by mutation have revealed that the substrate specificity can be altered (Rellos et al., 1997, Protein Expression and Purification, 9: 89-90; Green et al., 1993, J. Biol. Chem., 268: 7792-98). Ec_YqhD and S. cerevisiae ADH7 are NADPH-dependent enzymes whose physiological functions are not as well understood. Ec_YqhD has been implicated in the protection of the cell from peroxide-derived aldehydes (Perez et al., 2008, J. Biol. Chem. 283: 7346-53). The substrate specificity of both enzymes is understood, and amino acids lining the substrate binding pocket are known (Perez et al., 2008, J. Biol. Chem. 283: 7346-53). Based on the known amino acid residues implicated in substrate binding (S. cerevisiae ADH1, Z. mobilis ADHII) or the cofactor binding site (Ec_yqhD), sites with the highest likelihood of affecting desired enzyme features such as substrate specificity or cofactor specificity may be mutated to generate the desired function.
(291) One approach to increase activity of enzymes with NADH as the cofactor is saturation mutagenesis with NNK libraries at each of the residues that interact with the cofactor. These libraries can be screened for activity in the presence of NADPH and NADH in order to identify which single mutations contribute to increased activity on NADH and altered specificity for NADH over NADPH. Combinations of mutations at aforementioned residues can be investigated by any method known in the art. For example, a combinatorial library of mutants may be designed based on the results of the saturation mutagenesis studies. For example, a combinatorial library of mutants may be designed including only those mutations that do not lead to decrease in NADH-dependent activity.
(292) Another approach to increase the NADH-dependent activity of the enzyme is to perform saturation mutagenesis of a first amino acid that interacts with the cofactor, then isolate the mutant with the highest activity using NADH as the cofactor, then perform saturation mutagenesis of a second amino acid that interacts with the cofactor, and so on. Similarly, a limited number of amino acids that interact with the cofactor may be targeted for randomization simultaneously and then be screened for improved activity with NADH as the cofactor. The selected, best mutant can then be subjected to the same procedure again and this approach may be repeated iteratively until the desired result is achieved.
(293) Another approach is to use random oligonucleotide mutagenesis to generate diversity by incorporating random mutations, encoded on a synthetic oligonucleotide, into the cofactor binding region of the enzyme. The number of mutations in individual enzymes within the population may be controlled by varying the length of the target sequence and the degree of randomization during synthesis of the oligonucleotides. The advantages of this more defined approach are that all possible amino acid mutations and also coupled mutations can be found.
(294) If the best variants from the experiments described above are not sufficiently active with NADH as the cofactor, directed evolution via error-prone PCR may be used to obtain further improvements. Error-prone PCR mutagenesis of the first domain containing the cofactor binding pocket may be performed followed by screening for ADH activity with NADH and/or increased specificity for NADH over NADPH as the cofactor.
(295) Surprisingly, alcohol dehydrogenase enzymes that are not known to catalyze the reduction of isobutyraldehyde to isobutanol were identified that catalyze this reaction. Thus, in another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,3-propanediol dehydrogenase. In yet another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,2-propanediol dehydrogenase. Preferred enzymes of this disclosure include enzymes listed in Table 1 of co-pending and commonly owned U.S. Ser. No. 12/610,784 and PCT/US09/62952 (published as WO/2010/051527). These enzymes exhibit NADH-dependent isobutyraldehyde reduction activity, measured as Unit per minute per mg of crude cell lysate (U min.sup.1 mg.sup.1) that is approximately six-fold to seven-fold greater than the corresponding NADPH-dependent isobutyraldehyde reduction activity.
(296) In addition to exhibiting increased activity with NADH as the cofactor as compared to the NADPH, alcohol dehydrogenases of the present invention may further be more active as compared to the native E. coli alcohol dehydrogenase Ec_YqhD. In particular, alcohol dehydrogenases of the present invention may exhibit increased activity and/or decreased K.sub.M values with NADH as the cofactor as compared to Ec_YqhD with NADPH as the cofactor. Exemplary enzymes that exhibit greater NADH-dependent alcohol dehydrogenase activity than the NADPH-dependent alcohol dehydrogenase activity are listed include the Drosophila melanogaster ADH, the L. lactis adhA, K. pneumoniae dhaT, and E. coli fucO (see Table 1 of U.S. Ser. No. 12/610,784).
(297) Alcohol dehydrogenases of the present disclosure may also be utilized in metabolically-modified microorganisms that include recombinant biochemical pathways useful for producing additional alcohols such as 2-methyl-1-butanol, 3-methyl-1-butanol, 2-phenylethanol, 1-propanol, or 1-butanol via conversion of a suitable substrate by a modified microorganism.
(298) Microorganisms producing such compounds have been described (WO/2008/098227). For example, these alcohols can be 1-propanol, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol or 2-phenylethanol and are generally produced from a metabolite comprising a 2-keto acid. In some aspects, the 2-keto acid includes 2-ketobutyrate, 2-ketovalerate, 2-keto-3-methylvalerate, 2-keto-4-methyl-pentanoate, or phenylpyruvate. The 2-ketoacid is converted to the respective aldehyde by a 2-ketoacid decarboxylase. For example, 2-ketobutyrate is converted to 1-propanal, 2-ketovalerate is converted to 1-butanal, 2-keto-3-methylvalerate is converted to 2-methyl-1-butanol, 2-keto-4-methyl-pentanoate is converted to 3-methyl-1-butanal, and phenylpyruvate is converted to phenylethanal by a 2-ketoacid decarboxylase. Thus, the recombinant microorganism includes elevated expression or activity of a 2-keto-acid decarboxylase, as compared to a parental microorganism. The 2-keto-acid decarboxylase may be encoded by kivD from Lactococcus lactis, or homologs thereof. The 2-keto-acid decarboxylase can be encoded by a polynucleotide derived from a gene selected from kivD from L. lactis, or homologs thereof.
(299) In earlier publications (See, e.g., WO/2008/098227), only NADPH-dependent alcohol dehydrogenases are described that convert the aforementioned aldehyde to an alcohol. In particular, S. cerevisiae Adh2p is described that converts the aldehyde to the respective aldehyde.
(300) Thus, in one embodiment of this disclosure, a microorganism is provided in which the cofactor dependent final step for the conversion of the aldehyde to the respective alcohol is catalyzed by an NADH-dependent alcohol dehydrogenase. In particular, NADH-dependent alcohol dehydrogenases are disclosed that catalyze the reduction aldehydes to alcohols, for example, of 1-propanal to 1propanol, 1-butanal to 1-butanol, 2-methyl-1-butanal to 2-methyl-1-butanol, 3-methyl-1-butanal to 3-methyl-1-butanol, or phenylethanal to phenylethanol.
(301) In a specific aspect, such an alcohol dehydrogenase may be encoded by the Drosophila melanogaster alcohol dehydrogenase Dm_Adh or homologs thereof. In another specific aspect, such an alcohol dehydrogenase may be encoded by the Lactococcus lactis alcohol dehydrogenase (LI_AdhA) or homologs thereof.
(302) Surprisingly, alcohol dehydrogenase enzymes that are not known to catalyze the reduction of isobutyraldehyde to isobutanol were identified that catalyze this reaction. Thus, in another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,3-propanediol dehydrogenase. In yet another aspect, such an alcohol dehydrogenase may be encoded by an NADH-dependent 1,2-propanediol dehydrogenase.
(303) In another embodiment, a method of producing an alcohol is provided. The method includes providing a recombinant microorganism provided herein; culturing the microorganism of in the presence of a suitable substrate or metabolic intermediate and under conditions suitable for the conversion of the substrate to an alcohol; and detecting the production of the alcohol. In various aspects, the alcohol is selected from 1-propanol, 1-butanol, 2-methyl 1-butanol, 3-methyl 1-butanol, and 2-phenylethanol. In another aspect, the substrate or metabolic intermediate includes a 2-keto acid-derived aldehyde, such as 1-propanal, 1-butanal, 2-methyl-1-butanal, 3-methyl-1-butanal, or phenylethanal.
(304) Recombinant Host Cells Comprising a NADH-Dependent KARI and/or ADH Enzymes
(305) In an additional aspect, the present invention is directed to recombinant host cells (i.e. metabolically engineered or modified microorganisms) comprising NADH-dependent KARI and/or ADH enzymes of the invention. Recombinant microorganisms provided herein can express a plurality of additional heterologous and/or native target enzymes involved in pathways for the production of beneficial metabolites such as isobutanol from a suitable carbon source.
(306) Accordingly, metabolically engineered or modified microorganisms are produced via the introduction of genetic material (i.e. a NADH-dependent KARI and/or ADH enzymes) into a host or parental microorganism of choice, thereby modifying or altering the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material and/or the modification of the expression of native genes the parental microorganism acquires new properties, e.g. the ability to produce a new, or greater quantities of, an intracellular metabolite. As described herein, the introduction of genetic material and/or the modification of the expression of native genes into a parental microorganism results in a new or modified ability to produce beneficial metabolites such as isobutanol. The genetic material introduced into and/or the genes modified for expression in the parental microorganism contains gene(s), or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of isobutanol and may also include additional elements for the expression and/or regulation of expression of these genes, e.g. promoter sequences.
(307) Recombinant microorganisms provided herein may also produce metabolites in quantities not available in the parental microorganism. A metabolite refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., 2-ketoisovalerate), or an end product (e.g., 1-propanol, 1-butanol, isobutanol, 2-methyl-1-butanol, 3-methyl-1-butanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.
(308) Exemplary metabolites include glucose, pyruvate, 1-propanol, 1-butanol, isobutanol, 2-methyl-1-butanol, and 3-methyl-1-butanol.
(309) The metabolite 1-propanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 1-propanol. An exemplary metabolic pathway that converts pyruvate to 1-propanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451(7174): 86-9), the disclosures of which are herein incorporated by reference in their entireties. In a preferred embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
(310) The metabolite 1-butanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 3-methyl-1-butanol. An exemplary metabolic pathway that converts pyruvate to 3-methyl-1-butanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451(7174): 86-9), the disclosures of which are herein incorporated by reference in their entireties. In a preferred embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
(311) The metabolite isobutanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to isobutanol. An exemplary metabolic pathway that converts pyruvate to isobutanol may be comprised of a acetohydroxy acid synthase (ALS) enzyme encoded by, for example, alsS from B. subtilis, a ketolacid reductoisomerase (KARI) of the present invention, a dihydroxy-acid dehydratase (DHAD), encoded by, for example ilvD from E. coli or L. lactis, a 2-keto-acid decarboxylase (KIVD) encoded by, for example kivd from L. lactis, and an alcohol dehydrogenase (ADH) of the present invention.
(312) The metabolite 3-methyl-1-butanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 3-methyl-1-butanol. An exemplary metabolic pathway that converts pyruvate to 3-methyl-1-butanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451(7174): 86-9), the disclosures of which are herein incorporated by reference in their entireties. In a preferred embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
(313) The metabolite 2-methyl-1-butanol can be produced by a recombinant microorganism engineered to express or over-express a metabolic pathway that converts pyruvate to 2-methyl-1-butanol. An exemplary metabolic pathway that converts pyruvate to 2-methyl-1-butanol has been described in WO/2008/098227 and by Atsumi et al. (Atsumi et al., 2008, Nature 451: 86-9), the disclosures of which are herein incorporated by reference in their entireties. In an exemplary embodiment, metabolic pathway comprises a KARI and/or an ADH enzyme of the present invention.
(314) The disclosure identifies specific genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutation and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme using methods known in the art. In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein.
(315) Microorganism Characterized by Increased Capacity to Produce Intermediates of the Isobutanol Pathway
(316) As a consequence of increased yield of isobutanol, it follows that this yeast microorganism exhibits a higher capacity to produce the intermediates of the isobutanol pathway including, but not limited to, acetolactate, 2,3-dihydroxyisovalerate, keto-isovalerate, and isobutyraldehyde.
(317) Method of Using Microorganism for High-Yield Isobutanol Fermentation
(318) In a method to produce isobutanol from a carbon source at high yield, the yeast microorganism is cultured in an appropriate culture medium containing a carbon source.
(319) Another exemplary embodiment provides a method for producing isobutanol comprising a recombinant yeast microorganism of the invention in a suitable culture medium containing a carbon source that can be converted to isobutanol by the yeast microorganism of the invention.
(320) In certain embodiments, the method further includes isolating isobutanol from the culture medium. For example, isobutanol may be isolated from the culture medium by any method known to those skilled in the art, such as distillation, pervaporation, or liquid-liquid extraction.
EXAMPLES
(321) General Methods
(322) Sample Preparation:
(323) Samples (2 mL) from the fermentation broth were stored at 20 C. for later substrate and product analysis. Prior to analysis, samples were thawed and then centrifuged at 14,000g for 10 min. The supernatant was filtered through a 0.2 m filter. Analysis of substrates and products was performed using authentic standards (>99%, obtained from Sigma-Aldrich), and a 5-point calibration curve (with 1-pentanol as an internal standard for analysis by gas chromatography).
(324) Determination of Optical Density and Cell Dry Weight:
(325) The optical density of the yeast cultures was determined at 600 nm using a DU 800 spectrophotometer (Beckman-Coulter, Fullerton, Calif., USA). Samples were diluted as necessary to yield an optical density of between 0.1 and 0.8. The cell dry weight was determined by centrifuging 50 mL of culture prior to decanting the supernatant. The cell pellet was washed once with 50 mL of milliQ H.sub.2O, centrifuged and the pellet was washed again with 25 mL of milliQ H.sub.20. The cell pellet was then dried at 80 C. for at least 72 hours. The cell dry weight was calculated by subtracting the weight of the centrifuge tube from the weight of the centrifuge tube containing the dried cell pellet.
(326) Gas Chromatography:
(327) Analysis of ethanol and isobutanol was performed on a HP 5890 gas chromatograph fitted with a DB-FFAP column (Agilent Technologies; 30 m length, 0.32 mm ID, 0.25 M film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200 C. for the injector, 300 C. for the detector, 100 C. oven for 1 minute, 70 C./minute gradient to 235 C., and then hold for 2.5 min.
(328) High Performance Liquid Chromatography:
(329) Analysis of glucose and organic acids was performed on a HP-1100 High Performance Liquid Chromatography system equipped with an Aminex HPX-87H Ion Exclusion column (Bio-Rad, 3007.8 mm) or equivalent and an H.sup.+ cation guard column (Bio-Rad) or equivalent. Organic acids were detected using an HP-1100 UV detector (210 nm, 8 nm 360 nm reference) while glucose was detected using an HP-1100 refractive index detector. The column temperature was 60 C. This method was Isocratic with 0.008N sulfuric acid in water as mobile phase. Flow was set at 0.6 mL/min. Injection size was 20 L and the run time was 30 minutes.
(330) Anaerobic Batch Fermentations:
(331) Anaerobic batch cultivations were performed at 30 C. in stoppered 100 mL serum bottles. A total of 20 mL of synthetic medium with an initial glucose concentration of 20 g-glucose L.sup.1 was used (Kaiser et al., Methods in Yeast Genetics, a Cold Spring Harbor Laboratory Manual (1994)). 2 mL samples are taken at 24 and 48 hours. The fermentation is ended after 48 hours or when all glucose is consumed. Samples are processed and analyzed by Gas Chromatography and/or High Performance Liquid Chromatography as described above.
(332) Yeast TransformationsK. lactis:
(333) Transformations were performed by electroporation according to Kooistra et al., Yeast 21:781-792 (2004).
(334) Lithium Acetate transformations of S. cerevisiae strains were transformed by the Lithium Acetate method (Gietz et al., Nucleic Acids Res. 27:69-74 (1992). Cells were collected from overnight cultures grown in 50 mL of defined (SC) ethanol media at an OD.sub.600 of approximately 0.8 to 1.0 by centrifugation at 2700 rcf for 2 minutes at room temperature. The cell pellet was resuspended in 50 mL sterile water, collected by centrifugation (2700 rcf; 2 min; room temp.), and resuspended in 25 mL sterile water. The cells were collected by centrifugation (2700 rcf; 2 min; room temp.) and resuspended in 1 mL 100 mM lithium acetate. The cell suspension was transferred to a sterile 1.5 mL tube and collected by centrifugation at full speed for 10 seconds. The cells were resuspended in 100 mM lithium acetate with a volume four times the volume of the cell pellet (e.g. 400 L for 100 L cell pellet). To the prepared DNA Mix (72 l 50% PEG, 10 l 1M Lithium Acetate, 3 l boiled salmon sperm DNA, and 5 l of each plasmid), 15 l of the cell suspension was added and mixed by vortexing with five short pulses. The cell/DNA suspensions were incubated at 30 C. for 30 minutes and at 42 C. for 22 minutes. The cells were collected by centrifugation for 10 seconds at full speed and resuspended in 100 l SOS (1M Sorbitol, 0.34% (w/v) Yeast Extract, 0.68% (w/v) Peptone, 6.5 mM CaCl). The cell suspensions were top spread over appropriate selective agar plates.
(335) Yeast Colony PCR:
(336) Yeast cells were taken from agar medium and transferred to 30 l 0.2% SDS and heated for 4 mins at 90 C. The cells were spun down and 1 l of the supernatant was used for PCR using standard Taq (NEB).
(337) Molecular Biology:
(338) Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook & Russell).
(339) Media:
(340) YP: contains 1% (w/v) yeast extract, 2% (w/v) peptone. YPD is YP containing 2% (w/v) glucose, YPE is YP containing 2% (w/v) Ethanol.
(341) SC+Complete: 20 g/L glucose, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco Yeast Nitrogen Base. 0.076 g/L histidine, 0.076 g/L tryptophan, 0.380 g/L leucine, and 0.076 g/L uracil.
(342) SC-HWUL: 20 g/L glucose, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco Yeast Nitrogen Base
(343) SC-WLU: 20 g/L glucose, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 6.7 g/L Difco Yeast Nitrogen Base without amino acids, and 0.076 g/L histidine.
(344) SC-HWU: 20 g/L glucose, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 6.7 g/L Difco Yeast Nitrogen Base without amino acids, and 0.380 g/L leucine.
(345) SC-Ethanol-HWU: 2% (w/v) ethanol, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), 6.7 g/L Difco Yeast Nitrogen Base, and 0.380 g/L leucine.
(346) Solid versions of the above described media contain 2% (w/v) agar.
(347) Strains, Plasmids and Primer Sequences
(348) TABLE-US-00001 TABLE 1 details the genotype of strains diclosed herein: GEVO No. Genotype and/or Reference GEVO1187 S. cerevisiae CEN.PK MAT a ho his3- leu2 trp1 ura3 PDC1 PDC5 PDC6 GEVO1188 S. cerevisiae CEN.PK MAT alpha ho his3- leu2 trp1 ura3 PDC1 PDC5 PDC6 GEVO1287.sup.1 K. lactis MAT uraA1 trp1 leur2 lysA1 ade1 lac4-8 [pKD1] (ATCC #87365) GEVO1537.sup.2 S. cerevisiae HO/HO pdc1::Tn5ble/pdc1::Tn5ble pdc5::Tn5ble/pdc5::Tn5ble pdc6::APT1/pdc6::APT1 HIS3/HIS, LEU2/LEU2, URA3/URA3, TRP1/TRP1 Gevo1538 S. cerevisiae MAT a/, HIS3, LEU2, TRP1, URA3, pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO GEVO1581 S. cerevisiae MAT a/alpha, his3/his3, trp1/trp1, ura3/ura3, LEU2/LEU2, pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO Gevo1715 S. cerevisiae MAT a, leu2, ura3, pdc1::ble, pdc5::ble, pdc6::apt1(kanR), ho GEVO1584 S. cerevisiae MAT a, his3, trp1, ura3, leu2, pdc1::ble, pdc5::ble, pdc6::apt1(kanR), ho- GEVO1742 K. lactis MAT uraA1 trp1 leur2 lysA1 ade1 lac4-8 [pKD1] Klpdc1::pGV1537 (G418.sup.R)] GEVO1794 K. lactis MATalpha uraA1 trp1 leu2 lysA1 ade1 lac4-8 [pKD1] pdc1::kan {Ll-kivd; Sc- Adh7:KmURA3 integrated} GEVO1818 K. lactis MATalpha uraA1 trp1 leu2 lysA1 ade1 lac4-8 [pKD1] pdc1::kan {Ec-ilvC- deltaN; Ec-ilvD-deltaN(codon opt for K. lactis):Sc-LEU2 integrated} {Ll-kivd; Sc- Adh7:KmURA3 integrated} GEVO1829 K. lactis MATalpha uraA1 trp1 leu2 lysA1 ade1 lac4-8 [pKD1] pdc1::kan {Ec-ilvC- deltaN; Ec-ilvD-deltaN(codon opt for K. lactis):Sc-LEU2 integrated} {Ll-kivd; Sc- Adh7:KmURA3 integrated} {ScCUP1-1 promoter:Bs alsS, TRP1 random integrated} Gevo1863 S. cerevisiae MAT a, his3, trp1, ura3, leu2, pdc1::ble, pdc5::ble, pdc6::apt1(kanR), ho-, chemostat-evolved to be C2-independent. .sup.1same as ATCC200826 .sup.2The strains Gevo1537 and Gevo1538 were originally designated GG570 (derived from strain T2-3D)and was obtained from Paul van Heusden from the University of Leiden, the Netherlands. For complete references for both strains, see: Flikweert, M. T. et al., (1996) Yeast 12: 247-257.
(349) TABLE-US-00002 TABLE 2 outlines the plasmids disclosed herein: GEVO No. FIG. Genotype or Reference pGV1056 23 bla(amp.sup.r) S.c. TDH3 promoter - polylinker - CYC1 terminator CEN6/ARSH4 HIS3 pUC ori pGV1062 24 bla(amp.sup.r) S.c. TDH3 promoter - polylinker - CYC1 terminator CEN6/ARSH4 URA3 pUC ori pGV1102 25 bla(amp.sup.r) S.c. TEF1 promoter - HA tag - polylinker - CYC1 terminator 2 micron URA3 pUC ori pGV1103 26 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 2 micron HIS3 pUC ori pGV1104 27 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 2 micron TRP1 pUC ori pGV1106 28 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 2 micron URA3 pUC ori pGV1254 16 bla(amp.sup.r) S.c. TEF1 promoter - HA-L.l. KIVD - S.c. TDH3 promoter - myc-S.c. ADH2 - CYC1 terminator 2 micron URA3 pUC ori pGV1295 17 bla(amp.sup.r) S.c. TDH3 promoter - myc-ilvC - CYC1 terminator 2 micron TRP1 pUC ori pGV1390 18 bla(amp.sup.r) S.c. CUP1-1 promoter - L.l. alsS - CYC1 terminator 2 micron HIS3 pUC ori pGV1438 19 bla(amp.sup.r) S.c. TDH3 promoter - myc-ilvD- CYC1 terminator 2 micron LEU2 pUC ori pGV1503 8 bla(amp.sup.r) S.c. TEF1 promoter - KanR pUC ori pGV1537 9 bla(amp.sup.r) S.c. TEF1 promoter - KanR pUC ori K. lactis PDC1 5 region - PmlI - K. lactis PDC1 3 region pGV1429 10 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 1.6 micron TRP1 pUC ori pGV1430 11 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 1.6 micron LEU2 pUC ori pGV1431 12 bla(amp.sup.r) S.c. TDH3 promoter - myc tag - polylinker - CYC1 terminator 1.6 micron K.m. URA3 pUC ori pGV1472 13 bla(amp.sup.r) S.c. TEF1 promoter - AU1(x2)-L.l. alsS- CYC1 terminator 1.6 micron LEU2 pUC ori pGV1473 14 bla(amp.sup.r) S.c. TEF1 promoter - AU1(x2)-E.c. ilvD - S.c. TDH3 promoter - myc-E.c. ilvC - CYC1 terminator 1.6 micron TRP1 pUC ori pGV1475 15 bla(amp.sup.r) S.c. TEF1 promoter - HA-L.l. KIVD - S.c. TDH3 promoter - myc-S.c. ADH7 - CYC1 terminator 1.6 micron K.m. URA3 pUC ori pGV1590 20 bla(amp.sup.r) S.c. TEF1 promoter - L.l. KIVD - S.c. TDH3 promoter - S.c. ADH7 - CYC1 terminator 1.6 micron K.m. URA3 pUC ori pGV1726 21 bla(amp.sup.r) S.c. CUP1-1 promoter - B.s. alsS - CYC1 terminator TRP1 pUC ori pGV1727 22 bla(amp.sup.r) S.c. TEF1 promoter - E.c. ilvD deltaN- S.c. TDH3 promoter -E.c. ilvC deltaN- CYC1 terminator LEU2 pUC ori pGV1649 29 bla(amp.sup.r) S.c. CUP1-1 promoter - B.s. alsS - CYC1 terminator 2 micron TRP1 pUC ori pGV1664 30 bla(amp.sup.r) S.c. TEF1 promoter - L.l. KIVD - S.c. TDH3 promoter - S.c. ADH7 - CYC1 terminator 2 micron URA3 pUC ori pGV1672 31 bla(amp.sup.r) S.c. CUP1-1 promoter - polylinker - CYC1 terminator CEN6/ARSH4 TRP1 pUC ori pGV1673 32 bla(amp.sup.r) S.c. CUP1-1 promoter - B.s. alsS - CYC1 terminator CEN6/ARSH4 TRP1 pUC ori pGV1677 33 bla(amp.sup.r) S.c. TEF1 promoter - E.c. ilvD deltaN- S.c. TDH3 promoter -E.c. ilvC deltaN- CYC1 terminator 2 micron HIS3 pUC ori pGV1679 34 bla(amp.sup.r) S.c. TEF1 promoter - E.c. ilvD deltaN- S.c. TDH3 promoter -E.c. ilvC deltaN- CYC1 terminator CEN6/ARSH4 HIS3 pUC ori pGV1683 35 bla(amp.sup.r) S.c. TEF1 promoter - L.l. KIVD - S.c. TDH3 promoter - S.c. ADH7 - CYC1 terminator CEN6/ARSH4 URA3 pUC ori
(350) TABLE-US-00003 TABLE3 outlinestheprimerssequencesdisclosedherein: No. Name SEQIDNO: Sequence 489 MATcommon 30 AGTCACATCAAGATCGTTTATGG 490 MATalpha 31 GCACGGAATATGGGACTACTTCG 491 MATa 32 ACTCCACTTCAAGTAAGAGTTTG 838 pGV1423-seq1(838) 33 TATTGTCTCATGAGCGGATAC 965 KIPDC1616FOR 34 ACAACGAGTGTCATGGGGAGAGGAAGAGG 966 KIPDC1+2528REV 35 GATCTTCGGCTGGGTCATGTGAGGCGG 995 KIPDC1internal 36 ACGCTGAACACGTTGGTGTCTTGC 996 KIPDC1internal 37 AACCCTTAGCAGCATCGGCAACC 1010 KI-PDC1-prom-seo-c 38 TATTCATGGGCCAATACTACG 1006 KI-FDC1-prom-3c 39 GTAGAAGACGTCACCTGGTAGACCAAAGATG 1009 KI-PDC1-term-5c 40 CATCGTGACGTCGCTCAATTGACTGCTGCTAC 1016 KI-PDC1-prom-5-v2(1016) 41 ACTAAGCGACACGTGCGGTTTCTGTGGTATAG 1017 KI-PDC1-term-3c-v2(1017) 42 GAAACCGCACGTGTCGCTTAGTTTACATTTCTTTCC 1019 TEF1prom-5c(1019) 43 TTTGAAGTGGTACGGCGATG 1321 Bs-alsS-Q-A5(1321) 44 AATCATATCGAACACGATGC 1324 Bs-alsS-Q-B3(1324) 45 AGCTGGTCTGGTGATTCTAC 1325 Ec-ilvC-dN-Q-A5(1325) 46 TATCACCGTAGTGATGGTTG 1328 Ec-livC-dN-Q-B3(1328) 47 GTCAGCAGTTTCTTATCATCG 1330 Ec-ilvD-dN-co-KI-Q-A3(1330) 48 GCGAAACTTACTTGACGTTC 1331 Ec-ilvD-ON-co-KI-Q-B5(1331) 49 ACTTTGGACGATGATAGAGC 1334 LI-kivd-co-Ec-Q-A3(1334) 50 GCGTTAGATGGTACGAAATC 1335 LI-kivd-co-Ec-Q-B5(1335) 51 CTTCTAACACTAGCGACCAG 1338 Sc-ADH7-Q-A3(1338) 52 AAAGATGATGAGCAAACGAC 1339 Sc-ADH7-Q-B5(1339) 53 CGAGCAATACTGTACCAATG 1375 HO+ 1300F 54 TCACGGATGATTTCCAGGGT 1376 HO+ 1761R 55 CACCTGCGTTGTTACCACAA
Example 1: Construction and Confirmation of PDC Deletion in K. lactis
(351) The purpose of this Example is to describe how a PDC-deletion variant of a member of the Saccharomyces clade, Crabtree-negative yeast, pre-WGD yeast K. lactis was constructed and confirmed.
(352) Construction of Plasmid pGV1537:
(353) Plasmid pGV1537 (SEQ ID NO: 1) was constructed by the following series of steps. All PCR reactions carried out to generate pGV1537 used KOD polymerase (Novagen, Inc., Gibbstown, N.J.) and standard reaction conditions according to the manufacturer. A first round of two PCR reactions was carried out, wherein one PCR reaction contained primers 1006 and 1016 and used approximately 100 ng of genomic DNA from K. lactis strain GEVO1287 as a template. The other first-round PCR reaction contained primers 1017 and 1009 and approximately 100 ng of genomic DNA from K. lactis strain GEVO1287 as a template. The two resulting PCR products (approximately 530 bp and 630 bp in size, respectively) were gel purified using a Zymo Research Gel DNA Extraction kit (Zymo Research, Orange, Calif.) according to manufacturer's instructions and eluted into 10 L of water. Two (2) microliters of each eluted PCR product were then used as a template for a final round of KOD polymerase-catalyzed PCR, which also included primers 1006 plus 1009. The resulting product was purified (Zymo Research DNA Clean & Concentrate kit, Zymo Research, Orange, Calif.), digested to completion with the enzymes Mfel and Aatll, and the resulting product gel purified and eluted as described above. This DNA was ligated into the vector pGV1503 (
(354) Construction of a K. lactis Klpdc1 Strain:
(355) Strain GEVO1287 was transformed with PmlI-digested, linearized plasmid pGV1537. Transformation was carried out by electroporation with approximately 300 ng of linearized pGV1537, essentially as described by Kooistra et al. (Kooistra, R., Hooykaas, P. J. J., and Steensman, H. Y. (2004) Efficient gene targeting in Kluyveromyces lactis. Yeast 21:781-792). Transformed cells were selected by plating onto YPD plates containing 0.2 mg/mL geneticin (G418). Colonies arising from the transformation were further selected by patching colonies onto YPD plates and then replica plating onto YPD containing 5 M (final concentration) of the respiratory inhibitor Antimycin A, as Pdc-variants of K. lactis are unable to grow on glucose in the presence of Antimycin A (Bianchi, M., et al., (1996). The petite negative yeast Kluyveromyces lactis has a single gene expressing pyruvate decarboxylase activity. Molecular Microbiology 19(1):27-36) and can therefore be identified by this method. Of the 83 G418-resistant colonies patched onto YPD+Antimycin A, six colonies (7%) were unable to grow and were therefore identified as candidate Klpdc1::pGV1537 disruption strains.
(356) Confirmation of a K. lactis Klpdc1Strain by Colony PCR:
(357) Candidate Klpdc1::pGV1537 disruption strains were confirmed by colony PCR analysis. To do so, genomic DNA from candidate lines was obtained by the following method. A small amount (equivalent to a matchhead) of yeast cells were resuspended in 50 L of 0.2% SDS and heated to 95 C. for 6 minutes. The suspension was pelleted by centrifugation (30 sec, 16,000g) and 1 L of the supernatant was used as template in 50 L PCR reactions. In addition to standard components, the reactions contained Triton X-100 at a final concentration of 1.5% and DMSO at a final concentration of 5%. The various primer sets used, and the expected amplicon sizes expected, are indicated in Table EX1-1. By these analyses, a correct Klpdc1::pGV1537 strain was identified and was named GEVO1742.
(358) TABLE-US-00004 TABLE EX1-1 Primer pairs and expected amplicon sizes predicted for colony PCR screening of candidate Klpdc1::pGV1537 cells. Expected product size for Expected product size Primer Pair Klpdc1:pGV1537 for KlPDC1+ 965 & 838 796 bp (none) 1019 & 966 947 bp (none) 995 & 996 (none) 765 bp
(359) Confirmation of GEVO1742 Klpdc1::DGV1537 by Fermentation:
(360) Strains of K. lactis lacking KlPdc1p (Klpdc1) have been shown to produce significantly lower levels of ethanol when grown on glucose (Bianchi, M., et al., (1996). The petite negative yeast Kluyveromyces lactis has a single gene expressing pyruvate decarboxylase activity. Molecular Microbiology 19(1):27-36). To confirm this phenotype, fermentations with strains GEVO1287 and GEVO1742 were carried out. Briefly, a saturated overnight (3 mL) culture of each strain grown in YPD was inoculated into 25 mL of YPD at a starting OD.sub.600 of 0.1 and grown aerobically in a loosely-capped flask in a shaker for 24 hours at 30 C., 250 rpm. Following growth, 2 mL of culture were collected, the cells pelleted by centrifugation (5 minutes, 14,000g) and the supernatant subjected to analysis by gas chromatography and liquid chromatography. A summary of the data from these analyses is summarized in Table EX1-2. The strongly diminished production of ethanol and the increased accumulation of pyruvate in the fermentation medium are characteristic of K. lactis strains in which PDC1 has been deleted. Thus, these observations confirm the molecular genetics conclusions that strain GEVO1742 is in fact Klpdc1.
(361) TABLE-US-00005 TABLE EX1-2 Ethanol and pyruvate produced and glucose consumed in aerobic fermentations of GEVO1287 and GEVO1742. Ethanol Pyruvate Glucose produced produced consumed STRAIN (g/L) (g/L) (g/L) GEVO1287 8.129 (not detected) 17.56 GEVO1742 0.386 1.99 5.25
Example 2: Construction and Confirmation of PDC Deletion in S. cerevisiae
(362) The purpose of this Example is to describe how a PDC deletion variant of a member of the Saccharomyces sensu stricto yeast group, the Saccharomyces yeast clade, a Crabtree-positive yeast, and a post-WGD yeast, S. cerevisiae was constructed and confirmed.
(363) Strains GEVO1537 and GEVO1538 were incubated in 1% potassium acetate for 3-4 days which induces sporulation. The resulting haploid spores were recovered by random spore analysis. Briefly, a culture of sporulating cells was examined microscopically to ensure that a sufficient fraction of cells had sporulated (>10%). Five (5) mL of a culture of sporulated cells were collected by centrifugation (5 minutes at 3000g) and washed once in 1 mL of water. The cells were resuspended in 5 mL water to which was added 0.5 mL of a 1 mg/mL solution (freshly made) of Zymolyase-T (in water) as well as 10 L of -mercaptoethanol. The cell suspension was incubated overnight at 30 C. in a shaker at 50 rpm. Five mL of 1.5% Triton X-100 were added and the mixture was incubated on ice for 15 minutes. The solution was sonicated three times for 30 seconds per cycle at 50% power, with 2 minutes rest on ice in between sonication cycles. The suspension was centrifuged (1200g, 5 minutes) and washed twice with 5 mL of water. The final cell pellet was resuspended in 1 mL water and cells were plated to YP+2% EtOH.
(364) Following this procedure, the separate individual spores, were plated onto solid medium to obtain colonies, all of genotype HO pdc1::Tn5ble pdc5::Tn5ble pdc6:APT1 HIS3 LEU2 TRP1 URA3 and of unknown mating type. Some fraction of the cells were (homozygous) diploid due to the HO+ gene status and resultant mating type switching and re-mating to form diploids.
(365) The genotype of the mating type locus of the putative Pdc-minus colonies was confirmed by PCR using Taq DNA polymerase (New England BioLabs, Ipswich, Mass.) under standard conditions using primers specific for the MAT a locus (primers #489 and #491) or MAT a locus (primers #490 and #491). Colonies that generated a single PCR product with one of the two possible primer sets primer set and no product when tested with the other were putative haploid Pdc-minus strains. To confirm the mating type, such strains were crossed to Gevol1187 and Gevol188 (CEN.PK). Resulting diploid progeny were selected on medium containing glucose (to select for the presence of PDC+ genes introduced by CEN.PK background) and also lacking at least one of the following nutrients: histidine, leucine, tryptophan, or uracil (to select for the appropriate prototrophy as provided by the wild-type allele of the corresponding gene from the Gevol537 or GEVO1538 background.
(366) Diploid cells were sporulated and germinated on agar plates containing YP+2% ethanol (to permit growth of Pdc-minus isolates). To identify Pdc-minus candidates, viable colonies were streaked on to YPD agar plates and colonies that were inviable on glucose were isolated. Inability to grow on glucose confirms that these candidates are pdc1::ble and pdc5::ble. The pdc6::apt1 was confirmed their ability to grow on YP+Ethanol plates containing the antibiotic G418. The genotype of the mating type locus of the putative Pdc-minus colonies was confirmed by PCR using Taq DNA polymerase (New England BioLabs, Ipswich, Mass.) under standard conditions using primers specific for the MAT a locus (primers #489 and #491) or MAT a locus (primers #490 and #491). The presence of a product from both sets of PCR reactions indicated that both mating type alleles were present in the population, as a consequence of mating type allele switching by an active HO-encoded enzyme. The presence of a PCR product for one set of MAT locus-specific primers but not the other indicated that the strain lacks this activity and was therefore ho-. Based upon these analyses, six candidates colonies were identified as ho-strains and one candidate #4 was HO.
(367) These Pdc-minus strains were streaked to SC+Ethanol plates lacking one of: leucine, histidine, tryptophan, or uracil, to determine presence of auxotrophic mutations within these strains. One Pdc-minus strain, GEVO1581, was auxotrophic for histidine, uracil, and tryptophan, and thus carried three of the makers (his3, ura3, and trp1). Another Pdc-minus strain, GEVO1715, was auxotrophic for uracil and leucine and thus carried the two markers, ura3 and leu2.
(368) GEVO1581 and GEVO1715 were screened by RFLP analysis to verify the presence of the ho allele. A 447 bp portion of the HO locus was amplified by PCR that contained the codon that is altered in the ho allele (H475L) using primers 1375 and 1376. This mutation introduces an AluI restriction site, and consequently, digestion with AluI (New England BioLabs, Ipswich, Mass.) yielded either a 447 bp fragment (HO) or a 122 bp fragment plus a 325 bp fragment (ho). Based upon RFLP analysis, GEVO1581 was HO and GEVO1715 was ho.
(369) To obtain a Pdc-minus strain with all four auxotrophic markers, GEVO1715 was crossed to GEVO1188 and diploids generated as described above. The resulting diploid was sporulated and Pdc-minus candidates were isolated by plating onto YP+Ethanol containing both Phleomycin and G418. These candidates were then streaked onto YPD agar plates and tested for their inviability on glucose. Those that did not grow on glucose were isolated as this phenotype, in addition to their resistance to Phleomycin and G418 confirms that these candidates are pdc1::ble, pdc5::ble and pdc6::apt1. These isolates were streaked to SC+Ethanol plates lacking one of: leucine, histidine, tryptophan, or uracil, to determine presence of auxotrophic mutations within these strains. One of these Pdc-minus strains, GEVO1584, was auxotrophic for histidine, uracil, tryptophan and leucine and thus carried all four markers, his3, ura3, trp1, and leu2. GEVO1584 was also confirmed to be MATa and ho by colony PCR and RFLP analysis, respectively, as described above.
(370) TABLE-US-00006 TABLE EX2-1 Summary table of S. cerevisiae Pdc-minus strains obtained GEVO No. GENOTYPE STRAIN SOURCE 1537 MAT a/, HIS3, LEU2, TRP1 , URA3, Strain GG570 from Paul van pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, Heusden, Univ. of Leiden, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO Netherlands 1538 MAT a/, HIS3, LEU2, TRP1, URA3, Strain GG570 from Paul van pdc1::ble/pdc1::ble, pdc5::ble/pdc5::ble, Heusden, Univ. of Leiden, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO Netherlands 1581 MAT a/, his3/his3, trp1/trp1, ura3/ura3, candidate #4 LEU2/LEU2, pdc1::ble/pdc1::ble, GEVO1537 GEVO1187 pdc5::ble/pdc5::ble, pdc6::apt1(kanR)/pdc6::apt1(kanR), HO/HO 1584 MAT a, his3, trp1, ura3, leu2, pdc1::ble, pdc5::ble, candidate #201 pdc6::apt1(kanR), ho GEVO1715 GEVO1188 1715 MAT a, leu2, ura3, pdc1::ble, pdc5::ble, candidate #104 pdc6::apt1(kanR), ho GEVO1187 GEVO1537
Example 3: Other Pdc-Minus S. cerevisiae Strains
(371) S. cerevisiae engineered to be deficient in PDC activity have been previously described: (Flikweert, M. T., van der Zanden, L., Janssen, W. M. T. M, Steensma, H. Y., van Dijken J. P., Pronk J. T. (1996) Yeast 12(3):247-57). Such strains may be obtained from these sources.
Example 4: Chemostat Evolution of S. cerevisiae PDC Triple-Mutant
(372) This example demonstrates that a PDC deletion variant of a member Saccharomyces sensu stricto yeast group, the Saccharomyces clade yeast, Crabtree-positive, post-WGD yeast, S. cerevisiae, can be evolved so that it does not have the requirement for a two-carbon molecule and has a growth rate similar to the parental strain on glucose.
(373) A DasGip fermentor vessel was sterilized and filled with 200 ml of YNB (Yeast Nitrogen Base; containing per liter of distilled water: 6.7 g YNB without amino acids from Difco, the following were added per liter of medium: 0.076 g histidine, 0.076 g tryptophan, 0.380 g leucine, and/or 0.076 g uracil; medium was adjusted pH to 5 by adding a few drops of HCL or KOH) and contained 2% w/v ethanol. The vessel was installed and all probes were calibrated according to DasGip instructions. The vessel was also attached to an off-gas analyzer of the DasGip system, as well as to a mass spectrometer. Online measurements of oxygen, carbon dioxide, isobutanol, and ethanol were taken throughout the experiment. The two probes that were inside the vessel measured pH and dissolved oxygen levels at all times. A medium inlet and an outlet were also set up on the vessel. The outlet tube was placed at a height just above the 200 ml level, and the pump rate was set to maximum. This arrangement helped maintain the volume in the vessel at 200 ml. Air was sparged into the fermentor at 12 standard liters per hour (slph) at all times. The temperature of the vessel was held constant at 31.8 C. and the agitation rate was kept at 300 rpm. The off-gas was analyzed for CO.sub.2, O.sub.2, ethanol and isobutanol concentrations. The amount of carbon dioxide (X.sub.CO2) and oxygen (X.sub.O2) levels in the off-gas were used to assess the metabolic state of the cells. An increase X.sub.CO2 levels and decrease in X.sub.O2 levels indicated an increase in growth rate and glucose consumption rate. The ethanol levels were monitored to ensure that there was no contamination, either from other yeast cells or from potential revertants of the mutant strain since the S. cerevisiae PDC triple-mutant (GEVO1584) does not produce ethanol. The minimum pH in the vessel was set to 5, and a base control was set up to pump in potassium hydroxide into the vessel when the pH dropped below 5.
(374) GEVO1584 was inoculated into 10 ml of YNB medium with 2% w/v ethanol as the carbon source. The culture was incubated at 30 C. overnight with shaking. The overnight culture was used to inoculate the DasGip vessel. Initially, the vessel was run in batch mode, to build up a high cell density. When about 3 g CDW/L of cell biomass was reached, the vessel was switched to chemostat mode and the dilution of the culture began. The medium pumped into the vessel was YNB with 7.125 g/L glucose and 0.375 g/L of acetate (5% carbon equivalent). The initial dilution rate was set to 0.1 h.sup.1, but as the cell density started dropping, the dilution rate was decreased to 0.025 h.sup.1 to avoid washout. GEVO1584 was mating type a. A PCR check for the mating type of the chemostat population several days into the experiment indicated that the strain still present was mating type a.
(375) The culture in the chemostat was stabilized and the dilution rate increased to 0.1 h.sup.1. After steady state was reached at the 0.1 h.sup.1 dilution rate, the concentration of acetate was slowly decreased. This was achieved by using a two pump system, effectively producing a gradient pumping scheme. Initially pump A was pumping YNB with 7.125 g/L glucose, and 0.6 g/L of acetate at a rate of 12.5 mL/h and pump C was pumping YNB with only 7.125 g/L glucose at a rate of 7.5 mL/h. The combined acetate going into the vessel was 0.375 g/L. Then, over a period of 3 weeks, the rate of pump A was slowly decreased and the rate of pump C was increased by the same amount so that the combined rate of feeding was always 20 mL/h. When the rate of pump A dropped below 3 mL/h the culture started to slowly wash out. To avoid complete washout the dilution rate was decreased to 0.075 h.sup.1 from 0.1 h.sup.1 (
(376) To characterize growth of the evolved strains YNB, YPD (yeast extract, peptone, dextrose), and YPE (yeast extract, peptone, ethanol) were used with various concentrations of glucose or ethanol. The growth characterization was performed in either snap-cap test tubes or 48-well plates (7.5 ml). The snap-cap test tubes were not closed completely so that air would vent in/out of the tubes, and the 48-well plates were covered with an air permeable membrane to allow for oxygen transfer. To check for contaminations, YPD or YPE agar plates were used with the antibiotics G418 and Phleomycin. The PDC triple mutant strain (GEVO1584) has both G418 and Phleomycin resistance markers, so the progeny of that strain were able to grow on the antibiotics. Single colonies isolated from each chemostat sample were studied for growth rates. A single colony isolated from the 35-day chemostat population was selected because of high growth rates on glucose as a sole carbon source, was resistant to both G418 and Phleomycin, and grew without the need for ethanol or acetate. The single colony was further evolved through 24 successive serial transfers in test tubes on YPD at 30 C., 250 rpm shaking. The resulting strain, GEVO1863, grew similarly to the wild-type yeast parent on glucose (
Example 5: Isobutanol Production in Pdc-Plus K. lactis
(377) This example demonstrates isobutanol production in a member of the Saccharomyces clade, Crabtree-negative, pre-WGD yeast, K. lactis.
(378) The isobutanol production pathway was cloned in a K. lactis vector-based expression system: a SacI-MluI fragment containing the TEF1 promoter. Lactococcus lactis alsS and part of the CYC1 terminator sequence was cloned into the same sites of the K. lactis expression plasmid, pGV1430 (
(379) The K. lactis strain GEVO1287 was transformed with the above plasmids, pGV1472, pGV1473, and pGV1475 (Table EX5-1) to express the isobutanol pathway. As a control, K. lactis GEVO1287 was also transformed with empty vectors pGV1430, pGV1429, and pGV1431 (Table EX5-1).
(380) TABLE-US-00007 TABLE EX 5-1 K. lactis clones expressing an isobutanol pathway clone Host Plasmid 1 Plasmid 2 Plasmid 3 ALS KARI DHAD KIVD ADH iB165 GEVO1287 PGV1430 pGV1429 pGV1431 iB173 GEVO1287 pGV1472 pGV1473 pGV1475 Ptef1- Ec. Ec. ilvD Ll. Sc. Ll. ilvC Kivd Adh7 alsS
(381) Transformed cells were grown overnight and transferred to 100 mL fermentation bottles using 20 mL SC-WLU medium. Two mL samples were taken at 24 and 48 hours for GC analysis. At each time point, 2 mL of a 20% glucose was added after removing samples for GC analysis. At 48 hours the fermentation was ended. GC samples were processed as described. Results are shown in Table EX5-2 Up to 0.25 g/L isobutanol was produced in K. lactis transformed with an isobutanol pathway whereas the control strain without the pathway only produced 0.022 g/L in 48 hours.
(382) TABLE-US-00008 TABLE EX5-2 K. lactis fermentation results Isobutanol titer Isobutanol yield Ethanol clone (mg/L) (% theoretical) (g/L) iB165 0.022 0.13 11.4 iB173 0.25 1.5 12.6
(383) To determine if isobutanol titers can be increased by using a rich complex media, fermentations were performed as described above with iB165 (vector only control) and iB173 using YPD instead of SC-WLU medium. In addition, fermentations were also carried out in 250 mL screw-cap flasks (microaerobic conditions) and in 125 mL metal-cap flasks (aerobic conditions). Samples were taken at 24, 48, and 72 and the isobutanol levels obtained are shown in Table EX5-3.
(384) TABLE-US-00009 TABLE EX5-3 K. lactis fermentation results using YPD Isobutanol titer Isobutanol yield Ethanol clone Condition (mg/L) (% theoretical) (g/L) iB165 Anaerobic 66 0.4 27.4 iB165 Microaerobic 117 0.7 24.5 iB165 Aerobic 104 0.6 11.7 iB173 Anaerobic 297 1.8 25.8 iB173 Microaerobic 436 2.6 23.4 iB173 Aerobic 452 2.7 13.4
Example 6: Isobutanol Production in Pdc Plus S. cerevisiae
(385) This example demonstrates isobutanol production in a member of Saccharomyces sensu stricto group, Saccharomyces clade, Crabtree-positive, post-WGD yeast, S. cerevisiae.
(386) Various plasmids carrying the isobutanol production pathway were constructed for expression of this metabolic pathway in a Pdc-plus variant of S. cerevisiae, GEVO1187. Plasmids pGV1254 (
(387) GEVO1187 was transformed with plasmids as shown in Table EX6-1. As a defective isobutanol pathway control, cells were transformed with pGV1056 (
(388) TABLE-US-00010 TABLE EX6-1 Plasmid Plasmid pGV# Promoter Gene type marker pGV1254 Sc TEF1 L. lactis kivD High copy Sc URA3 pGV1295 Sc TDH3 E. coli ilvC High copy Sc TRP1 pGV1390 Sc CUP1 L. lactis alsS High copy Sc HIS3 pGV1438 Sc TDH3 E. coli ilvD High copy Sc LEU1
(389) The cells were grown overnight and anaerobic batch fermentations were carried out as described in General Methods. SC-HWUL was used as the media. 2 mL samples were taken at 24, 48 and 72 hours for GC At each time point, the cultures were fed 2 mL of a 40% glucose solution. The fermentation was ended after 72 hours. Samples were processed and analyzed as described. The results are shown in Table EX6-2. As shown, isobutanol was produced in GEVO1187 transformed with the isobutanol-pathway containing plasmids.
(390) TABLE-US-00011 TABLE EX6-2 Isobutanol production in S. cerevisiae, GEVO1187, after 72 hours Isobutanol Ethanol Titer Yield Titer Yield Strain Plasmids [g L.sup.1] [%] [gL.sup.1] [%] GEVO1187 pGV1254, pGV1438, 0.13 0.31 31 60 pGV1390, pGV1438 GEVO1187 pGV1056, pGV1295, 0.04 0.10 42 82 pGV1438, pGV1254
(391) This example demonstrates isobutanol production in a Pdc-minus member of the Saccharomyces clade, Crabtree-negative, pre-WGD yeast, K. lactis.
(392) Description of Plasmids pGV1590, pGV1726, pGV1727:
(393) pGV1590 (
(394) Construction of GEVO1829, a K. lactis Strain with Pathway Integrated:
(395) The isobutanol pathway was introduced into the Pdc-minus K. lactis strain GEVO1742 by random integrations of the pathway genes. GEVO1742 was transformed with the Acc651-NgoMIV fragment of pGV1590 containing the L. lactis kivd and S. cerevisiae ADH7 but without the yeast replication origin, to generate GEVO1794. The presence of both L. lactis kivd and S. cerevisiae ADH7 was confirmed by colony PCR using primer sets 1334+1335 and 1338+1339, respectively. GEVO1794 was transformed with pGV1727, a yeast integration plasmid carrying E. coli ilvD (under the TEF1 promoter) and E. coli ilvC (under TDH3 promoter), that had been linearized by digesting with BcgI. The resulting strain, GEVO1818, was confirmed by colony PCR for the presence of E. coli ilvD and E. coli ilvC using primer sets 1330+1331 and 1325+1328, respectively. GEVO1818 was then transformed with pGV1726, a yeast integration plasmid carrying B. subtilis alsS (under the CUP1 promoter), that had been linearized by digesting with AhdI to generate GEVO1829. The presence of B. subtilis alsS was confirmed by colony PCR using primers 1321+1324.
(396) Aerobic fermentations were carried out to test isobutanol production by the Pdc-minus strain carrying the isobutanol pathway, GEVO1829. The Pdc-minus strain without the isobutanol pathway, GEVO1742, was used as a control. These strains were cultured in YPD overnight at 30 C., 250 rpm, then diluted into 20 mL fresh YPD in a 125 mL flask and grown at 30 C., 250 rpm. 2 mL samples were taken at 24 and 48 hours, cells pelleted for 5 minutes at 14,000g and the supernatant was analyzed for isobutanol by GC. In addition glucose concentrations were analyzed by LC. The results are shown in Table EX7-1. At 48 hours, the OD of the GEVO1742 strain had reached over 8.5 while the OD of the GEVO1829 was less than 5. GEVO1829 consumed around 15.7 g/L glucose while GEVO1742 consumed roughly 7.7 g/L glucose. GEVO1829 produced 0.17 g/L isobutanol while GEVO1742 did not produce any isobutanol above media background.
(397) TABLE-US-00012 TABLE EX7-1 K. lactis fermentation results Isobutanol titer Isobutanol yield Ethanol Clone (mg/L) (% theoretical) (mg/L) GEVO1742 0 0 17 GEVO1829 170 2.6 53
Example 8A: Isobutanol Production in Pdc-Minus S. cerevisiae GEVO1581
(398) This example demonstrates isobutanol production in a Pdc-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae.
(399) Strain GEVO1581 with the three genes encoding PDC activity deleted (pdc1, pdc5, and pdc6) was used to produce isobutanol. Isobutanol pathway enzymes were encoded by genes cloned into three plasmids. pGV1103 (
(400) TABLE-US-00013 TABLE EX8-1 Plasmids transformed into GEVO1581 Fermentation # Strain Plasmids Notes iB250 GEVO1581 pGV1103, Vector Control pGV1104, pGV1106 iB251 GEVO1581 pGV1677, iBuOH Pathway, alsS on pGV1649, 2 micron plasmid pGV1664 iB252 GEVO1581 pGV1677, iBuOH Pathway, alsS on pGV1673, CEN plasmid pGV1664
(401) Fermentation experiments were carried out with GEVO1581 transformed with plasmids according to Table EX8-1 to determine the amount of isobutanol produced (titer) and the percentage of isobutanol to consumed glucose (yield).
(402) Fermentations with Transformants of GEVO1581:
(403) Using cells grown in 3 mL defined (SC-Ethanol) medium, 20 mL cultures were inoculated with transformants of GEVO1581 (3 independent colonies per transformation set) to an OD.sub.600 of approximately 0.1. The cultures were incubated at 30 C. at 250 RPM in 125 mL metal cap flasks until they reached an OD.sub.600 of approximately 1. Glucose was added to a final concentration of 5% and a 2 mL aliquot was removed from each sample (T=0 sample). The OD.sub.600 of each sample was measured, the cells in each sample were pelleted by centrifugation (14,000g, 5 min), and the supernatant from each sample was stored at 20 C. The remaining cultures were incubated at 30 C. at 125 RPM for another 48 hours. Samples (2 mL) were removed after 24 and 48 hours and prepared as just described. The samples were thawed, and prepared as described in General Methods. Three individual transformants were used for each set of plasmids during the fermentations. The amount of glucose consumed and the amount of pyruvate, glycerol, ethanol, and isobutanol produced after 48 hours are listed in Table EX8A-2.
(404) TABLE-US-00014 TABLE EX8A-2 48 hour time point data are shown as an average of three replicates Glucose consumed Isobutanol Yield (g/L) (mg/L) (% theoretical) iB250 3.6 .7 4.7 0.00 0.31 0.04 iB251 2.8 1.6 122 41 11.0 5.0 iB252 1.2 .5 62 11 12.8 2.8
Again using cells grown in 3 mL defined (SC-Ethanol) medium, 20 mL cultures were inoculated with transformants of GEVO1581 to an OD.sub.600 of approximately 0.1. The cultures were incubated at 30 C. at 250 RPM in 125 mL metal cap flasks until they reached an OD.sub.600 of approximately 1. Biomass was pelleted and resuspended in 20 ml media with 2% glucose as the sole carbon source and a 2 mL aliquot was removed from each sample (T=0 sample). The OD.sub.600 of each sample was measured and each sample was stored at 20 C. The remaining cultures were incubated at 30 C. at 125 RPM for another 48 hours. Samples (2 mL) were removed after 24 and 48 hours and stored at 20 C. The samples were thawed, and prepared as described in General Methods. The amounts of ethanol and isobutanol produced after 48 hours are listed in Table EX8A-3.
(405) TABLE-US-00015 TABLE EX8A-3 48 hour time point data for fermentation in glucose, shown as an average of three replicates Isobutanol Isobutanol yield Ethanol Ethanol yield (mg/L) (% theoretical) (mg/L) (% theoretical) iB250 0 0 0 0 iB251 210 3.5 110 1.8
Example 8B: Isobutanol Production in Pdc-Minus S. cerevisiae GEVO1584
(406) This example demonstrates isobutanol production in a Pdc-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade, Crabtree-positive yeast, WGD yeast, S. cerevisiae.
(407) GEVO1581 is a diploid strain, thus, a second backcross of a Pdc-minus yeast into the CEN.PK background was performed, yielding a Pdc-minus haploid strain GEVO1584 with the required auxotrophic markers for plasmid propagation.
(408) Transformations of GEVO1584:
(409) The following combinations of plasmids were transformed into GEVO1584 (Table EX8B-1) using lithium acetate transformation (described in General Methods) followed by selection on appropriate minimal media. pGV1672 (
(410) TABLE-US-00016 TABLE EX8B-1 Fermentation # Strain Plasmids Notes iB300 GEVO1584 pGV1672, Vector Control pGV1056, (CEN plasmids) pGV1062 iB301 GEVO1584 pGV1673, Isobutanol pathway pGV1679, (CEN plasmids) pGV1683 iB302 GEVO1584 pGV1103, Vector Control pGV1104, (2 plasmids) pGV1102 iB303 GEVO1584 pGV1677, Isobutanol pathway pGV1649, (2 plasmids) pGV1664
(411) Fermentations with Transformants of GEVO1584:
(412) Using cells grown in 3 mL defined (SC) media containing ethanol (SC+Ethanol-HWU), 200 mL cultures were inoculated with transformants of GEVO1584 and incubated in SC+Ethanol-HWU at 30 C. at 250 RPM in 500 mL shake flasks for 72 hours. The OD.sub.600 values measured after 72 hours ranged from 1.4 to 3.5. The cultures were diluted 1:10 into fresh 250 mL SC+Ethanol-HWU media and incubated at 30 C. at 250 RPM in 500 mL shake for 24 hours. The cells were collected by centrifugation at 3000 RPM for 3 minutes and resuspended in 20 mL SC+Glucose-HWU media in 125 mL metal cap flasks. 250 L of 100% ethanol was added to each culture to bring the concentration of ethanol to 1%. A 2 mL aliquot was removed, the OD.sub.600 was measured using 100 L, and the remaining aliquot was centrifuged to pellet cells (14,000g, 5 min) and the supernatants were stored at 20 C. The cultures were incubated at 125 rpm at 30 C. A 2 mL aliquot was removed from each culture after 24 and 48 hours of incubation, and the OD.sub.600 was measured as before (see Table 3, t=24 and t=48) and the sample centrifuged and stored as described above. The samples were thawed, and the samples were prepared and analyzed via GC and HPLC as described in General Methods. Results are shown in Table EX8B-2.
(413) TABLE-US-00017 TABLE EX8B-2 48 hour time point data are shown as an average of three replicates Isobutanol Glucose Ethanol Titer Consumed Consumed Yield Fermentation # (g/L) (g/L) (g/L) (% theor.)] iB300 Vector Control 0.012 0.003 9.75 4.17 2.47 0.30 0.30% (CEN plasmids) iB301 Isobutanol 0.392 0.087 9.31 5.03 0.95 0.64 10.27% pathway (CEN plasmids) iB302 Vector Control 0.013 0.006 8.61 4.51 0.64 + 0.17 0.37% (2 plasmids) iB303 Isobutanol 0.248 0.032 9.51 1.25 0.77 0.59 6.36% pathway (2 plasmids)
(414) All Pdc-minus yeast (GEVO1584) consumed approximately 10 g/L of glucose and less than 2 g/L of ethanol after 48 hours. All strains accumulated 1.5 g/L pyruvate, except for those carrying the isobutanol pathway on 2p plasmids (<0.5 g/L). The accumulation of pyruvate and failure of the yeast to produce ethanol from glucose is confirmation that all lacked PDC activity. After 48 hours, the Pdc-minus yeast with the isobutanol pathway encoded on 2p plasmids generated 0.2480.032 g/L isobutanol at a theoretical yield of 6.36% of the consumed glucose (Table EX8B-2). The CEN plasmid isobutanol pathway strain generated 0.3920.087 g/L isobutanol at a yield of 10.27% (Table EX8B-2). Isobutanol titers were well above the equivalent vector control strains.
Example 9: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis
(415) In yeast, excess NADH is oxidized to NAD+ through the generation of glycerol. The key enzyme involved in this reaction is the glycerol 3-phosphate dehydrogenase. Deletion of the gene encoding this protein, KI-Gpd1p, would eliminate loss of NADH as well as carbons from glucose. This would lead to an increased yield of isobutanol.
(416) The PDC-minus K. lactis strain, GEVO1488, is engineered to delete GPD1 gene of K. lactis. This PDC-minus GPD-minus strain is transformed with pGV1565 and pGV1568 (
Example 10: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis with Balanced Isobutanol Pathway
(417) Yield is further increased by the use of a pathway in which there is a balanced usage of NADH and NADPH. This balance is accomplished by the use of an engineered ilvC which is able to utilize NADH and the NADH-dependent alcohol dehydrogenase, Adh2. These constructs are used to express the isobutanol pathway in a PDC-minus and GPD-minus K. lactis. This strain is subjected to anaerobic batch fermentation as described above and samples are analyzed for isobutanol. As shown in Table EX9-1, the yield of isobutanol using this pathway in a PDC-minus K. lactis is expected to result in a significant increase in yield.
Example 11: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis with Balanced Isobutanol Pathway
(418) An alternative route to balancing the NADH and NADPH usage is to overexpress an NADP.sup.+-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in addition to the endogenous NAD.sup.+-dependent GAPDH, such that both NADH and NADPH are generated from glycolysis. The isobutanol pathway can utilize an NADPH-dependent KARI enzyme and the NADH-dependent Adh2p. In this case, PDC-minus and GPD-minus K. lactis is transformed with a construct expressing a NADP+-dependent GAPDH and an isobutanol pathway using Adh2. This strain is subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX9-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
Example 12: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus and GPD-Minus K. lactis with Balanced Isobutanol Pathway
(419) Yet another alternative route to balancing the NADH and NADPH usage is to replace the endogenous NAD.sup.+-dependent GAPDH with an NADP.sup.+-dependent GAPDH in a PDC-minus and GPD-minus K. lactis. This strain is transformed with the isobutanol pathway and subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX9-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
(420) TABLE-US-00018 TABLE EX9-1 Isobutanol productivity in K. lactis strains after 48 hours. (Listed numbers for the pdc-minus strains are expected numbers). Isobutanol Ethanol Titer Yield Titer Yield Genotype Plasmid [g L.sup.1] [%] [g L.sup.1] [%] PDC+ pathway genes 0.25 1.5 12.6 62 GPD+ pdc pathway genes 8.2 50 0.01 0.05 GPD+ pdc pathway genes 11.5 70 0.01 0.05 gpd pdc balanced pathway 13.2 80 0.01 0.05 gpd (NADH utilizing pathway) pdc balanced pathway 13.2 80 0.01 0.05 gpd (NADH and NADPH production from glycolysis) pdc balanced pathway 13.2 80 0.01 0.05 gpd (NADPH production from glycolysis)
Example 13: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus and GPD-Minus S. cerevisiae
(421) The PDC-minus S. cerevisiae strain is engineered to delete both GPD1 and GPD2. This PDC-minus GPD-minus strain is transformed with plasmids expressing the isobutanol pathway in S. cerevisiae. These transformants are then subjected to anaerobic batch fermentation and samples analyzed as described. As is seen in Table EX13-1, the additional deletions of GPD1 and GPD2 is expected to result in a significant increase in isobutanol yield.
Example 14: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus and GPD-Minus S. cerevisiae with Balanced Isobutanol Pathway
(422) Yield is further increased by the use of a pathway in which there is balanced usage of NADH and NADPH usage. This balance is accomplished by the use of an engineered KARI which is able to utilize NADH and the NADH-dependent alcohol dehydrogenase, Adh2p. These constructs are used to express the isobutanol pathway in a PDC-minus and GPD-minus S. cerevisiae. This strain is subjected to anaerobic batch fermentation as described above and samples are analyzed for isobutanol. As shown in Table EX13-1, the yield of isobutanol using this pathway in a PDC-minus S. cerevisiae is expected to result in a significant increase in yield.
Example 15: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus GPD-Minus S. cerevisiae with Balanced Isobutanol Pathway
(423) An alternative route to balancing the NADH and NADPH usage is to overexpress an NADP.sup.+-dependent glyceraldehydes 3-phosphate dehydrogenase (GAPDH) in addition to the endogenous NAD.sup.+-dependent GAPDH, such that both NADH and NADPH are generated from glycolysis. The isobutanol pathway can utilize an NADPH-dependent KARI enzyme and the NADH-dependent Adh2. In this case, PDC-minus and GPD-minus S. cerevisiae is transformed with a construct expressing a NADP.sup.+-dependent GAPDH and an isobutanol pathway using Adh2. This strain is subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX13-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
Example 16: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus S. cerevisiae with Balanced Isobutanol Pathway
(424) Yet another alternative route to balancing the NADH and NADPH usage is to replace the endogenous NAD.sup.+-dependent GAPDH with an NADP.sup.+-dependent GAPDH in a PDC-minus and GPD-minus S. cerevisiae. This strain is transformed with the isobutanol pathway and subjected to anaerobic batch fermentation as described above and samples analyzed for isobutanol. As shown in Table EX13-1, introduction of this NADP.sup.+-dependent GAPDH is expected to result in a significant increase in productivity of isobutanol.
(425) TABLE-US-00019 TABLE EX13-1 Isobutanol productivity in S. cerevisiae strains after 48 hours. (Listed numbers for the pdc-minus strains are expected numbers). Isobutanol Ethanol Titer Yield Titer Yield Genotype Plasmid [g L.sup.1] [%] [g L.sup.1] [%] WT pathway genes 0.13 0.31 31 60 pdc pathway genes 8.2 50 0.01 0.05 pdc pathway genes 9.9 70 0.01 0.05 gpd pdc balanced pathway 13.2 80 0.01 0.05 gpd (NADH utilizing pathway) pdc balanced pathway 13.2 80 0.01 0.05 gpd (NADH and NADPH production from glycolysis) pdc balanced pathway 13.2 80 0.01 0.05 gpd (NADPH production from glycolysis)
Example 17: High-Yield Isobutanol Fermentation Using Crabtree-Negative PDC-Minus GPD-Minus Evolved K. lactis with Balanced Isobutanol Pathway
(426) In an embodiment, the yield for isobutanol may be increased by further engineering yeast microorganism to reduce production of minor byproducts. Isobutanol may be produced at a yield of about 90% theoretical.
Example 18: High-Yield Isobutanol Fermentation Using Crabtree-Positive PDC-Minus GPD-Minus Evolved S. cerevisiae with Balanced Isobutanol Pathway
(427) In another embodiment, the yield for isobutanol may be increased by further engineering a yeast microorganism to reduce production of minor byproducts. Isobutanol may be produced at a yield of about 90% theoretical.
General Methods for Examples 19-24
(428) Sample Preparation:
(429) Samples were prepared from various timepoints for analysis by liquid chromatography and gas chromatography. 2 mL of media was removed and centrifuged at 14,000g for 10 min. The supernatant was removed and stored at 4 C. until analysis.
(430) Determination of Optical Density:
(431) The optical density of the yeast cultures was determined at 600 nm using a DU 800 spectrophotometer (Beckman-Coulter, Fullerton, Calif., USA). Samples were diluted as necessary to yield an optical density of between 0.1 and 0.8.
(432) Gas Chromatography:
(433) Analysis of ethanol and isobutanol was performed on a HP 5890 gas chromatograph fitted with a ZB-FFAP column (Phenomenex; 30 m length, 0.32 mm ID, 0.25 M film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200 C. for the injector with Agilent cyclo-splitter insert, 300 C. for the detector, 100 C. oven for 1 minute, 70 C./minute gradient to 235 C., and then hold until a final run time of 5.54 min. Injection volume was 0.5 l, with a split ratio of 50:1; Helium flow rate was approximately 2.3 ml/min using a constant pressure of 0.88 bar.
(434) High Performance Liquid Chromatography:
(435) Analysis of glucose and organic acids was performed on a HP-1100 High Performance Liquid Chromatography system equipped with two Rezex RFQ-Fast Fruit columns in series (Phenomenex, 1007.8 mm, 8 m particles), or equivalent, and an H cation guard column (Bio-Rad) or equivalent. Pyruvate and HMF were detected using an HP-1100 UV detector (210 nm, 8 nm 360 nm reference) while all other organic acids and glucose were detected using an HP-1100 refractive index detector. The column and RI temperatures were 60 C. This method was Isocratic with 0.018N sulfuric acid in water as mobile phase. Flow was set at 1.1 mL/min. Injection size was 20 L and the run time was 15 minutes
(436) Lithium Acetate transformations of S. cerevisiae strains were transformed by the Lithium Acetate method (Gietz et al., Nucleic Acids Res. 27:69-74 (1992). Cells were collected from overnight cultures grown in 50 mL of defined (SC) ethanol media at an OD.sub.600 of approximately 0.8 to 1.0 by centrifugation at 2700 rcf for 2 minutes at room temperature. The cell pellet was resuspended in 50 mL sterile water, collected by centrifugation (2700 rcf; 2 min; room temp.), and resuspended in 25 mL sterile water. The cells were collected by centrifugation (2700 rcf; 2 min; room temp.) and resuspended in 1 mL 100 mM lithium acetate. The cell suspension was transferred to a sterile 1.5 mL tube and collected by centrifugation at full speed for 10 seconds. The cells were resuspended in 100 mM lithium acetate with a volume four times the volume of the cell pellet (e.g. 400 L for 100 L cell pellet). To the prepared DNA Mix (72 l 50% PEG, 10 l 1M Lithium Acetate, 3 l boiled salmon sperm DNA, and 5 l of each plasmid), 15 l of the cell suspension was added and mixed by vortexing with five short pulses. The cell/DNA suspensions were incubated at 30 C. for 30 minutes and at 42 C. for 22 minutes. The cells were collected by centrifugation for 10 seconds at full speed and resuspended in 100 l SOS (1M Sorbitol, 0.34% (w/v) Yeast Extract, 0.68% (w/v) Peptone, 6.5 mM CaCl). The cell suspensions were top spread over appropriate selective agar plates.
(437) Yeast Colony PCR:
(438) Yeast cells were taken from agar medium and transferred to 30 l 0.2% SDS and heated for 4 mins at 90 C. The cells were spun down and 1 l of the supernatant was used for PCR using standard Taq (NEB).
(439) Molecular Biology:
(440) Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook & Russell).
(441) Media:
(442) YP: contains 1% (w/v) yeast extract, 2% (wlv) peptone.
(443) YPD is YP containing 2% (w/v) glucose, YPE is YP containing 2% (w/v) Ethanol.
(444) YPD80 medium (Difco) is YP containing 80 g/L glucose, 0.2 g/L G418 antibiotic, 20 M CuSO.sub.4, and 1% ethanol.
(445) SC+Complete: 20 g/L glucose, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco Yeast Nitrogen Base. 0.076 g/L histidine, 0.076 g/L tryptophan, 0.380 g/L leucine, and 0.076 g/L uracil.
(446) Solid versions of the above described media contain 2% (w/v) agar.
(447) Strains, Plasmids and Primer Sequences for Examples 19-24
(448) TABLE-US-00020 TABLE EX 19-1 Genotype of strains for Examples 19-24. GEVO No. Genotype and/or Reference GEVO2712 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 pdc1::{P.sub.CUP1-Bs_alsS2, TRP1} pdc5::{P.sub.TEF1:Sc_ILV3N P.sub.TDH3:Ec_ilvC_coSc.sup.Q110V, LEU2} pdc6::{P.sub.TEF1: Ll_kivd2_coEc P.sub.TDH3:Dm_ADH, URA3}, evolved for C2 supplement-independence, glucose tolerance and faster growth GEVO2843 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1:[Bs_alsS1_coSc:T.sub.CYC1: P.sub.PGK1: Ll_kivD2: P.sub.ENO2: Sp_HIS5] pdc5::[LEU2-bla-P.sub.TEF1: ILV3N: P.sub.TDH3: Ec_ilvC_coSc.sup.Q110V] pdc6::[URA3: bla; P.sub.TEF1: Ll_kivD2: P.sub.TDH3: Dm_ADH] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO2962 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 pdc1::PCUP1-Bs_alsS_coSc- TCYC1-PPGK1-Ll_kivd-PENO2-Sp_HIS5 pdc5::LEU2-bla-PTEF1-ILV3N-PTDH3- ilvC_coSc_Q110V pdc6::URA3-bla-PTEF1-Ll_kivd-PTDH3-DmADH {evolved for C2 supplement-independence, glucose tolerance and faster growth} pGV2227 GEVO2994 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1- P.sub.PGK1-Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3- Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2- Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3059 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF- Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3061 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd2::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3-Ec_ilvC_coSc_ Q110V pdc6::P.sub.TEF- Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3124 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 gpd2::P.sub.CCW12-Hph pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc- P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1- Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3128 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::P.sub.CCW12-Hph gpd2::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3-T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1- Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3- Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2- Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3158 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 gpd2::P.sub.CCW12-Hph pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc- P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1- Sc_TRP1 [pGV2227] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3159 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3- T.sub.Kl_URA3 gpd2::P.sub.CCW12-Hph pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc- P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3-Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1- Sc_TRP1 [pGV2082] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3160 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::P.sub.CCW12-Hph gpd2::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3-T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1- Ll_kivd2_coEc-P.sub.ENO2-Sp_his5 pdc5::LEU2-bla-P.sub.TEF1-ILV3N20-P.sub.TDH3- Ec_ilvC_coSc_Q110V pdc6::P.sub.TEF-Ll_ilvD_coSc_P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.ENO2- Ll_adhA-P.sub.FBA1-Sc_TRP1 [pGV2247] {evolved for C2 supplement-independence, glucose tolerance and faster growth} GEVO3532 S. cerevisiae CEN.PK2; MATa ura3 leu2 his3 trp1 gpd1::T.sub.Kl_URA3 gpd2::T.sub.Kl_URA3 pdc1::P.sub.CUP1-Bs_alsS1_coSc-T.sub.CYC1-P.sub.PGK1-Ll_kivd2_coEc-P.sub.ENO2-Sp_HIS5 pdc5::T.sub.Kl_URA3_short-P.sub.FBA1-Kl_URA3-T.sub.Kl_URA3 pdc6::P.sub.TEF1-Ll_ilvD_P.sub.TDH3-Ec_ilvC_coSc.sup.P2D1- .sup.A1-P.sub.ENO2-Ll_adhA-P.sub.FBA1-Sc_TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth} (first described here)
(449) TABLE-US-00021 TABLE EX 19-2 Plasmids disclosed for Examples 19-24. GEVO No. Genotype or Reference pGV2082 P.sub.TEF1-Ll_ilvD_coSc-P.sub.TDH3-Ec_ilvC_coSc_ Q110V-P.sub.TPI1-G418R-P.sub.PGK1-Ll_kivD2_coEc- P.sub.ENO2-Dm_ADH, 2 ori, bla, pUC-ori. pGV2227 P.sub.TEF1-Ll_ilvD_coSc-P.sub.TDH3-Ec_ilvC_coSc.sup.Q110V-P.sub.TPI1-G418R-P.sub.PGK1-Ll_kivd2_coEc- PDC1-3region-P.sub.ENO2-Ll_adhA 2 bla, pUC-ori pGV2247 P.sub.TEF1-Ll_ilvD_coSc-P.sub.TDH3-Ec_ilvC_coSc_P2D1-A1-P.sub.TPI1-G418R-P.sub.PGK1- Ll_kivD2_coEc-P.sub.ENO2-Ll_adhA, 2 ori, bla, pUC-ori. pGV2563 P.sub.TEF1-Ll_ilvD_coSc, P.sub.TDH3-Ec_ilvC_coSc.sup.P2D1-A1-his8, P.sub.ENO2-Ll_adhA_coSc.sup.RE1-his8, 2-ori, pUC ori, bla, G418r
Example 19: Isobutanol Production in Pdc-Yeast
(450) This example demonstrates isobutanol production at greater than 30% yield in a Pdc-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast S. cerevisiae.
(451) GEVO2962 is a modified yeast biocatalyst that contains genes within the chromosome of the biocatalyst which encode a pathway of enzymes that convert pyruvate into isobutanol. GEVO2962 is GEVO2843 transformed with pGV2227 (SEQ ID NO: 57), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110), LI_ilvD (Lactococcus lactis ilvD), LI_kivD2 (Lactococcus lactis kivD), and LIU_AdhA (Lactococcus lactis adhA). The strain GEVO2843 is PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO2843 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) and Dm_ADH (Drosophila melanogaster ADH, SEQ ID NO: 60) under the TEF1 and TDH3 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (SEQ ID NO: 61) and Sc_ILV3N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
(452) When the biocatalyst GEVO2962 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30 C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO2962 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 medium (Difco) at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 1 L of YPD80 medium in a 2.8 L baffled Fembach flask. The seed flask culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm.
(453) A portion of the flask seed culture was transferred to a 2 L DasGip seed fermenter containing about 750 mL of YPD80 medium to achieve a 1 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 5.0 through addition of base, temperature at 30 C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 1000 rpm and 2 sL/h air flow overlay. Cells were grown until the OD.sub.600 was about 10. Some of the seed fermenter culture was then transferred to a 2 L DasGip fermenter vessel containing about 1100 mL of YPD80. The vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at about 30 C., dissolved oxygen, and agitation. Initially, during the cell growth phase, the vessel was agitated with a variable agitation of 400-600 rpm using a 10 sL/h air sparge until the OD.sub.600 was about 8. Cell growth continued for approximately 16 hrs, after which time, the agitation was fixed at 600 rpm with 5 sL/h airflow. The dissolved oxygen was approximately zero throughout this experiment with an OTR of about 4-8 mM/h. Continuous measurement of the fermentor vessel off-gas by mass spectrometer analysis was performed for oxygen, isobutanol, ethanol, and carbon dioxide throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration, and isobutanol concentration in the broth.
(454) At about 48 h intervals throughout the 470 h experiment, the fermenter whole broth was removed from the fermenter, cells were separated from the broth using centrifugation at about 20 C. and 4000g in 500 mL centrifuge bottles. The cell pellets were resuspended in fresh YPD medium that contained 80 g/L glucose, 0.2 g/L G418 antibiotic, 20 M CuSO.sub.4, and 1% ethanol and returned to the fermenter. At six points throughout the fermentation, about 1 L of a flask culture of GEVO2962 at about 7 OD.sub.600 was concentrated to 50-100 mL by centrifugation and then added to the fermenter vessel aseptically.
(455) The fermenter vessel was attached by tubing to a smaller 400 mL fermenter vessel that served as a flash tank and operated in a recirculation loop with the fermenter. Whole fermentation broth was recirculated between the flash tank and fermenter at a rate of about 10-30 mL per min. The volume in the flash tank was approximately 100 mL and the hydraulic retention time in the flash tank was about 3-10 minutes. Heat and vacuum were applied to the flash tank. The vacuum level applied to the flash tank was initially set at about 60 mBar and the flash tank was set at approximately 36 C. Generally, the vacuum ranged from 50-65 mBar and the flash tank temperature ranged from 35 C. to 37 C. throughout the experiment. Vapor from the heated flash tank was condensed into a collection vessel as distillate. Whole fermentation broth was continuously returned from the flash tank back to the fermentation vessel. When the concentration of isobutanol in the broth dropped below 1.5 g/L, the flash recycle system was turned off. The flash recycle was turned back on when the broth concentration of isobutanol reached above 2.5 g/L.
(456) The distillate recovered in the experiment was strongly enriched for isobutanol. Isobutanol formed an azeotrope with water and lead to a two phase distillate: an isobutanol rich top phase and an isobutanol lean bottom phase. Distillate samples were analyzed by GC for isobutanol concentration.
(457) Isobutanol production reached a maximum at around 470 hrs with a total effective titer of about 111 g/L. The isobutanol production rate was about 0.24 g/L/h on average over the course of the experiment. The percent theoretical yield of isobutanol was approximately 36% at the end of the experiment.
Example 20: Isobutanol Production in Pdc-Gpd-Yeast
(458) This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae.
(459) The modified yeast biocatalyst, GEVO3158, encodes a heterologous pathway of enzymes that convert pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3158 is GEVO3124 transformed with pGV2247 (SEQ ID NO: 63), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110), LI_ilvD (Lactococcus lactis ilvD), LI_kivD (Lactococcus lactis kivD), and LI_adhA (Lactococcus lactis adhA). The strain GEVO3124 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3124 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc, and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
(460) GEVO3124 was generated by deletion of GPD2 using Hph as marker in strain GEVO3059. Deletion of GPD2 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD2 5 and 3 targeting sequences. This gpd2::Hph disruption cassette was generated by multiple rounds of SOE PCR. First, the GPD2 5 targeting sequence was amplified from pGV2164 (SEQ ID NO: 69), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the Hph ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD2 3 targeting sequence was also amplified. Second, the GPD2 5 targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD2 3 targeting sequence were stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3059 recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates. Twelve colonies were re-streaked for singles and colony PCRs were performed in single colony isolates to test for correct 5 and 3 junctions and the loss of GPD2.
(461) GEVO3059 was generated by deletion of GPD1 using K_URA3 as marker in strain GEVO2994. Deletion of GPD1 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5 bipartite fragment contained the GPD1_5 targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3 truncated and was generated by PCR with pGV2359 (SEQ ID NO: 72) as template. The 3 bipartite fragment contained KI_URA3_5 truncated-T.sub.KI.sub._.sub.URA3-GPD1_3 targeting sequence and was generated by PCR with pGV2157 (SEQ ID NO: 73) as template. The 3 truncated and 5 truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5 and 3 bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
(462) GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc, (Lactococcus lactis ilvD, SEQ ID NO: 65) and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, into the PDC6 locus of GEVO2843. This integration replaced the LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) and the Dm_ADH (Drosophila melanogaster ADH, SEQ ID NO: 60) that were present at the PDC6 locus in GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712
(463) When the biocatalyst GEVO3158 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30 C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3158 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 medium in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm.
(464) A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30 C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.2-0.7 mM/h by reducing agitation to a fixed 250-350 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC.
(465) Isobutanol production reached a maximum at around 7 days with a titer of about 10 g/L. Yield of the fermentation, calculated when the titer of isobutanol was between 3.7 g/L and 10 g/L, was approximately 74% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 10 g/L, was approximately 52% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0.5 g/L and 10 g/L, was approximately 61% maximum theoretical.
Example 21: Isobutanol Production in Pdc-Gpd-Yeast
(466) This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae.
(467) The modified yeast biocatalyst, GEVO3159, encodes a heterologous pathway of enzymes that convert pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3159 is GEVO3124 transformed with pGV2082 (SEQ ID NO: 67), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110), LI_ilvD (Lactococcus lactis ilvD), LI_kivD2 (Lactococcus lactis kivD), and Dm_ADH (Drosophila melanogaster ADH).
(468) The strain GEVO3124 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3124 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, repectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
(469) GEVO3124 was generated by deletion of GPD2 using Hph as marker in strain GEVO3059. Deletion of GPD2 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD2 5 and 3 targeting sequences. This gpd2::Hph disruption cassette was generated by multiple rounds of SOE-PCR. First, the GPD2 5 targeting sequence was amplified from pGV2164 (SEQ ID NO: 69), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the HPH ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD2 3 targeting sequence was also amplified. Second, the GPD2 5 targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD2 3 targeting sequence were also stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3059 recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates. Twelve colonies were re-streaked for singles and colony PCRs were performed in single colony isolates to test for correct 5 and 3 junctions and the loss of GPD2.
(470) GEVO3059 was generated by deletion of GPD1 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD1 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5 bipartite fragment contained the GPD1_5 targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3 truncated and was generated by PCR with pGV2359 (SEQ ID NO: 72) as template. The 3 bipartite fragment contained KI_URA3_5 truncated-T.sub.KI.sub._.sub.URA3-GPD1_3 targeting sequence and was generated by PCR with pGV2175 (SEQ ID NO: 73) as template. The 3 truncated and 5 truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5 and 3 bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
(471) GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, repectively, into the PDC6 locus of GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58 and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712.
(472) When the biocatalyst GEVO3159 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30 C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3159 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm.
(473) A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30 C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.2-0.7 mM/h by reducing agitation to a fixed 250-350 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC.
(474) Isobutanol production reached a maximum at around 5 days with a titer of about 8.5 g/L. Yield of the fermentation, calculated when the titer of isobutanol was between 3.2 g/L and 8.5 g/L, was approximately 75% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 8.5 g/L, was approximately 48% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 1 g/L and 8.5 g/L, was approximately 58% maximum theoretical.
Example 22: Isobutanol Production in Pdc-Gpd-, Co-Factor Balanced Yeast
(475) This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae, expressing an NADH-dependent isobutanol biosynthetic pathway.
(476) The recombinant yeast microorganism, GEVO3160, encodes a heterologous biosynthetic pathway that converts pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3160 is GEVO3128 transformed with pGV2247(SEQ ID NO: 63), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_P2D1-A1 (Escherichia coli ilvC variant), LI_ilvD (Lactococcus lactis ilvD),
(477) GEVO3128 was generated by deletion of GPD1 using Hph as marker in strain GEVO3061. To obtain a gpd1 gpd2 double deletion, deletion of GPD1 was pursued in the gpd2::KI_URA3 deletion strains GEVO3061 Deletion of GPD1 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD1 5 and 3 targeting sequences. This gpd1::Hph disruption cassette was generated by multiple rounds of SOE PCR. First, the GPD1 5 targeting sequence was amplified from pGV2163 (SEQ ID NO: 74), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the Hph ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD1 3 targeting sequence was amplified by PCR. Second, the GPD1 5 targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD1 3 targeting sequence were also stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3061, recovered overnight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates
(478) GEVO3061 was generated by deletion of GPD2 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD2 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5 bipartite fragment contained the GPD2_5 targeting sequence-T.sub.KI.sub._.sub.URA3.sub._.sub.short-P.sub.FBA1-KI_URA3_3 truncated and was generated by PCR with pGV2360 (SEQ ID NO: 75) as template. The 3 bipartite fragment contained KI_URA3_5 truncated-T.sub.KI.sub._.sub.URA3-GPD2_3 targeting sequence and was generated by PCR with pGV2381 (SEQ ID NO: 76) as a template. The 3 truncated and 5 truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5 and 3 bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
(479) GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, repectively, into the PDC6 locus of GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712.
(480) When the biocatalyst GEVO3160 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30 C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3160 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 medium at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 medium in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm.
(481) A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell density. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30 C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.2-0.4 mM/h by reducing agitation to a fixed 200 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC. Isobutanol production reached a maximum at around 7 days with a titer of about 10.5 g/L.
(482) Yield of the fermentation, calculated when the titer of isobutanol was between 5.7 g/L and 10.2 g/L, was approximately 74% of theoretical (max yield calculation). Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 10.5 g/L, was approximately 48% of theoretical (yield calculation including growth of biomass). Yield of the fermentation, calculated when the titer of isobutanol was between 0.6 g/L and 10.5 g/L, was approximately 57% of theoretical (yield calculation for production phase only).
Example 23: Isobutanol Production in Pdc-Gpd-Yeast
(483) This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae, expressing an NADH-dependent isobutanol biosynthetic pathway.
(484) The recombinant yeast microorganism, GEVO3160, encodes a heterologous biosynthetic pathway that converts pyruvate into isobutanol. Genes for the pathway are located on the chromosome and on a single plasmid. GEVO3160 is GEVO3128 transformed with pGV2247 (SEQ ID NO: 63), which is a high copy yeast expression plasmid used to overexpress Ec_ilvC_P2D1-A1 (Escherichia coli ilvC variant), LI_ilvD (Lactococcus lactis ilvD), LI_kivD (Lactococcus lactis kivD), and LI_adhA (Lactococcus lactis adhA). The strain GEVO3128 is both GPD-deficient, PDC-deficient and able to grow in high glucose media without addition of C2-compounds. GEVO3128 has integrated into the PDC1 locus the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) genes under the CUP1 and PGK1 promoters, respectively. This strain also has the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, respectively, integrated into the PDC6 locus. Lastly, this strain has the Ec_ilvC_coSc_Q110V (Escherichia coli ilvC containing a Q to V mutation at position 110; SEQ ID NO: 61) and Sc_ILV3N20 (SEQ ID NO: 62) under the TDH3 and TEF1 promoters, respectively, integrated at the PDC5 locus.
(485) GEVO3128 was generated by deletion of GPD1 using Hph as marker in strain GEVO3061. To obtain a gpd1 gpd2 double deletion, deletion of GPD1 was pursued in the gpd2::KI_URA3 deletion strains GEVO3061 Deletion of GPD1 was carried out by transforming a hygromycin resistance marker, Hph, flanked by the GPD1 5 and 3 targeting sequences. This gpd1::Hph disruption cassette was generated by multiple rounds of SOE PCR. First, the GPD1 5 targeting sequence was amplified from pGV2163 (SEQ ID NO: 74), the CCW12 promoter was amplified from pGV1954 (SEQ ID NO: 70), the Hph ORF was amplified from pGV2074 (SEQ ID NO: 71), and the GPD1 3 targeting sequence was amplified by PCR. Second, the GPD1 5 targeting sequence and the CCW12 promoter were stitched together by SOE-PCR, and the Hph ORF and GPD1 3 targeting sequence were also stitched together by SOE-PCR. Lastly, these two SOE-PCR products were stitched together in another round of SOE-PCR. The resulting product was then transformed into GEVO3061, recovered ovemight in YPD+1% EtOH+G418 or YPD+1% EtOH+G418+1 g/L glycerol, and selected on YPD+G418+Hygro+1 g/L glycerol or YPD+G418+Hygro+10 g/L glycerol plates
(486) GEVO3061 was generated by deletion of GPD2 using KI_URA3 as marker in strain GEVO2994. Deletion of GPD2 was carried out by a bipartite integration scheme using the KI_URA3 marker. The 5 bipartite fragment contained the GPD2_5 targeting sequence-T.sub.KI.sub._.sub.URA3-P.sub.FBA1-KI_URA3_3 truncated and was generated by PCR with pGV2360 (SEQ ID NO: 75) as template. The 3 bipartite fragment contained KI_URA3_5 truncated-T.sub.KI.sub._.sub.URA3-GPD2_3 targeting sequence and was generated by PCR with pGV2381 (SEQ ID NO: 76) as template. The 3 truncated and 5 truncated KI_URA3 overlapped by 347 bp to allow for recombination between the KI_URA3 sequences and reconstitution of a functional KI_URA3 gene. The 5 and 3 bipartite fragments were co-transformed into GEVO2994 and selected on SCD-U+1 g/L glycerol plates.
(487) GEVO2994 was generated by integrating the Ec_ilvC_coSc_P2D1-A1 (Escherichia coli ilvC variant; SEQ ID NO: 64), LI_ilvD_coSc (Lactococcus lactis ilvD, SEQ ID NO: 65), and LI_adhA (Lactococcus lactis adhA, SEQ ID NO: 66) under the TDH3, TEF1 and ENO2 promoters, repectively, into the PDC6 locus of GEVO2843. GEVO2843 was generated by integrating the Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) and LI_kivD2_coEc (Lactococcus lactis kivD, SEQ ID NO: 59) into the PDC1 locus of GEVO2712.
(488) When the biocatalyst GEVO3160 was contacted with glucose in a medium suitable for growth of the biocatalyst, at about 30 C., the biocatalyst produced isobutanol from the glucose. A 24-hour starter culture was started in a 50 mL conical tube with GEVO3160 cells from a frozen glycerol stock. The tube contained a 5 mL volume of YPD80 medium at a starting OD.sub.600 of about 1.0. The starter culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm. The entire contents of the starter culture were then transferred to a flask seed culture. The flask seed culture was 80 mL of YPD80 medium in a 500 mL baffled Erlenmeyer flask. The seed flask culture was grown for approximately 24 hrs in a 30 C. shaker at 250 rpm.
(489) A portion of the flask seed culture was transferred to a 2 L DasGip fermenter containing about 750 mL of YPD80 medium to achieve a 0.5 OD.sub.600 initial cell concentration. The fermenter vessel was attached to a computer control system to monitor and control pH at 6.0 through addition of base, temperature at 30 C., oxygen transfer rate (OTR), and agitation. The vessel was agitated, with a fixed agitation of 700 rpm to maintain an OTR of about 10 mM/h using a 5 sL/h air overlay until the OD.sub.600 was about 8-10. After continuing growth for approximately 20 hrs, the OTR was decreased to approximately 0.3-0.8 mM/h by reducing agitation to a fixed 180-350 rpm and continued 5 sL/h airflow overlay. Measurement of the fermentor vessel off-gas by mass spectrometer was included for ethanol, isobutanol, carbon dioxide, and oxygen. Continuous measurement of off-gas concentrations of carbon dioxide and oxygen were also measured by a DasGip off-gas analyzer throughout the experiment. Samples were aseptically removed from the fermenter vessel throughout the experiment and used to measure OD.sub.600, glucose concentration by HPLC, and isobutanol concentration in the broth by GC.
(490) Isobutanol production reached a maximum at around 7 days with a titer of about 14 g/L. Yield of the fermentation, calculated when the titer of isobutanol was between 7.2 g/L and 12.6 g/L, was approximately 71% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0 g/L and 14 g/L, was approximately 52% maximum theoretical. Yield of the fermentation, calculated when the titer of isobutanol was between 0.5 g/L and 14 g/L, was approximately 60% maximum theoretical.
Example 24: Isobutanol Production in Pdc-Gpd-Yeast
(491) This example demonstrates isobutanol production at greater than 70% yield in a Pdc-minus, Gpd-minus member of the Saccharomyces sensu stricto group, Saccharomyces clade yeast, Crabtree-positive yeast, post-WGD yeast, S. cerevisiae, expressing an NADH-dependent isobutanol biosynthetic pathway.
(492) GEVO3647 contains P.sub.ADH1-Bs_alsS1_coSc (Bacillus subtilis alsS; SEQ ID NO: 58) with two copies of the Lactococcus lactis kivD gene (SEQ ID NO: 59) integrated at the PDC1 locus. The strain is a transformation product of the parent strain GEVO3532 with plasmid pGV2563 (SEQ ID NO: 68).
(493) Medium used for the fermentation was YP+80 g/L glucose+1% v/v Ethanol+0.2 g/L G418. The medium was filter sterilized using a 1 L bottle top Corning PES 0.22 m filter (431174). Medium was pH adjusted 6.0 in the fermenter vessels using 6N KOH. Table EX 15-1 outlines medium components per liter of Di-H.sub.2O.
(494) Inoculum cultures were started from patch plates and placing them in 500 mL baffled flasks containing 80 ml YP+20 g/L glucose+1% v/v ethanol+0.2 g/L G418 medium. The cultures were incubated for 32.5 h at 30 C. in an orbital shaker at 250 rpm. Cell density after incubation was as at OD.sub.600 of 2.5. Batch fermentations were conducted using a 2 L top drive motor DasGip vessel with a working volume of 1.2 L per vessel. The operating conditions are summarized in Table EX15-1 below.
(495) TABLE-US-00022 TABLE EX15-1 Process control parameters. Initial volume mL 1200 Temperature C. 30 pH 6.0 Growth Phase (0-32 hours): Oxygen transfer rate (OTR) mM/h 10.0 Air flow (overlay) slph 5.0 Agitation rpm 900 Dissolved oxygen (DO) % Not controlled Production phase (32-84.3 hours): Oxygen transfer rate (OTR) mM/h 0.5 Air flow (overlay) slph 5.0 Agitation rpm 300 Dissolved oxygen (DO) % Not controlled
(496) Fermenter vessels were sterilized, along with the appropriate dissolved oxygen probes and pH probes, for 60 minutes at 121 C. pH probes were calibrated prior to sterilization however, dissolved oxygen probes were calibrated post sterilization in order to achieve complete polarization prior to calibration. Table EX15-1 outlines the process control parameters used during the fermentation. Note that pH was controlled using 6N KOH and 2N H.sub.2SO.sub.4.
(497) The fermentation was run for 84.3 h. Vessels were sampled every 6-10 h or 3 times daily. Sterile 5 mL syringes were used to collect 3 mL of fermenter broth via a sterile sample port. The sample was placed in a 2 mL microfuge tube and a portion was used to measure cell density (OD.sub.600) on a Genesys 10 spectrophotometer (Thermo Scientific). The remaining sample was filtered through a 0.22 m Corning filter. The supernatant from each vessel was refrigerated in a 96-well deep well plate, and stored at 4 C. prior to gas and liquid chromatography analysis.
(498) Analysis of volatile organic compounds, including ethanol and isobutanol was performed on a HP 5890/6890/7890 gas chromatograph fitted with an HP 7673 Autosampler, a DB-FFAP column (J&W; 30 m length, 0.32 mm ID, 0.25-M film thickness) or equivalent connected to a flame ionization detector (FID). The temperature program was as follows: 200 C. for the injector, 300 C. for the detector, 100 C. oven for 1 minute, 70 C./minute gradient to 230 C., and then hold for 2.5 min. Analysis was performed using authentic standards (>99%, obtained from Sigma-Aldrich, and a 5-point calibration curve with 1-pentanol as the internal standard).
(499) Analysis of organic acid metabolites was performed on an HP-1200 High Performance Liquid Chromatography system equipped with two Restek RFQ 1504.6 mm columns in series. Organic acid metabolites were detected using an HP-1100 UV detector (210 nm) and refractive index. The column temperature was 60 C. This method was isocratic with 0.0180 N H.sub.2SO.sub.4 in Milli-Q water as mobile phase. Flow was set to 1.1 mL/min. Injection volume was 20 L and run time was 16 min. Analysis was performed using authentic standards (>99%, obtained from Sigma-Aldrich, with the exception of DHIV (2,3-dihydroxy-3-methyl-butanoate, CAS 1756-18-9), which was custom synthesized at Caltech (Cioffi, E. et al. Anal Biochem 104 pp. 485 (1980)), and a 5-point calibration curve.
(500) Additionally, on-line continuous measurement of the fermenter vessel off-gas by GC-MS analysis was performed for oxygen, isobutanol, ethanol, carbon dioxide, and nitrogen throughout the experiment.
(501) At the end of the fermentation, the isobutanol titer had reached 6.4 g/L. Yield of the fermentation, calculated over the entire production phase, i.e. from 32 to 84.3 hours, was approximately 71% of theoretical.
Example 25: Cytosolic ALS Homologs that Support Isobutanol Production
(502) This example demonstrates isobutanol production using expression of cytosolically localized ALS genes in the presence of the rest of the isobutanol pathway. The ALS genes were integrated into the PDC1 locus of S. cerevisiae strain GEVO1187 and isobutanol production was achieved by expression from plasmid of the other genes in the isobutanol pathway. Isobutanol production in strains carrying the ALS genes from T. atroviride (Ta_ALS) and T. stipitatus (Ts_ALS) was compared to isobutanol production in strains carrying the ALS gene from B. subtilis (either Bs_alsS2 or Bs_alsS1_coSc). Strains, and plasmids are listed in Tables EX16-1 and EX16-2, respectively.
(503) TABLE-US-00023 TABLE EX16-1 Genotype of strains disclosed herein GEVO No. Genotype Gevo 1187 S. cerevisiae, CEN.PK; MATa ura3 leu2 his3 trp1 Gevo 2280 S. cerevisiae MATa ura3 leu2 his3 trp1 ADE2 pdc1::P.sub.CUP1-1-Bs_AlsS2, TRP1 Note that this is TRP1+. Transformed with plasmid pGV1730. Original isolate A2 Gevo 2618 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-1-Bs_AlsS1_coSc, TRP1. Transformed with plasmid pGV2114. Gevo 2621 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-1-Ta_Als, TRP1. Transformed with plasmid pGV2117. Gevo 2622 S. cerevisiae, MATa ura3 leu2 his3 trp1 pdc1::P.sub.CUP1-1-Ts_Als, TRP1. Transformed with plasmid pGV2118.
(504) TABLE-US-00024 TABLE EX16-2 Plasmids disclosed herein Plasmid name Relevant Genes/Usage Genotype pGV1730 Integration plasmid that will integrate P.sub.CUP1-1:Bs_alsS2, pUC ORI, P.sub.CUP1-1:Bs_alsS2 into PDC1 using Amp.sup.R , TRP1, PDC1 3- digestion with NruI for targeting. This fragment-NruI-PDC1 5- was the parent vector for cloning the fragment. ALS homologs. pGV1773 Vector with Bacillus subtilis AlsS P.sub.PDC1:Bs_AlsS1_coSc, codon optimized for S. cerevisiae. P.sub.TDH3:Ll_kivD, P.sub.ADH1:Sc_ADH7_coSc, URA3 5-end, pUC ORI, kan.sup.R. pGV1802 DNA2.0 plasmid carrying the Ta_ALS_coSc in DNA 2.0 Trichoderma atroviride ALS. vector pGV1803 DNA2.0 plasmid carrying the Ts_ALS_coSc in DNA 2.0 Talaromyces stipitatus ALS. vector pGV2082 High copy 2 plasmid with 4 Ec_ilvC_coSc.sup.Q110V, isobutanol pathway genes without an Ll_ilvD_coSc, Ll_kivD2_coEc, ALS gene. and Dm_ADH, 2 ori, bla, G418R. pGV2114 Integration plasmid that will integrate P.sub.CUP1-1:Bs_alsS1_coSc, pUC into PDC1 using digestion with NruI ORI, Amp.sup.R, TRP1, PDC1 3- for targeting. It carries the Bacillus fragment-NruI-PDC1 5- subtilis AlsS gene codon optimized fragment. for S. cerevisiae. pGV2117 Integration plasmid that will integrate P.sub.CUP1-1:Ta_ALS_coSc, pUC into PDC1 using digestion with NruI ORI, Amp.sup.R, TRP1, PDC1 3- for targeting. It carries the fragment-NruI-PDC1 5- Trichoderma atroviride ALS gene fragment. codon optimized for S. cerevisiae. pGV2118 Integration plasmid that will integrate P.sub.CUP1-1:Ts_ALS_coSc, pUC into PDC1 using digestion with NruI ORI, Amp.sup.R, TRP1, PDC1 3- for targeting. It carries the fragment-NruI-PDC1 5- Talaromyces stipitatus ALS gene fragment. codon optimized for S. cerevisiae.
Materials and Methods for Example 25
(505) Standard molecular biology methods for cloning and plasmid construction were generally used, unless otherwise noted (Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory Manual. 3.sup.rd ed. 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press).
(506) Cloning techniques included digestion with restriction enzymes, gel purification of DNA fragments (using the Zymoclean Gel DNA Recovery Kit, Cat#D4002, Zymo Research Corp, Orange, Calif.), ligations of two DNA fragments (using the Roche rapid ligation kit, Cat#11 635 379 001, Roche Diagnostics, Mannheim, Germany), Klenow treatment of fragments to give blunt ends (using the NEB DNA Polymerase I, Large (Klenow), cat#M0210S, Ipswich, Mass.), and bacterial transformations into chemically competent E. coli cells made at GEVO (TOP10). Plasmid DNA was purified from E. coli cells using the Qiagen QIAprep Spin Miniprep Kit (Cat#27106, Qiagen, Valencia, Calif.).
(507) PCR was performed on an Eppendorf Mastercycler (Cat#71086, Novagen, Madison Wis.). The following PCR program was followed for all primer sets unless otherwise noted: 94 C. for 2 min then 40 cycles of (94 C. 30 sec, 54 C. 30 sec, 72 C. 1 min) then 72 C. for 10 min. Yeast colony PCR used the FailSafe PCR System EPICENTRE Biotechnologies, Madison, Wis.; Catalog #FS99250). A PCR cocktail containing 15 l of Master Mix E buffer, 10.5 l water, 2 l of each primer at 10 M concentration, 0.5 l polymerase enzyme mix from the kit was added to a 0.2 mL PCR tube for each sample (30 l each). For each candidate a small amount of cells was added to the reaction tube using a sterile P10 pipette tip. Presence of the positive PCR product was assessed using agarose gel electrophoresis. The following primer pairs were used. Primers 1432 and 1433 for the 5-ends of all integrations (800 bp band), primers 1435 and 2233 for the 3-ends of pGV2114 integrations (1.1 Kb band), primers 1435 and 2234 for the 3-end of the pGV2115 integrations (1.1 Kb band), primers 1435 and 2236 for the 3-ends of the pGV2117 integrations (1.1 Kb band), primers 1435 and 2237 for the 3-ends of the pGV2118 integrations (1.1 Kb band).
(508) Transformation of integration plasmids was performed according to the lithium acetate protocol described above. Integration plasmids were digested with NruI, checked by gel electrophoresis for complete digestion and used directly from digestion. Integrative transformants were selected by plating the transformed cells on SCD-Trp agar medium. Once the transformants were single colony purified they were maintained on SCD-Trp plates. Once transformants were screened by PCR as described above for proper integration, each strain was transformed with the plasmid pGV2082. Transformants were plated to YPD plates containing 0.2 g/L G418.
(509) SCD-Trp: 20 g/L glucose, 14 g/L Sigma Synthetic Dropout Media supplement (includes amino acids and nutrients excluding histidine, tryptophan, uracil, and leucine), and 6.7 g/L Difco Yeast Nitrogen Base. 0.076 g/L histidine, 0.380 g/L leucine, and 0.076 g/L uracil.
(510) Fermentations
(511) Strains with integrated ALS genes expressed from the CUP1 promoter were transformed with pGV2082 (which carries the other 4 isobutanol pathway genes Ec_ilvC_coScQ110V (SEQ ID NO: 61), LI_ilvD (SEQ ID NO: 65), LI_kivd2_coEc (SEQ ID NO: 59), and Dm_ADH (SEQ ID NO: 60)). Strains were patched onto YPD plates containing 0.2 mg/mL G418. The following morning cells were removed from the plate with a sterile toothpick and resuspended in 4 mL of YPD with 0.2 mg/mL G418. The OD.sub.600 was determined for each culture. Cells were added to 50 mL YP with 5% dextrose and 0.2 mg/mL G418 such that a final OD.sub.600 of 0.1 was obtained. 1 mL of media was removed and the OD.sub.600 for this undiluted sample determined, leftover media was stored at 4 C. to act as media blank for the analytics submission, and to act as the t=0 sample for the fermentation. At t=24 h, 2 mL of media was removed and 25 L used at a 1:40 dilution to determine OD.sub.600. The remaining culture was centrifuged in a microcentrifuge at maximum speed for 10 min and a 1:10 dilution read on the YSI. 50% glucose containing 0.2 mg/mL G418 was added to a final concentration of 100 g/L glucose. 1 mL of supernatant was analyzed by gas chromatography as described above. At t=48 h, 2 mL of media was removed and 25 L used at a 1:40 dilution to determine OD.sub.600. The remaining culture was centrifuged in a microcentrifuge at maximum speed for 10 min and a 1:10 dilution read on the YSI. 50% glucose plus water (with 0.2 mg/mL G418) were added to give a final concentration of glucose of 100 g/L. 1 mL of supernatant was analyzed by gas chromatography. At t=72 h, 2 mL of media was removed and 25 L used at a 1:40 dilution to determine OD.sub.600. The remaining culture was centrifuged in a microcentrifuge at maximum speed for 10 min and a 1:10 dilution read on the YSI. 1 mL of supernatant was analyzed by gas chromatography and high performance liquid chromatography.
(512) Yeast Strain Construction
(513) GEVO2280 was constructed by transforming GEVO1187 with the integration plasmid pGV1730. The plasmid pGV1730 was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol. Transformants were selected by plating to SCGal-Trp plates. Individual integrants were verified using colony PCR with primers 1432 and 1433 to detect proper integration at the 5-end (803 bp fragment) and primers 1220 and 1435 to detect proper integration at the 3-end (772 bp).
(514) GEVO2618 was constructed by transforming GEVO1187 with the integration plasmid pGV2114. The plasmid was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol described above. Correct integration was verified with colony PCR using primers 1432 and 1433 to check the 5-end of the integration (800 bp band) and primers 1435 and 2233 for the 3-end of pGV2114 integration (1,100 bp band).
(515) GEVO2621 was constructed by transforming GEVO1187 with the integration plasmid pGV2117. The plasmid was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol described above. integration was verified with colony PCR using primers 1432 and 1433 to check the 5-end of the integration (800 bp band) and primers 1435 and 2236 for the 3-end of pGV2117 integration (1,100 bp band).
(516) GEVO2622 was constructed by transforming GEVO1187 with the integration plasmids pGV2118. The plasmid was first linearized with NruI, which cuts such that the linear plasmid will integrate into the PDC1 locus, and the DNA was transformed using the standard yeast transformation protocol described above. Twelve transformants were single colony purified. Correct integration was verified with colony PCR using primers 1432 and 1433 to check the 5-end of the integration (800 bp band) and primers 1435 and 2237 for the 3-end of pGV2118 integration (1,100 bp band).
(517) Each ALS-containing strain was transformed with the 4 component pathway plasmid, pGV2082 (SEQ ID NO: 67), as described above. Control strains GEVO2280 (Bs_alsS2) and GEVO1187 (no ALS) were also transformed with pGV2082. Transformants were single colony purified and maintained on YPD plates with 0.2 mg/mL G418.
(518) Plasmid Construction
(519) Construction of Plasmid pGV2082.
(520) The plasmid pGV2044 carries the genes Ec_ilvC_coSc.sup.Q110V, Bs_AlsS2, LI_ilvD_coSc and Dm_ADH. The plasmid pGV2082 was created from pGV2044 by replacing the Bs_AlsS2 with LI_kivD2_coEc as follows: the LI_kivD2_coEc gene and associated PGK1 promoter were removed from pGV2047 by digestion with AvrlI and NcoI. The 2530 bp fragment was purified by gel electrophoresis and the fragment was prepared using the Zymoclean kit described above. Plasmid pGV2044 was digested with EcoRI and SbfI to remove the Bs_AlsS2 gene and associated CUP1 promoter and the 11275 bp vector fragment was gel purified. The vector and insert were treated with Klenow fragment to produce blunt ends. The pGV2044 vector fragment and the P.sub.PGK1:LI_kivD2_coEc insert were ligated using standard methods in an approximately 5:1 insert:vector molar ratio and transformed into TOP10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with the following enzymes: EcoRV to give correct fragments of 6.3 and 7.5 kb, EcoRV plus NruI to give correct fragments of 2.9, 3.4, and 7.5 kb), EcoRI plus NcoI to give correct fragments of 2.5 and 11.2 Kb.
(521) pGV1730 was digested with BamHI and SalI and the vector fragment of 4.9 kb was gel purified by agarose gel electrophoresis. pGV1773 was digested with BamHI and SalI and the 1.7 Kb fragment containing the Bs_AlsS_coSc was gel purified by agarose gel electrophoresis. The pGV1730 vector fragment was ligated to the pGV1773 insert fragment using the Roche rapid ligation kit in a ratio of 5:1 insert to vector ratio and transformed into TOP10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with ScaI plus PstI to give correct fragments of 2.7, 1.7, 1.4 and 0.9 Kb, AflII to give correct fragments of 1.5 and 5.1 kb, NaeI plus StuI to give correct fragments of 1.4, 5.2 kb.
(522) Construction of pGV2117:
(523) pGV1730 was digested with BamHI and SalI and the vector fragment of 4.9 kb was gel purified by agarose gel electrophoresis. pGV1802 was digested with BamHI and SalI and the 1.8 kb fragment containing the Ta_ALS was gel purified by agarose gel electrophoresis. The pGV1730 vector fragment was ligated to the pGV1802 insert fragment using the Roche rapid ligation kit in a ration of 5:1 insert to vector ratio and transformed into TOP-10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with BamHI plus StuI to give correct fragments of 1.4 and 5.2 kb, SalI plus PstI to give correct fragments of 0.7 and 5.9 kb, and AhdI to give correct fragments of 1.9 and 4.7 kb.
(524) Construction of pGV2118:
(525) pGV1730 was digested with BamHI and SalI and the vector fragment of 4.9 kb was gel purified by agarose gel electrophoresis. pGV1803 was digested with BamHI and SalI and the 1.8 kb fragment containing the Ts_ALS gel purified by agarose gel electrophoresis. The pGV1730 vector fragment was ligated to the pGV1803 insert fragment using the Roche rapid ligation kit in a ration of 5:1 insert to vector ratio and transformed into TOP-10 chemically competent E. coli cells. Plasmid DNA was isolated and correct clones were confirmed using restriction enzyme analysis consisting of digestion of potential clones with NaeI to give correct bands of 2.9 and 3.7 kb, EcoRV to give correct bands of 0.7 and 5.9 kb, and HpaI plus SacI to give correct bands of 1.9 and 4.7 kb.
(526) Results
(527) Fermentations of GEVO1187, GEVO2280, GEVO2618, GEVO2621, GEVO2622 and transformed with pGV2082 were carried out as described above (except G418 was not added to the glucose at 24 h). In this experiment strains containing the ALS genes Ta_ALS_coSc and Ts_ALS_coSc produced more isobutanol than the strain containing the Bs_Als2. The Bs_Als1_coSc produced the most isobutanol. Table EX16-3 shows the final OD, glucose consumption, and isobutanol titer for each of the strains. The integration of the cytosolic genes Ta_ALS_coSc and Ts_ALS_coSc led to production of isobutanol that was in each case 6-fold above that of a strain without an integrated ALS gene, demonstrating that these strains are producing isobutanol using a cytosolic pathway.
(528) TABLE-US-00025 TABLE EX16-3 Results of fermentation with cytosolic ALS homologs, at 72 h Glucose consumed Isobutanol produced Strain OD.sub.600 g/L g/L GEVO1187 10.9 0.3 233 36 0.3 0.0 GEVO2280 9.9 0.3 274 26 1.3 0.11 GEVO2618 9.4 0.2 138 9 2.6 .09 GEVO2621 9.9 0.3 161 52 1.9 .18 GEVO2622 10.8 0.6 182 47 1.8 .15
(529) The foregoing detailed description has been given for clearness of understanding only and no unnecessary limitations should be understood there from as modifications will be obvious to those skilled in the art.
(530) While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.
(531) The disclosures, including the claims, figures and/or drawings, of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entireties.