EHV INSERTION SITE ORF70

20180080043 ยท 2018-03-22

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the field of (vector) vaccines, and especially to the novel EHV insertion site ORF70. The present invention further concerns related expression cassettes and vectors, which are suitable to express genes of interest, especially antigen encoding sequences. The viral vectors of the present invention are useful for producing an immunogenic composition or vaccine.

    Claims

    1. An expression cassette comprising (i) at least one exogenous nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, whereby said nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence is operably linked to a promoter sequence, and (ii) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 13 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, SEQ ID NO.: 15 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, and SEQ ID NO.: 17 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, and (iii) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 14 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, SEQ ID NO.: 16 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, and SEQ ID NO.: 18 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof.

    2. An Equid Alphaherpesvirus 1 (EHV-1) vector, preferably strain RacH, comprising the expression cassette of claim 1.

    3. An Equid Alphaherpesvirus 1 (EHV-1) vector, preferably strain RacH, comprising (i) at least one exogenous nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, whereby said nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, is operably linked to a promoter sequence, and (ii) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 13 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, SEQ ID NO.: 15 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, and SEQ ID NO.: 17 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, and (iii) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 14 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, SEQ ID NO.: 16 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof, and SEQ ID NO.: 18 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof.

    4. An Equid Alphaherpesvirus 1 (EHV-1) vector, preferably strain RacH, comprising a nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence, inserted into ORF70.

    5. An Equid Alphaherpesvirus 1 (EHV-1) vector, preferably strain RacH, comprising a first nucleotide sequence or gene of interest, preferably an antigen encoding sequence, inserted into ORF70 and a second nucleotide sequence or gene of interest, preferably another antigen encoding sequence, inserted into a second insertion site, preferably ORF1/3.

    6. The EHV-1 vector of claim 2, whereby the insertion into ORF70 is characterized by a partial deletion, truncation, substitution, modification or the like in ORF70, whereby ORF71 remains functional.

    7. The EHV-1 vector of claim 2, whereby the insertion into ORF70 is characterized by the deletion of an approximately 801 bp portion within ORF70 for RacH (SEQ ID NO.: 20) or a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof.

    8. The EHV-1 vector of claim 2, whereby the EHV-1 vector comprises at least one flanking region selected from the group consisting of: SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, and SEQ ID NO.: 18 and a 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence of any one of these sequences.

    9. The EHV-1 vector of claim 2, whereby the EHV-1 vector comprises (i) at least one left ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 13, SEQ ID NO.: 15, and SEQ ID NO.: 17, and (ii) at least one right ORF70 flanking region selected from the group consisting of: SEQ ID NO.: 14, SEQ ID NO.: 16, and SEQ ID NO.: 18.

    10. The EHV-1 vector of claim 2, whereby said nucleotide sequence of interest, preferably a gene of interest, more preferably an antigen encoding sequence is non-naturally occurring and/or recombinant.

    11. The EHV-1 vector of claim 2, whereby said nucleotide sequence of interest is recombinant and/or heterologous and/or exogenous.

    12. The EHV-1 vector of claim 2, whereby said antigen encoding sequence relates to a pathogen infecting a food producing animal such as swine or cattle.

    13. The EHV-1 vector of claim 2, further comprising additional regulatory sequences such as a termination signal or polyadenylation sequence.

    14. The EHV-1 vector of claim 2, further comprising at least one further nucleotide sequence of interest, preferably another gene of interest, more preferably an antigen encoding sequence, optionally inserted into another insertion site, such as ORF1/3.

    15. The EHV-1 vector of claim 4, whereby the gene of interest is operably linked to a regulatory sequence, preferably a promoter sequence or the EHV-1 vector of claims 5 to 14 whereby the at least two genes of interest are operably linked to regulatory sequences, preferably promoter sequences.

    16. The EHV-1 vector of claim 2, whereby the promoter sequence(s) operably linked to the one or two or more sequences or genes of interest are selected from the group consisting of: SV40 large T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter, a functional fragment of 4pgG600 (SEQ ID No. 1), preferably said functional fragment is p430 (SEQ ID NO.:3), a functional fragment of the complementary nucleotide sequence of 4pgG600 (SEQ ID No. 1), a functional fragment of 4pMCP600 (SEQ ID No. 2), preferably said functional fragment is p455 (SEQ ID NO.:4), a functional fragment of the complementary nucleotide sequence of 4pMCP600 (SEQ ID No. 2).

    17. The EHV-1 vector of claim 5, whereby the promoter sequences operably linked to the at least two genes of interest are different.

    18. The EHV-1 vector of the claim 2, whereby the promoter sequence operably linked to at least one gene of interest is p455 (SEQ ID NO. 4) or a functional fragment thereof or the complementary nucleotide sequences thereof and whereby the promoter sequence operably linked to another gene of interest is p430 (SEQ ID NO. 3) or a functional fragment thereof or the complementary nucleotide sequences thereof.

    19. A mammalian host cell characterized in that it comprises a vector according to claim 2.

    20. Use of the vector according to claim 2, for the manufacture of an immunogenic composition or vaccine.

    21. An immunogenic composition comprising a) the vector according to claim 2, and/or b) a polypeptide expressed by the vector according to claim 2, such as a virus, a modified live virus, a virus like particle (VLP) or the like, and c) optionally a pharmaceutical- or veterinary-acceptable carrier or excipient, wherein said carrier is suitable for oral, intradermal, intramuscular or intranasal application, and said immunogenic composition comprises a virus, such as an infectious virus.

    22. A vaccine or pharmaceutical composition comprising a) the vector according to claim 2, and/or b) a polypeptide expressed by the vector according to claim 2, selected from the group consisting of a modified live virus, a virus like particle (VLP) or the like, and c) a pharmaceutical- or veterinary-acceptable carrier or excipient, wherein said carrier is suitable for oral, intradermal, intramuscular or intranasal application, and d) optionally said vaccine further comprises an adjuvant.

    23. A method for the preparation of an immunogenic composition or a vaccine for reducing the incidence or the severity of one or more clinical signs associated with or caused by an infection, comprising the following steps: a) Infecting a mammalian host cell with the vector according to claim 2, b) cultivating the infected cells under suitable conditions, c) collecting infected cell cultures, d) optionally purifying the collected infected cell cultures of step c) e) optionally mixing said collected infected cell culture with a pharmaceutically acceptable carrier.

    24. The immunogenic composition according to claim 21, for use in a method of reducing or preventing the clinical signs or disease caused by an infection with a pathogen in an animal or for use in a method of treating or preventing an infection with a pathogen in an animal, preferably said animal is a food producing animal such as swine.

    25. A method of immunizing an animal such as a food producing animal including swine against a clinical disease caused by a pathogen in said animal, said method comprising the step of administering to the animal the immunogenic composition according to claim 21, whereby said immunogenic composition or vaccine fails to cause clinical signs of infection but is capable of inducing an immune response that immunizes the animal against pathogenic forms of said pathogen.

    26. A kit for vaccinating an animal, preferably a food producing animal such as swine or cattle, against a disease associated with and/or reducing the incidence or the severity of one or more clinical signs associated with or caused by a pathogen in an animal comprising: a) a dispenser capable of administering a vaccine to said animal; and b) the immunogenic composition according to claim 21, and c) optionally an instruction leaflet.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0205] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

    [0206] FIG. 1. Schematic illustration comparing the orf1/3 regions of wild-type (wt) EHV-1 strain ab4 and attenuated vaccine strain EHV-1 RacH.

    [0207] FIG. 2. Schematic drawing of the orf70 insertion site [0208] UL=long unique segment [0209] US=short unique segment [0210] IR=inner inverted repeat [0211] TR=terminal inverted repeat [0212] gG=glycoprotein G [0213] gpII=glycoprotein II [0214] orf=open reading frame [0215] bp=base pairs

    [0216] FIG. 3. Plasmid map and nucleotide sequence of transfer plasmid pU-mC70-BGH

    [0217] FIG. 4. Plasmid map and nucleotide sequence of transfer vector pU70-p455-71K71

    [0218] FIG. 5. Plasmid map and nucleotide sequence of the transfer plasmid for insertion of the expression cassette p455-H3-71 into orf70 of EHV-1 RacH. [0219] H3=open reading frame encoding for Influenza A virus hemagglutinin H3 [0220] 71pA=new polyA sequence as described in invention disclosure EM P2016-022 [0221] I-SceI=cleavage site for the restriction endonuclease I-SceI [0222] promoter aph=prokaryotic Kanamycin resistance gene promoter [0223] Kana=Kanamycine resistance gene [0224] 3end ORF70=recombination region downstream of insertion site [0225] ORI=origin of replication of the plasmid [0226] AP.sub.r=Ampicillin resistance gene of the plasmid [0227] upstream orf70=recombination region upstream of insertion site [0228] p455=new promoter p455 [0229] bp=base pairs

    [0230] FIG. 6. Schematic illustration of the genome of rEHV-1 RacH-SE-70-p455-H3 with the orf70 insertion region enlarged. [0231] orf69: open reading frame number 69 upstream of the insertion site in orf70; p455: new promoter described herein, see e.g. example 1; H3: transgene Influenza Virus hemagglutinin; 71pA: new polyadenylation sequence; orf70: remainder of orf70 containing the promoter for orf71, which encodes the structural viral glycoprotein II (gpII).

    [0232] FIG. 7. Indirect immunofluorescence assay: Indirect immunofluorescence assay of VERO-cells infected with rEHV-1 RacH-SE-70-p455-H3 24 h p.i. cells were fixed with ethanol and air-dried. Using a commercial monoclonal antibody against H3 as primary antibody and a FITC-conjugated rabbit-anti mouse IgG as secondary antibody, H3 was shown in cells infected with the recombinant EHV-1 RacHSE-70-p455-H3 by fluorescence microscopy.

    [0233] FIG. 8. Western blot: Western blot of cells infected with different passages of rEHV-1 RacH-SE-70-p455-H3 or a control rEHV-1 RacH-SE or mock-infected. The blot on the left was incubated with a monoclonal antibody Ai2G7 directed to gpII of EHV-1. The replica blot on the right was incubated with a commercial rabbit hyperimmune serum against Influenza A hemagglutinin H3 (PA5-34930).

    [0234] FIG. 9A. Virus Titers: Graphs showing viral loads of lung samples of vaccinated or non-vaccinated pigs after challenge. Mean lung virus titers of animals; and FIG. 9B. Graphs showing viral loads of lung samples of vaccinated or non-vaccinated pigs after challenge. Mean lung virus titers of Groups. [0235] Inact=commercially available inactivated vaccine [0236] EHV=rEHV-1 RacH-SE-70-p455-H3

    [0237] FIG. 10. Plasmid map and nucleotide sequence of transfer vector pU-1-3-p430-BGHKBGH

    [0238] FIG. 11. Plasmid map and nucleotide sequence of the transfer plasmid for insertion of the expression cassette p430-H1av-BGH into orf1/3 of EHV-1 RacH. [0239] H1av=open reading frame encoding for Influenza A virus hemagglutinin H1 [0240] BGHpA=bovine growth hormone polyA sequence [0241] promoter aph=prokaryotic Kanamycin resistance gene promoter [0242] Kana=Kanamycine resistance gene [0243] Flank B=recombination region downstream of insertion site [0244] Flank A=recombination region upstream of insertion site [0245] p430=new promoter p430 [0246] bp=base pairs

    [0247] FIG. 12. Schematic illustration of the genome of rEHV-1 RacH-SE-1/3-p430-H1av with the orf1/3 insertion region enlarged.

    [0248] orf1: Remaining portion of open reading frame 1 upstream of the insertion site; p430: new promoter described herein, see e.g. example 1; H1av: transgene Influenza Virus hemagglutinin; [0249] BGHpA: bovine growth hormone polyadenylation sequence; orf3:open reading frame 3 downstream of insertion site.

    [0250] FIG. 13. Western blot and immunofluorescence of cells infected with rEHV-1 RacH-SE-1/3-p430-H1av showing expression of the transgene. [0251] H1av=rEHV-1 RacH-SE1/3-p430-H1av [0252] SE=rEHV-RacH-SE (control) [0253] mock=uninfected cells (control)

    [0254] FIG. 14. Schematic illustration of the genome of rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3 (rEHV-1-RacH-SE B) with the two insertion regions enlarged. [0255] orf1: Remaining portion of open reading frame 1 upstream of the insertion site; p430: new promoter; H1av: transgene Influenza Virus hemagglutinin; BGHpA: bovine growth hormone polyadenylation sequence; orf3:open reading frame 3 downstream of insertion site. [0256] orf69: open reading frame 69 upstream of the insertion site in orf70; p455: new promoter; H3: transgene Influenza Virus hemagglutinin; 71pA: new polyadenylation sequence; orf70: remainder of orf70 containing the promoter for orf71, which encodes the structural viral glycoprotein II (gpII).

    [0257] FIG. 15. Western blot: Western blot of cells infected with rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3 (B), empty vector rEHV-1 RacH-SE (SE), or mock-infected (ctrl). Replica blots were incubated with either a commercial rabbit hyperimmune serum to H3 (H3), a commercial rabbit hyperimmune serum (PA 34929) to H1 (H1), or a monoclonal antibody Ai2G7 to EHV-1 gpII (gpII).

    [0258] FIG. 16. Mean body temperatures of groups before and at 1,2, and 3 days after challenge. Error bars, standard deviations. From left to right per study day: negative control group (neg. ctrl.), challenge control group (chall. ctrl.), animals vaccinated once with RacH-SE-70-p455-H3 (1 EHV-1), vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1), or twice with inactivated Swine IAV vaccine (2 killed).

    [0259] FIG. 17. Mean lung scores of groups one and three days after challenge. Error bars, standard deviations. Negative control group (neg. ctrl.), challenge control group (chall. ctrl.), animals vaccinated once with RacH-SE-70-p455-H3 (1 EHV-1), vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1), or twice with inactivated Swine IAV vaccine (2 killed).

    [0260] FIG. 18. Reciprocal serum neutralization (SN) titers of animal sera against Swine IAV H3 challenge strain R452-14 collected at day of challenge. 20, detection limit. Negative control group (neg. ctrl.), challenge control group (chall. ctrl.), animals vaccinated once with RacH-SE-70-p455-H3 (1 EHV-1), vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1), or twice with inactivated Swine IAV vaccine (2 killed).

    [0261] FIG. 19. Results from IL-1 from BALF taken one or two days after Swine IAV challenge application. Each dot represents the value determined per one animal. Negative control group (Neg. Ctr.), challenge control group (Chall. Ctr.), animals vaccinated once with RacH-SE-70-p455-H3 (1 EHV-1), vaccinated twice with RacH-SE-70-p455-H3 (2 EHV-1), or twice with inactivated Swine IAV vaccine (2 killed).

    [0262] FIG. 20. Results from INF-ELISpots of PBMCs restimulated 7 days after 2.sup.nd vaccination. (A), unvaccinated control group; (B), vaccinated twice with inactivated Swine IAV vaccine; (C), vaccinated once with rEHV-1 RacH-SE-70-p455-H3; (D), vaccinated twice with rEHV-1 RacH-SE-70-p455-H3. For animals vaccinated only once with rEHV-1 RacH-SE-70-p455-H3 restimulation corresponds to 7 days after 1.sup.st vaccination. Each dot represents the value determined per one animal for the given timepoint and after restimulation with the specific stimulus. For restimulation, recombinantly expressed Swine IAV HA corresponding to the H3 vaccine antigen in rEHV-1 RacH-SE-70-p455-H3 (HA_V), recombinantly expressed Swine IAV HA corresponding to the H3 of challenge strain R452-14 (HA_CH), the media to dilute HA_V and HA_CH (RPMI), empty EHV-1 vector RacH-SE (EHV-1 empty), vaccine RacH-SE-70-p455-H3 (EHV-1-H3), Swine IAV H3N2 challenge strain R452-14 (H3N2), cell supernatant from non-infected cells used to grow R452-14 (MDCK), or recombinantly expressed Swine IAV nucleoprotein (NP) were used.

    [0263] FIG. 21. Schematic map of transfer plasmid pU1/3-p430-H1hu-BGHKBGH

    [0264] FIG. 22: Schematic map of transfer plasmid pU70-p455-H1pdm-71K71

    [0265] FIG. 23: The linear double-stranded DNA genome of rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm (rEHV-1 RacH-SE_D) with the orf1/3 and orf70 insertion regions enlarged

    [0266] FIG. 24: Western blots of cells infected with rEHV-1 RacH-SE_B, RacH-SE_D, RacH-SE, or uninfected (ctrl). Replica blots were incubated either with a polyclonal rabbit hyperimmune serum directed against H3 (PA5-34930), a polyclonal rabbit hyperimmune serum directed against H1 (PA5-34929), or a monoclonal antibody (Ai2G7) against EHV-1 glycoprotein II (gpII). All antibodies produced the expected patterns confirming expression of the desired antigens H3 and H1 and comparable replication efficiency of the different viruses as judged from the very similar staining of EHV-1 gpII in all infected cells samples.

    [0267] FIG. 25: Results of Influenza A virus neutralization tests of mice sera. *Error bars indicate standard deviation.

    [0268] FIG. 26: Map of transfer plasmid pU70-455-SBVGc_71K71

    [0269] FIG. 27A) Results of quantitative RT-PCR of unvaccinated control cattle (upper panel) and animals vaccinated twice with rEHV-SBV-Gc (lower panel) for detection of viral genome of SBV. Individual animals are identified by different types of lines and symbols for each group of animals unvaccinated and vaccinated, respectively. Animal 1 is depicted as black line with black filled circles (corresponds to black bar in FIG. 27B). Animal 2 is depicted as broken grey line with grey filled triangles (corresponds to light grey bar in FIG. 27B). Animal 3 is depicted as broken black line with unfilled squares (corresponds to white bar in FIG. 27B). Animal 4 is depicted as broken grey line with grey filled diamonds (corresponds to dark grey bar in FIG. 27B). FIG. 27B) Results of the serum neutralization tests of unvaccinated control cattle (upper panel) and animals vaccinated twice with rEHV-SBV-Gc (lower panel). Individual animals are identified by different bar colors/fillings (from black over light grey and dark grey to white) for each group of animals unvaccinated and vaccinated, respectively. Animal 1 is depicted as black bar (corresponds to black line with black filled circles in FIG. 27A). Animal 2 is depicted as light grey bar (corresponds to broken grey line with grey filled triangles in FIG. 27A). Animal 3 is depicted as white bar (corresponds to broken black line with unfilled squares in FIG. 27A). Animal 4 is depicted as dark grey bar (corresponds to broken grey line with grey filled diamonds in FIG. 27A).

    [0270] FIG. 28: EHV neutralization test. All results obtained from samples of the identical animal in a respective group are shown in the same shade of grey: one animal is represented by a black filled bar, another animal is represented by a light grey filled bar, a third animal is represented by a white bar, and a fourth animal is represented by a dark grey bar.

    [0271] FIG. 29: Swine IAV lung titers determined as TCID50/g lung tissue for animals killed one day after challenge. neg. ctrl., negative control group; chall. ctrl., challenge control group; 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Data points indicate means obtained for individual animals. Middle horizontal lines indicate group means, respectively. Upper and lower horizontal lines indicate standard deviations, respectively. p values for pairwise statistical comparisons of groups are given below and were calculated by t-test using the Mann-Whitney test and GRAPHPAD PRISM for Windows software 7.02, GraphPad Software, Inc., La Jolla, Calif. 92037, USA, using standard software settings, respectively.

    [0272] FIG. 30: Swine IAV lung titers determined as TCID50/g lung tissue for animals killed three days after challenge. neg. ctrl., negative control group; chall. ctrl., challenge control group; 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Data points indicate means obtained for individual animals. Middle horizontal lines indicate group means, respectively. Upper and lower horizontal lines indicate standard deviations, respectively. p values for pairwise statistical comparisons of groups are given below and were calculated by t-test using the Mann-Whitney test and GRAPHPAD PRISM for Windows software 7.02, GraphPad Software, Inc., La Jolla, Calif. 92037, USA, using standard software settings, respectively.

    [0273] FIG. 31: Swine IAV lung titers determined as TCID50/g lung tissue for animals killed five days after challenge. neg. ctrl., negative control group; chall. ctrl., challenge control group; 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Data points indicate means obtained for individual animals. Middle horizontal lines indicate group means, respectively. Upper and lower horizontal lines indicate standard deviations, respectively. p values for pairwise statistical comparisons of groups are given below and were calculated by t-test using the Mann-Whitney test and GRAPHPAD PRISM for Windows software 7.02, GraphPad Software, Inc., La Jolla, Calif. 92037, USA, using standard software settings, respectively.

    [0274] FIG. 32: Results from an enzyme-linked immunosorbent assay (ELISA) specific for swine immunoglobulin G (IgG) directed against a recombinantly expressed swine IAV hemagglutinin H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B. For the test, each well was coated with 100 ng of recombinantly expressed H3. Samples were measured pairwise, sample means calculated from pairwise measurements, and group values were calculated from sample means, respectively. chall. ctrl., challenge control group (served as negative control); 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Error bars indicate standard deviations. Study days (SD) are indicated in the legend to the right of the graph.

    [0275] FIG. 33: Results from an enzyme-linked immunosorbent assay (ELISA) specific for swine immunoglobulin G (IgG) directed against a recombinantly expressed swine IAV hemagglutinin H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B. For the test, each well was coated with 100 ng of recombinantly expressed H3. Samples were measured pairwise, sample means calculated from pairwise measurements, and group values were calculated from sample means, respectively. chall. ctrl., challenge control group (served as negative control); 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Error bars indicate standard deviations. Study days (SD) are indicated in the legend to the right of the graph.

    [0276] FIG. 34: Results from interferon gamma-specific enzyme-linked immunosorbent spot assay (INF ELISpot). Peripheral blood mononuclear cells (PBMCs) were purified from blood taken from study animals at study day 28 (SD28). The PBMCs then were restimulated either with H3N2 swine IAV challenge strain R452-14 at a multiplicity on infection of 1 (H3N2 MOI 1) or with recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B at a concentration of 1 g/ml (rH3 1 g/ml). Using the restimulated PBMCs, an interferon gamma-specific enzyme-linked immunosorbent spot assay (INF ELISpot) was performed, and the obtained values normalized to 106 cells and calculated as means per group, respectively. chall. ctrl., challenge control group (served as negative control); 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Error bars indicate standard deviations.

    [0277] FIG. 35: Results from interferon gamma-specific enzyme-linked immunosorbent spot assay (INF ELISpot). Peripheral blood mononuclear cells (PBMCs) were purified from blood taken from study animals at study day 28 (SD28). The PBMCs then were restimulated either with H3N2 swine IAV challenge strain R452-14 at a multiplicity on infection of 1 (H3N2 MOI 1) or with recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B at a concentration of 1 g/ml (rH3 1 g/ml). Using the restimulated PBMCs, an interferon gamma-specific enzyme-linked immunosorbent spot assay (INF ELISpot) was performed, and the obtained values normalized to 106 cells and calculated as means per group, respectively. chall. ctrl., challenge control group (served as negative control); 2 IM, group vaccinated two times intramuscularly; IN+IM, group vaccinated first intranasally and second intramuscularly; 2 IN, group vaccinated two times intranasally. Error bars indicate standard deviations.

    EXAMPLES

    [0278] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

    Example 1

    Establishment of the New Insertion Site ORF70

    [0279] In order to augment the capabilities of the EHV-1 vector the inventors sought to find a way to express two different transgenes from one vector backbone without coupling two transgenes by RNA-virus-derived functions under control of one promoter. The inventors hypothesized that the herpesvirus genome would tolerate the use of two independent transgene insertion sites in parallel. To determine whether the EHV-1 ORF70 was a suitable transgene insertion site, 801 basepairs of the 5end of orf70 (1236 bp) were replaced with an expression cassette coding for the autofluorescent mCherry protein (Shaner et al. 2004) by classical homologous recombination (FIG. 2). A map of the plasmid pU-mC70-BGH is in FIG. 3 (SEQUENCE ID NO.21). The DNA fragment used for homologous recombination was excised from pU-mC70-BGH with XbaI. The gel-purified fragment was co-transfected with viral genomic DNA of EHV-1 RacH into RK13 cells. Efficient rescue of recombinant vector virus and efficient replication in cultured cells were shown by live fluorescence and virus titrations (not shown). Deletion of two thirds of orf70 had the additional benefit that expression of glycoprotein G encoded by orf70 was abolished. Glycoprotein G of EHV-1 was shown to be a non-structural, secreted chemokine binding protein counter-acting the host's immune response (Drummer et al., 1998; Bryant et al., 2003). Since a vector vaccine is intended to stimulate the vaccines immune response, removal of this particular immunosuppressive function of the viral vector might additionally improve performance of the viral vector platform EHV-1 RacH-SE.

    Example 2

    Use of the New ORF70 Insertion Site with p455 Promoter in Recombinant EHV-1 Vector Vaccines and Construction of a Recombinant Virus

    [0280] The p455 promoter:

    [0281] For a first animal experiment an Influenza hemagglutinin subtype H3 from a swine origin Influenza A virus (A/swine/Italy/7680/2001(H3N2), GenBank accession no.: ABS50302.2) was used. Its coding sequence was synthesized and subcloned in the transfer vector pU70-p455-71K71 (FIG. 4, SEQ ID NO. 22) generating the transfer plasmid pU70-p455-H3-71K71, placing H3 under control of the new p455 promoter and the new 71pA polyadenylation signal and framing the cassette with the recombination regions for insertion into orf70 (FIG. 5, SEQ ID NO. 23).

    [0282] By en-passant mutagenesis using the RED recombination system (Tischer et al. 2006) the expression cassette p455-H3-71 was inserted in orf70 of pRacH-SE to generate pRacH-SE70-p455-H3 (FIG. 6).

    [0283] PK/WRL cells were transfected with pRacH-SE70-p455-H3, recombinant virus rEHV-1 RacH-SE70-p455-H3 was rescued and plaque-purified twice. Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA, FIG. 7).

    [0284] Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot (FIG. 8) using a monoclonal antibody Ai2G7 (owned by BI). Appearance of trimers of H3 on the plasma membrane of infected cells was assayed by a hemadsorption test using chicken erythrozytes (not shown). Peak titers determined as TCID.sub.50/ml in PK/WRL cells were in the same range as titers of the parental virus rEHV-1 RacH-SE which indicates that transgene expression had no detrimental effect on viral replication (not shown). This was confirmed by passaging of rEHV-1 RacH-SE70-p455-H3 in PK/WRL cells up to passage 20 (P20) after rescue. At P5, P10, P15, and P20 the virus was characterized by titration, sequencing, and Western blot (FIG. 8), at P10 and P20 additionally by IFA, and HA expression and genetic stability of the HA encoding insert along with the promoter and polyA sequences were confirmed.

    [0285] The two blots shown in FIG. 8 are replicas that were incubated with either the monoclonal antibody Ai2G7 (left) that specifically detects EHV-1 glycoprotein II (gpII) or with a commercial polyclonal antibody from rabbit (PA5-34930) raised against Influenza hemagglutinin subtype H3 (right). gpII was detected in all cell cultures infected with recombinant EHV-1 as expected. Full-length H3 was detected in all cells infected with the different passages of rEHV-1 RacH-SE-70-p455-H3 as expected. Specificity of the H3-antiserum was shown in the same Western blot, see lane gG430mC. Here only the gpII mab produced a reaction, as expected, while the anti-H3 antibody did not bind in the respective replica lane.

    [0286] By double immunofluorescence assay (dIFA) of viral plaques in cells infected with P20 using a monoclonal anti-H3 antibody and a horse anti-EHV antiserum, it was confirmed that virtually all EHV-1 induced plaques also express H3 (not shown). All tests confirmed stability of the recombinant EHV-1 RacH-SE-70-p455-H3.

    Example 3

    Proof of Concept Animal Study (POC I) Using the New ORF70 Insertion Site and Assessment of the Serological Response

    [0287] Test Animals: Inclusion Criteria and Experimental Design:

    [0288] Five groups of ten piglets born from Influenza A-naive sows were included in the POC-I study as summarized in table 2.

    TABLE-US-00002 TABLE 2 Group No. of animals Route Dose Vaccine Treatment 1 1 NaCl; 10 i.m. 2 ml NaCl; 1 EHV1 vector 2 ml EHV1, vaccine 1.00 10.sup.7 TCID.sub.50 2 2 EHV1 vector 10 i.m. 2 2 ml EHV1, vaccine 1.00 10.sup.7 TCID.sub.50 3 2 NaCl 10 i.m. 2 2 ml NaCl 4 2 inactivated vaccine 10 i.m. 2 2 ml IDT 5 2 NaCl 10 i.m. 2 2 ml NaCl Challenge Treatment 1 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 10.sup.7 TCID.sub.50/ VIRUS FROM ml SWINE 2 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 10.sup.7 TCID.sub.50/ VIRUS FROM SWINE ml 3 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 10.sup.7 TCID.sub.50/ VIRUS FROM SWINE ml 4 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 10.sup.7 TCID.sub.50/ VIRUS FROM SWINE ml 5 cell culture medium 10 Intratracheal 8 ml (Negative Control)

    [0289] An infectious dose of 110.sup.7 TCID50 of rEHV-1 RacH-70-p455-H3 (EHV-1) was applied either once at five weeks of age or twice at two and five weeks of age. For comparison commercially available inactivated vaccine was applied twice at two and five weeks of age. All piglets were free of maternally derived antibodies in order not to abolish the effect of the inactivated vaccine(Inact). Two groups were not vaccinated but received injections with physiological sodium chloride solution (NaCl) to serve as challenge control or strict negative control, respectively. 21 days after the second vaccination all groups except the strict negative control group were challenged with 110.sup.7 TCID.sub.50 of a heterologous Influenza A (IVA) strain (H3N2 INFLUENZA A VIRUS FROM SWINE R452-14, challenge isolate owned by BI). While in the non-vaccinated challenge control group (Chall ctrl) all pigs had high influenza virus titers in their lungs at one and three days after challenge infection, all pigs in the strict negative control group (neg ctrl) and the group that had been vaccinated twice (EHV 2) with rEHV-1 RacH-SE-70-p455-H3 were negative for IVA at both days. In the group vaccinated twice with the inactivated control vaccine (Inact 2), one of five animals had a low IVA titre at day three after challenge. In the group vaccinated once (EHV 1) 21 days prior to challenge with rEHV-1 RacH-SE-70-p455-H3, two of five animals had low IVA titers in their lungs one day after challenge infection and one of five at three days after challenge. (FIGS. 9A. and 9B.).

    [0290] Two vaccinations with 110.sup.7 TCID50 of rEHV-1 RacH-SE-70-p455-H3 completely protected pigs against challenge infection with a heterologous IVA, subtype H3N2. It was demonstrated that the EHV-1 vector RacH-SE is suitable for vaccination of pigs and that the new promoter p455 is functional in driving immunogenic expression of IVA hemagglutinin in vaccinated pigs.

    Example 4

    Use of the New p430 Promoter in Recombinant EHV-1 Vector Vaccines and Construction of a Recombinant Virus

    [0291] The p430 promoter:

    [0292] The newly identified p430 promoter was used to drive expression of another Influenza hemagglutinin from an H1N1 virus ((A/swine/Gent/132/2005(H1N1), GenBank accession no.: AFR76623.1). Since the hemagglutinin gene in this virus isolate originated from an avian IAV it will be referred to as H1av. H1av was synthesized and subcloned in a transfer vector for the orf1/3 insertion region (FIG. 10, SEQ ID NO. 24) to generate pU1/3-p430-H1av-BGH_K_BGH (FIG. 11, SEQ ID NO. 25). Expression of H1av was placed under control of the p430 promoter and the bovine growth hormone (BGH) polyA signal.

    [0293] By en-passant mutagenesis using the RED recombination system (Tischer et al. 2006) the expression cassette p430-H1av-BGH was inserted in orf1/3 of pRacH-SE to generate pRacH-SE1/3-p430-H1av (FIG. 12).

    [0294] PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av, recombinant virus rEHV-1 RacH-SE1/3-p430-H1av was rescued and plaque-purified twice. Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA) and Western blot using commercially available monoclonal and polyclonal antibodies (FIG. 13).

    [0295] Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA and Western blot using a monoclonal antibody Ai2G7 (owned by BI), (not shown). Correct processing and transport of H1av and localization in the plasma membrane of infected cells was assayed by a hemadsorption test using chicken erythrozytes (not shown). Peak titers determined as TCID50/ml in PK/WRL cells were in the same range as titers of the parental virus RacH-SE which indicates that transgene expression had no detrimental effect on viral replication (not shown).

    [0296] Specific detection of a broad band migrating at 75 kDa by antibody PA-34929 is in concordance with the expected appearance of the recombinant HA glycoprotein as predicted from its sequence. Apparent staining of cellular membranes with the monoclonal antibody C102 is in line with the subcellular localization as expected (FIG. 13).

    [0297] In order to test whether the expressed recombinant hemagglutinins were processed and transported as expected, VERO-cells were infected with rEHV-1 RacH-SE-1/3-p430-H1av, rEHV-1 RacH-SE-70-p455-H3, rEHV-1 RacH-SE (parent) at an m.o.i. of 0.01, or left uninfected. 24 h p.i. live infected and uninfected cells were incubated with a suspension of chicken erythrocytes in PBS, washed with PBS and stained with the fluorescent Hoechst 33342 nuclear stain. Since erythrocytes of birds contain cell nuclei they can be stained with Hoechst33342 and appear as tiny blue specks by fluorescence microscopy, Compared with cells that were infected with rEHV-1 RacH-SE that does not express hemagglutinin, adsorption of chicken erythrocytes was significantly increased on cells infected with either rEHV-1 RacH-SE-1/3-p430-H1av or rEHV-1 RacH-SE-70-p455-H3 (not shown). From this it can be concluded that the hemagglutinins were translated, processed and transported to the plasma membrane of vector virus infected cells in a manner as if they were produced by authentic influenza virus infection.

    [0298] The clear phenotype of hemadsorption of infected cells supports the findings of the Western blots and immunofluorescence assays showing efficient expression of the transgenic proteins and suggesting formation of functional HA trimers on the cell surface of EHV-1 vector infected cells.

    Example 5

    Use of the New ORF70 Insertion Site and the ORF1/3 Insertion Site in Recombinant EHV-1 Vector Vaccines in Parallel

    [0299] To show that the two new promoters can be used in parallel a recombinant EHV-1 RacH was generated expressing two different hemagglutinins of two different Influenza A virus subtypes.

    [0300] Specificity and lack of cross-reactivity of the polyclonal commercial antibodies to H3 (PAS-34930) and H1 (PAS-34929) was verified by Western blots of infected cells infected with single-insert viruses rEHV-1 RacH-SE-70-p455-H3 and rEHV-1 RacH-SE-1/3-p430-H1av (not shown).

    [0301] The open reading frame encoding the hemagglutinin of Influenza A virus (A/swine/Gent/132/2005(H1N1)) was synthesized and cloned into the transfer vector pU1-3-p430-BGHKBGH (FIG. 10) resulting in pU1-3-p430-H1av-BGHKBGH (FIG. 11). Starting with the recombinant BAC pRacH-SE-70-p455-H3, the expression cassette p430-H1av-BGH as assembled in pU1/3-p430-H1av-BGHKBGH (FIG. 11, SEQ ID NO. 25) was inserted into the orf1/3 insertion site by two-step RED recombination to generate pRacH-SE-1/3-p430-H1av-70-p455-H3. PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av-70-p455-H3, and recombinant virus rEHV-1 RacH-SE1/3-p430-H1av-70-p455-H3 was rescued and plaque-purified twice (FIG. 12).

    [0302] The short designation for this recombinant virus is rEHV-1 RacH-SE_B. Correct insertion of the expression cassette was verified by sequencing of high-fidelity PCR products of the insertion regions together with flanking sequences. Expression of the transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blot using commercially available monoclonal and polyclonal antibodies (FIG. 13). Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot using a monoclonal antibody Ai2G7 (owned by BI), (FIG. 13).

    [0303] As shown in FIG. 13 both transgenes H3 and H1av were expressed in parallel in cell cultures infected with the dual insert recombinant rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3 (B). Transgene expression was stable and did not impair viral titers tested until passage 11 in PK/WRL cells (not shown).

    [0304] The two new promoters p430 and p455 were shown to be functional in the context of rEHV1-RacH replication in cell cultures. Activity levels during the viral replication cycle appear to be very similar as deduced from in vitro promoter kinetic experiments. These properties allow creation of recombinant vector vaccines based on EHV-1 RacH or other vector platforms expressing two different antigens in parallel with similar efficiency. If a vaccine target consists of two different pathogens application of the two new promoters in two insertion sites combined with two polyadenylation sequences can reduce cost of goods significantly and represents a clear advantage over a vector expressing only one antigenic component.

    Examples 6

    Generation, In Vitro Characterization and In Vivo Testing of a Monovalent Ehv-1 Vectored Influenza A Virus Vaccine (H3 Vaccine) For Swine

    [0305] Swine IAV Influenza virus hemagglutinin of serotype H3 (SEQ ID NO 27) (A/swine/Italy/7680/2001(H3N2), GenBank accession no.: ABS50302.2) was chosen as antigen to be tested for vaccination study in pigs. This new vaccine against swine IAV provides a DIVA feature, e.g. by detection of antibodies against Swine IAV proteins NP or NA in animals that were infected by Swine IAV field strains but not in animals only vaccinated with the vaccine described here since it only expresses one Swine IAV HA protein. Its coding sequence was synthesized and subcloned generating the transfer vector pU70-p455-H3-71K71, placing H3 under control of the new p455 promoter and the new 71pA polyadenylation signal and framing the cassette with the recombination regions for insertion into orf70 (FIG. 2).

    [0306] By en-passant mutagenesis using the RED recombination system the expression cassette p455-H3-71 was inserted in orf70 of pRacH-SE to generate pRacH-SE70-p455-H3 (FIG. 6).

    [0307] PK/WRL cells were transfected with pRacH-SE70-p455-H3, recombinant virus rEHV-1 RacH-SE70-p455-H3 was rescued and plaque-purified twice.

    [0308] Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA, FIG. 7) and Western blot (FIG. 8) using commercially available monoclonal and polyclonal antibodies.

    [0309] Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot (FIG. 8) using a monoclonal antibody Ai2G7 (owned by BI). Appearance of trimers of H3 on the plasma membrane of infected cells was assayed by a hemadsorption test using chicken erythrozytes (not shown). Peak titers determined as TCID.sub.50/ml in PK/WRL cells were in the same range as titers of the parental virus RacH-SE which indicates that transgene expression had no detrimental effect on viral replication (not shown). This was confirmed by passaging of rEHV-1 RacH-SE70-p455-H3 in PK/WRL cells up to passage 20 (P20) after rescue. At PS, P10, P15, and P20 the virus was characterized by titration, sequencing, and Western blot (FIG. 8), at P10 and P20 additionally by IFA, and HA expression and genetic stability of the HA encoding insert along with the promoter and polyA sequences were confirmed.

    [0310] The two blots shown in FIG. 8 are replicas that were incubated with either the monoclonal antibody Ai2G7 (left) that specifically detects EHV-1 glycoprotein II (gpII) or with a commercial polyclonal antibody from rabbit (PAS-34930) raised against Influenza hemagglutinin subtype H3 (right). gpII was detected in all cell cultures infected with recombinant EHV-1 as expected. Full-length H3 was detected in all cells infected with the different passages of rEHV-1 RacH-SE-70-p455-H3 as expected. Specificity of the H3-antiserum was also shown by Western blots of cells infected with other recombinant EHV-1 RacH-SE expressing Influenza hemagglutinins from H1 subtype viruses, see below, FIG. 15.

    [0311] By double immunofluorescence assay (dIFA) of viral plaques in cells infected with P20 using a monoclonal anti-H3 antibody and a horse anti-EHV antiserum, it was confirmed that virtually all EHV-1 induced plaques also express H3 (not shown). All tests confirmed stability of the recombinant EHV-1 RacH-SE-70-p455-H3.

    [0312] To investigate its properties as a vectored vaccine in young piglets, rEHV-1 RacH-SE-70-p455-H3 was tested in a vaccination-challenge study. In detail, piglets without maternally derived immunity against Swine IAV (no maternal antibodies) were vaccinated twice with cell culture supernatant containing RacH-SE-70-p455-H3 at a dose of 1107 TCID50 intramuscularly at an age of two and five weeks (two-shot vaccination, 2 EHV-1), or at an age of five weeks only (one-shot vaccination, 1 EHV-1). A non-vaccinated group served as negative control and a group of animals that were vaccinated at two and five weeks of age with a commercially available inactivated Swine IAV vaccine according to the manufacturer's instructions (but for the time points of vaccination) served as positive control (killed). At an age of 8 weeks, all animals but the negative control were challenged by an intratracheally applied dosage of 1107 TCID50 of an H3N2 Swine IAV challenge strain (European field virus isolate R452-14 whose H3 is being heterologous to the H3 vaccine antigen used in RacH-SE-70-p455-H3). Non-vaccinated and unchallenged animals served as negative control, while non-vaccinated but challenged animals served as challenge control. At and after vaccinations and before and after challenge, body temperatures were measured and blood samples were taken at different time points. One day after challenge, half of the animals per group were killed and the lungs were scored for lesions typical for Swine IAV infection, three lung samples per left and right lung were taken per animal, respectively, to determine infectious Swine IAV titers in lung homogenates, and bronchioalveolar lavage fluid (BALF) was sampled. The same procedure was performed with the remaining half on animals per group three days after challenge.

    [0313] When investigating the body temperature rise after Swine IAV challenge virus application, non-vaccinated animals showed a body temperature increase of about 1 C. 1 day after challenge. This body temperature increase 1 day after challenge was prevented for the group vaccinated twice with the RacH-SE-70-p455-H3 vaccine (FIG. 16).

    [0314] Assessment of the lung scores from animals killed at 1 or 3 days after Swine IAV challenge virus application revealed that the negative control showed no lung lesions typical for Swine IAV infection, the challenge control showed lung lesions in the mean range of 6-7%, and that regarding the group mean values lung lesion scores were strongly reduced to one to less than 4% for the group vaccinated twice with the RacH-SE-70-p455-H3 vaccine (FIG. 17).

    [0315] The mean Swine IAV lung titers from animals killed at 1 or 3 days after Swine IAV challenge virus application showed that the negative control showed no Swine IAV in lung samples, whereas the challenge control showed virus titers per g lung tissue in the range of more than 5 (day3) to more than 7 logs (day 1). In stark contrast, the group mean values were strongly reduced to about two logs or less for the group vaccinated once with the RacH-SE-70-p455-H3 vaccine and reduced to undetectable levels for the group vaccinated twice with the RacH-SE-70-p455-H3 vaccine (FIGS. 9A. and 9B.).

    [0316] When testing the induction of Swine IAV neutralizing antibodies after vaccination, sera from animals vaccinated once with the RacH-SE-70-p455-H3 vaccine showed reciprocal neutralization titers in the range of about 160 three weeks after first vaccination and sera from animals vaccinated twice with the RacH-SE-70-p455-H3 vaccine showed neutralizing titers of about 2560 three weeks after 2.sup.nd vaccination, while sera from the non-vaccinated groups had no detectable Swine IAV neutralizing antibody levels (FIG. 18).

    [0317] When determining the amounts of pro-inflammatory cytokine IL-1 in BALF from animals 1 or 3 days after Swine IAV challenge, IL-1 levels of more than 100 pg/ml up to 900 pg/ml were detectable in three of four animals tested at day 1, whereas these levels were reduced to 100-300 pg/ml IL-1 for BALFs from animals vaccinated once with the RacH-SE-70-p455-H3 vaccine and even further reduced to levels of 0 to less than 100 pg/ml IL-1 for all animals vaccinated twice with the RacH-SE-70-p455-H3 vaccine (FIG. 19). This shows that vaccination with the RacH-SE-70-p455-H3 vaccine had effectively prevented induction of the pro-inflammatory cytokine IL-1 after Swine IAV infection.

    [0318] When testing restimulation of peripheral blood mononuclear cells (PBMCs) sampled at study day 28 and using different stimuli, stimulation of PBMCs from non-vaccinated animals showed less than 75/1106 counts in INF-ELISpot irrespective of the stimuli used (FIG. 20A). PBMCs of animals that had received the inactivated vaccine twice (killed) showed about 150/1106 counts when they were restimulated with recombinant Swine IAV nucleoprotein NP and about 3000/1106 counts in INF-ELISpot when they were restimulated with Swine IAV H3N2 challenge strain R452-14, but showed no restimulation of PBMCs (levels of 75/1106 counts or lower) when recombinant Swine IAV HAs or EHV-1 viruses were used (FIG. 20B). In contrast, animals vaccinated once or twice with RacH-SE-70-p455-H3 vaccine also showed about 200 (1 EHV-1) to 300 (2 EHV-1)/110 6 counts in INF-ELISpot when they were restimulated with Swine IAV H3N2 challenge strain R452-14, but no restimulation of PBMCs (levels of 75/1106 counts or lower) when recombinant Swine IAV NP was used (FIGS. 20C and D). When EHV-1 viruses were used for restimulation, animals vaccinated once or twice with RacH-SE-70-p455-H3 vaccine showed about 300/1106 counts in INF-ELISpot when they were restimulated with empty EHV-1 vaccine RacH-SE, and this value was further increased to more than 400/1106 counts when RacH-SE-70-p455-H3 vaccine expressing a Swine IAV H3 was used, respectively (FIGS. 20C and D). Accordingly, when recombinant Swine IAV HAs were used for restimulation, only animals vaccinated once or twice with RacH-SE-70-p455-H3 vaccine showed about 100-150 (1 EHV-1) to 150-200 (2 EHV-1)/1106 counts in INF-ELISpot (FIGS. 20C and D).

    Example 7

    Generation, In Vitro Characterization and In Vivo Testing of a Tetravalent Ehv-1 Vectored Influenza A Virus Vaccine for Swine

    [0319] As described below, in the described invention the four above-described Swine IAV hemagglutinin (HA) antigens derived from H1N2, H3N2, H1N1 avian, and H1N1 pandemic Swine IAV sub-/serotypes are expressed by two recombinant EHV-1 vector viruses. This new tetravalent vaccine against swine IAV provides a DIVA feature, e.g. by detection of antibodies against Swine IAV proteins NP or NA in animals that were infected by Swine IAV field strains but not in animals only vaccinated with the vaccine described here since it only expresses the Swine IAV HA proteins.

    [0320] The new tetravalent Swine IAV vaccine was characterized in vitro and is tested in vivo for its efficacy against Swine IAV.

    [0321] The newly identified p430 promoter was used to drive expression of Swine IAV H1N1 ((A/swine/Gent/132/2005(H1N1), GenBank accession no.: AFR76623.1). Since the hemagglutinin gene in this virus isolate originated from an avian IAV it will be referred to as H1av. H1av was synthesized and subcloned in a transfer vector for the orf1/3 insertion region to generate pU1/3-p430-H1av-BGH_K_BGH. Expression of H1av was placed under control of the p430 promoter and the bovine growth hormone (BGH) polyA signal and framed with the recombination regions for insertion into orf1/3 (FIG. 11, SEQ ID NO. 25).

    [0322] By en-passant mutagenesis using the RED recombination system the expression cassette p430-H1av-BGH was inserted in orf1/3 of pRacH-SE to generate pRacH-SE1/3-p430-H1av FIG. 12). PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av, recombinant virus rEHV-1 RacH-SE1/3-p430-H1av was rescued and plaque-purified twice. Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA) and Western blot using commercially available monoclonal and polyclonal antibodies (FIG. 13). Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA and Western blot using a monoclonal antibody Ai2G7 (owned by BI), (not shown). Correct processing and transport of H1av and localization in the plasma membrane of infected cells was assayed by a hemadsorption test using chicken erythrozytes (not shown). Peak titers determined as TCID50/ml in PK/WRL cells were in the same range as titers of the parental virus RacH-SE which indicates that transgene expression had no detrimental effect on viral replication (not shown).

    [0323] Specific detection of a broad band migrating at 75 kDa by antibody PA-34929 is in concordance with the expected appearance of the recombinant HA glycoprotein as predicted from its sequence. Apparent staining of cellular membranes with the monoclonal antibody C102 is in line with the subcellular localization as expected.

    [0324] In order to test whether the expressed recombinant hemagglutinins were processed and transported as expected, VERO-cells were infected with rEHV-1 RacH-SE-1/3-p430-H1av, rEHV-1 RacH-SE-70-p455-H3, rEHV-1 RacH-SE (parent) at an m.o.i. of 0.01, or left uninfected. 24 h p.i. live infected and uninfected cells were incubated with a suspension of chicken erythrocytes in PBS, washed with PBS and stained with the fluorescent Hoechst 33342 nuclear stain. Since erythrocytes of birds contain cell nuclei they can be stained with Hoechst33342 and appear as tiny blue specks by fluorescence microscopy, compared with cells that were infected with rEHV-1 RacH-SE that does not express hemagglutinin, adsorption of chicken erythrocytes was significantly increased on cells infected with either rEHV-1 RacH-SE-1/3-p430-H1av or rEHV-1 RacH-SE-70-p455-H3 (not shown). From this it can be concluded that the hemagglutinins were translated, processed and transported to the plasma membrane of vector virus infected cells in a manner as if they were produced by authentic influenza virus replication. The phenotype of hemadsorption of infected cells supports the findings of the Western blots and immunofluorescence assays (for H1av, FIG. 13) showing efficient expression of the transgenic proteins and suggesting formation of functional HA trimers on the cell surface of EHV-1 vector infected cells.

    [0325] Specificity and lack of cross-reactivity of the polyclonal commercial antibodies to H3 (PAS-34930) and H1 (PAS-34929) was verified by Western blots of infected cells infected with single-insert viruses rEHV-1 RacH-SE-70-p455-H3 and rEHV-1 RacH-SE-1/3-p430-H1av (not shown).

    [0326] Next, a recombinant EHV-1 RacH-SE was generated expressing two different hemagglutinins of two different Influenza A virus sub-/serotypes.

    [0327] Starting with the recombinant BAC pRacH-SE-70-p455-H3, the expression cassette p430-H1av-BGH as assembled in the transfer vector pU1/3-p430-H1av-BGH_K_BGH (FIG. 12) was inserted into the orf1/3 insertion site by two-step RED recombination to generate pRacH-SE-1/3-p430-H1av-70-p455-H3. PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av-70-p455-H3, and recombinant virus rEHV-1 RacH-SE1/3-p430-H1av-70-p455-H3 was rescued and plaque-purified twice. The short designation for this recombinant virus is rEHV-1 RacH-SE_B (FIG. 14). Correct insertion of the expression cassette was verified by sequencing of high-fidelity PCR products of the insertion regions together with flanking sequences.

    [0328] Expression of the transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blot using commercially available monoclonal and polyclonal antibodies (FIG. 15). Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot using a monoclonal antibody Ai2G7 (owned by BI), (FIG. 15).

    [0329] Both transgenes H3 and H1av were expressed in parallel in cell cultures infected with the dual insert recombinant rEHV-1 RacH-SE_B. Transgene expression was stable and did not impair viral titers tested until passage 11 in PK/WRL cells.

    [0330] The enhanced EHV-1 vector with two insertion sites and two new promoters was shown to express two Influenza virus hemagglutinins in parallel. Subcellular localization as determined by IFA and mobility in SDS-PAGE as determined by Western blot corresponded to authentic hemagglutinins expressed in Influenza A virus infected cells known from the literature.

    [0331] Next, a second double-insert rEHV-1 RacH expressing hemagglutinins H1hu, SEQ ID NO:29, (A/swine/Italy/4675/2003(H1N2); GenBank accession no. ADK98476.1) and H1pdm, SEQ ID NO:26, (A/swine/Italy/116114/2010(H1N2); GenBank accession no. ADR01746.1) was generated.

    [0332] The coding sequence of H1hu was synthesized and subcloned in a transfer vector for the orf1/3 insertion region to generate pU1/3-p430-H1hu-BGHKBGH. Expression of H1hu was placed under control of the p430 promoter and the bovine growth hormone (BGH) polyA signal and framed with the recombination regions for insertion into orf1/3 (FIG. 21).

    [0333] The coding sequence of H1pdm was synthesized and subcloned generating the transfer vector pU70-p455-H1pdm-71K71, placing H1pdm under control of the new p455 promoter and the new 71pA polyadenylation signal and framing the cassette with the recombination regions for insertion into orf70 (FIG. 22).

    [0334] Subsequently, the expression cassettes p430-H1av-BGH and p455-H1pdm-71 were inserted into pRacH-SE by en-passant mutagenesis using the RED recombination system, generating pRacH-SE-1/3-p430-H1hu first. Using this modified BAC as the target, p455-H1pdm-71 was inserted by en-passant mutagenesis using the RED recombination system, generating pRacH-SE-1/3-p430-H1hu-70-p455-H 1pdm. pRacH-SE-1/3-p430-H1hu-70-p455-H 1pdm was transfected in PK/WRL cells and rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm was rescued and plaque purified three times. The short designation of the new recombinant vector virus is rEHV-1 RacH-SE_D (FIG. 23).

    [0335] Expression of the transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blot using commercially available monoclonal and polyclonal antibodies (FIG. 24). Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot using a monoclonal antibody Ai2G7 (owned by BI), (FIG. 24).

    [0336] Genetic and phenotypic stabilities of the recombinant rEHV-1 were shown by passaging in cell culture, determining viral titers every 5 passages. Sequences of the insertion regions were confirmed every ten passages as well as transgene expression by Western blot (not shown). Expression fidelity was assessed by double IFA of plaques under methocel-overlay, counting plaques stained with anti-EHV-antibodies and transgene-specific antibodies (not shown).

    [0337] To investigate its properties as a vectored vaccine in young piglets, the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D is tested in a vaccination-challenge study. In detail, piglets with maternally derived immunity against Swine IAV (positive for maternal antibodies) are vaccinated twice with rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D at a dose of 1107 TCID50 per vaccine strain intramuscularly at an age of one and four weeks (two-shot vaccination, 2 EHV-1) or at an age of four weeks only (one-shot vaccination, 1 EHV-1). A non-vaccinated group serves as negative control. At an age of 11 weeks, all animals but the negative control are challenged by an intratracheally applied dosage of 1106 TCID50 of an H3N2 Swine IAV challenge strain (European field virus isolate R452-14 whose H3 is being heterologous to the H3 vaccine antigen used in rEHV-1 RacH-SE_B). Non-vaccinated and unchallenged animals serve as negative control, while non-vaccinated but challenged animals serve as challenge control. At and after vaccinations and before and after challenge, body temperatures are measured and blood samples are taken at different time points. One day after challenge, half of the animals per group are killed and the lungs are scored for lesions typical for Swine IAV infection, three lung samples per left and right lung are taken per animal, respectively, to determine infectious Swine IAV titers in lung homogenates, and bronchioalveolar lavage fluid (BALF) is sampled. The same procedure is performed with the remaining half on animals per group three days after challenge. Sample material and collected data is analyzed to determine, among others, body temperature changes after challenge, clinical signs after Swine IAV infection, lung scores, Swine IAV lung titers, histological changes in lung tissue, Swine IAV serum neutralization titers, cytokine levels in BALF, restimulation of PBMCS as measured by INF-ELISpot, and B-cell activation.

    Example 8

    Induction of a Neutralizing Antibody Response Against Two Antigens in Mice Vaccinated with a Bivalent Rehv-1 Rach Vector Vaccine

    [0338] The rEHV-1 RacH SE B (rEHV-1 RacH-SE-1/3-p430-H1av-7-p455-H3 see FIG. 14) was used for immunization of Balb/c mice in order to demonstrate that the expressed transgenes are immunogenic in another species than swine and that neutralizing antibodies are induced against either one of the two antigens by intranasal application.

    [0339] In detail, three groups of five Balb/c mice per group, 3-5 weeks of age, were intranasally inoculated on study days 0 and 21 either with 40 l of rEHV-1 RacH SE B (rEHV-1 RacH-SE-1/3-430-H1av-7-455-H3, group 1), or 40 l of empty vector (rEHV-1 RacH-SE, group 2, vector control), or 40 l of tissue culture medium (group 3 negative control), respectively. For groups 1 and 2, infectious recombinant EHV-1 dosages were 1105 TCID50/40 l, respectively. Mice were bled on study days 0 (before 1.sup.st inoculation), 7, 14, 21 (before 2.sup.nd inoculation), 28, and 35. Serum was prepared from the blood samples and stored frozen at 80 C.

    [0340] Immunofluorescence Assay for Detection of Antibodies Against the Vector Virus

    [0341] AI-ST cells were infected at a multiplicity of infection (MOI) of 0.001 with rEHV-1 RacH-SE1212, a virus rescued from the empty vector BAC pRacH-SE1.2. 24 hours p.i. distinctive plaques were observed and cells were processed for indirect immunofluorescence assay (IFA). Sera of all three groups of the final bleeds (obtained 14 days after the second vaccination) diluted 1:50 in PBS were tested. As positive control serum from an EHV-1 vaccinated horse was used in a dilution of 1:500. Secondary antibodies were commercially available FITC-conjugated rabbit anti-mouse IgG for the mice sera and Cy5-conjugated goat-anti horse IgG for the horse serum and used at 1:200 dilution. Antibody binding was evaluated by fluorescence microscopy. All vaccinated mice had developed antibodies reactive in IFA with rEHV-1 RacH-SE-infected cells. Uninfected cells were not bound by any of the tested sera. Sera from the negative control group of mice did not show any specific binding neither to infected nor to uninfected cells. Data are summarized in the table below.

    [0342] From this it can be concluded that inoculation of the rEHV-1 into the nostrils of the mice resulted in infection and viral replication, so that the mice immune systems were stimulated to produce anti-EHV-1 antibodies.

    [0343] Virus Neutralization Tests (VNT)

    [0344] In order to show induction of protective immunity against the expressed transgenes originating either from Influenza A virus (IAV) (A/swine/Italy/7680/2001(H3N2)) or (A/swine/Gent/132/2005(H1N1)) the mice sera were tested for neutralizing activity against the respective viruses (Allwinn et al. 2010; Trombetta et al. 2014). IAV used for neutralization tests were isolates from pigs in Germany from 2014, specifically A/swine/Germany/AR452/2014 (H3N2) and A/swine/Germany/AR1181/2014 (H1N1). As these are heterologous from the strains the vaccine targets were derived from, any neutralization of these viruses by the mouse sera will be indicative of broad and efficient induction of protective immunity by the rEHV-1 vaccination. As a negative control serum, a serum from a pig which had been shown to be negative for Influenza virus antibodies was used.

    [0345] Influenza A Virus Neutralization Tests:

    [0346] MDCK cells for virus neutralization as well as back-titration in 96-well plates were incubated for two days at 37 C./5% CO.sub.2 prior to use. The respective IAV stocks H3N2 and H1avN1 were thawed on ice and diluted in MEM containing Gentamycin and the double concentration of trypsin (MEM/Genta/2 trypsin).

    [0347] Sera tested were from the final bleeds of group 1 (rEHV-1 RacH SE B), group 2 (empty vector), a positive control (serum from a pig vaccinated with inactivated multivalent IAV vaccine, and a negative control.

    [0348] Sera were heat inactivated and in two and three independent tests, respectively, serially 1:2 diluted starting at 1:16 up to 1:4096. IAV was diluted to approximately 100 TCID50/neutralization reaction. Neutralization reactions were incubated for 2 hours at 37 C., 5% CO.sub.2. Back-titration of used virus was done in quadruplicate. Growth medium was removed and MDCK-cells were washed with medium containing Gentamycin and trypsin before adding the neutralization reactions or the virus dilutions of the back-titrations. VNT and titration plates were incubated at 37 C./5% CO2 for 1 h after addition of neutralization reaction or virus dilutions to the MDCK-cells, respectively. Thereafter inocula were removed and cells were overlaid with fresh medium containing Gentamycin and trypsin. Five days p.i. CPE was monitored and documented. Actually used virus titre in the test was calculated as TCID50/ml according to Reed and Munch and dilutions at which the tested sera prevented induction of Influenza virus-typical CPE were reported, see tables below.

    [0349] In order to compare results of independent tests neutralizing capacity was calculated by multiplication of the reciprocal serum dilution and the respective titre that was neutralized by it. Averages of three tests were then divided by 100 to reflect neutralization of 100 TCID50 (Tables 3, 4, and 5). Data are summarized and shown graphically in FIG. 25.

    [0350] All mice vaccinated with rEHV-1 RacH SE B had developed neutralizing antibodies against the respective IAV, heterologous strains of subtypes H3N2 and H1avN1. Thus, twofold intranasal application of rEHV-1 RacH-SE expressing hemagglutinins of IAV from the orf70 insertion site under control of the p455 promoter (H3) and in parallel from the orf1/3 insertion site under control of the p430 promoter (H1av), successfully stimulated protective immune response in BALB/c mice.

    [0351] It can be concluded that the vector rEHV-1 RacH-SE can be used for parallel expression of two different transgenes to stimulate immune response after intranasal vaccination.

    Example 9

    Generation, In Vitro Characterization and In Vivo Testing of an Ehv-1 Vectored Schmallenberg (Sbv) Virus Vaccine For Cattle

    [0352] One of the emerging bunyaviruses is Schmallenberg virus (SBV), the first European Simbu serogroup virus (genus Orthobunyavirus), which may cause abortions, stillbirth, and severe fetal malformation when pregnant animals are infected during a critical phase of gestation and which is by now more and more used as a model virus for studying orthobunyaviruses (Bilk et al.,2012). Since Simbu viruses are transmitted by insect vectors and treatment options are not available, vaccination is a major component of disease control. Against SBV and further Simbu viruses such as Akabane virus (AKAV) or Aino virus inactivated whole-virus vaccines are available and live attenuated vaccines against SBV have been developed (Anonymous, 2013, 2015; Kraatz et al., 2015; Wernike et al., 2013b), however, none of these vaccines allows differentiation between field-infected and vaccinated animals (DIVA principle). Only recently, DIVA-compatible subunit vaccines based on 234 amino acids (aa) from the amino-terminus of SBV glycoprotein Gc, were tested in a lethal small animal challenge model and in cattle (Wernike et al., 2017). When delivered as expression plasmids or expressed in a mammalian cell culture system the Gc domain conferred protection in up to 66% of the animals, while all animals immunized with the Gc domain of SBV linked to the corresponding domain of the related AKAV were fully protected (Wernike et al., 2017). In order to investigate the application of rEHV-1 RacH-SE as a vector vaccine in cattle the 234 amino-terminal aa of SBV-Gc were inserted into the orf70(US4) insertion site and expressed under control of the new p455 promoter and 71pA poly A signal and tested in a vaccination-challenge trial in cattle.

    Generation of Recombinant EHV-1 Expressing an Antigen Derived of Schmallenberg Virus (SBV) Glycoprotein c (Gc)

    [0353] A 234 amino acid portion of the coding region of Schmallenberg virus (SBV) glycoprotein c (Gc) was codon-usage optimized for expression in EHV-1 and additionally modified to achieve efficient transport to and insertion in the plasma membranes of infected cells. To this end a signal peptide coding sequence derived from an Influenza A virus (IAV) hemagglutinin (HA) subtype H1N2 (A/swine/Italy/116114/2010 (H1N2), GenBank accession no. ADR01746.1) as well as the transmembrane anchor (TM) and a cytoplasmic C-terminus from that HA were attached to the 5 and 3 ends, respectively. In addition, a GS linker HMGGSGGGGSGGGGSGGGT (SEQ ID NO:30) was inserted between the Gc portion and the HA-TM-domain. The DNA (SEQ ID NO:31) was synthesized and subcloned into the NotI/KpnI sites of pU70-455-71K71, a transfer vector for insertion of transgene expression cassettes into orf70 (US4) of EHV-1 by RED-mediated recombination of the BAC pRacH-SE. The resulting plasmid pU70-455-SBVG_71K71 (FIG. 26) was cut with XbaI to release a 3056 bp DNA fragment (SEQ ID NO:32), which was transformed into E. coli K12 GS1783 carrying pRacH-SE.

    [0354] SEQ ID NO:31: Synthesized DNA sequence including restriction sites for subcloning

    TABLE-US-00003 GCGGCCGCATGAAGGCGATCCTGGTTGTGCTGCTGTACACCTTTGCCACC GCCAACGCCGATACGCTGATCAACTGCAAGAACATCCAGAGCACCCAGCT GACAATCGAGCACCTGAGCAAGTGCATGGCCTTCTACCAGAACAAGACCA GCAGCCCCGTCGTGATCAACGAGATCATCTCCGACGCCAGCGTGGACGAA CAGGAACTGATTAAGTCTCTGAACCTGAACTGCAACGTGATCGACCGGTT CATCAGCGAGTCCAGCGTGATCGAGACACAGGTGTACTACGAGTATATCA AGAGCCAGCTGTGTCCACTGCAAGTGCACGATATCTTCACCATCAACAGC GCCAGCAACATCCAGTGGAAGGCCCTGGCCCGCAGCTTTACCCTGGGCGT GTGCAACACCAACCCCCACAAGCACATCTGCCGGTGCCTGGAATCCATGC AGATGTGTACCAGCACCAAGACCGACCACGCCAGAGAGATGAGCATCTAC TACGACGGCCACCCCGACAGATTCGAGCACGACATGAAGATTATCCTGAA TATCATGCGGTACATCGTGCCCGGCCTGGGCAGAGTGCTGCTGGACCAGA TCAAGCAGACCAAGGACTACCAGGCCCTGAGACACATCCAGGGCAAGCTG AGCCCCAAGTCCCAGAGCAACCTGCAGCTGAAGGGCTTCCTGGAATTCGT GGACTTCATCCTGGGCGCCAACGTGACCATTGAGAAAACCCCCCAGACCC TGACCACCCTGAGCCTGATTCATATGGGAGGTTCCGGAGGTGGAGGTTCC GGAGGTGGAGGTTCCGGAGGTGGCACCATACTGGCCATTTACAGCACAGT TGCGAGCAGCCTGGTCCTGATCGTGAGCCTGGGTGCTATATCATTCTGGA TGTGCAGCAACGGCTCTCTCCAGTGCCGCATCTGTATCTGAGGTACC

    [0355] SEQ ID NO:32: DNA fragment used for RED recombination to generate pRacH-SE-70-455-SBVGc

    TABLE-US-00004 Restrictionenzymecleavagepositionsindicatedby asterisks(*) T*CTAGACTCGAGCGCAAGCCCTACACGCGCTACCCCTGCTTTCAACGCG TCAACCTGCACATTGACGGGGAGTTTCTGGTTCACAAGATGCTAGCGTTC AATGCCGCGATGCGCCCATCGGCCGAGGAGCTGCTGTCATACCCAATGTT TGCTCAACTTTAGGATGACTAACCTGTTTCTGGGAGGAGACAGCGTGGGC GACGGTGTATAAAGTTGGTCTGCTTTCAAGCCCTGCCACTGCGCTACAGT GCCACCAACTGTAAAGCGGTAGTAAGCTGCAGTGGTCGACTGGTGGTAGC ATATACTACCTTATTTATACGCTCCGAGCTGTTTTTCAGCATGCTAGCAC CCAACGCCGAGCGAGAGTATATAACTCCCATCATTGCCCACAAGCTTATG CCACTTATTAGCGTCCGCTCTGCCGTTTGCTTAGTCATAATATCTACCGC CGTTTACGCAGCAGACGCTATCTGCGACACAATTGGATTTGCGATACCGC GCATGTGGATGTGTATTTTAATGAGATCAACCTCCATGAAGCGTAACTAG GGGGCCTCCCACTGAGGCACTACCGGCTTAGCAGCTGACTAACACAGTAT AAAACGTGAGAAGAAATCAGTCTCATGCGCCATTAGCGCTAGGCTAGTTA GCGTGGAGGACCGGAGCGCTACCGCCAGCAGTTTCATCCGCCTGGTTACG GGTTTGTTAACACCTACCGGTGTTTTACCGCTACCATAGGATCCGATCCA TGGGCGGCCGCATGAAGGCGATCCTGGTTGTGCTGCTGTACACCTTTGCC ACCGCCAACGCCGATACGCTGATCAACTGCAAGAACATCCAGAGCACCCA GCTGACAATCGAGCACCTGAGCAAGTGCATGGCCTTCTACCAGAACAAGA CCAGCAGCCCCGTCGTGATCAACGAGATCATCTCCGACGCCAGCGTGGAC GAACAGGAACTGATTAAGTCTCTGAACCTGAACTGCAACGTGATCGACCG GTTCATCAGCGAGTCCAGCGTGATCGAGACACAGGTGTACTACGAGTATA TCAAGAGCCAGCTGTGTCCACTGCAAGTGCACGATATCTTCACCATCAAC AGCGCCAGCAACATCCAGTGGAAGGCCCTGGCCCGCAGCTTTACCCTGGG CGTGTGCAACACCAACCCCCACAAGCACATCTGCCGGTGCCTGGAATCCA TGCAGATGTGTACCAGCACCAAGACCGACCACGCCAGAGAGATGAGCATC TACTACGACGGCCACCCCGACAGATTCGAGCACGACATGAAGATTATCCT GAATATCATGCGGTACATCGTGCCCGGCCTGGGCAGAGTGCTGCTGGACC AGATCAAGCAGACCAAGGACTACCAGGCCCTGAGACACATCCAGGGCAAG CTGAGCCCCAAGTCCCAGAGCAACCTGCAGCTGAAGGGCTTCCTGGAATT CGTGGACTTCATCCTGGGCGCCAACGTGACCATTGAGAAAACCCCCCAGA CCCTGACCACCCTGAGCCTGATTCATATGGGAGGTTCCGGAGGTGGAGGT TCCGGAGGTGGAGGTTCCGGAGGTGGCACCATACTGGCCATTTACAGCAC AGTTGCGAGCAGCCTGGTCCTGATCGTGAGCCTGGGTGCTATATCATTCT GGATGTGCAGCAACGGCTCTCTCCAGTGCCGCATCTGTATCTGAGGTACC AATAAACGCGGTATGTCTACCTTCAAGCCTATGATGAACGGATGTTTGGT GTTTGCGGCTATTATAACGCTCTTGAGTTTTATGCTATCTCTGGGAACAT GCGAAAATTACAGGCGTGTGGTTCGGGATCCTAGGGATAACAGGGTAATC GATTTATTCAACAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATT GCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACAT AAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTT GCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTAT AAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATT GTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTA GCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACG GAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGA TGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTAT TAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTG TTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAG CGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTT TGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAA CAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGT CGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGA AATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATAC CAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATT ACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATA AATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAAATAAACGCGGT ATGTCTACCTTCAAGCCTATGATGAACGGATGTTTGGTGTTTGCGGCTAT TATAACGCTCTTGAGTTTTATGCTATCTCTGGGAACATGCGAAAATTACA GGCGTGTGGTTCGGGATCCGACCCTGTTGGTGGGTGCGGTTGGACTCAGA ATCTTGGCGCAGGCATGGAAGTTTGTCGGTGACGAAACATACGACACCAT CCGCGCAGAAGCAAAGAATTTAGAGACCCACGTACCCTCAAGTGCTGCAG AGTCGT*CTAGA

    [0356] Recombinant pRacH-SE-70-455-SBVGc DNA was prepared and correct insertion of the expression cassette and sequence identity was confirmed by high fidelity PCR using HERCULASE and Sanger sequencing of the PCR products. Used primers see table 6, SEQ ID NO: 33 to SEQ ID NO:37.

    TABLE-US-00005 TABLE6 PrimersusedforPCRandsequencing # name sequence use SEQID up70_F 5-CGTGCGCGGATACATCG-3 PCR& NO:33 sequencing SEQID up71_R 5-CGCTTCGCAGGTGGGC-3 PCR& NO:34 sequencing SEQID seq455- 5-GACTGGTGGTAGCATATAC-3 sequencing NO:35 F1 SEQID SBVGc 5-GATCAACGAGATCATCTCC-3 sequencing NO:36 F1 SEQID SBVGc 5-CTGGAGAGAGCCGTTGC-3 sequencing NO:37 R1

    [0357] Rescue and Characterization of Recombinant EHV-1 RacH-SE-70-455-SBVGc

    [0358] BAC DNA was prepared from four different clones of pRacH-SE-70-455-SBVGc. AI-ST cells (Boehringer-Ingelheim proprietary swine testicular cell line) were seeded in 6-well plates (Corning IncorporatedLife Sciences, One Becton Circle, Durham, N.C. 27712, USA; REF 353046) at a density of 10.sup.5 cells/well in MEM (Sigma-Aldrich Chemie GmbH, Munich, Germany, SAFC62892-1000M3056) containing 10% FBS (Sigma-Aldrich Chemie GmbH, Munich, Germany, SAFC, Cat 12003C-1000 ml). When the cells were 60-70% confluent, usually the next day, they were transfected with 2 l of BAC DNA using the MIRUS mRNA transfection kit (Mirus Bio LLC, 545 Science Drive, Madison, Wis. 53711 USA) according to the instructions by the supplier. Briefly, 200 l OPTIMEM (Thermo Fisher Scientific) medium were added to 5 ml polystyrene tubes. DNA was added and mixed. Next 3 l of Boost reagent were added and mixed by swirling followed by addition of the same volume of Transfection reagent and again mixing by swirling. Mixtures were incubated for 3 minutes at room temperature and then added drop-wise directly into the cell cultures. Cells were incubated at 37 C./5% CO.sub.2 for five days. Cells were rinsed into the medium and collected for storage at 80 C. Serial 1:10 dilutions of the rescued viruses were prepared in MEM and plated on confluent AI-ST cell monolayers in 6-well plates. After adsorption for 1 h at 37 C./5% CO.sub.2, inocula were removed and cells were overlaid with semi-solid medium containing 0.5% Methocel (Methyl cellulose Ph. Eur., Fluka 64632-500G) and 5% FBS (MEM-Methocel). After incubation at 37 C./5% CO.sub.2 for two to three days (passage 1), individual plaques located as distant from neighbouring plaques as possible were aspirated in a volume of 10 l and inoculated in new AI-ST cell cultures in 6-well plates. Infected cells were incubated for two to three days until massive CPE was observed (passage 2). Cells were rinsed into the medium and collected for storage at 80 C. This procedure of plaque purification was repeated twice. AI-ST cells infected with the three times plaque purified viruses were processed for indirect immunofluorescence assay (IFA) or Western blot, respectively.

    [0359] Viral DNA prepared from infected cells was used as template for high fidelity PCR using HERCULASE. Obtained PCR-products were analyzed by Sanger sequencing and identity of the insertion region with the theoretical sequence and the sequence of the corresponding PCR-product of the BAC were confirmed.

    Indirect Immuno-Fluorescence Assay

    [0360] AI-ST cells in 24-well plates (Corning IncorporatedLife Sciences, One Becton Circle, Durham, N.C. 27712, USA; REF 353047) were infected with three times plaque purified virus serially diluted in MEM. Growth medium was aspirated off the cells and cells were overlaid with 250 L of diluted virus (dilutions 10.sup.2 to 10.sup.7). Cells were incubated for 1 h at 37 C./5% CO.sub.2 for adsorption of virus, then the inocula were removed and cells were overlaid with 1000 L MEM-Methocel/well and incubated at 37 C./5% CO.sub.2 for two days. When plaque formation was observed microscopically, cells were processed for IFA. Medium was aspirated and cells were washed once with 1 ml PBS (Gibco Life Technologies, Paisley PA49RF, UK, DPBS (1) REF 14190-136)/well. PBS was removed and cells were fixed by addition of 1 ml/well of 20 C. cold ethanol (Carl Roth GmbH, Schoemperlenstr. 3-5, D-76185 Karlsruhe, Art. Nr. 5054.1) and incubation for 30 min at RT. Ethanol was aspirated and cells were air-dried. After rehydration of the cells with 1 ml/well of PBS for 10 min at RT, primary antibodies diluted in PBS were added (150 l/well) and incubated for 1 h at RT. Primary antibodies were removed and cells were washed three times for 2 min with 1 ml PBS/well before adding secondary antibody dilutions (150 l/well). After 1 h incubation at RT protected from light, secondary antibody dilutions were removed and cells were washed three times for 2 min with 1 ml PBS/well and finally overlaid with 500 l PBS/well for inspection by fluorescence microscopy. Used antibodies are listed in table 7.

    TABLE-US-00006 TABLE 7 Antibody diluted Horse anti-EHV-1 hyper-immune serum (Boehringer Ingelheim 1:400 Veterinary Research Centre proprietary) Anti SBV-Gc monoclonal antibody (Wernike et al., 2015a) 1:50 FITC-conjugated Goat anti-mouse IgG Jackson 1:200 Immuno Research cat. no. 115-095-003 Cy 5-conjugated Goat anti-horse IgG Jackson Immuno 1:200 Research cat. no. 108-175-003

    Western Blot

    [0361] 1. Infection: Three wells each of confluent monolayers of AI-ST cells in 6-well plates were infected at an M.O.I. of approximately 1 with two different plaque isolates of rEHV-1 RacH-SE-455-SBVGc (#121.131 P6 and #121.232 P6) and a plaque isolate of rEHV-1 RacH-SE1212 P9 (rescued from the parental empty BAC pRacH-SE1.2) by directly adding 50 l and 10 l respectively, of thawed virus stocks to the growth medium. Three wells were left uninfected. Infected and uninfected cells were incubated for two days and then processed for Western blot.

    [0362] 2. Preparation of lysates: RIPA buffer supplemented with protease inhibitor cocktail (RIPA+PI) was prepared as follows: 0.7 ml 10 RIPA lysis buffer Millipore Cat #20-188 were added to 6.3 ml H.sub.2O, Fisher Scientific Cat # BP2470-1, and 1 tablet COMPLETE Mini Protease inhibitor cocktail (Roche cat #11 836 153 001) was dissolved in 7 ml 1 RIPA buffer. Uninfected controls were scraped into the medium and suspensions from the three replicate wells were pooled in 15 ml centrifuge tubes and placed on ice. Infected cells were rinsed off in the medium and the suspensions from the three replicate wells were pooled in 15 ml centrifuge tubes and placed on ice. Cells were sedimented by centrifugation at 1000g 4 C. for 5 min. Supernatants were carefully aspirated and the cell pellets were resuspended in RIPA+PI (Uninfected cells in 300 l infected cells in 150 l). Suspensions were incubated on ice for 30 min and vortexed every 10 min. Suspensions were transferred to 1.5 ml microfuge tubes and undissolved material was sedimented by centrifugation at 15000 rpm, 4 C., for 10 min in a microcentrifuge. Clear supernatants were transferred to new 1.5 ml microfuge tubes and stored at 80 C. until use.

    [0363] 3. SDS-PAGE and transfer on nylon membranes: Materials: BioRad Criterion TGX Stain Free Precast Gels, 4-20%, 26 well Cat #567-8095; Bio Rad Precision Plus Dual Colour Marker, Cat #161-0374; Bio Rad Precision Plus All Blue Marker, Cat # 161-0373; Bio Rad Trans Blot Turbo transfer kit, Midi format Cat # 170-4159; Bio Rad 4 Laemmli Sample Buffer (Cat no. 161-0747) (Bio Rad Laboratories GmbH, Heidemannstrasse 164, D-80939 Mnchen); TGS Running buffer (Sambrook et al.), Blocking Solution 1: 5% FBS in PBST (Sambrook et al.); PBST.

    [0364] Samples were prepared without addition of a reducing agent. Samples were thawed on ice and mixed with 1 volume of 4 Lmmli buffer, boiled for 6 min at 96 C., and kept at RT until loading of the gel. Gel was run for 30 min at 230 mA and then assembled for electrotransfer using the BioRad Trans Blot Turbo system. Transfer was set to 2,5 A 25 V 10 min. Membrane was rinsed in sterile distilled H.sub.2O and incubated with 25 mL Blocking Solution 5% FBS in PBST for 30 min at 4 C.

    Antibody Incubation and Detection

    [0365] Materials: Immun-Star WesternC Chemiluminescent Kit (Bio Rad Laboratories GmbH, Heidemannstrasse 164, D-80939 Mnchen) Cat #170-5070

    [0366] Primary antibodies: [0367] A: SBV-Gc-protein specific monoclonal antibody (Wernike et al., 2015a) 1:20 [0368] B: Mouse monoclonal antibody Ai2G7 to EHV-1 gpII (Boehringer Ingelheim proprietary)

    [0369] Secondary Antibody: Peroxidase conjugated Goat anti-mouse, (Jackson Immune Research #115-035-146) 1:5000

    [0370] All incubations were done in sufficient volume under constant agitation. Antibodies were diluted in 5% FBS/TBST. Primary antibodies were incubated over night at 4 C. Antibody solution was removed and blots were washed three times with TBST for 5-10 min. Diluted secondary antibody was incubated with the blots for 1 h at RT, removed and blots were washed three times with TBST for 5-10 min. Blots were placed on a clear plastic sheet protector. Peroxide and Lumino/Enhancer solutions were mixed 1 ml+1 ml (2 ml total for each blot), pipetted on the blots and incubated for 3 to 5 min. Thereafter the membranes were placed in the ChemiDocXRS imaging system (Bio Rad Laboratories GmbH, Heidemannstrasse 164, D-80939 Mnchen) and signals were recorded using Image Lab software.

    Virus Titrations

    [0371] AI-ST cells were seeded in 96-well plates (Corning IncorporatedLife Sciences, One Becton Circle, Durham, N.C. 27712, USA; REF 353072) at 210.sup.4 cells/well in MEM supplemented with 10% FBS one day before infection. Virus stocks were quickly thawed and placed on ice. Ten serial 1:10 dilutions were prepared in MEM in 1.2 ml volume per dilution. 100 l/well of the virus dilutions were added to the cells, 8 wells in one vertical row per dilution. Vertical rows 11 and 12 of each plate served as medium control by addition of 100 l/well MEM. Titrations were done in triplicate and cells were incubated for 5 days at 37 C./5% CO.sub.2. Cell cultures were inspected microscopically and wells where EHV-1 RacH typical CPE was observed were recorded. Titers were calculated as TCID50/ml according to the method by Reed and Muench (1938).

    Characterization of Recombinant EHV-1 Used for Vaccination

    [0372] Expression of the modified SBV Gc234 in infected cells was shown by Western blot and double immunofluorescence assay (DIFA) for plaque isolate of rEHV-1 RacH-SE-70-455-SBVGc 121.232. DIFA with a polyclonal horse-anti-EHV-antiserum and the monoclonal anti-SBV antibody confirmed expression of the transgene in apparently 100% of the rEHV-1 infected cells. When DIFA of cells infected with rEHV-1 RacH-SE-70-455-SBVGc 121.232 was performed, EHV-1 antigen-positive cells that were stained with a horse anti-EHV antiserum (purple) also bound a monoclonal antibody to SBV Gc. Western blots run under non-reducing conditions confirmed expression of the modified SBVGc234 in cells infected with recombinant EHV-1 RacH-SE-70-455-SBVGc. Western blots of lysates of infected or uninfected cells probed with a monoclonal antibody to SBV Gc or a monoclonal antibody to EHV-1 gpII were performed. While EHV-1 gpII was expressed in all infected cells, SBV Gc was only expressed in the cells infected with rEHV-1RacH-SE-70-455-SBVGc, not in those infected with the empty vector rEHV-1 RacH-SE1212. Neither viral protein was detected in lysates of mock-infected cells. Incubation of parallel blots with a monoclonal antibody against gpII of EHV-1 confirmed restoration of orf71 (US5) by the self-excision procedure during rescue of recombinant virus after transfection. A P7 virus stock raised from three times plaque purified isolate rEHV-1 RacH-SE-70-455-SBVGc_121.232 replicated to a very high titre of 1.8510.sup.9 TCID50/ml in AI-ST cells, indicating that expression of the transgene did not impair EHV-replication in this cell line. An average of six titrations of rEHV-1RacH-SE-70-455-SBVGc_121.232 as TCID50/ml resulted in 1.8510.sup.9 TCID50/ml with a standard deviation of 1.28 10.sup.9 TCID50/ml.

    Animals and Experimental Design

    [0373] A number of 4 cattle of German domestic breeds were vaccinated twice three weeks apart with 10.sup.8 TCID.sub.50 rEHV-SBV-Gc; 4 additional cattle were kept as unvaccinated controls. Three weeks after the second immunization all animals were inoculated subcutaneously with 20.5 ml of an SBV field strain which was passaged solely in cattle (Wernike et al., 2012). During the entire study, rectal body temperatures were measured daily and the animals were examined for clinical signs by veterinarians. Sera were taken at weekly intervals and analyzed by a commercially available N-based ELISA (ID SCREEN Schmallenberg virus Competition, ID vet, France) and by a microneutralization test against SBV isolate BH80/11 as described previously (Wernike et al., 2013a). Evaluation was done by assessment of the cytopathic effect after 3 days; all samples were tested in quadruplicate and the antibody titers were calculated as ND.sub.50 according to Behrens and Kaerber. Sera taken at the days of immunization, challenge infection, and at the end of the study, respectively, were additionally analyzed by microneutralization tests against EHV strain RacH (group rEHV-SBV-Gc and unvaccinated control animals).

    [0374] During the first 10 days after challenge infection blood samples were additionally collected on a daily basis. From these samples, viral RNA was extracted using the King Fisher 96 Flex (Thermo Scientific, Braunschweig, Germany) in combination with the MagAttract Virus Mini M48 Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions and tested by an S-segment-based real-time RT-PCR (Bilk et al., 2012).

    [0375] The experimental protocol has been reviewed by the responsible state ethics commission and was approved by the competent authority (State Office for Agriculture, Food Safety and Fisheries of Mecklenburg-Vorpommern, Rostock, Germany, ref. LALLF M-VTSD/7221.3-1.1-004/12).

    Clinical Observation and Viral RNA Detection

    [0376] None of the animals showed any relevant SBV-specific clinical signs during the entire study and the body temperatures remained within a normal range for all animals, when measured rectally.

    [0377] Starting from day one or two post challenge infection, viral RNA was detectable in serum samples of each unvaccinated control animal for four consecutive days. All vaccinated animals from the rEHV-SBV-Gc group showed reduced viral RNA concentrations by quantitative RT-PCR (FIG. 27A) throughout the entire sampling period. Two animals of the rEHV-SBV-Gc group tested completely negative by quantitative RT-PCR (FIG. 27A) throughout the entire sampling period. In two animals immunized with rEHV-SBV-Gc the SBV genome was detected at reduced levels for three or five days, respectively.

    Antibody Response

    [0378] In the unvaccinated control animals no SBV-specific antibodies were detected by serum neutralization test before challenge infection. From one or two weeks after infection onwards high titers of neutralizing antibodies were detected in all unvaccinated animals (FIG. 27B).

    [0379] In contrast to the unvaccinated control group, SBV-specific neutralizing antibodies were detectable at the day of challenge infection in two out of four cattle immunized with rEHV-SBV-Gc. In the remaining two animals of this group, no SBV-specific neutralizing antibodies were detected before challenge infection, but from two weeks after infection, neutralizing antibodies were present (FIG. 27B). Titers of SBV-specific neutralizing antibodies in all four vaccinated animals were lower than in the challenge control, indicating less efficient viral replication of the challenge virus, and thus supporting the quantitative RT-PCR data.

    EHV Neutralization Test

    [0380] Two-fold dilutions of sera were prepared in MEM, starting at 1:5. Fifty l of MEM containing 100 TCID50 of SBV and 50 l of the diluted sera were incubated in 96-well cell culture plates for 2 hours. Thereafter, 100 l freshly prepared suspension of BHK-cells (in MEM containing 10% foetal calf serum) were added and cultures plates were incubated for 3-4 days at 37 C./5% CO.sub.2. Cytopathic effect was evaluated by light microscopy. All sera were tested in duplicates, and the antibody titre was calculated as ND50 according to Kaerber (1931) as modified by Behrens (personal communication). The results as shown in FIG. 28 indicate that vaccination of cattle with rEHV-1 RacH-SE-70-455-SBVGc resulted in replication of the vector virus efficient enough to induce a specific immune response. In one out of four animal EHV-1 a very low titre of neutralizing antibodies (1:4) was detectable three weeks after primary vaccination. After two vaccinations, three weeks after the second application, all four cattle had produced neutralizing antibodies at a titre of 1:128. From this result it can be concluded that EHV-1 RacH might also be functional as a vaccine vector in cattle.

    Example 10

    Efficacy of Tetravalent Swine IAV Vaccine Consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D Against Swine IAV H3N2 Challenge in Piglets

    [0381] To investigate its properties as a vectored vaccine in young piglets, the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B (rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3 see FIG. 14) and rEHV-1 RacH-SE_D (rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm see FIG. 23) was tested in a second vaccination-challenge study.

    [0382] In this second study, piglets from unvaccinated sows and tested serologically negative for swine IAV-specific antibodies by use of an H3-specific ELISA (FIG. 32) and by virus neutralization test (data not shown) at the time of first vaccination were vaccinated twice with the tetravalent vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D. Animals were vaccinated the first time in their first week of life (study day 0, SD0) and the second time in their fourth week of life (study day 21, SD21), respectively, either intramuscularly and then intramuscularly (2 IM), or first intranasally and then intramuscularly (IN+IM), or twice intranasally (2 IN), at a dose of 1107 TCID50 in a 2 ml dose per vaccine strain, animal, and vaccination, respectively. A non-vaccinated group served as negative control and another non-vaccinated group served as challenge controleventh week of life (study days 69 or 70, SD42/43), all animals but the negative control were challenged by an intratracheally applied dosage of 2107 TCID50 of an H3N2 Swine IAV challenge strain (European field virus isolate R452-14 whose H3 is being heterologous to the H3 vaccine antigen used in rEHV-1 RacH-SE_B). Non-vaccinated and unchallenged animals served as negative control (neg. ctrl.), while non-vaccinated but challenged animals served as challenge control (chall. ctrl.). At and after vaccinations and before challenge, blood samples were taken at different time points.

    [0383] One day after challenge, half of the animals per group were killed and three lung samples per left and per right lung were taken per animal, respectively. Then, infectious swine IAV titers per gram lung homogenate were determined for each animal as an average of the left and right lungs per animal that each were obtained from homogenates of the pooled three samples per left or right lung and that were normalized to the total weight of the three samples of the left or the right lung, respectively. The same procedure was performed with the remaining half of animals per group three days after challenge. For all vaccinated groups, the medians of titers of infectious swine IAV obtained from individual animals in the group were statistically significantly reduced for samples taken at day one after challenge (CH+1) when compared to the challenge control group, while all animals from the negative control group showed no infectious swine IAV virus titers in their lung homogenates (FIG. 29). Moreover, for all vaccinated groups, the medians of titers of infectious swine IAV obtained from individual animals in the group were statistically significantly reduced for samples taken at day 3 after challenge (CH+3) when compared to the challenge control group, while all animals from the negative control group showed no infectious swine IAV virus titers in their lung homogenates (FIG. 30). Thus, vaccination with the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D statistically significantly reduced the swine IAV lung loads at one and three days after challenge with a heterologous swine IAV H3N2 strain in piglets, respectively. Consequently, the vaccine described here is efficacious against swine IAV in pigs.

    [0384] Moreover, serum taken from study animals at study day 0 (SD0, before first vaccination), at study day 21 (SD21, before second vaccination), and at study days 42 or 43 (SD42/43, before application of challenge material) was analyzed by an enzyme-linked immunosorbent assay (ELISA) specific for swine immunoglobulin G (IgG) directed against a recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B. While mean OD values of sera from the negative control group gave only very low values for all time points measured, sera from vaccinated groups demonstrated a strong increase of OD values after two intramuscular applications (2 IM; SD21 and SD42/43), after first intranasal and then intramuscular application (IN+IM; SD42/43), and after two intranasal applications (2 IN; SD42/43); FIG. 32. Thus, vaccination with the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D elicited a serological immune response in piglets against the swine IAV hemagglutinin H3 expressed by vaccine strain rEHV-1 RacH-SE_B, respectively.

    [0385] In addition, peripheral blood mononuclear cells (PBMCs) were purified from blood taken from study animals at study day 28 (SD28). The PBMCs then were restimulated either with H3N2 swine IAV challenge strain R452-14 at a multiplicity on infection of 1 (H3N2 MOI 1) or with recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B at a concentration of 1 g/ml (rH3 1 g/ml). Using the restimulated PBMCs, an interferon gamma-specific enzyme-linked immunosorbent spot assay (INF ELISpot) was performed, and the obtained values normalized to 106 cells and calculated as means per group, respectively (FIG. 34). While restimulated PBMCs from the challenge control group (served as negative control for this test, animals were not vaccinated) showed mean spots per group of below 45 after either of the restimulations, restimulated PBMCs from vaccinated animals showed mean spots per group of above 85 after two intramuscular applications, of more than 100 spots after first intranasal and then intramuscular application (IN+IM), and of more than 150 spots after two intranasal applications (2 IN), after either of the restimulations, respectively (FIG. 34). Thus, vaccination with the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D elicited a cellular immune response in piglets both against the swine IAV hemagglutinin H3 expressed by vaccine strain rEHV-1 RacH-SE_B and against the swine IAV H3N2 R452-14 used for heterologous challenge virus infection, respectively.

    [0386] Thus, vaccination of piglets with tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a detectable serological and cellular immune response in piglets and demonstrated vaccine efficacy by statistically significantly reducing swine IAV loads in lung homogenates one and three days after heterologous swine IAV challenge.

    Example 11

    Efficacy of Tetravalent Swine IAV Vaccine Consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D Against Swine IAV H3N2 Challenge in Piglets with Maternally Derived Antibodies

    [0387] To investigate its properties as a vectored vaccine in young piglets, the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D was tested in a third vaccination-challenge study.

    [0388] In this third study, piglets born by and colostrum- and milk-fed by sows that were vaccinated twice during pregnancy with a commercially available inactivated vaccine against swine IAV were used. Piglets were tested serologically positive for swine IAV-specific antibodies by use of a H3-specific ELISA (FIG. 33) and by use of a commercially available swine IAV-specific antibody ELISA (IDEXX Influenza A (Virus Antibody Test); IDEXX, Westbrook, Me. 04092, USA) following the manufacturer's testing recommendations (data not shown) at the time of first vaccination were vaccinated twice with the tetravalent vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE D. Animals were vaccinated the first time in their first week of life (study day 0, SD0) and the second time in their fourth week of life (study day 21, SD21), respectively, either intramuscularly and then intramuscularly (2 IM), or first intranasally and then intramuscularly (IN+IM), or twice intranasally (2 IN), at a dose of 1107 TCID50 in a 2 ml dose per vaccine strain, animal, and vaccination, respectively. A non-vaccinated group served as negative control and another non-vaccinated group served as challenge control. In their eleventh week of life (study days 69 or 70, SD69/70), all animals but the negative control were challenged by an intratracheally applied dosage of 2107 TCID50 of an H3N2 Swine IAV challenge strain (European field virus isolate R452-14 whose H3 is being heterologous to the H3 vaccine antigen used in rEHV-1 RacH-SE_B). Non-vaccinated and unchallenged animals served as negative control (neg. ctrl.), while non-vaccinated but challenged animals served as challenge control (chall. ctrl.). At and after vaccinations and before challenge, blood samples were taken at different time points.

    [0389] Five days after challenge animals were killed and three lung samples per left and per right lung were taken per animal, respectively. Then, infectious swine IAV titers per gram lung homogenate were determined for each animal as an average of the left and right lungs per animal that each were obtained from homogenates of the pooled three samples per left or right lung and that were normalized to the total weight of the three samples of the left or the right lung, respectively. For all vaccinated groups, the medians of titers of infectious swine IAV obtained from individual animals in the group were statistically significantly reduced for samples taken at day five after challenge (CH+5) when compared to the challenge control group, while all animals from the negative control group showed no infectious swine IAV virus titers in their lung homogenates (FIG. 31). Thus, vaccination with the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D statistically significantly reduced the swine IAV lung loads at five days after challenge with a heterologous swine IAV H3N2 strain in piglets, respectively. Consequently, the vaccine described here is efficacious against swine IAV in pigs.

    [0390] Moreover, serum taken from study animals at study day 0 (SD0, before first vaccination), at study day 21 (SD21, before second vaccination), and at study day 35 (SD35, two weeks after second vaccination) was analyzed by an enzyme-linked immunosorbent assay (ELISA) specific for swine immunoglobulin G (IgG) directed against a recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B. While mean OD values of sera from the negative control group gave only very low values for SD21 and SD35, sera from vaccinated groups demonstrated a strong increase of OD values after two intramuscular applications (2 IM; SD35), after first intranasal and then intramuscular application (IN+IM; SD35), and after two intranasal applications (2 IN; SD35); FIG. 33. Thus, vaccination with the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D elicited a serological immune response in piglets against the swine IAV hemagglutinin H3 expressed by vaccine strain rEHV-1 RacH-SE_B, respectively.

    [0391] In addition, peripheral blood mononuclear cells (PBMCs) were purified from blood taken from study animals at study day 28 (SD28). The PBMCs then were restimulated either with H3N2 swine IAV challenge strain R452-14 at a multiplicity on infection of 1 (H3N2 MOI 1) or with recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B at a concentration of 1 g/ml (rH3 1 g/ml). Using the restimulated PBMCs, an interferon gamma-specific enzyme-linked immunosorbent spot assay (INF ELISpot) was performed, and the obtained values normalized to 106 cells and calculated as means per group, respectively (FIG. 35). While restimulated PBMCs from the challenge control group (served as negative control for this test, animals were not vaccinated) showed mean spots per group of below 15 after either of the restimulations, restimulated PBMCs from vaccinated animals showed mean spots per group of above 30 after two intramuscular applications, of more than 55 spots after first intranasal and then intramuscular application (IN+IM), and of more than 65 spots after two intranasal applications (2 IN), after either of the restimulations, respectively (FIG. 35). Thus, vaccination with the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D elicited a cellular immune response in piglets both against the swine IAV hemagglutinin H3 expressed by vaccine strain rEHV-1 RacH-SE_B and against the swine IAV H3N2 R452-14 used for heterologous challenge virus infection, respectively.

    [0392] Thus, vaccination of piglets with tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a detectable serological and cellular immune response in piglets and demonstrated vaccine efficacy by statistically significantly reducing swine IAV loads in lung homogenates five days after heterologous swine IAV challenge.

    [0393] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the following claims.

    REFERENCES

    [0394] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0395] 1. Allwinn R, Geiler J, Berger A, Cinatl J, Doerr H W. 2010. Determination of serum antibodies against swine-origin influenza A virus H1N1/09 by immunofluorescence, haemagglutination inhibition, and by neutralization tests: how is the prevalence rate of protecting antibodies in humans? Med Microbiol Immunol. 199(2):117-21. doi: 10.1007/s00430-010-0143-4. Epub 2010 Feb. 17. [0396] 2. Anonymous (2013). VMD authorizes SBV vaccine for use in the UK. The Veterinary record 172, 543 [0397] 3. Anonymous (2015). Schmallenberg virus vaccine. The Veterinary record 177, 321 [0398] 4. Bilk S, Schulze C, Fischer M, Beer M, Hlinak A, Hoffmann B (2012). Organ distribution of Schmallenberg virus RNA in malformed newborns. Veterinary microbiology 159, 236-238 [0399] 5. Boshart M, Weber F, Jahn G, Dorsch-Hsler K, Fleckenstein B, Schaffner W. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41(2):521-30. [0400] 6. Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A., and Alcami, A. 2003. Glycoprotein G isoforms from some alphaherpesviruses function as broad-spectrum chemokine binding proteins. The EMBO Journal Vol. 22 (4): 833-846. [0401] 7. Bustin, S. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology 25(2): 169-193. [0402] 8. Charoensawan, V., Wilson, D., Teichmann, S. A. 2010. Genomic repertoires of DNA-binding transcription factors across the tree of life. Nucleic Acids Res. 38(21):7364-77 [0403] 9. Colle, C. F. 3rd, O'Callaghan, D. J. 1995. Transcriptional analyses of the unique short segment of EHV-1 strain Kentucky A. Virus Genes; 9(3):257-68. [0404] 10. Dorsch-Hsler, K., Keil, G. M., Weber, F., Jasin, M. Schaffner, W., and Koszinowski, U. H. 1985. A long and complex enhancer activates transcription of the gene coding for the highly abundant immediate early mRNA in murine cytomegalovirus. PNAS Vol. 82: 8325-8329. [0405] 11. Drummer, H. E., Studdert, M. J., Crabb, B. S. 1998. Equine herpesvirus-4 glycoprotein G is secreted as a disulphide-linked homodimer and is present as two homodimeric species in the virion. J. Gen. Virol. 79: 1205-1213 [0406] 12. von Einem J, Smith P M, Van de Walle G R, O'Callaghan D J, Osterrieder N (2007). In vitro and in vivo characterization of equine herpesvirus type 1 (EHV-1) mutants devoid of the viral chemokine-binding glycoprotein G (gG). Virology 362, (1) 151-162 [0407] 13. Goodwin, E. C. & Rottman, F. M. 1992. The 3flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J. Biol. Chem. 267: 16330-16334. [0408] 14. Hubert, P. H., Birkenmaier, S., Rziha, H.-J. and Osterrieder, N. 1996, Alterations in the Equine Herpesvirus Type-1 (EHV-1) Strain RacH During Attenuation. Journal of Veterinary Medicine, Series B, 43: 1-14. doi:10.1111/j.1439-0450.1996.tb00282.x [0409] 15. Krber, G (1931) Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Archiv f experiment Pathol u Pharmakol.; 162:480-483 [0410] 16. Kraatz F, Wernike K, Hechinger S, Knig P, Granzow H, Reimann I, Beer, M (2015). Deletion mutants of Schmallenberg virus are avirulent and protect from virus challenge. J Virol 89, 1825-1837 [0411] 17. Luke, G A and Ryan, M D. 2013. The protein coexpression problem in biotechnology and biomedicine: virus 2A and 2A-like sequences provide a solution. Future Virology, Vol. 8, No. 10, Pages 983-996. [0412] 18. Ma, G., Eschbaumer, M., Said, A., Hoffmann, B., Beer, M., Osterrieder, N. 2012. An equine herpesvirus type 1 (EHV-1) expressing VP2 and VP5 of serotype 8 bluetongue virus (BTV-8) induces protection in a murine infection model. PLoS One. 2012; 7(4):e34425. doi: 10.1371/journal.pone.0034425. Epub 2012 Apr. 12. [0413] 19. Ma, G., Azab, W., Osterrieder, N. 2013. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol. 167(1-2):123-34. [0414] 20. Nolan, T. Rebecca E Hands, R. E., and Bustin S. A. Journal name: 2006. Quantification of mRNA using real-time RT-PCR Nature Protocols 1: 1559-1582 [0415] 21. Osterrieder, N., Neubauer, A., Brandmller, C., Kaaden, O. R., and O'Callaghan, D. J. 1996. The equine herpesvirus 1 IR6 protein influences virus growth at elevated temperature and is a major determinant of virulence. Virology 226:243-251. [0416] 22. Ptashne, M. 2014. The Chemistry of Regulation of Genes and Other Things The Journal of Biological Chemistry Vol. 289, (9) 5417-5435. Reed, L. J., and Muench, H. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. (27) 3; 493-497. [0417] 23. Reed L J and Muench H (1938). A simple method estimating fifty percent endpoints. The American Journal of Hygiene 27(3) 493-497 [0418] 24. Rosas, C. T., Konig, P., Beer, M., Dubovi, E. J., Tischer, B. K., Osterrieder, N., 2007a. Evaluation of the vaccine potential of an equine herpesvirus type 1 vector expressing bovine viral diarrhea virus structural proteins. J. Gen. Virol. 88 (3), 748-757. [0419] 25. Rosas, C. T., B. K. Tischer, G. A. Perkins, B. Wagner, L. B. Goodman, N. Osterrieder. 2007b . Live-attenuated recombinant equine herpesvirus type 1 (EHV-1) induces a neutralizing antibody response against West Nile virus (WNV) Virus Research, 125, pp. 69-78. [0420] 26. Rosas, C. T., Van de Walle, G. R., Metzger, S. M., Loelzer, K., Dubovi, E. J., Kim, S. G., Parrish, C. R., Osterrieder, N., 2008. Evaluation of a vectored equine herpesvirus type 1 (EHV-1) vaccine expressing H3 haemagglutinin in the protection of dogs against canine influenza. Vaccine 26 (19), 2335-3234. [0421] 27. Said, A., Elke Lange, E., Beer, M. Damiani, A., Osterrieder, N. 2013. Recombinant equine herpesvirus 1 (EHV-1) vaccine protects pigs against challenge with influenza A(H1N1) pmd09 Virus Research 173: 371-376 [0422] 28. Sambrook J and Russell D W (2001). Molecular Cloning, 3rd ed. Cold Spring harbor Laboratory Press, Cold Spring Harbor, N.Y.; ISBN 978-087969-577-4 [0423] 29. Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N., Palmer, A. E., Tsien, R. Y. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. December; 22(12):1567-72. Epub 2004 Nov. 21. [0424] 30. Tischer, B. K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechnol. Tech. 40, 191-197. [0425] 31. Tischer, B. K., Kaufer, B. B., Sommer, M., Wussow, F., Arvin, A., and Osterrieder, N. A Self-Excisable Infectious Bacterial Artificial Chromosome Clone of Varicella-Zoster Virus Allows Analysis of the Essential Tegument Protein Encoded by ORF9. J. Viro1.81 (23), 2007, 13200-13208. [0426] 32. Tischer, B. K, Smith, G. A., and Osterrieder, N. in: Jeff Braman (ed.), In Vitro Mutagenesis Protocols: Third Edition, Methods in Molecular Biology, vol. 634,DOI 10.1007/978-1-60761-652-8_30, Springer Science+Business Media, LLC 2010, Chapter 30: En Passant Mutagenesis: A Two Step Markerless Red Recombination System. [0427] 33. Thompson, S. R. 2012. Tricks an IRES uses to enslave ribosomes. Trends Microbiol. November; 20(11):558-66. [0428] 34. Trapp, S., von Einem, J., Hofmann, H., Kostler, J., Wild, J., Wagner, R., Beer, M., Osterrieder, N., 2005. Potential of equine herpesvirus 1 as a vector for immunization. J. Virol. 79, 5445-5454. [0429] 35. Trombetta C M, Perini D, Mather S, Temperton N, Montomoli E. 2014.Overview of Serological Techniques for Influenza Vaccine Evaluation: Past, Present and Future. Vaccines (Basel) 13;2(4):707-34. doi: 10.3390/vaccines2040707. [0430] 36. Wellington, J. E., Allen, G. P., Gooley, A. A., Love, D. N., Packer, N. H., Yan, J. X., Whalley, J. M. 1996. The highly 0-glycosylated glycoprotein gp2 of equine herpesvirus 1 is encoded by gene 71. J Virol. 70(11):8195-8. [0431] 37. Wernike K, Aebischer A, Roman-Sosa G, Beer M, (2017). The N-terminal domain of Schmallenberg virus envelope protein Gc is highly immunogenic and can provide protection from infection. Scientific reports. 2017 Feb. 13; 7:42500. [0432] 38. Wernike K, Eschbaumer M, Breithaupt A, Hoffmann B, Beer M (2012). Schmallenberg virus challenge models in cattle: infectious serum or culture-grown virus? Veterinary research 43, 84 [0433] 39. Wernike K, Eschbaumer M, Schirrmeier H, Blohm U, Breithaupt A, Hoffmann B, Beer M, (2013a). Oral exposure, reinfection and cellular immunity to Schmallenberg virus in cattle. Veterinary microbiology 165, 155-159 [0434] 40. Wernike K, Nikolin V M, Hechinger S, Hoffmann B, Beer M (2013b). Inactivated Schmallenberg virus prototype vaccines. Vaccine 31, 3558-3563