HEPATITIS B THERAPEUTIC VACCINES
20180078636 ยท 2018-03-22
Inventors
- Chia-Mao Wu (Hsinchu County, TW)
- Jiun-Ming Wu (Hsinchu County, TW)
- Yi-Chia Lin (Hsinchu County, TW)
- Kung-Lung Lee (Hsinchu County, TW)
- Chia-Hao Kang (Hsinchu County, TW)
- Fu-Hsien Chiang (Hsinchu County, TW)
- Cheng-Yung Chang (Hsinchu County, TW)
- Wei-Lun Chang (Hsinchu County, TW)
- Hsiang-Kai Lin (Hsinchu County, TW)
- Chia-Kuan Peng (Hsinchu County, TW)
- Wei-Hsiang Lin (Hsinchu County, TW)
- Yi-Tsui Chiu (Hsinchu County, TW)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2730/10122
CHEMISTRY; METALLURGY
C12N2730/10134
CHEMISTRY; METALLURGY
C07K2319/33
CHEMISTRY; METALLURGY
A61K39/292
HUMAN NECESSITIES
A61K2039/55561
HUMAN NECESSITIES
C07K2319/40
CHEMISTRY; METALLURGY
C07K2319/10
CHEMISTRY; METALLURGY
A61K2039/57
HUMAN NECESSITIES
C07K2319/74
CHEMISTRY; METALLURGY
A61P1/16
HUMAN NECESSITIES
International classification
Abstract
A fusion protein for use as a hepatitis B therapeutic vaccine is disclosed. The fusion protein comprises: (a) an antigen-presenting cell (APC)-binding domain or a CD91 receptor-binding domain; (b) a protein transduction domain; and (c) an antigen comprising a hepatitis B virus X protein deletion mutant that lacks amino acids (aa) at least from as 21 to as 50. The protein transduction domain is a fusion polypeptide comprising a T cell sensitizing signal-transducing peptide, a linker, and a translocation peptide. The APC-binding domain or the CD91 receptor-binding domain is located at the N-terminus of the fusion protein, and the antigen is located at the C-terminus of the protein transduction domain.
Claims
1. A fusion protein comprising: (a) an antigen-presenting cell (APC)-binding domain or a CD91 receptor-binding domain, located at the N-terminus of the fusion protein; (b) a protein transduction domain, located at the C-terminus of the APC-binding domain or the CD91 receptor-binding domain, wherein the protein transduction domain is a fusion polypeptide comprising: (1) a T cell sensitizing signal-transducing peptide consisting of 28-53 amino acid residues in length, comprising the amino acid sequence of SEQ ID NO: 28, in which Xaa.sup.8 is I or L; Xaa.sup.10 is V, F or A, Xaa.sup.11 is M or L, Xaa.sup.17 is L or I, being located at the N-terminus of the fusion polypeptide; (2) a translocation peptide consisting of 34-112 amino acid residues in length, comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 3, 4, 20 or 30; and (3) a linker linking the T cell sensitizing signal-transducing peptide and the translocation peptide; and (c) an antigen comprising a hepatitis B3 virus X protein deletion mutant (HBx) that lacks residues at least from amino acid residue 21 to amino acid residue 50, located at the C-terminus of the protein transduction domain.
2. The fusion protein of claim 1, wherein the APC-binding domain or the CD91 receptor-binding domain comprises an amino acid sequence that is at least 90% identical to the sequence selected from the group consisting of SEQ ID NOs: 5, 9, 6, 7, and 8.
3. The fusion protein of claim 1, further comprising an endoplasmic reticulum retention sequence located at the C-terminus of the fusion protein.
4. The fusion protein of claim 1, wherein the fusion protein is free of an endoplasmic reticulum retention sequence at C-terminus thereof if the antigen contains 10 or more epitopes.
5. The fusion protein of claim 1, wherein the protein transduction domain comprises the amino acid sequence of SEQ ID NO: 27.
6. The fusion protein of claim 1, wherein the APC-binding domain or the CD91 receptor-binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 9, 6, 7, and 8.
7. The fusion protein of claim 1, wherein the T cell sensitizing signal-transducing peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and 2.
8. The fusion protein of claim 1, wherein the translocation peptide comprises the amino acid sequence of SEQ ID NO: 3.
9. The fusion protein of claim 1, wherein the antigen comprises the amino acid sequence of SEQ ID NO: 23.
10. The fusion protein of claim 1, wherein the deletion mutant HBx has a deletion of amino acids (aa) 1 to 50, or aa 5 to 50, or as 10 to 50, or as 15 to 50, or aa 18 to 50.
11. A vaccine composition comprising: (a) a therapeutically effective amount of the fusion protein of claim 1; and (b) an adjuvant.
12. The vaccine composition of claim 11, wherein the adjuvant comprises CpG oligodeoxynucleotide.
13. A method for inducing a hepatitis B virus X protein (HBx)-specific T cell response, comprising: administering a therapeutically effective amount of the fusion protein of claim 1 to a subject in need thereof.
14. A method for treating infection caused by hepatitis B virus, and/or minimizing symptoms caused by hepatitis B virus infection, comprising: administering a therapeutically effective amount of the fusion protein of claim 1 to a subject in need thereof.
15. A method of inhibiting proliferation of hepatitis B virus in liver cells and/or suppressing hepatitis B virus infection in a subject in need thereof, comprising: administering a therapeutically effective amount of the fusion protein of claim 1 to the subject in need thereof.
16. A method for preparation of a hepatitis B virus X protein deletion mutant fusion protein, comprising: (a) generating a plasmid for expressing the fusion protein of claim 1; (b) causing the plasmid to express the fusion protein within a host cell; and (c) collecting the fusion protein from the host cell.
17. The fusion protein of claim 1, wherein the deletion mutant HBx has a deletion of 30 amino acid residues from aa 21 to aa 50.
18. The fusion protein of claim 17, wherein the translocation peptide comprises the amino acid sequence of SEQ ID NO: 3.
19. The fusion protein of claim 18, further comprising an endoplasmic reticulum retention sequence located at the C-terminus of the fusion protein.
20. The fusion protein of claim 1, wherein the protein transduction domain comprises the amino acid sequence of SEQ ID NO: 22.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0037] The terms used in this specification generally have their ordinary meanings in the art, within the context of the invention, and in the specific context where each term is used. Certain terms that are used to describe the invention are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the invention. For convenience, certain terms may be highlighted, for example using italics and/or quotation marks. The use of highlighting has no influence on the scope and meaning of a term; the scope and meaning of a term is the same, in the same context, whether or not it is highlighted. It will be appreciated that same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to various embodiments given in this specification.
[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the case of conflict, the present document, including definitions will control.
[0039] As used herein, around, about or approximately shall generally mean within 20 percent, preferably within 10 percent, and more preferably within 5 percent of a given value or range. Numerical quantities given herein are approximate, meaning that the term around, about or approximately can be inferred if not expressly stated.
[0040] Immunogenic proteins such as fusion proteins for use as immunogenic enhancers for inducing antigen-specific T cell responses are disclosed in the U.S. Pat. No. 9,481,714 B2, 9,339,536 B2 and 20160250324 A1, each of which is incorporated herein by reference in its entirety.
[0041] The term an antigen-presenting cell (APC)-binding domain refers to a domain (which is a polypeptide) that can bind to an antigen-presenting cell (APC). In an embodiment, the APC-binding domain is selected from the group consisting of receptor-associated protein-1 (RAP1) domain III, alpha-2-macroglobulin receptor-associated protein (A2M), HIV-Tat, and heat shock proteins (HSPs), and Pseudomonas exotoxin A (PE) binding domain I. In another embodiment, the APC-binding domain may be a polypeptide comprising an amino acid sequence that is at least 90% identical to the sequence selected from the group consisting of SEQ ID NOs: 5, 6, 7, 8, and 9.
[0042] Cluster of differentiation 91 (CD91) is a protein that forms a receptor found in the plasma membrane of cells and is involved in receptor-mediated endocytosis.
[0043] In another embodiment of the invention, the APC-binding domain or the CD91 receptor-binding domain exhibits a characteristics of recognizing and binding to a receptor on an antigen-presenting cell (APC) selected from the group consisting of dendritic cells, monocytes, B-cells and lymphocytes.
[0044] Receptor-associated protein (RAP1) with a molecular weight of 39 kDa is an ER resident protein and molecular chaperone for LDL receptor-related protein. It has a high binding affinity to CD91 (Kd3 nM) and is composed by three functional-similar domain.
[0045] The term a protein transduction domain is a polypeptide whose function is to sensitize T-cells and thus enhance antigen-specific T cell response, and/or to guide or direct an antigen toward (i.e., to target to) class I major histocompatibility complex (MHC-I) pathway (i.e., a cytotoxic T cell pathway) of antigen presentation.
[0046] The term to sensitize T cells generally means that CD8+ and CD4+ T cells are sensitized and as a result, CD8+ (CTL) and CD4+ T cell responses to an antigen challenge are enhanced. An antigen-specific cytotoxic cell (CTL) response is measured by quantifying the production of antigen-specific induced -interferon in response to an antigen. For example, without a sensitization signal, an antigen alone may induce weak or no CTL response at all, i.e., weak or no production of antigen-specific -interferon, while in the presence of a sensitization signal, the antigen may induce an enhanced CTL response. Thus, the function of a sensitization signal is to sensitize CD8+ T cells in a host so that when the host is later challenged by an antigen, the antigen can induce an enhanced antigen-specific CTL response due to prior CD8+ T cell sensitization.
[0047] In addition, CD4+ T cell response is also enhanced by prior T cell sensitization. An antigen-specific CD4+ T cell response is indirectly measured by antibtxody (IgG) titer production from B cells.
[0048] A protein transduction domain may be a peptide and/or fusion polypeptide selected from the group consisting of: [0049] (i) a T cell-sensitizing signal-transducing peptide of 28-53 amino acid residues in length, comprising the amino acid sequence that is at least 90% identical to SEQ ID NO: 1; [0050] (ii) a translocation peptide of 34-12 amino acid residues in length, comprising the amino acid sequence that is at least 90% identical to SEQ ID NO: 3; and [0051] (iii) a fusion polypeptide, comprising the T cell sensitizing signal-transducing peptide and the translocation peptide, wherein the T cell sensitizing signal-transducing peptide is located at the N-terminus of the fusion polypeptide
[0052] In another embodiment of the invention, the protein transduction domain may be a fusion polypeptide, in which the fusion polypeptide comprises a T cell sensitizing signal-transducing peptide, a linker, and a translocation peptide. For example, the fusion polypeptide may be the polypeptide CD28.sub.convPE.sub.t, which comprises a linker between the CD28.sub.conv and the PE.sub.t.
[0053] The term CD28.sub.conv refers to a CD28 conserved region, which is a T cell sensitizing signal-transducing peptide. It's an epitope for inducing CD28 agonist antibody.
[0054] The term PE.sub.t or PE.sub.tCore refers to a PE translocation domain core with 34 amino acid residues in length.
[0055] The orientation or arrangement of the fusion polypeptide CD28.sub.convPE.sub.t is important in that CD28.sub.conv (or the T cell sensitizing signal-transducing peptide) must be at the upstream to the PE.sub.t (or the translocation peptide), i.e., PE.sub.t must be at the C-terminus of the CD28.sub.conv to obtain enhanced T-cell responses. The CD28.sub.convPE.sub.t can raise much higher IgG titer (called CD28-specific agonist antibody) specific to CD28.sub.conv than the reversed orientation fusion peptide PE.sub.tCD28.sub.conv. The CD28-specific agonist antibody can sensitize both CD4+ and CD8+ T cells. The correct orientation fusion polypeptide CD28.sub.convPE.sub.t contains a linker (R.sup.1X.sup.2R.sup.3X.sup.4K.sup.5R.sup.6) between CD28.sub.conv and PE.sub.t domains. The linker contains an antigen presenting cell (APC)-specific protease (cathepsin L) cutting site Lys-Arg (KR). Therefore, the fusion protein RAP1-CD28.sub.convPE.sub.t-Antigen-K3 can be digested into the two fragments: RAP1-CD28.sub.conv and PE.sub.t-Antigen-K3. The RAP1-CD28.sub.conv fragment can be further digested in the lysosome and the epitope of CD28.sub.conv is then presented to the APC cell surface via MHC II pathway, which in turn elicits a humoral immune response producing CD28 agonist antibody. Thus, CD28 agonist antibody is produced by B cells. This CD28 agonist antibody can bind to CD28 on the T cell surface and pre-activate the T cells (CD4+ and CD8+ T cells).
[0056] A T cell-sensitizing signal-transducing peptide has 28-53 amino acid residues in length and comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 28, in which X.sup.8 is I or L; X.sup.10 is V, F or A, X.sup.11 is M or L, X.sup.17 is L or I.
[0057] The T cell-sensitizing signal-transducing peptide comprises the critical region K.sup.1X.sup.2E.sup.3X.sup.4X.sup.5Y.sup.6P.sup.7P.sup.8P.sup.9Y.sup.10 (SEQ ID NO: 29), wherein X.sup.2 is I or L; X.sup.4 is V, F or A, X.sup.5 is M or L.
[0058] A T cell sensitizing signal-transducing peptide (TDIYFCKIEFMYPPPYLDNEKSNGTIIH; SEQ ID NO: 28, wherein X.sup.8 is 1, X.sup.10 is F, X.sup.11 is M, X.sup.17 is L) specific for mice was illustrated in the U.S. Pat. No. 9,481,714 B2.
[0059] A PE translocation peptide may comprise an amino acid sequence that is at least 90% identical to SEQ ID NO: 3, 4, 20 or 30. For example, the amino acid sequence of a PE translocation peptide may be a.a. 280-a.a. 313 (SEQ ID NO: 3), a.a. 268-a.a. 313 (SEQ ID NO: 20), a.a. 253-a.a. 313 (SEQ ID NO: 30), or a.a. 253-a.a. 364 (SEQ ID NO: 4) of full length PE (SEQ ID NO: 10). That is, the amino acid sequence of a PE translocation peptide may contain any region of the PE domain II (a.a. 253 to a.a. 364; SEQ ID NO: 4) as long as it comprises a.a. 280-a.a. 313 (SEQ ID NO: 3) essential fragment.
[0060] The function of an endoplasmic reticulum (ER) retention sequence is to assist translocation of an antigen from an endocytic compartment into ER and retains it in the lumen. It comprises the sequence Lys Asp Glu Leu (KDEL) or RDEL. For example, an ER retention sequence may comprise the sequence of KKDLRDELKDEL (SEQ ID NO: 16), KKDELRDELKDEL (SEQ ID NO: 17), KKDELRVELKDEL (SEQ ID NO: 18) or KDELKDELKDEL (SEQ ID NO: 19).
[0061] Two fusion protein with deletion HBx mutants were generated, one with a deletion of 1.sup.st-50.sup.th amino acids, the other with a deletion of 21.sup.st-50.sup.th amino acids. The fusion protein RAP1-CD28.sub.convPEt-HBx-K3 according to the invention was equally effective as the fusion protein RAP1-CD28.sub.convPEt-HBx-K3 (with the full-length HBx), but the former exhibited a much better stability than the latter. After being storaged for a certain time period such as one year, the fusion protein RAP1-CD28.sub.convPEt-HBx-K3 in a liquid form showed 100% aggregation, while the fusion protein RAP1-CD28.sub.convPEt-HBx-K3 exhibited less aggregation.
[0062] Oligodeoxyribonucleotides containing CpG motifs (CpG ODNs) are widely used for activation of immune cells.
[0063] The term subject refers to a human or a non-human animal.
[0064] The term treating or treatment refers to administration of an effective amount of the fusion protein to a subject in need thereof, who has cancer or infection, or a symptom or predisposition toward such a disease, with the purpose of cure, alleviate, relieve, remedy, ameliorate, or prevent the disease, the symptoms of it, or the predisposition towards it. Such a subject can be identified by a health care professional based on results from any suitable diagnostic method.
[0065] The term an effective amount refers to the amount of an active compound that is required to confer a therapeutic effect on the treated subject. Effective doses will vary, as recognized by those skilled in the art, depending on rout of administration, excipient usage, and the possibility of co-usage with other therapeutic treatment.
Abbreviations
[0066] CD 28, Cluster of Differentiation 28.
Examples
[0067] Without intent to limit the scope of the invention, exemplary instruments, apparatus, methods and their related results according to the embodiments of the present invention are given below. Note that titles or subtitles may be used in the examples for convenience of a reader, which in no way should limit the scope of the invention. Moreover, certain theories are proposed and disclosed herein; however, in no way they, whether they are right or wrong, should limit the scope of the invention so long as the invention is practiced according to the invention without regard for any particular theory or scheme of action.
Methods
Preparation of the Fusion Protein RAP1-CD28.SUB.conv.PEt-HBx-K3
[0068] 1. Construction of the plasmid RAP1-CD28-PEt-HBx-K3-pTac
[0069] The following primers were used:
TABLE-US-00001 HBV1-F-EcoRI: (SEQIDNO:31) GAATTCATGGCTGCTCGTATGTGCTGC; HBV20.51-S: (SEQIDNO:32) CTGCGTCCGTCTCACCTGTCTCTGCGTGG; HBV20.51-A: (SEQIDNO:33) GTTCTGTGCCTGCGTCCGTCTCACCTGTCGACAGGTGAGACGGACGCAGG CACAGAAC; HBV154-R-XhoI: (SEQIDNO:34) CTCGAGGGCAGAGGTGAAGAAGTTGCAC.
[0070] Using the fusion protein RAP1-CD28.sub.convPEt-HBx.sub.1-154-K3-pTac disclosed in the U.S. Pat. No. 9,481,714 B2 as a DNA template (See
[0071] Utilizing MfeI and EcoRI cutting sites, the fragments mCD28.sub.conv and hCD28.sub.conv were separately inserted into the EcoR site of the RAP1-HBx-K3-pTac plasmid to generate the constructs RAP1-mCD28.sub.conv PEt-HBx-K3-pTac and RAP1-hCD28.sub.conv PEt-HBx-K3-pTac, respectively.
[0072] 2. RAP1-CD28.sub.conv PEt-HBx-K3 Comprises RAP1, CD28conv, PEt, HBx, Etc. Components.
[0073] Table 1 shows sequences of various components that may be used to prepare a fusion protein according to the invention.
TABLE-US-00002 TABLE1 Length Component SEQIDNO: (resdues) hCD28Core 1 28 hCD28Maximum 2 53 PE.sub.tCore(PEtranslocationdomaincore;a.a.280-a.a.313ofPE) 3 34 PE.sub.tMaximum(translocationdomainmaxi,a.a.253-a.a.364ofPE) 4 112 RAP1Minimum(domainIIIofRAP1) 5 104 A2MMinimum 6 151 HIV-TatMinimum 7 24 HSPsMinimum,Heatshock70kDaprotein(HSPs;Homosapiens) 8 641 MinimumPseudomonasexotoxinA(PE)bindingdomain1a(an 9 252 APC-bindingdomain,a.a.1-a.a.252ofPE) FulllengthPE(ExotoxinAmatureformPseudomonasaeruginosa) 10 613 FulllengthRAP1(Homosapienslowdensitylipoproteinreceptor- 11 323 relatedproteinassociatedprotein1,LRPAP1);Domain1:a.a.1-a.a. 112;domain2:a.a.113-a.a.218;domain3:a.a.219-a.a.323. FulllengthA2M(Homosapiensalpha-2-macroglobulinreceptor- 12 357 associatedproteinprecursor) HIV-Tat(Humanimmunodeficiencyvirus1) 13 101 KDEL 14 4 LinkerRXRXKR,inwhichX isanyaminoacidresidue. 15 6 KKDLRDELKDEL 16 12 KKDELRDELKDEL 17 13 KKDEERVELKDEL 18 13 KDELKDELKDEL(K3) 19 12 PE.sub.268-313 20 46 CD28.sub.convPEt(w/mCD28) 21 68 CD28.sub.convPEt(w/hCD28) 22 68 hepatitisBvirusXproteindeletionmutant(HBx) 23 124 124a.a.(a.a.1-20a.a.+ a.a.51-154)* Full-lengthhepatitisBvirusXprotein(HBx) 24 154 RAP1-CD28.sub.convPEt-HBx-K3(w/mCD28) 25 317 RAP1-CD28.sub.convPEt-HBx-K3(w/hCD28) 26 317 CD28.sub.convPE.sub.t 27 68 T.sup.1D.sup.2I.sup.3Y.sup.4F.sup.5C.sup.6K.sup.7(X).sup.8E.sup.9(X).sup.10(X).sup.11Y.sup.12P.sup.13P.sup.14P.sup.15Y.sup.16(X).sup.17D.sup.18N.sup.19E.sup.20K.sup.21 S.sup.22N.sup.23G.sup.24T.sup.25I.sup.26I.sup.27H.sup.28R.sup.29(X).sup.30R.sup.31(X).sup.32K.sup.33R.sup.34G.sup.35W.sup.36E.sup.37Q.sup.38L.sup.39E.sup.40Q.sup.41 C.sup.42G.sup.43Y.sup.44P.sup.45V.sup.46Q.sup.47R.sup.48L.sup.49V.sup.50A.sup.51L.sup.52Y.sup.53L.sup.54A.sup.55A.sup.56R.sup.57L.sup.58S.sup.59W.sup.60N.sup.61Q.sup.62 V.sup.63D.sup.64Q.sup.65V.sup.66I.sup.67R.sup.68,wherein(X).sup.8isIorL;(X).sup.10isV,ForA,(X).sup.11 isMorL,(X).sup.17isLorI,(X).sup.30,32isanyaminoacidresidue. CD28consensussequence(CD28.sub.conv) 28 28 T.sup.1D.sup.2I.sup.3Y.sup.4F.sup.5C.sup.6K.sup.7(X).sup.8E.sup.9(X).sup.10(X).sup.11Y.sup.12P.sup.13P.sup.14P.sup.15Y.sup.16(X).sup.17D.sup.18N.sup.18E.sup.20K.sup.21 S.sup.22N.sup.23G.sup.24T.sup.25I.sup.26I.sup.27H.sup.28,wherein(X).sup.8isIorL;(X).sup.10isV,ForA,(X).sup.11 isMorL,(X).sup.17isLorI. CD28criticalregion 29 10 PE.sub.253-313 30 61 *: HBx is a mutant with a deletion of residues from a.a. 21.sup.st to a.a. 50.sup.th.
[0074] 3. Production of Fusion Proteins:
[0075] Briefly, Escherichia coli BL21 cells containing the plasmid of interest from Master Cell Bank were thawed, and diluted 100 folds with a culture medium, and cultured at 30 C. with agitation at 250 rpm for 15 hrs. Afterwards, the BL21 cells were placed in a fermentation tank containing the culture medium, diluted to OD.sub.600=0.5, continued to culture under the condition of 37 C., pH 7.0, 40% dissolved oxygen for 4 hrs, and fed with 70% glucose solution. When the OD.sub.600 reached 20, 0.2 M isopropyl--D-thiogalactopyranoside (IPTG) was added to induce protein expression for 4 hrs. The induced E. coli was subjected to centrifugation at 4 C., 7000 rpm for 15 minutes, and a cell pellet was collected and stored at 80 C.
[0076] To recover the fusion protein, the cell pellet was re-suspended, sonicated to break the cells, and centrifuged at 9500 rpm, 4 C. for 15 minutes to separate and precipitate the inclusion bodies. The inclusion bodies were washed several times, added with a buffer solution containing 8M urea and 10 mM DTT, and then placed at 4 C. for overnight to solubilize the recombinant protein within the inclusion bodies. The buffer solution containing the solubilized protein was centrifuged at 9500 rpm, 4 C. for 2 minutes, the supernatant was filtered through a 0.2 m filter and the filtrate collected. The filtrate was purified by ion-exchange chromatography, in which a DEAE sepharose was used as a solid phase and the elution buffer contained 8M urea, 1 mM DTT, 30-200 mM NaCl (pH 8.8).
[0077] The eluate purified from the ion exchange chromatography was collected, followed by dialysis (using 8-fold volume of buffer solution without urea, pH 5.0) to remove urea to allow renaturation (refolding) of the recombinant protein. The liquid was centrifuged at 9500 rpm, 4 C. for 15 minutes to form a supernatant and a precipitate (pellet), the supernatant was collected to thereby obtain a soluble fusion protein of interest.
HBx Fusion Protein Comparative Efficacy Data and Verification:
[0078] The existing technology in the process of preparation of recombinant protein in the inclusion body has employed urea to disrupt protein hydrogen bonds, and the denatured recombinant protein is then renatured. During renaturation, inappropriate sequence may facilitate the misfolding of fusion protein RAP1-mCD28.sub.convPEt-HBx.sub.1-154-K3 and lead to irreversible aggregate and precipitate. Using recombinant DNA techniques to remove the 21.sup.st-50.sup.th amino acid region of HBx, it was discovered that the fusion protein RAP1-mCD28.sub.convPEt-HBx-K3 solved the problem of easy aggregation and sedimentation during protein refolding and thus, improved the final protein recovery yield.
[0079] The protein renaturation condition was tested on the dialyzed and purified fusion proteins RAP1-mCD28.sub.convPEt-HBx.sub.1-154-K3 and RAP1-mCD2.sub.convPEt-HBx-K3. It was found that after protein renaturation, more amount of RAP1-mCD28.sub.convPEt-HBx-K3 (with deletion of HBX amino acid residues from a.a. 21 to a.a. 50.sup.th) retained soluble in the supernatant (
[0080] Image analysis software was used to quantify the protein bands at 40 kDa (
[0081]
[0082] Table 2 shows the results of quantitative analyses of the protein bands on the electrophoresis images of RAP1-mCD28.sub.convPEt-HBx.sub.1-154-K3 and RAP1-mCD28.sub.convPEt-HBx-K3 after protein refolding.
TABLE-US-00003 TABLE 2 Image quanti- Target protein Treatment Lane tative values RAP1- supernatant/with reducing 1 410.92 mCD28.sub.convPEt- agent HBx.sub.1-154-K3 supernatant/without reducing 2 108.9 agent precipitate/with reducing 3 17386.593 agent precipitate/without reducing 4 17056.513 agent RAP1- supernatant/with reducing 5 3210.832 mCD28.sub.convPEt- agent HBx-K3 supernatant/without reducing 6 956.648 agent precipitate/with reducing 7 21631.815 agent precipitate/without reducing 8 12612.48 agent
[0083] Protein refolding comparisons were also made between RAP1-hCD28.sub.convPEt-HBx.sub.1-154-K3 and RAP1-hCD28.sub.convPEt-HBx-K3. Similar to the RAP1-mCD28.sub.convPEt-HBx.sub.1-154-K3, the post-refolding recovery rate of the RAP1-hCD28.sub.convPEt-HBx-K3 also increased by 10% as compared with RAP1-hCD28.sub.convPEt-HBx.sub.1-154-K3 (data not shown). The result confirms that removal of HBx 21.sup.st-50.sup.th amino acids can reduce aggregation and improve recovery rate of the target protein.
Effectiveness of HBx Fusion Protein as a Vaccine:
(1) Vaccine Immunogenicity Test:
[0084] Dosing schedule, methods, and animal groups:
[0085] C57BL/6 female mice (4-5 weeks old) were immunized once a week for 3 times via subcutaneous injections on Day 0, 7, 14, blood samples were collected on Day 0, 7, 14, 21, and serum anti-HBx specific antibodies were analyzed with ELISA. Mice were sacrificed and spleen collected. The immune cells in the spleen were stimulated with two HBx-specific peptide libraries (HBx small peptide pool-1, HBx small pool-2). The number of Th1-specific immune cells and secretion of cytokines species were analyzed with ELiSpot.
[0086]
TABLE-US-00004 TABLE 3 Dose (mg) Number of Experimental groups [antigen/adjuvant] animals PBS Buffer (control group) 0/0 5 RAP1-mCD28.sub.convPEt-HBx-K3 + 0.1/0.02 5 CpG ODN1826 (vaccine group)
Results:
[0087] The C57BL/6 mice were immunized with RAP1-mCD28.sub.convPEt-HBx-K3+CpG ODN1826. Serum samples collected on Day 0, 7, 14, 21 were analyzed for HBx-specific antibodies by ELISA (
[0088] The mice were sacrificed after 21 days. Their spleen immune cells were stimulated by two pools of different HBx-specific short peptides (HBx small peptide pool-1, HBx small peptide pool-2). A specific cell-mediated immunogenic response was analyzed by ELISPOT (ELISpot). There was a significant increase in the number of the mouse spleen immune cells that secreted IL-2 (top). IFN (middle) and TNF (bottom) in the vaccine group (
[0089] In summary,
(2) Vaccine Therapeutic Efficacy Test
Animal Experimental Model:
[0090] Male mice of a CBA line (5-6 weeks old) were used to establish an animal model carrying a long-term hepatitis B virus (HBV carrier mice). A mixture of pAAV/HBV1.2 plasmid and saline (in the amount of about 8% of the equivalent weight of mice) was intravenously injected into the tail vein of mice at a high pressure (hydrodynamic injection, HDI) in a fast mode (5-10 seconds), which forced the plasmid to penetrate the cell membrane and enter liver cells. The liver cells carrying the plasmid express hepatitis B virus proteins. Virus can assemble inside the liver cells and release therefrom. A surface antigen (HBsAg) is also released into blood. This animal model emulates a human patient afflicted with chronic hepatitis B symptoms.
[0091] Dosing schedule, methods, and animal groups:
[0092] Twenty eight days after the high-pressure injection, the CBA mice were treated with the therapeutic vaccine on Day 0, Day 7, Day 14, via subcutaneous injections once a week for three times (
[0093] Mice were divided into 3 experimental groups as follows: The control group was administered with PBS buffer, the adjuvant group was administered with CpG ODN1826; and the vaccine group was administered with RAP1-mCD28.sub.convPEt-HBx-K3+CpG ODN1826. Table 4 shows the animal groups, dosage, and the number of animals in each group.
TABLE-US-00005 TABLE 4 dosage (mg) number of dosing groups [antigen/adjuvant] animals PBS buffer (control group) 0/0 7 CpG ODN1826 (adjuvant group) .sup.0/0.02 10 RAP1-mCD28.sub.convPEt-HBx-K3 + 0.1/0.02 10 CpG ODN1826 (vaccine group)
Results:
[0094] The body weight (
[0095] As to the adjuvant group, the serum ALT level also increased slightly, and showed slight fluctuations. However, the average value did not exceeded the normal range. The serum ALT level in the control group was normal, and had no significant fluctuations. The results indicate that the vaccine and adjuvant, when used in the HBV carrier mice, are likely to induce a specific immune response, clear infected liver cells, lead to mild liver inflammation, and result in an increase and fluctuations in the serum ALT level.
[0096] Mice were sacrificed 82 days after the first dosing. The weight ratios of liver and spleen versus body weight were measured (
[0097] The changes in the viral markers (i.e. HBV DNA and HBsAg) in the serum samples showed a significant difference among the experimental groups. The average value of the serum viral DNA load in the control group maintained at 40,000-120,000 copies/ml with a positive rate of 100% up to 42 days (
[0098] The average value of the viral DNA load in the adjuvant group decreased from about 80,000 copies/ml on day 0 to about 15,000 copies/ml on Day 7 (7 days after the first dose administration) with a positive rate being decrease to 60% (
[0099] In contrast, the average value of the viral DNA load in the vaccine group started at the level of about 80.000 copies/ml on day 0, and dramatically reduced on Day 7 (7 days after the first dose administration), although still with a positive rate of 90% (
[0100] The average value of the surface antigens and the changes in the positive rate showed a positive correlation with the serum viral DNA load. The control group showed that the serum surface antigen (HBsAg) level remained stable at 600-800 IU/ml with a positive rate of 100% all the way through the 42nd days (
[0101] The adjuvant group showed that the average value of the serum surface antigen (HBsAg) level was about 1200 IU/ml on day 0, reduced to about 500 IU/ml on Day 7 (7 days after the first dose administration), and about 400 IU/ml on Day 14 (7 days after the second dose), with no further significant decline after the third dose administration (
[0102] The vaccine group showed that the average value of the serum surface antigen (HBsAg) on day 0 was about 800 IU/ml. It plummeted to about 2 IU/ml on Day 14 (7 days after the second dose) and further dropped to less than 1 IU/mL on Day 21, Day 32 and Day 42. There was a statistically significant difference in the serum surface antigen level between the vaccine group and the adjuvant group, and this difference was stable and continued all the way through the 42nd day (
[0103] The results indicate that administration of the vaccine RAP1-mCD28.sub.convPEt-HBx-K3+CpG ODN1826 could induce an HBx-specific immune response, cleared the infected liver cells, suppressed viral replication inside the mouse body, and also almost stopped the production and release of the surface antigen. The effect of the vaccine on the HBV carrier mice might be partly from the antiviral effect of the adjuvant, or from the synergism of the vaccine and the adjuvant, which enhanced the anti-viral effect.
[0104] Western blot was used to compare the amount of the core antigen (HBcAg) expression in the liver tissue between the animal groups 82 days after the first vaccination. The core antigen expression was detected in all the liver tissues obtained from the control group, in which 5 mice showed a higher amount of HBcAg expression, and 2 mice (R4, MIA) showed less expression (
[0105] The western blot results were in consistency with the immunohistochemical staining results (data not shown), and were positively correlated with the serum viral DNA load and virus surface antigen positive rate (
[0106] A core antibody specific against HBcAg was used to detect the core antigen (HBcAg) in the liver tissues, and the core antigen (HBcAg) expression in the mouse liver was quantified and compared among the control, adjuvant, and vaccine groups (
Other HBx Fusion Proteins
[0107] Using a similar design as disclosed above, the following HBx fusion proteins are generated: (1) RAP1-CD28.sub.convPEt-HBx (2) PE.sub.1-252-CD28.sub.convPEt-HBx; (3) A2M Minimum-CD28.sub.convPEt-HBx; (4) HIV-Tat Minimum-CD28.sub.convPEt-HBx; (5) HSPs Minimum-CD28.sub.convPEt-HBx; (6) PE.sub.1-252-CD28.sub.convPEt-HBx-K3; (7) A2M Minimum-CD28.sub.convPEt-HBx-K3; (8) HIV-Tat Minimum-CD28.sub.convPEt-HBx-K3; (9) HSPs Minimum-CD28.sub.convPEt-HBx-K3.
[0108] The immunogenicity of these HBx fusion proteins are tested using similar experimental designs, dosing and sampling schedules described above and in
[0109] The foregoing description of the exemplary embodiments of the invention has been presented only for the purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise forms disclosed. Many modifications and variations are possible in light of the above teaching.
[0110] Alternative embodiments will become apparent to those skilled in the art to which the present invention pertains without departing from its spirit and scope. Accordingly, the scope of the present invention is defined by the appended claims rather than the foregoing description and the exemplary embodiments described therein. Some references, which may include patents, patent applications and various publications, are cited and discussed in the description of this invention. All references cited and discussed in this specification are incorporated herein by reference in their entireties and to the same extent as if each reference was individually incorporated by reference.