CANINE ADENOVIRUS VECTORS

Abstract

The present invention relates to the field of CAdV vector vaccines, and especially to promoters suitable to express target antigens from such vector vaccines. Disclosed and claimed are recombinant canine adenoviruses, methods of making them, uses for them (including in immunological, immunogenic, vaccine or therapeutic compositions, or, as a vector for cloning, replicating or expressing DNA and methods of using the compositions and vector), expression products from them, and uses for the expression products. Additionally, disclosed and claimed are truncated EHV4 promoters, expression cassettes containing the promoters, and recombinant viruses and plasmids containing the promoters or expression cassettes.

Claims

1. A recombinant canine adenovirus (rCAdV) vector comprising an expression cassette encoding at least one heterologous DNA operably linked to an equine herpesvirus-4 (EHV4) promoter.

2. The rCAdV vector of claim 1, wherein the equine herpesvirus-4 (EHV4) promoter comprises 4pgG600 (SEQ ID NO.:29) or 4pMCP600 (SEQ ID NO.:30) or the complementary nucleotide sequences thereof or a functional fragment or a functional derivative thereof or the complementary nucleotide sequences thereof, wherein said promoter sequence leads to expression of a heterologous antigen.

3. The rCAdV vector of claim 2, wherein the functional fragment or derivative of the promoter sequence has at least 80%, 85% sequence identity, preferably 90%, 91%, 92%, 93%, 94% sequence identity, more preferably 95%, 96%, 97%, 98%, 99%, 99.9% sequence identity.

4. The rCAdV vector of claim 2, wherein the functional fragment is a truncation of 4pgG600 (SEQ ID NO.:29) or the complementary nucleotide sequence thereof, wherein the sequence identity is at least 72% over entire length.

5. The rCAdV vector of claim 2, wherein the functional fragment is a truncation of 4pMCP600 (SEQ ID NO.:30) or the complementary nucleotide sequence thereof, wherein the sequence identity is at least 78% over entire length (or higher).

6. The rCAdV vector of claim 2, wherein the functional fragment or derivative of the promoter sequence has a length of 550 nucleotides or selected from the group consisting of: 500, 490, 480, 470, 460, 455, 450, 445, 440, 435, 434, 433, 432, 431, or 430 nucleotides.

7. The rCAdV vector of claim 1, wherein the equine herpesvirus-4 (EHV4) promoter comprises 4pgG600 (SEQ ID NO.:29).

8. The rCAdV vector of claim 1, wherein the equine herpesvirus-4 (EHV4) promoter comprises 4pMCP600 (SEQ ID NO.:30).

9. The rCAdV vector of claim 1, wherein the equine herpesvirus-4 (EHV4) promoter comprises G430 (SEQ ID NO.:31).

10. The rCAdV vector of claim 1, wherein the equine herpesvirus-4 (EHV4) promoter comprises gMCP455 (SEQ ID NO.:32).

11. The rCAdV vector of claim 1, which is packaged as an infectious CAdV.

12. The rCAdV vector of claim 1, wherein the heterologous DNA encodes a polypeptide selected from the group consisting of an epitope of interest, a biological response modulator, a growth factor, a recognition sequence, a therapeutic gene, and a fusion protein.

13. The rCAdV vector of claim 12, wherein the heterologous DNA encodes an antigenic epitope of interest.

14. The rCAdV vector of claim 13, wherein the antigenic epitope of interest is an antigen of a canine or feline pathogen.

15. The rCAdV vector of claim 13, wherein the antigenic epitope of interest is an antigen derived from a food producing animal pathogen.

16. The rCAdV vector of claim 14, wherein the antigenic epitope of interest is selected from the group consisting of a Morbillivirus antigen, a rabies glycoprotein, Feline Leukemia virus (FeLV) envelope protein, an immunodeficiency virus antigen, a parvovirus antigen, a poxvirus antigen.

17. The rCAdV vector of claim 15, wherein the food producing animal pathogen is derived from swine, cattle, equine, poultry, and/or ovine animals.

18. The rCAdV vector of claim 17, wherein the food producing animal pathogen is selected from the group consisting of: Bovine viral diarrhea virus (BVDV), Parainfluenza-3 Virus (PI-3), Infectious Bovine Rhinotracheitis virus (IBR), Bovine Respiratory Syncytial Virus (BRSV), Bovine Herpesvirus (BHV), Bovine Rotavirus (BRV), Bovine Enterovirus (BEV), Bovine Coronovirus (BCV), Bovine Rabies (BR), Bovine Parvovirus (BPV), Adenovirus Astrovirus, Mannheimia haemolytica (formerly Pasteurella haemolytica), Pasteurella multocida, Haemophilus somnus (Histophilus ovis and Haemophilus agni), Actinomyces (Corynebacterium), Actinomyces pyogenes, Chlamydia psittaci, Campylobacter fetus venerealis and Campylobacter fetus fetus (formerly C fetus intestinalis), Leptospira interrogans, Leptospira hardjo, Leptospira pomona, and Leptospira grippotyphosa, Leptospira canicola, Leptospira grippotyphosa, Leptospira hardjo (Leptospira hardjoprajitno and Leptospira hardjo-bovis), Brucella abortus, Brucella suis and Brucella melitensis, Listeria monocytogenes, Chlamydia psittaci, Clostridium chauvoei, Clostridium septicum, Clostridium haemolyticum, Clostridium novyi, Clostridium sordellii, Clostridium perfringens, Clostridium tetani, Moraxella bovis, Klebsiella spp, Klebsiella pneumoniae, Salmonella typhimurium; Salmonella newport, Mycobacterium avium paratuberculosis, Cryptsporidium parvum, Cryptsporidium hominis, Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus uberis, Streptococcus agalactiae, Escherichia coli, Mycoplasma spp, Mycoplasma dispar, and Ureaplasma spp., Tritrichomonas foetus, Trichophyton verrucosum, Trichophyton mentagrophytes, Trichophyton sarkisovii, Neospora caninum (formerly Toxoplasma gondii), Babesia bigemina and Babesia bovis, Dictyocaulus viviparous (Lungworm disease), and combinations thereof.

19. The rCAdV vector of claim 17, wherein the food producing animal pathogen is selected from the group consisting of: Salmonella spp., in particular S. typhimurium S. choleraesuis; Astroviruses; Rotavirus; Transmissible gastroenteritis virus; Brachyspira spp., in particular B. hyodysenteriae, B. pilosicoli; Clostridium spp., in particular C. difficile, C. perfringens types A, B and C, C. novyi, C. septicum, C. tetani; Porcine enteric picornaviruses; Porcine enteric caliciviruses; respiratory pathogens, which include: Actinobacillus pleuropneumonia; Bordetella bronchiseptica; Erysipelothrix rhsiopathiae; Haemophilus parasuis, in particular subtypes 1, 7 and 14; Pasteurella spp., in particular P. multocida; Mycoplasma spp., in particular M. hyopneumoniae, M. hyorhinis; Swine influenza A virus; PRRS virus; Porcine circovirus; Porcine parvovirus; Pseudorabies virus; Eperythrozoonosis suis, Mycobacterium spp., in particular M. avium, M. intracellulare, M. bovis; Porcine respiratory corona virus; Porcine coronavirus in particular TGEV, PEDV, and delta coronavirus; Arcanobacterium pyogenes; Porcine adenovirus; Classical swine fever; Porcine cytomegalovirus; African swine fever; or other pathogens, which include Escherichia coli, Streptococcus spp., in particular S. suis, S. porcinus, S. dysgalactiae, preferably subsp. equisimilis; Brucella suis, in particular biovars 1, 2 and 3; Leptospira spp., in particular L. australis, L. canicola, L. grippotyphosa, L. pomona, L. icterohaemorrhagicae, L. interrogans, L. tarassovi, L. hardjo, L. sejroe; Encephalomyocarditis virus; Hemagglutinating encephalomyelitis virus; Japanese encephalitis virus; West Nile virus; Reovirus; Rubulavirus; Menangle virus; Nipah virus; Vesicular stomatitis virus; Virus of vesicular exanthema of swine; Swine pox virus; Swine herpes virus; and Staphylococcus hyicus, and combinations thereof.

20. An immunogenic or vaccine composition comprising the recombinant canine adenovirus (rCAdV) vector according to claim 1, and a pharmaceutical or veterinary-acceptable acceptable carrier or diluent.

21. The immunogenic or vaccine composition of claim 20, wherein said carrier is suitable for oral, intradermal, intramuscular or intranasal application.

22. A method of producing the immunogenic composition or vaccine for reducing the incidence or the severity of one or more clinical signs associated with or caused by an infection, comprising the following steps : a. introducing into a host cell a recombinant rCAdV vector according to claim 1; b. cultivating the infected cells under suitable conditions; c. harvesting infected cells and/or vector and/or virus components; d. optionally purifying the harvest of step (c); and e. admixing said harvest with a pharmaceutically acceptable carrier.

23. A method of reducing or preventing the clinical signs or disease caused by an infection with a pathogen in an animal or for use in a method of treating or preventing an infection with a pathogen in an animal comprising the step of administering to the animal a therapeutically effective amount of the immunogenic composition of vaccine according to claim 20, for use in preferably.

24. The method of claim 23, wherein the immunogenic composition is administered once.

25. The method of claim 23, wherein the immunogenic composition is administered as two doses.

26. The method of claim 23, wherein the immunogenic composition is administered orally, intradermally, intramuscular or intranasally.

27. The method of claim 23, wherein the immunogenic composition protects against a homologous and/or heterologous viral challenge.

28. A method of immunizing an animal against a clinical disease caused by a pathogen in said animal, comprising the step of administering to the animal the immunogenic composition according to claim 20, whereby said immunogenic composition or vaccine fails to cause clinical signs of infection but is capable of inducing an immune response that immunizes the animal against pathogenic forms of said pathogen.

29. The method of claim 28, wherein the immunogenic composition is administered once.

30. The method of claim 29 wherein the immunogenic composition is administered as two doses.

31. The method of claim 28, wherein the immunogenic composition is administered orally, intradermally, intramuscular or intranasally.

32. The method of claim 28, wherein the immunogenic composition protects against a homologous and/or heterologous viral challenge.

33. A kit for vaccinating an animal, against a disease associated with and/or reducing the incidence or the severity of one or more clinical signs associated with or caused by a pathogen in an animal comprising: a. a dispenser capable of administering a vaccine to said animal; and b. the immunogenic composition or vaccine according to claim 20, and c. optionally an instruction leaflet.

34. A eukaryotic host cell line expressing the recombinant canine adenovirus type 2 (rCAdV2) of claim 1.

35. The eukaryotic host cell line of claim 34, wherein said host cell line is a mammalian cell line or an insect cell line selected from the group consisting of a PK/WRL cell line, a RK13 cell line, a MDBK cell line, a ST cell line, an AI-ST cell line, a VERO cell line, a Sf9 cell line, a Sf21, a Sf plus cell line, a MDCK cell line, and/or derivatives thereof.

36. A prokaryotic host cell line expressing the recombinant canine adenovirus type 2 (rCAdV2) of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0171] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0172] FIG. 1. Schematic drawing of the generation of a CAdV2 Infectious Clone. (A) Synthesized DNA fragment encoding 5 and 3 ends of the viral genome with intervening unique restriction site and cloned into pBR322 E. coli shuttle vector. PmeI restriction endonuclease sites (arrows) were engineered into the construct at the 5 and 3 ends of the ITRs to facilitate excision of the CAdV-2 genome from the pBR322 vector backbone. (B) B. Cloned dsDNA CAdV-2 genome onto vector via homologous recombination in BJ5183 REC.sup.+ E. coli. (C) Successful HR-recombinant rCAdV-2 infectious clone. ITR=inverted terminal repeat.

[0173] FIG. 2. Schematic of the organization of the E3 region of CAdV-2.

[0174] FIG. 3. Schematic illustration of homologous recombination between a linearized infectious clone DNA and a E3-targeting CAdV-2 transfer fragment.

[0175] FIG. 4. Schematic of the BIVI-generated E3-deletion (E3A and E3B) Transfer Fragment(s) in the CAdV-2 backbone.

[0176] FIG. 5. Schematic of the BIVI-generated E3-deletions. A) Schematic of the E3 ORFs with total combined sizes of remaining ORF1 and 2 DNAs and the amounts of each. B) Schematic of the CAdV-2 genome indicating the total amount of E3 ORF1 and ORF2 DNA remaining in E3A and E3B configurations. In the A deletion (E3A) all but the first 186 nucleotides of E3 ORF1 and the last 301 nucleotides of ORF2 were deleted, while for the E3 B deletion (E3B) 186 nucleotides of E3 ORF1 and 83 nucleotides of ORF2 remain.

[0177] FIG. 6. E3 Deletion and Insertion of Expression Cassettes

[0178] FIG. 7. An analysis of promoter strength by quantification of CPV VP2 expression by transient expression from the expression constructs as detected by IFA in transfected MDCK cells was performed. Panel A: CPV IFA of MDCK cells transfected with CPV VP2 expression plasmids driven by the CMVie or CMV5 promoters is shown. Panel B: Histogram of CPV VP2 ELISA of MDCK cells transfected with CPV VP2 expression plasmids driven by the CMVie, CAG, or CMV5 promoters as indicated. Panel C: Histogram of Molecular Devices ImageXpress MicroXL quantification of CPV VP2-positive MDCK cells transfected with CPV VP2 expression plasmids driven by the CMVie or CMV5 promoters as indicated.

[0179] FIG. 8: Schematic of the CMVie EGFP SV40 polyA expression cassette in the CAV-2 MCS-1-5 backbone. Insertion is in the E3B ORF2 where all but the first 186 nucleotides of E3 ORF1 and the last 82 nucleotides of are deleted. The EGFP gene is followed by a SV40 polyA signal. ITR=inverted terminal repeat.

[0180] FIG. 9: Schematic of the CMVie CPV VP2 (n) SV40 polyA expression cassette in the CAV-2 backbone. Insertion is in the E3B ORF2 where all but the first 186 nucleotides of E3 ORF1 and the last 82 nucleotides of are deleted. The VP2 (n) gene is followed by a SV40 poly A signal.

[0181] FIG. 10: PCR Analysis of rCAV-2 DNA purified from infected cells and supernatants. PCR was used to verify the presence of the CMVie CPV VP2 (n) transgene expression cassette in rCAV2E3B/CMVie CPV VP2 from isolated viral DNAs. Panel A, pCAV-2 control virus; Panel B, clone #1; Panel C, clone #2. Panel D, control reactions with CMVie CPV VP2 (n) Transfer Plasmid. M is 1 Kb+ DNA ladder. Panel E. Expected Results of Transgene Expression Cassette-specific PCR Reactions. Reactions 1 and 2 utilize primers specific for CAV-2 H-A P VIII, the U-exon and CVP VP2; Reactions 3, 4 and 5 utilize primers specific for CPV VP2 (see Panel E). Reaction 7 (positive reaction for CAdV-2) uses the CAV-2-specific H-A P VIII and U-exon primers.

[0182] FIG. 11. Flow Cytometric Analysis of rCAV-2-infected MDCK cells. Panels A-F are histograms of signal present in single cells. Suspension MDCK cells were infected with rCAV-2 control virus carrying the BRSV F (co) (Panels B and E) or infected with rCAV-2 carrying the CPV VP2 (co) (Panels C and F) expression cassettes and stained 72h post-infection with either FITC-conjugated anti-CPV VP2 (Panels A, B and C) or FITC-conjugated anti-CAV2 (Panels D, E and F) antibodies. Panel G is a summary and quantification of the results shown in Panels A-F.

[0183] FIG. 12. Schematic of the CMVie BRSV F (co) BGH polyA expression cassette in the CAdV-2 backbone. The BRSV F (co) gene is followed by a BGH poly A signal.

[0184] FIG. 13. Schematic of the CMVie RabGP BGH polyA expression cassette in the CAdV-2 backbone. The RabGP gene is followed by a BGH poly A signal.

[0185] FIG. 14. CAdV-2-specific IFA of rCAV-2 RabGP P2 virus infected E1B-MDCK cells. CAdV-2 IFAs of infected E1B-MDCK cells were performed 60 h post-infection cells using anti-CAdV-2 antibodies directly conjugated to fluorescein isothiocyanate (FITC) and mouse anti-RabG monoclonal and FITC-conjugated goat anti-mouse antibodies.

[0186] FIG. 15: Flow Cytometric Analysis of CAdV2 CMVie CPV VP2-infected AI-ST 2015 cells: 72 h post-infection

[0187] FIG. 16: rCAdV-2 with New EHV-4 Promoters: Flow Cytometric Analysis of Infected AI-ST 2015 cells: 48 h post-infection

[0188] FIG. 17: rCAdV-2 with New EHV-4 Promoters: Dot Blot Analysis of CPV VP2 Protein Expression in Infected MDCK cells. 1= 1/50 a-CPV-FITC mAb (VMRD); 2= 1/1.000 Goat-a-mouse IgG-peroxidase (JIR). (A)Original dot blot data. (B) Semi-quantitative data generated from dot blot: For quantification, dot blots are analyzed using ImageJ software (Burger, W., Burge, M. J. (Eds.), 2008. Digital Image Processing: An algorithmic introduction using Java. Springer-Verlag, New York). Image colors are inverted to subtract background and integrated density of each dot recorded. Values are assigned + and designations as follows: ++++=>800000, +++=500000 to 800000, ++=300000 to 499999, +=120000 to 299999, +/=80000 to 119999 and =<80000. FIG. 18: RabG detection in cells infected with rCAdV-2 p455 RabG: expression is detected in <1% of cells infected with original rCAdV-2 CMVie RabG.

[0189] FIG. 18. Summary of Flow Cytometric analysis of RabG proteins express by AI-ST 2015 cells infected by rCAdV-2 infectious clones.

[0190] FIG. 19A: Detection of CPV VP2 in cells infected with rCAdV-2 p430 and p455 (denoted as gG430 and MCP455, respectively) RabG.

[0191] FIG. 19B: Detection of RabG in cells infected with rCAdV-2 p455 (denoted as MCP455) RabG.

[0192] FIG. 19C: Detection of both CAdV-2 and RabG in cells infected with rCAdV-2 p455 (denoted MCP455) RabG.

Sequences Overview

[0193] The following sequences are detailed and disclosed hereby in the present invention:

TABLE-US-00001 TABLE 1 SEQ. DNA/RNA/ IDENTIFIER NAME PROTEIN SEQ ID NO: 1 CAdV2 E3A-E3 region DNA SEQ ID NO: 2 CAdV2 E3B-E3 region DNA SEQ ID NO: 3 huCMVie promoter DNA SEQ ID NO: 4 huCMV 5 promoter DNA SEQ ID NO: 5 huCMVie 5 F primer Artificial SEQ ID NO: 6 huCMVie 3 R primer Artificial SEQ ID NO: 7 huCMVie EGFP Expression DNA Casette SEQ ID NO: 8 EGFP Forward (PCR Screen Primer) Artificial SEQ ID NO: 9 EGFP Reverse (PCR Screen Primer) Artificial SEQ ID NO: 10 huCMVie CPV VP2 (n) Expression DNA Casette SEQ ID NO: 11 Set 1 H-AP VIII F Primer (FIG. 10E) Artificial SEQ ID NO: 12 Set 1 VP2 RPrimer (FIG. 10E) Artificial SEQ ID NO: 13 Set 2 VP2 F Primer (FIG. 10E) Artificial SEQ ID NO: 14 Set 2U Exon R Primer (FIG. 10E) Artificial SEQ ID NO: 15 Set 3 VP2 F Primer (FIG. 10E) Artificial SEQ ID NO: 16 Set 3 VP2 R- Primer (FIG. 10E) Artificial SEQ ID NO: 17 Set 4 VP2F-Primer (FIG. 10E) Artificial SEQ ID NO: 18 Set 4 VP2 R Primer (FIG. 10E) Artificial SEQ ID NO: 19 Set 5VP2F-Primer (FIG. 10E) Artificial SEQ ID NO: 20 Set 5VP2R-Primer (FIG. 10E) Artificial SEQ ID NO: 21 Set 6H-AP VIIIF Primer (FIG. 10E) Artificial SEQ ID NO: 22 Set 6U Exon Reverse Primer (FIG. 10E) Artificial SEQ ID NO: 23 huCMVie CPV VP2 (co) Expression DNA Casette SEQ ID NO: 24 Canine Parvovirus VP2 Protein Protein SEQ ID NO: 25 huCMVie RabGP Expression Cassette DNA SEQ ID NO: 26 Pasteur Rabies G (n) glycoprotein Protein SEQ ID NO: 27 huCMVie BRSV F (co) Expression DNA Cassette SEQ ID NO: 28 BRSV F (co) Polypeptide Protein SEQ ID NO: 29 EHV-4 600 bp Promoter (4pgG600) DNA SEQ ID NO: 30 EHV-4 600 bp Promoter (4pMCP600) DNA SEQ ID NO: 31 EHV-4 430 bp Promoter (pG430) DNA SEQ ID NO: 32 EHV-4 MCP455 bp Promoter (p455) DNA SEQ ID NO: 33 gG430 F Primer Artificial SEQ ID NO: 34 gG430 R Primer Artificial SEQ ID NO: 35 MCP455 F Primer Artificial SEQ ID NO: 36 MCP455 R Primer Artificial SEQ ID NO: 37 CPV VP2 Despliced ORF with BamHI DNA and SalI Restriction Endonuclease Sites SEQ ID NO: 38 CPV VP2 Gen0.95 ORF with BamHI DNA and SalI Restriction Endonuclease Sites SEQ ID NO: 39 p430 CPV VP2 (Despliced) Expression DNA Casette SEQ ID NO: 40 p430 CPV VP2 (Gen 0.95) Expression DNA Casette SEQ ID NO: 41 p455 CPV VP2 (Gen0.95) Expression DNA Casette SEQ ID NO: 42 p430 RabG (n) Expression Casette DNA SEQ ID NO: 43 p455 RabG (n) Expression Casette DNA SEQ ID NO: 44 Despliced Forward Primer Artificial SEQ ID NO: 45 Despliced Reverse Primer Artificial SEQ ID NO: 46 Gen0.95 Forward Primer Artificial SEQ ID NO: 47 Gen0.95 Reverse Primer Artificial

EXAMPLES

[0194] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1

CAdV Virus Isolation

[0195] The CAdV2 virus was originally isolated from a throat swab from a dog with laryngotracheitis and was obtained as the first passage in American Type Culture Collection (ATCC) MDCK cell line CCL-34. The virus was passed 8 times after acquisition, and the 8.sup.th passage was aliquoted and designated as the Master Seed Virus. The stock CAdV-2 Master Seed Virus was produced at Boehringer Ingelheim Vetmedica, Inc. under the reference CAdV-2, MSV Lot #001-dil, F: 11-24-98. The stock CAdV-2 Master Seed is closely related to the Toronto strain (Genbank Accession Number U77082.1). CAdV-2 is commercially available from Boehringer Ingelheim Vetmedica, Inc. as a canine vaccine.

[0196] The infectious clone DNA is the entire CAdV-2 genome cloned into the pBR322 low copy E. coli shuttle vector. A homologous recombination approach (Kremer, E. J., et al., Canine adenovirus vectors: an alternative for adenovirus-mediated gene transfer. J Virol, 2000. 74(1): p. 505-12.) was employed to construct the infectious clone DNAs. CAdV-2 DNA was purified from stock CAdV-2 MLV) and recombined in BJ5183 E. coli with a pBR322-based vector containing DNA homologous to the CAdV-2 Inverted Terminal Repeats.

[0197] CAdV-2 was rescued from Madine Darby canine kidney (MDCK) cells transfected with linearized infectious clone DNA FIG. 1 for a representation of the complete infectious clone DNA.

Example 2

Generation of E3-Deleted-Insertion CADV Clones

[0198] CAdV-2 has been successfully utilized as a vectored viral vaccine for animals. The E3 domain of CAdV-2 is known to be non-essential (none of the E3 open reading frames (ORFs) is required for viral replication in tissue culture (Fisher et al. 2002) and present a logical target for the insertion of heterologous DNAs.

[0199] Examples of efficacious CAdV-2-based vaccines wherein transgenes are localized to the E3 domain include canine distemper virus (Fisher et al. 2002), feline panleukopenia virus (Yang et al. 2008), and rabies for cats (Hu et al., 2007), dogs (Hu et al., 2006) mice (Li et al., 2006), raccoons, swine (Lui et al., 2008), skunks (Henderson et al., 2009) and sheep (Bouet-Cararo et al., 2011).

[0200] FIG. 2 is a schematic of the organization of the E3 region of CAdV-2. The 4146 bp NruI (bp 23932)/SalI (bp 28078) restriction endonuclease fragment is illustrated with open reading frames (ORFs) shown as the H-A Protein VIII, ORF1, ORF2, and the U Exon. The positions of select restriction endonuclease sites (NruI, DraIII, SspI and SalI) are shown for this DNA fragment and the numbering is relative to the closely related Toronto strain (Genbank Accession Number U77082.1) of CAdV-2.

[0201] As noted by Fischer et al. (2002), the genomic organization of E3 regions is only loosely conserved between different adenoviruses (Linne, T., Differences in the E3 regions of the canine adenovirus type 1 and type 2. Virus Res, 1992. 23(1-2): p. 119-33), and therefore, the precise limits of the CAdV2 E3 region nonessential loci cannot be transposed from E3 insertion sites in other viruses. In a first construct the entire ORF1 and ORF2 DNA segment from E3 was deleted to maximize the size of the transgene insertions, however infectious clone DNAs failed to facilitate rescue of rCAdV-2. This strategy was found to inadvertently delete the last five codons (including the stop codon) of the hexon-associated protein VIII gene (H-A-PVIII) that extends into E3 ORF1 (different reading frame) in the 5 E3 Flank DNA, resulting in an H-A PVIII gene with a substantial 3 extension (could result in an H-A PVIII with a 5 amino acid deletion followed by a substantial c-terminal addition).

[0202] Thus the transfer plasmids were redesigned so that the 5 and 3 E3 Flanking DNAs contained the first 183 bp of E3 ORF1 and the last 47 bp of ORF2, which were found to be sufficient for rCAdV-2 rescue.

Example 3

Homologous Recombination for Generation of RCADV-2 Infectious Clone DNAS

[0203] Homologous recombination in Rec+ BJ5183 E. coli between linearized CAdV-2 infectious clone DNAs and E3-targeting CAdV-2 transfer plasmids/fragments, based on methods described in papers by Chartier et al. (1996) and Kremer et al. (2000), was employed for the generation of rCAdV-2 with transgene expression cassettes localized to the E3 domain. As illustrated in FIG. 3, an infectious clone that contains a unique restriction site in the E3 domain recombines with a transfer fragment containing 500 bp of CAdV-2 flanking DNA both 5and 3to transgene expression cassettes to both a) target the transgene expression cassette to the E3 region and b) effectively delete select portions of E3.

[0204] DNA was isolated from expanded BJ5183 clones identified using a transgene-specific PCR screen, and these DNAs were resolved by agarose gel electrophoresis to verify their migration at or >23.1 Kb (successful HR results in DNA species of 35 kb which as a supercoiled DNA migrates similarly to the 23.1 kb marker on a 0.7% agarose gel). These DNA were then transformed and expanded in either Stb12 or XL-10 Gold E. coli for larger scale purification and use for generation of rCAdV-2 in mammalian cells.

[0205] FIG. 3 is a schematic illustration of homologous recombination between a NruI/SalI-linearized infectious clone DNA (native CAdV-2 sequence) and an E3-targeting CAdV-2 transfer fragment encompassing the aforementioned E3 deletion and a unique restriction site or sites (designated MCS for multiple cloning site) located between the remaining portions of E3. The infectious clone DNA is bordered by the left and right inverted terminal repeats, LITR and RITR, respectively.

Example 4

Generation of E3 rCAdV-2 Infectious Clone DNAs

[0206] E3-Deleted rCAdV-2: E3A and E3B

[0207] Overlap extension PCR was employed to generate CAdV-2 E3-targeting transfer fragments encoding select E3 deletions and 500 bases of 5 and 3 flanking sequence to facilitate targeted homologous recombination (HR) in BJ5183 E. coli. (See schematics, FIG. 4 and FIG. 5). As shown in FIGS. 5A and B in the A deletion (E3A) all but the first 186 nucleotides of E3 ORF1 and the last 301 nucleotides of ORF2 were deleted, while for the E3 B deletion (E3B) 186 nucleotides of E3 ORF1 and 83 nucleotides of ORF2 remain (See SEQ ID NO:1 and SEQ ID NO:2 for 5 and 3 flanks).

[0208] Both infectious clones harboring the E3A and E3B deletions were successfully rescued from transfected MDCK and E1B-MDCK cells, indicating that the specific E3 deletions support viral rescue. Because the E3B configuration encompasses a larger E3-deletion, it became the design of choice for the generation of transgene expression cassette-carrying rCAdV-2 moving forward. This larger deletion indicates that practically all of the E3 region, e.g., about 82% of the E3 region can be deleted without adversely impacting viral rescue.

Example 5

Construction of E3 Deletion/Insertion Expression Cassettes with CMV Promoters

[0209] Generation of HCMV-IE and CMV5 Promoters:

[0210] Amplification of the 3 end of the human cytomegalovirus immediate early promoter (hCMV-IE)(SEQ ID NO:3) was performed by PCR as previously described, using the primers pair hCMV-IE 5F (SEQ. ID NO:5) (5-TTATTAATAGTAATCAATTACGGGG-3)/hCMV-IE 3 R (SEQ. ID NO:6) (5-GCCACCGTACACGCCTACCGCCC-3) and BAC DNA EHV-gG (10 ng) as template. The resulting DNA fragment was subsequently cloned into the pCRBluntII TOPO vector (ThermoFisher Scientific) and excised by digestion with restriction enzymes Kpn-1 and BamH-1 and further cloned into a pUC18-based plasmid shuttle vector for further manipulation and construction of the CAdV transfer plasmids. The human CMV5 promoter (SEQ ID NO:4) was synthesized using GENSCRIPT gene synthesis products with 5-3 Spe-1 and BamH-1 restriction sites, respectively and cloned into the pUC57 E. coli shuttle vector for further manipulation and construction of the CAdV transfer plasmids.

[0211] Comparison of CMVIE and CMV5 Promoter Activity:

[0212] Reports in the literature have shown more robust protein expression from mammalian transgene expression cassettes driven by the CMV5 versus CMVie promoters. The CMV5 promoter differs from the CMVie promoter in that it contains, downstream of the CMVie transcription start site, 560 bp of DNA encoding a human adenovirus type 5 (HuAd5) adenovirus tripartite leader with the adenovirus major late enhancer bracketed by splice donor and acceptor sites (Massie et al., 1995, Improved adenovirus vector provides herpes simplex virus ribonucleotide reductase R1 and R2 subunits very efficiently. Nature Biotechnology 13:602-608). The use of the CMV5 promoter was shown to substantially increase protein expression in 293 cells (Massie et al., 1998, Inducible overexpression of a toxic protein by an adenovirus vector with a tetracycline-regulatable expression cassette. Journal of Virology 72 (3):2289-2296).

[0213] Consistent with these reports, direct comparisons of protein expression from cassettes driven by either CMVie or CMV5 by transient transfection of expression plasmids containing CPV VP2, demonstrate more robust protein expression from mammalian transgene expression cassettes driven by the CMV5 versus CMVie promoters. As shown in FIG. 7., an analysis of promoter strength by quantification of CPV VP2 expression by transient expression from the expression constructs as detected by IFA in transfected MDCK cells was performed. In Panel A: CPV IFA of MDCK cells transfected with CPV VP2 expression plasmids driven by the CMVie or CMV5 promoters is shown. Panel B: is a histogram of CPV VP2 ELISA of MDCK cells transfected with CPV VP2 expression plasmids driven by the CMVie, or CMV5 promoters. Panel C: is a histogram of Molecular Devices ImageXpress MicroXL quantification of CPV VP2-positive MDCK cells transfected with CPV VP2 expression plasmids driven by the CMVie or CMV5 promoters as indicated. The results indicate that the CMV5 promoter can direct robust expression of the transgene, and expression from the CMV5 is greater in terms of both optical density IFA and the relative number of FITC positive MDCK cells than the CMVie promoter. Thus the CMV5 promoter was chosen to drive transcription of the CAdV-2 expression cassettes. However, none of the rCAdV-2 infectious clones containing the CMV5 promoter have led to rescue of rCAdV-2.

[0214] As shown in Table 2, while the CMV5 drove robust transient expression of the VP2 transgene, none of the rCAdV-2 infectious clones containing the CMV5 promoter have led to the rescue of rCAdV-2.

[0215] To directly address whether the CMV5 promoter sequence might be interfering with rCAdV-2 rescue, a DNA fragment containing the CMV5 promoter, a multiple cloning site (MCS) and the simian virus 40 (SV40) polyadenylation (polyA) sequence was integrated into the E3 region of the CAdV-2 genome. All of the components of the DNA cloned into AE3B, except for the 560 bp of DNA that distinguishes the CMV5 from the CMVie (and the MCS,) are part of previously rescued rCAdV-2 viruses. Attempts at rescue were unsuccessful, strongly suggesting that the CMV5 promoter interferes with rescue of rCAdV-2. To support this conclusion, a reciprocal experiment was designed wherein homologous recombination was used to replace the CMV5 MCS SV40 polyA region in this infectious clone with a rescuable CMVie-based expression cassette.

[0216] Generation of rCAdV-2E3B/CMVie EGFP, which Contains a CMV-IE-EGF Expression Cassette Expression Cassette Inserted into the E3B Region of the CAdV2 Genome:

[0217] A rCAdV-2 carrying an Enhanced Green Fluorescent Protein (EGFP, Clontech) expression cassette (2.6 kb (SEQ ID NO.:7, CMVie EGFP) was generated to facilitate assessment of viral rescue and evaluate tropism in select cell lines and species in vivo. In brief, a CAdV-2 E3B-targeting CMVie EGFP transfer fragment (CMVie-driven EGFP ORF followed by a SV40 polyadenylation sequence flanked by 500 bp CAdV-2 DNA ending at position 183 of ORF1 (5) and beginning at position 82 of CAdV-2 E3 ORF2 (3)), was used for homologous recombination to generate rCAdV-2E3B/CMVie EGFP. Successful HR events were evaluated by the detection of a DNA species of 35 kb. PCR colony screens were performed to identify clones containing the transgene expression cassette (Forward P SEQ ID NO.:8; Reverse P SEQ ID NO.9). Positive clones were visualized by agarose gel electrophoresis wherein a positive clone had 0.7 kb PCR product corresponding to the EFG transgene cassette. Additionally, proper transgene insertion and sequence was confirmed by sequence analysis using an ILLUMINA MiSeq Sequencer, NextEr_XT library preparation methods, and NexGene software (Softgenetic; version 2.3) and SEQUENCER software (Genecodes; version 5.1).

[0218] Successful Pme-1 digestion of the rCAdV-2GFP yielded two species: a 32.7 kb (rCAdV-2 genome) and 2.7 kb (PBR322 fragment). Transfection of MDCK and E1B-MDCK cells was achieved using LIPOFECTAMINE 2000 transfection reagent (ThermoFisher Scientific). rCAdV-2E3B/CMVie EGFP infectious clones were successfully rescued from transfected MDCK and E1B-MDCK cells, as indicated by GFP signal via fluorescence in transfected cells. Viruses were harvested from transfected cell supernatants/lysates and subjected to three successive freeze-thaw cycles (70 C./37 C.), filter-sterilized, and them passed on both MDCK and E1B-MDCK. Infected cells were then observed for infection-dependent EGFF signal via fluorescent microscopy (data not shown).

[0219] The CMVIE EGFP SV40 polyA transgene expression cassette was successfully cloned into the E3B domain of CAdV2. Recombinant virus was successfully rescued, and EGFP was detectable by fluorescent microscopic analysis post-infection.

[0220] Generation and Rescue of rCAdV-2 E3B with an Enhanced Green Fluorescent Protein (EGFP) Expression Cassette from the rCAdV-2 E3B Unrescuable Infectious Clone Carrying the CMV5 Promoter:

[0221] To support the conclusion that the CMV5 promoter inhibits rCAdV-2 rescue (see Use of the CMV5 Promoter for transgene expression section, above), a reciprocal experiment was conducted wherein homologous recombination was used to replace the CMV5 MCS SV40 polyA region in the MCS-1 infectious clone with a rescuable CMVie-based expression cassette. In brief, the CAdV-2 E3-targeting CMVie EGFP transgene transfer fragment above, was used for homologous recombination to generate a E3B rCAdV-2 from infectious clone MCS-1-5 (MCS-1-5 contains the CMV5 Promoter, a small multiple cloning site (MCS) and a SV40 polyadenylation sequence). A purified 2.6 Kb EGFP transfer fragment and linearized rCAV-2 infectious clone DNA derived from MCS-1-5, were co-transformed via electroporation into BJ5183 E. coli cells which were then selected on LB-agar plates with 50 g/mL Carbenicillin. PCR colony screens were performed to identify clones containing the transgene expression cassette. Successful homologous recombination results in DNA species of 35 Kb which, as supercoiled DNA, runs with or somewhat faster than the 23.1 Kb marker DNA species on a 0.7% agarose gel. Positive clones were visualized by agarose gel electrophoresis (FIG. 4). a schematic of the CMVie EGFP SV40 polyA expression cassette in the CAV-2 MCS-1-5 backbone the infectious clone DNA is illustrated in FIG. 8.

[0222] Pmel-digested of rCAV-2 MCS-1-5 EGFP virus was transfected into MDCK cells and E1B-MDCK cells using LIPOFECTAMINE 2000 CD and 3000. rCAdV-2E3B/CMVie EGFP infectious clones derived from the rCAdV-2 MCS-1-5 infectious clone DNA successfully facilitated the rescue of rCAdV-2 from transfected E1B-MDCK cells, as indicated by GFP signal via fluorescence in transfected cells (data not shown). As postulated in Appendix VI (Background), rescue of rCAdV-2 carrying the EGFP expression cassette derived from the CAdV-2 MCS-1 backbone further supports the conclusion that inhibition of rCAdV-2 rescue is CMV5-dependent, and more so is localized to the 560 bp huAd5 DNA sequence in CMV5.

[0223] Generation of rCAdV-2E3B/CMVie CPV VP2 (Native), which Contains a CMV-IE-VP2 Expression Cassette Expression Cassette Inserted into the E3B Region of the CAdV2 Genome:

[0224] A rCAdV-2 carrying the canine parvovirus (CPV) VP2 gene was generated. In brief, similar to the above, a CAdV-2 E3-targeting transfer fragment containing a CMVie-driven CPV VP2 ORF (SEQ ID NO.:10) was used for homologous recombination to generate a E3B rCAdV-2 containing the VP2 expression cassette (See FIG. 9). Clones containing the successful transgene integration were detected by PCR screen, where a 1.7 kb PCR product was visualized by agarose gel electrophoresis. Proper transgene insertion and sequence was confirmed by sequence analysis using an ILLUMINA MiSeq Sequencer, NextEr_XT library preparation methods, and NexGene software (Softgenetic; version 2.3) and SEQUENCER software (Genecodes; version 5.1).

[0225] Successful Pme-1 digestion of the rCAdV-2GFP yielded two species: a 32.7 kb (rCAdV-2 genome) and 2.7 kb (PBR322 fragment). rCAdV-2E3B/CMVie CPV VP2 infectious clones were successfully rescued from transfected MDCK and E1B-MDCK cells, as detected by CAdV-2 IFAs (data not shown). While CPV VP2 protein expression in infected cells was unsuccessful as detected by the lack of immunofluorescence antibody staining against the VP2 protein, the presence of the transgene expression cassette was detected in purified viral genomes by PCR

[0226] PCR analysis of rCAV-2 DNA purified from infected cells and supernatants was used to verify the presence of the CMVie CPV VP2 (n) transgene expression cassette in rCAV2E3B/CMVie CPV VP2 clones (FIG. 10). Panel A, pCAV-2 control virus; Panel B, clone #1; Panel C, clone #2. Panel D, control reactions with CMVie CPV VP2 (n) Transfer Plasmid. M is 1 Kb+ DNA ladder. Panel E. Expected Results of Transgene Expression Cassette-specific PCR Reactions. Reactions 1 and 2 utilize primers specific for CAV-2 H-A P VIII, the U-exon (SEQ ID NO.:11, SEQ ID NO.:12).and CVP VP2 (SEQ ID NO.:13, SEQ ID NO.:14); Reactions 3, 4 and 5 utilize primers specific for CPV VP2 (see Panel E) (SEQ ID NOs.:15-20). Reaction 7 (positive reaction for CAdV-2) uses the CAV-2-specific H-A P VIII and U-exon primers (SEQ ID NO.:21, SEQ ID NO.:22).

[0227] Therefore, while CMVIE CPV VP2 (n) SV40 polyA transgene expression cassette was successfully cloned into the E3B domain of CAdV2, recombinant virus successfully rescued, and the presence of the VP2 sequence was confirmed, VP2 protein expression was not detectable.

[0228] Generation of rCAdV-2E3B/CMVie CPV VP2 (Codon-Optimized), which Contains a CMV-IE-VP2 Expression Cassette Inserted into the E3B Region of the CAdV2 Genome:

[0229] A CAdV-2 E3-targeting CMVie CPV VP2 codon optimized (co) transgene transfer fragment (CMVie-driven CPV VP2 ORF (co) followed by a Bovine growth hormone (BGH) polyadenylation sequence flanked by 500 bp CAdV-2 DNA ending at position 183 of ORF1 (5) and beginning at position 82 of CAdV-2 E3 ORF2 (3)) (SEQ. ID NO.:23), was generated by overlap extension PCR and cloned into a TOPO vector for archiving and amplification. The construct was used for homologous recombination to generate a E3B rCAdV-2.

[0230] Clones containing the successful transgene integration were detected by PCR screen, where a 2.3 kb PCR product was visualized by agarose gel electrophoresis. Proper transgene insertion and sequence was confirmed by sequence analysis using an ILLUMINA MiSeq Sequencer, NextEr_XT library preparation methods, and NexGene software (Softgenetic; version 2.3) and SEQUENCER software (Genecodes; version 5.1).

[0231] rCAdV-2E3B/CMVie CPV VP2 (co) infectious clones were successfully rescued from transfected MDCK and E1B-MDCK cells, demonstrated by CAdV-2 IFA performed on P1-infected cells using anti-CAdV-2 antibodies directly conjugated to fluorescein isothiocyanate (FITC) (data not shown). To verify that rescued virus encodes the CMVie CPV VP2 (co) transgene expression cassette, P2 virus rCAdV-2 and P5 CAdV-2 genomes were purified. PCR analysis of extracted DNAs using primers specific for regions of the CAdV-2 genome (hexon-associated protein VIII (H-A P VIII) and the U-exon), the CMVie promoter and CPV VP2 were employed. (data not shown)The PCR analysis yielded the correct size PCR products indicating that purified P2 viral genomes encoded the CMVie CPV VP2 (co) transgene expression cassette.

[0232] Flow cytometic analysis of CMVie CPV VP2 (co) rCAdV infected cells using antibodies against CAdV2 and CPV VP2 was employed to verify expression of infected MDCK cells. Briefly, suspension MDCK cells were infected with rCAdV-2 and control rCAdV-2 in a 12-well format and cultured for 72 h (37 C., 5.0% CO.sub.2 at 125 rpm in a humidified incubator). Cells were then collected, washed with PBS and then, using a CYTOFIX/CYTOPERMTM Fixation/Permeabilization Kit (BD Biosciences, Cat. #554714), treated with the CYTOFIX fixation solution followed by two CYTOPERM permeabilization solution washes. Cells were then incubated with FITC-conjugated anti-CAdV-2 or anti-CPV VP2 antibodies (Anti-CAV2 antibody: VMRD, Catalog #CJ-F-CAV-50X and Anti-CPV VP2 antibody: VMRD, Catalog #CJ-F-CPV 50X, respectively), washed 2 with CYTOPERM and analyzed by flow cytometry using a BD Biosciences FACSCANTO Flow Cytometry System.

[0233] FIG. 11 shows the results from the flow cytometric analysis of CMVie CPV VP2 (co) rCAdV infected MDCK cells. Panels A-F are histograms of signal present in single cells. Suspension MDCK cells were infected with rCAdV-2 control virus carrying the BRSV F (co) (Panels B and E) or infected with rCAV-2 carrying the CPV VP2 (co) (Panels C and F) expression cassettes and stained 72 h post-infection with either FITC-conjugated anti-CPV VP2 (Panels A, B and C) or FITC-conjugated anti-CAV2 (Panels D, E and F) antibodies. Panel G is a summary and quantification of the results seen in FIG. 11. The results of staining with anti-CAV-2 shows that most of the rCAV2-BRSV F (co)- or rCAV2-CPV VP2 (co)-infected (FIG. 1, Panels E and F, respectively) MDCK cells express CAdV2 proteins, while uninfected cells (FIG. 1, Panel D) are effectively negative for CAdV-2. Staining with anti-CPV VP2 antibodies (FIG. 1, Panels A, B and C) shows that only rCAV2-CPV VP2 infected MDCK cells (Panel C) express CPV VP2 proteins, although some background signal is observed in uninfected and rCAV2-BRSV F-infected cells with the anti-CPV VP2 antibodies (Panels A and B, respectively).

[0234] Thus, the CMVie CPV VP2 codon optimized (co) transgene expression cassette was successfully cloned into the E3B domain of CAdV2. Recombinant virus was rescued from transfected MDCK cells, and the transgene expression cassette was detected in purified viral genomes. CPV VP2 mRNA was detected in infected cells (data not shown), and protein expression of CPV VP2 in infected cells was confirmed by flow cytometric analysis, in contrast to the native VP2 expression cassette.

[0235] Generation of rCAdV-2 E3B with a Codon-Optimized Bovine Respiratory Syncytial Virus Fusion Protein Expression Cassette Inserted into the E3B Region of the CAdV2 Genome:

[0236] In brief, a CAdV-2 E3-targeting transfer fragment containing a CMVie-driven CPV Bovine respiratory syncytial virus (BRSV) Fusion (F) protein ORF followed by a BGH polyadenylation sequence flanked by 500 bp CAdV-2 DNA ending at position 183 of ORF1 (5) and beginning at position 82 of CAdV-2 E3 ORF2 (3) was used for homologous recombination to generate a E3B rCAdV-2. (SEQ ID NO.:27). Both the native (n) and codon optimized (co) versions of the BRSV F gene were cloned into CAdV-2 vector background, and virus carrying both of versions of the transgene where successfully rescued. However, only the BRSV F (co) gene was used for downstream applications.

[0237] rCAdV-2E3B/CMVie BRSV F (CO) infectious clones were successfully rescued from MDCK cells, as indicated by CPE of cells infected with viral supernatants/cell lysates. The presence of the transgene expression cassette was detected in purified viral genomes. DNA was extracted from P3 rCAV2-BRSV F (co) virus and used as a template for PCR analysis to detect the presence of the BRSV F (co) gene in the virus genome. The transgene was sequenced to confirm the gene sequence.

[0238] Expression of BRSV F by infected cells was confirmed by flow cytometric analysis (See FIG. 11).

[0239] Generation of rCAdV-2 E3B with a Rabies Glycoprotein (n) Expression Cassette Inserted into the E3B Region of the CAdV2 Genome:

[0240] In brief, a CAdV-2 E3-targeting Transfer Fragment containing a CMVie-driven Pasteur Strain Rabies glycoprotein (RabGP) ORF followed by a BGH polyadenylation sequence flanked by 500 bp CAdV-2 DNA ending at position 183 of ORF1 (5) and beginning at position 82 of CAdV-2 E3 ORF2 (3) was used for homologous recombination to generate a E3B rCAdV-2. (SEQ ID NO.:25)(See FIG. 13) The native Pasteur Rabies G gene was PCR-amplified from a Raccoonpox-based rabies vaccine (rRCNV-Rabies G2 Vaccine), Lot #D015-054-). Expected size of amplified RabGP DNA is 1.6 Kb.

[0241] The RabGP fragment was then ligated into the pUC18-B-Bflb-CO fragment and transformed into TOP10 E. coli. PCR colony screen for RabGP DNA was performed using RabGP-specific primers (data not shown).

[0242] DNAs were digested with Pmel to liberate the transfer fragments (3.45 Kb) and Scal to cut the vector backbone to facilitate identification of the transfer fragments. Purified 3.45 Kb PmeI CMVie RabGP (n) Transgene (expression cassette) transfer fragments and linearized rCAV-2 infectious clone DNAs were co-transformed via electroporation into BJ5183 E. coli cells which were then selected on LB-agar plates with 50 g/mL Ampicillin. PCR colony screens were performed to identify clones containing the transgene expression cassette and visualized by agarose gel electrophoresis (data not shown).

[0243] PmeI-digested HR clone DNAs were transfected into E1B-MDCK cells using LIPOFECTAMINE 2000 CD. rCAdV-2E3B/CMVie RabGP infectious clones were successfully rescued from transfected E1B-MDCK cells, as indicated by CAdV-2 IFAs as shown in FIG. 14, a CAdV-2 IFA of rCAV-2 RabGP P2 virus-infected EIB-MDCK cells using anti-CAdV-2 antibodies directly conjugated to fluorescein isothiocyanate (FITC) confirms rCAdV-2 rescue both by anti-RabG and CAdV-2 immunofluorescence (Panels B and C, 48 and 72 hours post infection).

[0244] As indicated by fluorescent (CAV-2+ and RabG+) cells in FIG. 14, Panels B and C, E1B-MDCK cells infected with rCAV-2 RabGP E2 and E3 viruses do express rabies G. However, the number of RabG+ cells appears substantially less than CAdV-2+ cells.

TABLE-US-00002 TABLE 2 Summary of BIVI-generated rCAdV-2 infectious clones. Protein Expression in infected Transgene Promoter PolyA Rescue cells Transfer Construct 1 None: E3A and B N/A N/A Yes NT SEQ ID NOs.: 1, 2 2 EGFP CMVie SV40 Yes Yes SEQ ID NO.: 7 3 CPV VP2 (n) CMVie SV40 Yes NT SEQ ID NO.: 10 4 CPV VP2 (n) CMV5 SV40 No NT N/A 5 CPV VP2 (co) CMVie BGH Yes Yes SEQ ID NO: 23 6 CPV VP2 (co) CMV5 SV40 No NT SEQ ID NO.: 7NA 7 BRSV F CMVie BGH Yes Yes SEQ ID NO: 27 8 EGFP in MCS1 CMVie SV40 Yes Yes N/A 11 Rabies G (n) CMVie BGH Yes Yes SEQ ID NO: 25 12 Rabies G (co) CMVie SV40 No NT Data not shown 13 Rabies G (co) CMV5 SV40 No NT N/A N/A = Not applicable. NT = Not tested. * = Expression seen with transfection only

[0245] As summarized in Table 2, many E3B-based infectious clones have been generated that did not facilitate the rescue of rCAdV-2 from transfected MDCK or E1B-MDCK cells. These include CPV VP2, and Rabies G containing transgene expression cassettes driven by the CMV5 promoter, clones containing the rabies glycoprotein G wherein the nucleotide sequence was codon optimized (76% identity to the SAD P5/88 strain, and clones containing the hMGFP (green) (Promega) and MCherry (red) (Clontech) fluorescent protein reporter constructs(data not shown).

[0246] This variability as compared between comparably sized inserts is not simply a reflection of codon optimization, as both native and codon optimized sequences facilitated the rescue of rCAdV-2 carrying BRSV F and CPV VP2 (see above, Table 2). Indeed, rCAdV-2 infectious clones carrying native hMGFP and MCherry ORFs also did not facilitate rCAdV-2 rescue (data not shown). Taken together, the data suggested that the use of CMV promoters in the context of the CAdV-2 vector platform is unpredictable and that the choice of promoter is a significant consideration in the construction of the expression cassette because it can significantly impact the rescue of rCAdV-2 clones.

Example 6

Expression Cassettes with EHV4 Promoters

[0247] Identification and Construction of New Equine Derived Promoters:

[0248] Novel heterologous equine promoters from the equine herpesvirus type 4 (EHV4) were identified and isolated. Two promoters were of interest; (1) the 600 bp EHV-4 gG promoter (4pgG600)(SEQ ID NO.:29) at ORF70 encoding glycoprotein G (gG); and (2) the 600 base pair EHV-4 MCP promoter (4pMCP600) (SEQ ID NO.:30) at ORF42 encoding the major capsid protein (MCP). The glycoprotein G gene (orf70) is active during early and late times in the replication cycle (Colle et al. 1995, Drummer et al. 1998). The major capsid protein is one of the most abundant constituents of the virion and needed for assembly of capsids in the cell nucleus as soon as newly synthesized viral DNA is ready for packaging. Its promoter is therefore expected to be active during early and late times in the viral replication cycle. Sensitive to the size limitation of the CAdV backbone, both EHV-4 promoter sequences were truncated to approximately 75% of their original lengths. In particular the 600 bp 4pgG600 promoter was truncated to 430 bp to generate the promoter fragment p430 (SEQ ID NO.:31), and the 600 bp 4pMCP600 promoter was truncated to 455 bp to generate the promoter fragment p455 (SEQ ID NO.:32).

[0249] The generation of virus like particles (VLPs) by rCAdV-2 vaccine virus infected cells can be a critical factor for canine adenovirus (CAdV-2) vaccine efficacy. While rCAdV-2 containing a CMVie-driven CPV VP2 expression cassette could be rescued, as detailed above, substantial VP2 expression (for VLP generation) in rCAdV-2 CMVie CPV VP2 infected cells could not be achieved using the conventional CMVie promoter. Additionally, rCAdV-2 VP2 virus containing the CMVS promoter could not be rescued. Therefore, it was of interest to use new promoters with the above identified characteristics capable of driving robust, stable, reproducible expression of antigens of interest.

[0250] Generation BamHI of CAdV-2 Transfer Plasmids Containing EHV-4 P CPV VP2 (co): Generation of KpnI/EHV-4 P DNA:

[0251] EHV-4 promoters fragments gG430 and MCP455 were gradient PCR-amplified from using the following oligonucleotide pairs:

TABLE-US-00003 gG430F: (SEQIDNO.:33) TTTAAAGGTACCTCTATTTGAGGACCCGCCGAGTACC; gG430R: (SEQIDNO.:34) AAATTTGGATCCAACTGCAGCTTATCACAGCTTTACAGGTGG MCP455F: (SEQIDNO.:35) TTTAAAGGTACCACTGGTGGTAGCATATACTACCTTTATTTATACGC; MCP455R: (SEQIDNO.:36) AAATTTGGATCCGATCCTATGGTAGCGGTAAAACACCG,,
respectively.

[0252] Expected sizes of amplified gG430 and MCP455 DNAs are 454 and 479 bp, respectively.

[0253] Previously prepared CAdV-2 transfer plasmids used for the successful integration at the E3B and rescue of rCAV-2 (as detailed above) were used as the basis of the EHV-4 promoter containing CPV VP2 transfer plasmid by a BamHI/KpnI-based exchange of the CMVie promoter with the EHV-4 promoters.

[0254] Two different codon-optimized CPV VP2 sequences, designated Despliced (SEQ ID NO.:37) and Gen0.95 (SEQ ID NO.:38) were used to prepare CAdV-2 transfer plasmids containing expression cassettes driven by the CMVie. Gen0.95 is a codon-optimized CPV VP2 sequence obtained from Genscript with a Codon Adaptation Index (CAI) 0.95. Analysis of Gen0.95 with a splice site finder algorithm (2013/2014 Human Splicing FinderDesigned by Ghadi Ra; Inserm UMR_S910Aix Marseille Universit, 27 Boulevard Jean Moulin, 13385 Marseille Cedex 05) suggested the presence of 43 potential Splice Donor sites. 89 nucleotide changes (5.07% sequence change versus Gen0.95) were made to eliminate 40 splice donor sites that did not alter the amino acid sequence or generate least-favorable codons based on the canine species.

[0255] Purified 3.5 Kb PmeI EHV-4 P CPV VP2 (co) transfer fragments, containing the two VP2 sequences above, and linearized rCAV-2 infectious clone DNA were co-transformed via electroporation into BJ5183 E. coli cells for homologous recombination. Intact clones were selected on LB-agar plates with 50 g/mL Ampicillin. Clones with the proper integration size and orientation were identified by PCR screen, selected, and expanded.

[0256] Successful Pmel-digestion of the pCAV-2 infectious clones yield DNA species of 33.5 (pCAV-2 genome) and 2.7 (pBR322 fragment) Kb. PmeI-digested infectious clones were transfected into E1B-MDCK and MDCK cells using LIPOFECTAMINE 3000. Passage 1 (P1) through passage 7 (P7) viruses, designated pCAV2E3B/pgG430-VP2 (Despliced) (SEQ ID NO.:39), pCAV2E3B/gG430-VP2 (Gen 0.95) (SEQ ID NO.:40) or pCAV2E3B/p455 -VP2 (Gen0.95) (SEQ ID NO.:41), were harvested from transfected cell supernatants/lysates subjected to three successive freeze-thaw cycles (70 C./37 C.), filter-sterilized, and then passed on E1B-MDCK cells.

[0257] AI-ST cells were infected with select rCAdV-2 for immunofluorescence assays (IFAs) for CAdV-2 and CPV VP2 protein expression. 72 h post-infection, cells were fixed with CYTOFIX/CYTOPERM Fixation/Permeabilization Kit (BD Biosciences, Cat. #554714), treated with the CYTOFIX fixation solution followed by two CYTOPERM permeabilization solution washes. Cells were then incubated with FITC-conjugated anti-CAdV-2 or anti-CPV VP2 antibodies (Anti-CAdV2 antibody (mAb): VMRD, Catalog #CJ-F-CAV-50X and Anti-CPV VP2 antibody: VMRD, Catalog #CJ-F-CPV 50X, respectively), washed 2 with CYTOPERM and analyzed by flow cytometry using a BD Biosciences FACSCANTO Flow Cytometry System.

[0258] CAdV-2 and CPV VP2 proteins are readily visualized by IFA and detected by FC in a substantial proportion of AI-ST 2015 cells infected with rCAdV-2 carrying two different nucleotide variants of CPV VP2 (Despl and Gen0.95, at 48 and 72 h post-infection). Substantial CPV VP2 protein was identified in tissue culture supernatants/lysates (after freeze/thaw) by Dot Blot (and very likely reflects the presence of assembled VLPs).

[0259] The results in FIG. 19 show that CAV-2 and CPV VP2 proteins are readily visualized by IFA of infected AI-ST cells (but not in cells infected with rCAdV-2 encoding the non-relevant BRSV transgene), indicating robust CPV VP2 expression from both Despliced and Gen0.95 CPV VP2 (co) sequence variants driven by both gG430 and MCP455 EHV-4 promoters (see FIG. 19A). CPV VP2 expression was detected in less than 3% of the cells infected with original rCAdV-2 CMVie CPV VP2 (see FIG. 15) indicating rCAdV-2 carrying CPV VP2 expression cassettes driven by the new EHV4 derived promoters p430 and p455 could be successfully rescued. Surprisingly, CPV VP2 expression driven by the gG430 and MCP455 EHV-4 promoters was detected in 14% to 36% of the infected cells (see FIG. 16), as compared to the CAdV vectors where CMV5 promoter sequences were utilized at the E3B location, in which case viral rescue was not successful.

[0260] Dot blot analysis was performed to analyze transgene expression in infected cells. Briefly, clarified (6000g, 5 min) tissue culture supernatants/lysates (freeze/thaw) from infected AI ST (for rEHV-1) and E1B MDCK (for rCAdV-2) cells were serially diluted with PBS before addition to apparatus and adsorbed to PVDF via aspiration. Subsequent steps are a 30 minute exposure to 5.0% BioRad Blotting Grade Blocker in TBST, 1.0 h exposure to 1 antibodies, three TBST washes, and a 1.0 h exposure to peroxidase-conjugated 2 antibodies (anti-mouse and anti-swine, Jackson ImmunoResearch) and visualization via TMB. For quantification, dot blots were analyzed using ImageJ software (Burger, W., Burge, M. J. (Eds.), 2008. Digital Image Processing: An algorithmic introduction using Java. Springer-Verlag, New York). Image colors are inverted to subtract background and integrated density of each dot recorded. Values are assigned + and designations as follows: ++++=>800000, +++=500000 to 800000, ++=300000 to 499999, +=120000 to 299999, +/=80000 to 119999 and =<80000.

[0261] As seen in FIG. 17, strong CPV VP2 protein signal was observed in tissue culture supernatants/lysates from cells infected by rCAdV-2 encoding EHV-4 promoters-driven expression cassettes for CPV VP2, while signal was not detected in samples from cells infected with rCAdV-2 encoding a non-relevant expression cassette. These results show that substantial CPV VP2 protein was identified in tissue culture supernatants. These results very likely reflect the presence of assembled CPV VP2 VLPs. This is in contrast to the original rCAdV-2 CMVie CPV VP2 where dot blot analysis showed CMVie-driven CPV VP2 signal was at or below background levelsand at comparable with supernatants/lysates from the negative controls (CAdV-2, rCAdV-2 CMVie BRSV F-infected cells and cell culture supernatant/lysates from uninfected cells).

[0262] As shown in FIG. 17, the VP2 protein can be recognized in the supernatant and, therefore, is expected to be in the conformation required to be immunogenic. Importantly, as discussed above the rescue of recombinant CAdV-2 was not achieved in clones where the transgene was driven by CMV5 promoter sequences. Thus, the new EHV-4 derived promoter sequences of the present invention such as p430 and p455 not only facilitate transgene expression, but also support the crucial step of viral rescue.

[0263] Generation of CAdV-2 Transfer Plasmids Containing EHV-4 promoters CPV RabG (n):

[0264] A second CAdV-2 construct was generated using the new EHV-4 derived p455 promoter of the present invention. The rCAdV-2 RabG(n) was chosen because expression by infected cells was not observed using the conventional CMVie promoter.

[0265] The objective of this experiment was to confirm the activity of the new EHV-4 promoter in the context of rCAdV-2 with a second transgene, RabG (a membrane protein) by the measurement of EHV-4 promoter-driven RabG protein expression by rCAdV-2 p455 RabG (n)-infected AI-ST 2015 cells.

[0266] The RabG(n) sequence was isolated from rescued rCAV-2 CMVie RabG (n) (SEQ ID NO.:25) as discussed above. A 1596 bp RabG (n) sequence including a Kozak sequence immediately 5 to the ATG START codon was excised with BamHI and SalI (5 and 3, respectively) restriction endonucleases, and ligated into BamHI/SalI cut rCAdV transfer fragments with the gG430 promoter and MCP455 promoters which were then transformed into TOP10 E. coli.

[0267] Purified 3.3 Kb Pmel EHV-4 P RabG (n) transfer fragments and linearized rCAV-2 infectious clone DNA were co-transformed via electroporation into BJ5183 E. coli cells for homologous recombination. Intact clones were selected on LB-agar plates with 50 g/mL carbenicillin. PCR colony screens were performed to identify EHV-4 pG430/RabG (n) (SEQ ID NO.:42) and EHV-4 p455/RabG (n) (SEQ ID NO.:43) clones. Clones were screened with primers specific for RabG DNA and visualized via agarose gel electrophoresis. Expected DNAs are 1501 bp.

[0268] PmeI-digested infectious clones were transfected into E1B-MDCK and MDCK cells using LIPOFECTAMINE 3000. Passage 1-7 (P1-P7) viruses, designated pCAV2EB3/gG430 or MCP455 RabG (n), were harvested from transfected cell supernatants/lysates subjected to three successive freeze-thaw cycles (70 C./37 C.), filter-sterilized, and then passed on E1B-MDCK cells.

[0269] IFA and flow cytometry were employed to assess EHV-4 promoter-driven expression of RabG in rCAdV-2-infected AI-ST 2015 cells. CAdV-2 protein expression was probed with anti-CAdV-2 FITC-conjugated porcine polyclonal antibodies (VMRD). RabG protein expression was probed with mouse monoclonal antibodies (Novus). CAdV-2 and RabG proteins are readily visualized by IFA and detected by FC in AI-ST 2015 cells infected with rCAdV-2 carrying RabG (n) (at 72 h post-infection).

[0270] The results in FIG. 18 indicate that CAV-2 and RabG proteins are readily detected in AI-ST 2015 cells infected by select rCAdV-2 and rEHV-1 by flow cytometric analysis. These results demonstrate substantial expression of RabG driven by the MCP455 EHV-4 promoter. In contrast, while RabG is readily detected in cells infected with rCAdV-2 p455 RabG (see FIGS. 19B and C), expression is detected in <2.0% of cells infected with original rCAdV-2 CMVie RabG (see FIG. 18).

[0271] In conclusion, the gG430 and MCP455 RabG (n) SV40 polyA transgene expression cassettes were successfully cloned into the E3B domain of CAdV-2. Recombinant virus was rescued from transfected E1B-MDCK cells as indicated by CPE in virus infected cells. MCP455 promoter-driven expression of RabG transgene by rCAdV-2 in infected AI-ST 2015 and BIVI 2011 MDCK cells was confirmed by IFA and Flow Cytometry.

Example 7

Preparation of Pharmaceutical Compositions (Vaccines) Comprising rCAdV-CMV/CPV VP2

[0272] Canine parvovirus (CPV) is a highly contagious virus that can cause high morbidity and mortality depending on virulence, host, and environmental factors. The use of an effective vaccine program for dogs utilizing MLV and killed virus vaccines over the last 30 years has greatly decreased the mortality rate. CPV is a non-enveloped single-stranded DNA virus with two structural proteins (VP1 and VP2) forming the capsid. VP2 is known to be involved with virus pathogenicity and host immune response, and is therefore our target of choice for incorporation and expression in the recombinant CAdV2 system.

[0273] The objective of this study was to perform a preliminary evaluation of efficacy of an experimental rCAV2-CPV VP2 vaccine as compared to a MLV combination vaccine. The MLV combination contained canine adenovirus type 2 (CAV2), canine distemper virus (CDV), and canine parvovirus (CPV) blended at a level between the established minimum immunizing dose and the release dose of each fraction as established in current products for each particular antigen.

[0274] In this study, rCAV2-CPV VP2 was administered in a two-dose regimen, three weeks apart, to 6-7 week old puppies, in order to determine if the CAdV-CPV VP2 vector vaccine provided protection against CPV challenge. Currently, as MLV vaccines are the gold standard for protection against CPV and ICH, the test group was compared to a group of 6-7 week old puppies administered a two-dose regimen, three weeks apart, of a MLV vaccine combo containing CPV, CDV, and CAdV2. This group was considered the positive control group. A third group was administered a two-dose regimen, 3 weeks apart, of PBS as the challenge controls. Dogs were challenged with CPV-2b approximately three weeks post-second vaccination in order to evaluate efficacy.

[0275] Test vaccines were administered to twelve (12) healthy, CAV2- and CPV-sero-negative canines 6 weeks 2 days to 7 weeks 2 days of age, as a 1 ml subcutaneous dose, given in a 2-dose regimen, 3 weeks apart. The twelve (12) animals were split into 2 test groups as follows: Group 1rCAV2-CPV VP2 @ 8.0 logs/ml; Group 2MLV Combination (CAV2, CDV, CPV).

[0276] Phosphate Buffered Saline (PBS) was administered to a group of six (6) healthy, CAV2- and CPV-sero-negative canines 6 weeks 2 days to 7 weeks 2 days of age, as a 1 ml subcutaneous dose, given in a 2-dose regimen, 3 weeks apart. This group was deemed as Group 3, and served as challenge controls for the study. All animals in Groups 1-3 were challenged oro-nasally with virulent CPV-2b on 22 DPV2. Clinical case data post-challenge (clinical signs, pyrexia, lymphopenia, leukopenia and detection of CPV in feces) was analyzed.

[0277] Vaccine Formulation:

[0278] rCAV2-CPV VP2 tissue culture stock was diluted with 0.01M PBS to the target dose noted below. No adjuvants were used. The MLV positive control was formulated and lyophilized with a SGGK stabilizer where each of the antigens in the combo was higher than the minimum immunizing dose for the SOLOJEC product line. Targeted dosages for the vaccines were as follows:

TABLE-US-00004 TABLE 3 Targeted Dosage Group Vaccine (Log.sub.10FAID.sub.50/ml) 1 rCAdV2-CPV VP2 ~8.0 2 MLV (CAV2, CDV, CPV) CAdV2 - ~3.8-5.0 CDV - ~1.6-3.0 CPV - ~3.6-4.8 3 PBS or MEM NA

[0279] Challenge Material:

[0280] On the day of challenge, three vials of the frozen CPV-2b challenge material, were quick-thawed by manually agitating the vial(s) in a 362 C. water bath. The material was then diluted 1:10 in cell culture medium to the desired concentration. The challenge inoculum remained on ice at all times during the preparation and challenge procedures.

[0281] Vaccine Antigen Titration: CAV2-CPV VP2

[0282] Briefly, ten-fold serial dilutions of the vaccine were made. Each dilution was added to each of 5 wells at 100 microliters per well in 96 well plates planted with Madin-Darby Canine Kidney (MDCK) cells at 2.0105 cells/ml. Five replicates were performed for each vaccine. The plates were incubated at 361 C. and 50.5% CO2 for 41 days. After the incubation period, the plates were fixed, stained for the vector only and read. Titers were calculated for the 50% endpoint using the Reed and Muench method.

[0283] Positive Control (CPV-CDV-CAdV2)

[0284] Briefly, ten-fold serial dilutions of the vaccine were made. Each dilution was added to each of 5 wells at 100 microliters per well in 96 well plates planted with the appropriate concentration of cells (CPV-MDCK at 2105 cells/ml, CDV-VERO at 2105 cells/ml, CAV2-MDCK at 2105 cells/ml). Five replicates were performed for each antigen fraction. The plates were incubated at 361 C. and 50.5% CO2 for 3-6 days. After the incubation period, the plates were fixed, stained with a direct FA conjugate, and read. Titers were calculated for the 50% endpoint using the Reed and Muench method.

[0285] Sera

[0286] Up to 10 mL of whole blood from each dog was collected weekly for serum starting on 0 DPV1. Specific time points included the following: 0 DPV1, 7 DPV1, 14 DPV1, 21 DPV1/0 DPV2, 7 DPV2, and 14 DPV2. Blood was allowed to clot, centrifuged at 1,000-1,300g to separate the sera and dispensed into at least 2 aliquots. Sera were stored at 20 C. or colder until evaluated for antibody titer.

[0287] Serological analysis was performed using a serum neutralization (SN) assay. The SN assay was used to measure serum antibody titers to CAV2, CPV-2b, and CPV-2c.

[0288] Briefly, for CAdV2 serology, serial dilutions of heat-inactivated sera were mixed with equal volumes of a viral suspension (50 to 300 FAID50). The serum-virus mixture was incubated at 361 C. for one hour. The 96-well microtiter plates were then seeded with MDCK cells (2105 cells/ml at 0.1 ml/well). Plates were incubated at 361 C. in a humidified 5+0.5% CO2 incubator for 51 days. Plates were fixed with cold acetone for 155 minutes and virus was detected by specific immunofluorescence. Failure to detect the virus by immunofluorescence indicated the presence of SN antibodies. For determination of SN antibody titers, 50% neutralization endpoints were calculated using the Reed and Muench method.

TABLE-US-00005 TABLE 4 CAV2 SN GMT Values D0 D21 D43 Group (0 DPV1) D7 D14 (0 DPV2) D28 D35 (0 DPC) D50 D57 rCAV2-CPV 1 703 967 645 3160 3069 2170 1448 1184 VP2 MLV 1 7 575 196 384 418 308 228 215 Challenge 1 1 1 1 1 1 1 1 1 Controls

[0289] Briefly, for CPV-2b serology, serial dilutions of heat-inactivated sera were mixed with equal volumes of a viral suspension (50 to 300 FAID50). The serum-virus mixture was incubated at 361 C. for one hour. Dog Kidney (DKFD-00) cells (2.5105 cells/ml at 0.1 ml/well). were then added to all wells of the 96-well microtiter plate. Plates were incubated at 361 C. in a humidified 50.5% CO2 incubator for 61 days. Plates were fixed with cold acetone for 155 minutes and virus was detected by specific immunofluorescence. Failure to detect the virus by immunofluorescence indicated the presence of SN antibodies. For determination of SN antibody titers, 50% neutralization endpoints were calculated using the Reed and Muench method.

TABLE-US-00006 TABLE 5 CPV-2b SN GMT Values D0 D21 D43 Group (0 DPV1) D7 D14 (0 DPV2) D28 D35 (0 DPC) D50 D57 rCAV2-CPV 1 1 1 6 724 484 558 484 14596 VP2 MLV 1 34 1085 2170 6137 6502 10935 10321 10321 Challenge 1 1 1 1 1 1 1 1007 8192 Controls

[0290] Briefly, for CPV-2c serology, serial dilutions of heat-inactivated sera were mixed with equal volumes of a viral suspension (50 to 300 FAID50). The serum-virus mixture was incubated at 361 C. for one hour. The 96-well microtiter plates were then seeded with MDCK cells (7104 cells/ml at 0.1 ml/well). Plates were incubated at 361 C. in a humidified 5+0.5% CO2 incubator for 51 days. Plates were fixed with cold acetone for 155 minutes and virus was detected by specific immunofluorescence. Failure to detect the virus by immunofluorescence indicated the presence of SN antibodies. For determination of SN antibody titers, 50% neutralization endpoints were calculated using the Reed and Muench method.

TABLE-US-00007 TABLE 6 CPV-2c SN GMT Values D0 D21 D43 Group (0 DPV1) D7 D14 (0 DPV2) D28 D35 (0 DPC) D50 D57 rCAV2-CPV 1 1 2 9 911 684 383 342 10935 VP2 MLV 1 14 418 1772 6502 8192 6137 9742 7298 Challenge 1 1 1 1 1 1 1 103 724 Controls

[0291] A distinct antibody response was noted in relation to the 3 groups when compared to each other for CAdV2, CPV-2b and CPV-2c antibodies.

[0292] The CAdV2-CPV VP2 group exhibited a much stronger CAdV2 antibody response at 7 DPV1 as compared to the MLV group, however, by 14 DPV1 the GMT values of the groups were similar. The antibody titers for both groups were waning by 21 DPV1 at which point the animals were boostered. After the booster, both groups' antibody levels spiked and then gradually leveled off, with the CAdV2-CPV VP2 group leveling off at a higher titer than the MLV group. The negative control group remained negative for CAdV2 antibodies throughout the course of the study.

[0293] In contrast to the CAdV2 antibody response of the 2 vaccinate groups, the CPV antibody response of the CAdV2-CPV VP2 group was minimal up to second vaccination, at which point the CPV antibody titer spiked at 7 DPV2 and then leveled off until challenged with CPV. After challenge the CAdV2-CPV VP2 groups antibody response again spiked. The MLV vaccine responded well to the first vaccination, with an additional response to the second vaccination. The CPV antibody levels in the MLV group leveled off after the second vaccination and did not show a significant increase during the challenge phase of the study. The negative control animals remained negative for CPV antibodies throughout the vaccination phase until the first bleed after the time of challenge at which point they exhibited significant CPV antibody titer.

[0294] Clinical Observations:

[0295] All animals were observed and rectal temperatures were taken daily for baseline to the nearest tenth of a degree (Fahrenheit) on 2, 1 and 0 DPC. After challenge, the animals were monitored daily for up to 14 days where rectal temperature and observations of clinical signs were taken. Animal cages were not cleaned until observations had been completed for the day.

[0296] Clinical signs of CPV included, but were not limited to the following: (1) Bloody StoolA specific stool containing at least 10% blood, usually associated with diarrhea and/or mucus; stool is typically a dark red color and has a distinctive strong iron smell; (2) Mucoid StoolA specific stool containing at least 10% mucus may be associated with diarrhea, and may or may not contain blood. A mucoid stool may or may not have texture and/or form; (3) DiarrheaWatery, no texture, flat puddles; (4) Fever was indicated if the rectal temperature was 103.4 F. and at least 1 degree Fahrenheit above the baseline temperature. Hypothermia was indicated if the temperature was 99.5 F. or lower and at least one degree Fahrenheit below baseline temperature.

[0297] All dogs were weighed to the nearest tenth of a kilogram (kg) on 0, 7 and 14 DPC for determination of weight loss/gain post-challenge. All weights were collected on the Body Weight Record.

[0298] For clinical signs, a single occurrence of any clinical sign typical of CPV infection including, diarrhea, mucus in stool, or blood in stool following challenge defined an animal as positive for clinical signs. Inappetence, depression/lethargy, and the presence of vomit were also noted for use as supportive criteria for assessing an animal as positive for parvovirus infection.

[0299] Four (4) of the 18 animals in this study exhibited diarrhea or vomit on 2 DPC. These clinicals are outside the typical CPV onset range of 3-4 DPC and may be due to fasting and/or the anesthesia procedure used during the challenge. They are not considered signs of CPV infection.

[0300] The rCAdV2-CPV VP2 group (Group 1) showed no signs of infection until 10 DPC where 1 of 6 animals exhibited bloody, mucous stool for 1 day. It should be noted that 1 animal in the group did show signs of vomit at 2 DPC, which is outside the range of CPV onset as stated previously, and is therefore not considered a sign of infection.

[0301] In the MLV group (Group 2) 2 of 6 animals exhibited clinical signs on 5 and 7 DPC, where dog #12 was noted with a mucous stool on 7 DPC and dog #13 had diarrhea on 5 and 7 DPC. It should also be noted that 3 animals in this group showed signs of vomit or diarrhea on 2 DPC, which is outside the range of CPV onset as stated previously, and are therefore not considered signs of infection.

[0302] All dogs in the negative control group (Group 3) exhibited a range of moderate to severe clinical signs (diarrhea, mucoid stool, dehydration, vomit, inappetence, bloody stool) starting at 4 DPC and concluding on 11 DPC with 4 animals succumbing to CPV (3 on 7 DPC and 1 on 8 DPC).

[0303] Pyrexia: For pyrexia, a single occurrence of pyrexia (rectal temperature 103.4 F. and at least 1 degree above pre-challenge baseline) following challenge, categorized an animal as positive.

[0304] The rCAdV2-CPV VP2 test group (Group 1) exhibited 1 instance of pyrexia in 3 of 6 animals; 1 on 9 DPC and 2 on 12 DPC. None of the 6 animals in the MLV group (Group 2) exhibited pyrexia. In the negative control group (Group 3) 3 of the 6 animals showed at least 1 instance of pyrexia (1 animal showed 2 instances) ranging from 4 to 5 DPC. Two of the 6 animals exhibited hypothermia on 7 DPC.

[0305] Weight: To determine weight loss/gain, on a weekly basis, the weight for each individual animal was assessed by subtracting the weight from the previous week.

[0306] No animals in the rCAdV2-CPV VP2 test group (Group 1) nor the MLV test group (Group 2) exhibited weight loss at 7 or 14 DPC. All animals in the negative control group (Group 3) did exhibit weight loss at 7 DPC ranging from 0.1 to 0.8 kilograms. The animals remaining on test in Group 3 at 14 DPC experienced weight gain from 7 DPC.

[0307] Lymphopenia: For lymphopenia, a single occurrence of lymphopenia (50% loss of pre-challenge baseline) following challenge categorized a canine as positive. In this study the rCAdV2-CPV VP2 test group (Group 1) included 3 of 6 animals with at least 1 instance of lymphopenia with an onset ranging from 9-12 DPC. The MLV group (Group 2) did not exhibit signs of lymphopenia. All animals in the negative control group (Group 3) had at least 1 instance of lymphopenia with onset at 4 DPC.

[0308] Leukopenia: For leukopenia, a single occurrence of leukopenia (50% loss of pre-challenge baseline) following challenge categorized a canine as positive. In this study the rCAdV2-CPV VP2 test group (Group 1) and the MLV group (Group 2) did not exhibit signs of leukopenia. The negative control group (Group 3) included 5 of 6 animals which had at least 1 instance of leukopenia with onset at 6 DPC.

[0309] Virus Isolation from Fecal Samples: For CPV fecal virus isolation, a single occurrence of detection of CPV virus in feces following challenge categorized a canine as positive. A CPV fecal virus titer of 1.5 Log10FAID50/ml was recorded as negative for CPV fecal virus isolation. All other recorded titers >1.5 Log10FAID50/ml were categorized as positive for CPV fecal virus detection.

[0310] In this study, the rCAdV2-CPV VP2 (Group 1), group included 4 of 6 animals that exhibited at least 1 day of virus shedding initiating between 8 and 14 DPC. The MLV group (Group 2) did not shed detectable amounts of live virus. All animals in the negative control group shed detectable amounts of virus in the feces initiating on 3 or 4 DPC and lasting through 9 DPC.

[0311] Summary of Results:

[0312] In summary, canines, 6 weeks 2 days to 7 weeks 2 days of age, were vaccinated with 1.0 ml of the following vaccines on 0 DPV1 and 21 DPV1: (Group 1) rCAdV2-CPV VP2=8.0 logs/ml; (Group 2) MLV ComboCAdV2/CDV/CPV=4.7/2.6/3.9 logs/ml; (Group 3). PBS Control. All vaccinated canines were challenged with virulent CPV-2b, oro-nasally on 22 DPV2.

[0313] The rCAdV2-CPV VP2 test vaccine did not meet efficacy criteria when given in a 2-dose regimen at 8.0 logs per dose. Three (3) dogs exhibited fever, shedding of CPV in feces and lymphopenia and 1 dog exhibited definitive clinical signs of canine parvovirus. A fourth dog exhibited only shedding of CPV. The vaccine appeared to provide initial protection until approximately 10 DPC, which is a delayed onset of clinical signs of infection as compared to the negative controls. One vaccinate was reported with a complete clouding of the cornea with no known cause.

Example 8

Preparation of Pharmaceutical Compositions (Vaccines) Comprising rCAdV-EHV-4 p430/RabG (N)

[0314] Preparation of Pharmaceutical Compositions (Vaccines) Comprising rCAdV-EHV-4p430/RabG (N)Vaccine:

[0315] Vaccine Formulation:

[0316] rCAdV-EHV-4 pp430/RabG (N)tissue culture stock was diluted with 0.01M PBS to the target dose. No adjuvants were used.

[0317] Inoculation of Pigs with rCAdV-EHV-4 P430/RabG (N) and Assessment of the Serological Response:

[0318] Study Design: Vaccinated piglets and control groups ages 4-8 weeks of age, dosing (single/two dose) was 2 ml/dose intramuscularly.

[0319] To investigate its properties as a vectored vaccine in young piglets, rCAdV-EHV-4 P(GG430) RABG (N) C1 was tested in a vaccination-serology study.

[0320] In detail, piglets were vaccinated twice with rCAdV-EHV-4 p430/RabG (N) C1 at a dose of 6.7 logs at study day 0 and 21 (two-shot vaccination, 2 rCAdV). A non-vaccinated group served as negative control.

[0321] Serology: Assays to Measure Seroconversion After Vaccination

[0322] The induction of CAdV-2 neutralizing antibodies after vaccination was tested in sera from animals vaccinated once or twice with the rCAdV-2 p430 RabG vaccine. Vaccinated animals showed detectable virus neutralization (VN) titers to the CAdV2, while sera from the non-vaccinated groups had no detectable CAdV-2 neutralizing antibody levels (Table 2.). Rapid fluorescent foci inhibition tests (RFFIT) performed on sera by the Rabies Laboratory at Kansas State University showed detectable RFFIT titers in 3 of 12 vaccinated animals and no detectable RFFIT titers in control groups) measuring rabies neutralizing antibodies. Whole rabies antibody testing by ELISA as well as CAdV viral shedding was also tested.

[0323] These results confirm the utility of the EHV-4 promoters of the present invention in the CAdV vector by demonstrating effective expression of the transgene of interest (by expression evaluation of what proportion of the vaccine virus leads to expression of transgene of interest in infected cells), as well as viral rescue, and immunogenicity of the transgene in vaccinated animals. Expression evaluation was not even possible with CAdV vectors with expression cassettes driven by the CMV promoters. All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the following claims.

REFERENCES

[0324] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0325] 1. Buonavoglia, C. and V. Martella, Canine respiratory viruses. Vet Res, 2007. 38(2): p. 355-73. [0326] 2. Tham, K. M., G. W. Horner, and R. Hunter, Isolation and identification of canine adenovirus type-2 from the upper respiratory tract of a dog. N Z Vet J, 1998. 46(3): p. 102-5. [0327] 3. Hamelin, C., P. Jouvenne, and R. Assaf, Association of a type-2 canine adenovirus with an outbreak of diarrhoeal disease among a large dog congregation. J Diarrhoeal Dis Res, 1985. 3(2): p. 84-7. [0328] 4. Macartney, L., H. M. Cavanagh, and N. Spibey, Isolation of canine adenovirus-2 from the faeces of dogs with enteric disease and its unambiguous typing by restriction endonuclease mapping. Res Vet Sci, 1988. 44(1): p. 9-14. [0329] 5. Benetka, V., et al., Canine adenovirus type 2 infection in four puppies with neurological signs. Vet Rec, 2006. 158(3): p. 91-4. [0330] 6. Appel, M., et al., Pathogenicity of low-virulence strains of two canine adenovirus types. Am J Vet Res, 1973. 34(4): p. 543-50. [0331] 7. Appel, M., L. E. Carmichael, and D. S. Robson, Canine adenovirus type 2-induced immunity to two canine adenoviruses in pups with maternal antibody. Am J Vet Res, 1975. 36(08): p. 1199-202. [0332] 8. Bittle, J. L., W. A. Grant, and F. W. Scott, Canine and feline immunization guidelines1982. J Am Vet Med Assoc, 1982. 181(4): p. 332-5. [0333] 9. Curtis, R. and K. C. Barnett, The blue eye phenomenon. Vet Rec, 1983. 112(15): p. 347-53 [0334] 10. Bru, T., S. Salinas, and E. J. Kremer, An update on canine adenovirus type 2 and its vectors. Viruses, 2010. 2(9): p. 2134-53. [0335] 11. Hu, R. L., et al., Experimental immunization of cats with a recombinant rabies-canine adenovirus vaccine elicits a long-lasting neutralizing antibody response against rabies. Vaccine, 2007. 25(29): p. 5301-7. [0336] 12. Hu, R., et al., Prevention of rabies virus infection in dogs by a recombinant canine adenovirus type-2 encoding the rabies virus glycoprotein. Microbes Infect, 2006. 8(4): p. 1090-7. [0337] 13. Li, J., et al., A single immunization with a recombinant canine adenovirus expressing the rabies virus G protein confers protective immunity against rabies in mice. Virology, 2006. 356(1-2): p. 147-54. [0338] 14. Henderson, H., et al., Oral immunization of raccoons and skunks with a canine adenovirus recombinant rabies vaccine. Vaccine, 2009. 27(51): p. 7194-7. [0339] 15. Bouet-Cararo, C., et al., Canine adenoviruses elicit both humoral and cell-mediated immune responses against rabies following immunisation of sheep. Vaccine, 2011. 29(6): p. 1304-10. [0340] 16. Liu, Y., et al., Efficacy and safety of a live canine adenovirus-vectored rabies virus vaccine in swine. Vaccine, 2008. 26(42): p. 5368-72. [0341] 17. Fischer, L., et al., Vaccination of puppies born to immune dams with a canine adenovirus-based vaccine protects against a canine distemper virus challenge. Vaccine, 2002. 20(29-30): p. 3485-97. [0342] 18. Yang, S., et al., Complete protection of cats against feline panleukopenia virus challenge by a recombinant canine adenovirus type 2 expressing VP2 from FPV. Vaccine, 2008. 26(11): p. 1482-7. [0343] 19. Zhang, S., et al., Oral vaccination of dogs (Canis familiaris) with baits containing the recombinant rabies-canine adenovirus type-2 vaccine confers long-lasting immunity against rabies. Vaccine, 2008. 26(3): p. 345-50. [0344] 20. Gallichan, W. S., et al., Mucosal immunization with a recombinant adenovirus vector induces local and systemic immunity and protection from herpes simplex virus. Adv Exp Med Biol, 1995. 371B: p. 1581-5. [0345] 21. Lubeck, M. D., et al., Immunogenicity of recombinant adenovirus-human immunodeficiency virus vaccines in chimpanzees following intranasal administration. AIDS Res Hum Retroviruses, 1994. 10(11): p. 1443-9. [0346] 22. Wang, Y., et al., The use of an E1-deleted, replication-defective adenovirus recombinant expressing the rabies virus glycoprotein for early vaccination of mice against rabies virus. J Virol, 1997. 71(5): p. 3677-83. [0347] 23. Papp, Z., L. A. Babiuk, and M. E. Baca-Estrada, The effect of pre-existing adenovirus-specific immunity on immune responses induced by recombinant adenovirus expressing glycoprotein D of bovine herpesvirus type 1. Vaccine, 1999. 17(7-8): p. 933-43. [0348] 24. Babiuk, L. A. and S. K. Tikoo, Adenoviruses as vectors for delivering vaccines to mucosal surfaces. J Biotechnol, 2000. 83(1-2): p. 105-13. [0349] 25. Wright, N., et al., High prevalence of antibodies against canine adenovirus (CAV) type 2 in domestic dog populations in South Africa precludes the use of CAV-based recombinant rabies vaccines. Vaccine, 2013. 31(38): p. 4177-82. [0350] 26. Kremer, E. J., et al., Canine adenovirus vectors: an alternative for adenovirus-mediated gene transfer. J Virol, 2000. 74(1): p. 505-12. [0351] 27. Linne, T., Differences in the E3 regions of the canine adenovirus type 1 and type 2. Virus Res, 1992. 23(1-2): p. 119-33. [0352] 28. Chartier, C., et al., Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J Virol, 1996. 70(7): p. 4805-10. [0353] 29. Lopez de Turiso, J. A., et al., Recombinant vaccine for canine parvovirus in dogs. J Virol, 1992. 66(5): p. 2748-53. [0354] 30. Langeveld, J. P., et al., First peptide vaccine providing protection against viral infection in the target animal: studies of canine parvovirus in dogs. J Virol, 1994. 68(7): p. 4506-13. [0355] 31. Boshart M, Weber F, Jahn G, Dorsch-Hasler K, Fleckenstein B, Schaffner W. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41(2):521-30. [0356] 32. Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A., and Alcami, A. 2003. Glycoprotein G isoforms from some alphaherpesviruses function as broad-spectrum chemokine binding proteins. The EMBO Journal Vol. 22 (4): 833-846. [0357] 33. Bustin, S. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology 25(2): 169-193. [0358] 34. Charoensawan, V., Wilson, D., Teichmann, S. A. 2010. Genomic repertoires of DNA-binding transcription factors across the tree of life. Nucleic Acids Res. 38(21):7364-77 [0359] 35. Colle, C. F. 3rd, O'Callaghan, D. J. 1995. Transcriptional analyses of the unique short segment of EHV-1 strain Kentucky A. Virus Genes; 9(3):257-68. [0360] 36. Donnelly, M. L., Luke, G., Mehrotra, A., Li, X., Hughes, L. E., Gani, D., and Ryan, M. D. 2001. Analysis of the aphthovirus 2A/2B polyprotein cleavage mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal skip. J Gen Virol. 82(Pt 5):1013-25 [0361] 37. Dorsch-Hasler, K., Keil, G. M., Weber, F., Jasin, M. Schaffner, W., and Koszinowski, U. H. 1985. A long and complex enhancer activates transcription of the gene coding for the highly abundant immediate early mRNA in murine cytomegalovirus. PNAS Vol. 82: 8325-8329. [0362] 38. Drummer, H. E., Studdert, M. J., Crabb, B. S. 1998. Equine herpesvirus-4 glycoprotein G is secreted as a disulphide-linked homodimer and is present as two homodimeric species in the virion. J. Gen. Virol. 79: 1205-1213 [0363] 39. Fields, B, Knipe, D. M.; and Howley, P. M. 2013. Virology. 6.sup.th ed. Philadelphia; Wolters Kluwer Health/Lippincott Williams&Wilkins [0364] 40. Foecking, M. K., Hofstetter, H. 1986. Powerful and versatile enhancer-promoter unit for mammalian expression vectors. Gene 45(1):101-5. [0365] 41. Goodwin, E. C. & Rottman, F. M. 1992. The 3flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J. Biol. Chem. 267: 16330-16334. [0366] 42. Jang, S. K., Pestova, T. V., Hellen, C. U., Witherell, G. W., Wimmer, E. 1990. Cap-independent translation of picornavirus RNAs: structure and function of the internal ribosomal entry site. Enzyme.; 44(1-4):292-309. [0367] 43. Kim, D. W., Uetsuki, T., Kaziro, Y., Yamaguchi, N., Sugano, S. 1990. Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene 16; 91(2):217-23. [0368] 44. Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A. et al. 2001. A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73: 56-65. [0369] 45. Luke, G A and Ryan, M D. 2013. The protein coexpression problem in biotechnology and biomedicine: virus 2A and 2A-like sequences provide a solution.Future Virology, Vol. 8, No. 10, Pages 983-996. [0370] 46. Ma, G., Eschbaumer, M., Said, A., Hoffmann, B., Beer, M., Osterrieder, N. 2012. An equine herpesvirus type 1 (EHV-1) expressing VP2 and VP5 of serotype 8 bluetongue virus (BTV-8) induces protection in a murine infection model. PLoS One. 2012; 7(4):e34425. doi: 10.1371/journal.pone.0034425. Epub 2012 Apr 12. [0371] 47. Ma, G., Azab, W., Osterrieder, N. 2013. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol. 167(1-2):123-34. [0372] 48. Nolan, T. Rebecca E Hands, R. E., and Bustin S. A. Journal name: 2006. Quantification of mRNA using real-time RT-PCR Nature Protocols 1: 1559-1582 [0373] 49. Osterrieder, N., Neubauer, A., Brandmller,C., Kaaden, O. R., and O'Callaghan, D. J. 1996. The equine herpesvirus 1 IR6 protein influences virus growth at elevated temperature and is a major determinant of virulence. Virology 226:243-251. [0374] 50. Proudfoot, N. J. 2011. Ending the message: poly(A) signals then and now. Genes&Development 25:1770-1782. [0375] 51. Ptashne, M. 2014. The Chemistry of Regulation of Genes and Other Things The Journal of Biological Chemistry Vol. 289, (9) 5417-5435. Reed, L. J., and Muench, H. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. (27) 3; 493-497. [0376] 52. Rosas, C. T., Konig, P., Beer, M., Dubovi, E. J., Tischer, B. K., Osterrieder, N., 2007a. Evaluation of the vaccine potential of an equine herpesvirus type 1 vector expressing bovine viral diarrhea virus structural proteins. J. Gen. Virol. 88 (3), 748-757. [0377] 53. Rosas, C. T., B. K. Tischer, G. A. Perkins, B. Wagner, L. B. Goodman, N. Osterrieder. 2007b. Live-attenuated recombinant equine herpesvirus type 1 (EHV-1) induces a neutralizing antibody response against West Nile virus (WNV) Virus Research, 125, pp. 69-78. [0378] 54. Rosas, C. T., Van de Walle, G. R., Metzger, S. M., Loelzer, K., Dubovi, E. J., Kim, S. G., Parrish, C. R., Osterrieder, N., 2008. Evaluation of a vectored equine herpesvirus type 1 (EHV-1) vaccine expressing H3 haemagglutinin in the protection of dogs against canine influenza. Vaccine 26 (19), 2335-3234. [0379] 55. Ryan, M. D., and Drew J. 1994. Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. EMBO J February 15; 13(4):928-33. [0380] 56. Said, A., Elke Lange, E., Beer, M. Damiani, A., Osterrieder, N. 2013. Recombinant equine herpesvirus 1 (EHV-1) vaccine protects pigs against challenge with influenza A(H1N1)pmd09 Virus Research 173: 371-376 [0381] 57. Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N., Palmer, A. E., Tsien, R, Y. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. December; 22(12):1567-72. Epub 2004 Nov. 21. [0382] 58. Tischer, B. K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechnol. Tech. 40, 191-197. [0383] 59. Tischer, B. K., Kaufer, B. B., Sommer, M., Wussow, F., Arvin, A., and Osterrieder, N. A Self-Excisable Infectious Bacterial Artificial Chromosome Clone of Varicella-Zoster Virus Allows Analysis of the Essential Tegument Protein Encoded by ORF9. J. Virol. 81 (23), 2007, 13200-13208. [0384] 60. Tischer, B. K, Smith, G. A., and Osterrieder, N. in: Jeff Braman (ed.), In vitro Mutagenesis Protocols: Third Edition, Methods in Molecular Biology, vol. 634, DOI 10.1007/978-1-60761-652-8_30, Springer Science+Business Media, LLC 2010, Chapter 30: En Passant Mutagenesis: A Two Step Markerless Red Recombination System. [0385] 61. Thompson, S. R. 2012. Tricks an IRES uses to enslave ribosomes. Trends Microbiol. November; 20(11):558-66. [0386] 62. Trapp, S., von Einem, J., Hofmann, H., Kostler, J., Wild, J., Wagner, R., Beer, M., Osterrieder, N., 2005. Potential of equine herpesvirus 1 as a vector for immunization. J. Virol. 79, 5445-5454. [0387] 63. Wellington, J. E., Allen, G. P., Gooley, A. A., Love, D. N., Packer, N. H., Yan, J. X., Whalley, J. M. 1996. The highly O-glycosylated glycoprotein gp2 of equine herpesvirus 1 is encoded by gene 71. J Virol. 70(11):8195-8.