NEW SWINE INFLUENZA VACCINE
20180080044 ยท 2018-03-22
Inventors
Cpc classification
A61P31/00
HUMAN NECESSITIES
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2760/16122
CHEMISTRY; METALLURGY
C12N2710/16743
CHEMISTRY; METALLURGY
C12N2710/16043
CHEMISTRY; METALLURGY
A61K2039/60
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
A61K2039/545
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to Equine Herpes Virus (EHV) vectors comprising at least one exogenous antigen encoding sequence relating to a pathogen infecting food producing animals, wherein said exogenous antigen encoding sequence is inserted into an insertion site, preferably ORF70, and said exogenous antigen encoding sequence is operably linked to a promoter sequence, preferably the promoter sequence comprising 4pgG600 (SEQ ID NO:1) or 4pMCP600 (SEQ ID NO:2) or the complementary nucleotide sequences thereof or a functional fragment or a functional derivative thereof or the complementary nucleotide sequences thereof. Furthermore, the present invention relates to methods for immunizing a food producing animal comprising administering to such food producing animal an immunogenic composition comprising embodiments of the present invention. Moreover, the present invention relates to methods for the treatment or prophylaxis of clinical signs caused by swine influenza virus in a food producing animal.
Claims
1. An EHV vector comprising (i) at least one exogenous antigen encoding sequence relating to a pathogen infecting food producing animals, (ii) said exogenous antigen encoding sequence is inserted into ORF70, (iii) said exogenous antigen encoding sequence is operably linked to a promoter sequence.
2. An EHV vector comprising (i) at least one exogenous antigen encoding sequence relating to a pathogen infecting food producing animals, (ii) said exogenous antigen encoding sequence is inserted into an insertion site, (iii) said exogenous antigen encoding sequence is operably linked to a promoter sequence comprising 4pgG600 (SEQ ID No. 1) or 4pMCP600 (SEQ ID No. 2) or the complementary nucleotide sequences thereof or a functional fragment thereof or the complementary nucleotide sequences thereof.
3. An EHV vector comprising (i) at least two exogenous antigen encoding sequences relating to a pathogen infecting food producing animals, (ii) said exogenous antigen encoding sequences are inserted into insertion sites, (iii) said exogenous antigen encoding sequences are operably linked to promoter sequences.
4. An immunogenic composition comprising an EHV vector according to claim 1, and optionally a pharmaceutical carrier.
5. An immunogenic composition and/or a DIVA vaccine comprising two or more EHV vectors according to claim 1.
6. The EHV vector according to claim 1, wherein the EHV vector is a recombinant vector.
7. The EHV vector according to claim 1, wherein the EHV vector is selected from the group consisting of: EHV-1, EHV-3, EHV-4, EHV-8 and EHV-9.
8. The EHV vector according to claim 1, wherein the exogenous antigen encoding sequence is a hemagglutinin encoding sequence.
9. The EHV vector according to claim 1, wherein the exogenous antigen encoding sequence is a hemagglutinin encoding sequence and the hemagglutinin influenza antigen encoding sequence comprises a nucleic acid sequence encoding an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the amino acid sequence as set forth in SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 and SEQ ID NO:29.
10. The EHV vector according to claim 2, wherein said insertion site is ORF1/3 and/or ORF70.
11. The EHV vector according to claim 1, wherein a first exogenous antigen encoding sequence relating to a pathogen infecting food producing animals is inserted into ORF70 and/or a second exogenous antigen encoding sequence relating to a pathogen infecting food producing animals is inserted into ORF1/3.
12. The EHV vector according claim 1, wherein the insertion into ORF70 is characterized by a partial deletion, truncation, substitution, modification or the like in ORF70, whereby ORF71 remains functional.
13. The EHV vector according to claim 1, wherein the insertion into ORF70 is characterized by the deletion of an approximately 801 bp portion within ORF70 for RacH (SEQ ID NO: 20) or a 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence thereof.
14. The EHV vector according to claim 1, wherein the EHV-1 vector comprises at least one flanking regions selected from the group consisting of: SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18 and a 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homologous and/or identical sequence of any one of these sequences.
15. The EHV vector according to claim 1, wherein the promoter sequence is selected from the group consisting of: SV40 large T, HCMV and MCMV immediate early gene 1, human elongation factor alpha promoter, baculovirus polyhedrin promoter, a functional fragment of 4pgG600 (SEQ ID NO:1), preferably said functional fragment is p430 (SEQ ID NO:3), a functional fragment of the complementary nucleotide sequence of 4pgG600 (SEQ ID NO:1), a functional fragment of 4pMCP600 (SEQ ID NO:2), preferably said functional fragment is p455 (SEQ ID NO:4), a functional fragment of the complementary nucleotide sequence of 4pMCP600 (SEQ ID NO:2).
16. The EHV vector according to claim 1, wherein the promoter sequence comprises 4pgG600 (SEQ ID NO:1), or 4pMCP600 (SEQ ID NO:2), or the complementary nucleotide sequences thereof, or a functional fragment thereof, or the complementary nucleotide sequences thereof.
17. The EHV vector according to claim 16, wherein the functional fragment or derivative of the promoter sequence has a homology of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% and/or the functional fragment of the promoter sequence has a length of 550, 500, 490, 480, 470, 460, 455, 450, 445, 440, 435, 434, 433, 432, 431, or 430 nucleotides.
18. The EHV vector according to claim 16, wherein the functional fragment of the promoter sequence is a truncation of 4pgG600 (SEQ ID NO:1) or the complementary nucleotide sequence thereof, wherein the sequence identity is at least 72% over the entire length and/or the functional fragment of the promoter sequence of 4pgG600 (SEQ ID NO:1) is the fragment designated 430p430 (SEQ ID NO:3) or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% identity to SEQ ID NO:3.
19. The EHV vector according to claim 16, wherein the functional fragment of the promoter sequence is a truncation of 4pMCP600 (SEQ ID NO:2) or the complementary nucleotide sequence thereof, wherein the sequence identity is at least 78% over the entire length and/or the functional fragment of the promoter sequence of 4pMCP600 (SEQ ID NO:2) is the fragment designated p455 (SEQ ID NO:4) or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% identity to SEQ ID NO:4.
20. A method for immunizing a food producing animal comprising administering to such food producing animal an immunogenic composition and/or a DIVA vaccine of claim 4.
21. A method for the treatment or prophylaxis of clinical signs caused by swine influenza virus in a food producing animal, the method comprising administering to the food producing animal a therapeutically effective amount of an immunogenic composition and/or a DIVA vaccine according to claim 4.
22. A method of reducing the virus titers in lungs in a food producing animal, in comparison to a food producing animal of a non-immunized control group of the same species, the method comprising administering to the food producing animal a therapeutically effective amount of an immunogenic composition and/or a DIVA vaccine according to claim 4.
23. The method of claim 20, wherein the food producing animal is swine.
24. The method of claim 20, wherein said method results in an improvement in an efficacy parameter selected from the group consisting of: a reduction in weight loss, a lower virus load in lungs, a reduction in lung lesions, a reduced and/or shortened shedding of virus, a reduced rectal temperature, reduced clinical symptoms, reduced respiratory symptoms, increased induction of anti-Swine Influenza A virus antibodies, increased induction of neutralizing anti-Swine Influenza A virus antibodies, increased stimulation of T-cells against Swine Influenza A virus, increased stimulation of B-cells against Swine Influenza A virus, and a reduction of pro-inflammatory cytokines, or combinations thereof, in comparison to a food producing animal of a non-immunized control group of the same species.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0460] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0461]
[0462]
[0463]
[0464]
The graph in 3, A shows the kinetics of the transcription of orf72, encoding for the essential glycoprotein D. These data were used to normalize the data of the transcription kinetics of mCherry (graph in 3, B).
[0465]
[0466]
[0467]
[0468]
[0469]
[0470]
[0471]
[0472]
[0473]
[0474]
[0475]
[0476]
[0477]
[0478]
[0479]
[0480]
[0481]
[0482]
[0483]
[0484]
[0485]
[0486]
[0487]
[0488]
[0489]
[0490]
[0491]
[0492]
[0493]
[0494]
[0495]
SEQUENCES OVERVIEW
[0496] The following sequences are detailed and disclosed hereby in the present invention:
Promoters:
[0497] SEQ ID NO: 1 EHV-4 600 bp desoxyribonucleic acid sequence 4pgG600
SEQ ID NO: 2 EHV-4 600 bp desoxyribonucleic acid sequence 4pMCP600
SEQ ID NO: 3 EHV-4 430 bp desoxyribonucleic acid sequence p430
SEQ ID NO: 4 EHV-4 449 bp desoxyribonucleic acid sequence p455
SEQ ID NO: 5 primer no 1130 specific for orf72
SEQ ID NO: 6 primer no 1131 specific for orf72
SEQ ID NO: 7 primer no. 1079 specific for mCherry
SEQ ID NO: 8 primer no. 1080 specific for mCherry Insertion site:
SEQ ID NO: 9 Artificial sequence nucleic acid PCR primer 1017 for the orf70 insertion region
SEQ ID NO: 10 Artificial sequence nucleic acid PCR primer 1018 for the orf70 insertion region
SEQ ID NO: 11 Artificial sequence nucleic acid PCR primer 1007 for the orf1/3 insertion region
SEQ ID NO: 12 Artificial sequence nucleic acid PCR primer 1008 for the orf1/3 insertion region
SEQ ID NO: 13 left (Up70) flanking region (417 bp)
SEQ ID NO: 14 right (Up71) flanking region (431 bp)
SEQ ID NO: 15 flanking region left (up orf70) in the wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1), located at nucleotides 127264-127680
SEQ ID NO: 16 flanking region right (up orf71) in the wild-type EHV-1 strain ab4 (Genbank accession number AY665713.1), located at nucleotides 128484-128913
SEQ ID NO: 17 truncated flanking region in the RED system: left (Up70) flanking region (283 bp)=identical to the 3 283 bp of the 417 bp classical flanking region
SEQ ID NO: 18 truncated flanking region in the RED system: right (Up71) flanking region (144 bp)=identical to the 5 144 bp of the 431 bp classical flanking region
SEQ ID NO: 19 Deleted portion in the wild-type ab4 (Genbank accession number AY665713.1) genome sequence, nt 127681-128482
SEQ ID NO: 20 Deleted portion in the RacH genome sequence (no nt numbers available because complete genome sequence not known)
Plasmid/Vector Sequences:
[0498] SEQ ID NO: 21 Nucleotide sequence of transfer plasmid pU-mC70-BGH
SEQ ID NO.: 22 Nucleotide sequence of transfer vector pU70-p455-71K71
SEQ ID NO.: 23 Nucleotide sequence of transfer plasmid pU70-p455-H3-71K71
SEQ ID NO.: 24 Nucleotide sequence of transfer vector pU-1-3-p430-BGHKBGH
SEQ ID NO.: 25 Nucleotide sequence of transfer plasmid pU1-3-p430-H1av-BGHKBGH
Hemagglutinin Sequences
[0499] SEQ ID NO:26 hemagglutinin [Influenza A virus (A/swine/Italy/116114/2010(H1N2))] GenBank: ADR01746.1 H1pdm
SEQ ID NO:27 hemagglutinin [Influenza A virus (A/swine/Italy/7680/2001(H3N2))] GenBank: ABS50302.2 H3:
SEQ ID NO:28 hemagglutinin [Influenza A virus (A/swine/Gent/132/2005(H1N1))] GenBank: AFR76623.1 H1av:
SEQ ID NO:29 hemagglutinin [Influenza A virus (A/swine/Italy/4675/2003(H1N2))] GenBank: ADK98476.1* H1hu *Amino acid 531 (X, stop codon, was changed to I):
EXAMPLES
[0500] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
Establishment of the New Insertion Site ORF70
[0501] In order to augment the capabilities of the EHV-1 vector the inventors sought to find a way to express two different transgenes from one vector backbone without coupling two transgenes by RNA-virus-derived functions under control of one promoter. The inventors hypothesized that the herpesvirus genome would tolerate the use of two independent transgene insertion sites in parallel. To determine whether the EHV-1 ORF70 was a suitable transgene insertion site, 801 basepairs of the 5 end of orf70 (1236 bp) were replaced with an expression cassette coding for the autofluorescent mCherry protein (Shaner et al. 2004) by classical homologous recombination (
Example 2
Identification and Construction of New Promoters
[0502] The strategy to identify suitable promoter sequences was as follows: 600 bp fragments of the EHV-4 sequence upstream of two known orfs were analyzed first by aligning them with the respective sequence fragments of the EHV-1 genome. The genes chosen were orf42 encoding the major capsid protein (MCP), and orf70 encoding glycoprotein G (gG). The major capsid protein is one of the most abundant constituents of the virion and needed for assembly of capsids in the cell nucleus as soon as newly synthesized viral DNA is ready for packaging. Its promoter is therefore expected to be active during early and late times in the viral replication cycle. For glycoprotein G it is known that its gene (orf70) is active also during early and late times in the replication cycle (Colle et al. 1995, Drummer et al. 1998). Sequence identity was 82.2% for the putative MCP-promoter and 82.3% for the putative gG-promoter. These differences were considered large enough to prevent homologous recombination on the one hand, and small enough to allow for transcriptional activation during EHV-1 replication on the other hand. In order to test for promoter activity, the 600 bp DNA fragments 4pgG600
TABLE-US-00001 (SEQIDNO:1) GCAGACTTTGGAGCAGCACAATTTCCGGTTGTGGACCCCATGGACCTTG GTTTGGCTGGTACCGTGGAAACTAACGCTCCGGAAGTTTTGGCCAGAGCA AAATACAATTCGAAGGTAGACATATGGAGCGCCGGAATAGTTCTGTTTGA AATGCTCGCATATCCATCAACTCTATTTGAGGACCCGCCGAGTACCCCAC AAGAGTATGTAAAAAGCTGTCATTCTCAACTACTGAGAATAATATCAAAG CTAAAGATAAACCCTGAGGAGTTTCCACGGGAACCAGAGTCTAGGCTCGT GCGCGGATACATCGAATACGCCAGCCTAGAGCGTAAGCCACATACGCGCT ATCCTTGCTTCCAGCGCGTGAACCTACACATTGACGGGGAATTTTTGATC CATAAAATGCTAGCGTTCAATGCTGCGATGCGCCCATCCGCAGAAGAGTT GTTGTCCTACCCAATGTTTATGAATCTGTAGGATGACTAACAGATTTGGG GTGGAGACGGCGTGGGCGATACTGTATAAAGTTGTACTACTTACCAGCCC AGTCAGTGTGCTGTAGTGCCACCACCTGTAAAGCTGTGATAAGCTGCAGT T
[0503] and 4pMCP600
TABLE-US-00002 (SEQIDNO:2) AGCTGGGGGAGTTTGTACTATAGTGTATTACATGCGGCTTGCAATAACT GCCTGGTTTATGTTTCGCAACATTCAAGCAGACATGCTACCGCTAAACA CTTTGCAACAATTTTTTATTGGGTGTTTGGCCTTTGGTAGAACTGTCGC GTTTTTGGTGGTAGCATATACTACCTTATTTATACGCTCCGAGCTGTTT TTCAGCATGCTAGCACCCAACGCCGAGCGAGAGTATATAACTCCCATCA TTGCCCACAAGCTTATGCCACTTATTAGCGTCCGCTCTGCCGTTTGCTT AGTCATAATATCTACCGCCGTTTACGCAGCAGACGCTATCTGCGACACA ATTGGATTTGCGATACCGCGCATGTGGATGTGTATTTTAATGAGATCAA CCTCCATGAAGCGTAACTAGGGGGCCTCCCACTGAGGCACTACCGGCTT AGCAGCTGACTAACACAGTATAAAACGTGAGAAGAAATCAGTCTCATGC GCCATTAGCGCTAGGCTAGTTAGCGTGGAGGACCGGAGCGCTACCGCCA GCAGTTTCATCCGCCTGGTTACGGGTTTGTTAACACCTACCGGTGTTTT ACCGCTACCATA
were synthesized and cloned upstream of a reporter gene encoding the autofluorescent protein mCherry (Shaner et al., 2004). As transcription termination signal and mRNA stabilizing function the bovine growth hormone polyadenylation sequence (BGHpA; Goodwin & Rottman, 1992) was cloned directly downstream at the 3 end of the reporter gene.
[0504] To be used as a positive control the CMV promoter was amplified from the commercially available plasmid pcDNA3.1 (Invitrogen) and cloned upstream of the mCherry reporter gene, here also the BGHpA was added at the 3 end of the reporter gene. Cell cultures were transfected with the three plasmids (pBlu-4pgGmCherry, pBlu-4pMCPmCherry, and pBlu-CMVmCherry) and inspected by fluorescence microscopy for mCherry fluorescence. Strong activity of the CMV promoter was obvious at different times after transfection. The 4pgG600 promoter was also active after transfection, activity of the 4pMCP600 promoter was also detectable, but weak in comparison with the 4pgG600 promoter and even more so when compared with the CMV-promoter even three days after transfection.
[0505] In order to investigate the effect of viral gene products on promoter activity, cell cultures transfected with either pBlu-4pgG600-mCherry or pBlu-4pMCP600-mCherry were superinfected one day after transfection with the green fluorescent EHV-1 RacHI-EF. The viral gene products obviously transactivated the 4pMCP600 promoter to significantly higher activity than in the absence of EHV-1 RacHI-EF replication. The effect was also present in cell cultures transfected with pBlu-4pgG600-mCherry and superinfected with EHV-1 RacHI-EF, albeit not so drastic since the initial activity in the absence of viral replication was higher than observed for pBlu-4pMCP600-mCherry. Still, for both 600 bp promoters a transactivating effect of viral replication on their activities in cell cultures was demonstrated.
[0506] This effect might be explained if the 600 bp sequences contain repressor elements, which are normally located upstream of the activator elements. Consequently, a shorter promoter might be more active in the absence of viral gene products. To test this both EHV-4 promoter sequences were truncated to approximately 75% of their original lengths and tested again.
[0507] In particular the 600 bp promoters were truncated to 430 bp for 4pgG, new name: p430:
TABLE-US-00003 (SEQIDNO:3) TCTATTTGAGGACCCGCCGAGTACCCCACAAGAGTATGTAAAAAGCTGTC ATTCTCAACTACTGAGAATAATATCAAAGCTAAAGATAAACCCTGAGGAG TTTCCACGGGAACCAGAGTCTAGGCTCGTGCGCGGATACATCGAATACGC CAGCCTAGAGCGTAAGCCACATACGCGCTATCCTTGCTTCCAGCGCGTGA ACCTACACATTGACGGGGAATTTTTGATCCATAAAATGCTAGCGTTCAAT GCTGCGATGCGCCCATCCGCAGAAGAGTTGTTGTCCTACCCAATGTTTAT GAATCTGTAGGATGACTAACAGATTTGGGGTGGAGACGGCGTGGGCGATA CTGTATAAAGTTGTACTACTTACCAGCCCAGTCAGTGTGCTGTAGTGCCA CCACCTGTAAAGCTGTGATAAGCTGCAGTT
and to 449 bp for 4pMCP, new name: p455:
TABLE-US-00004 (SEQIDNO:4) TTGGTGGTAGCATATACTACCTTATTTATACGCTCCGAGCTGTTTTTCAG CATGCTAGCACCCAACGCCGAGCGAGAGTATATAACTCCCATCATTGCCC ACAAGCTTATGCCACTTATTAGCGTCCGCTCTGCCGTTTGCTTAGTCATA ATATCTACCGCCGTTTACGCAGCAGACGCTATCTGCGACACAATTGGATT TGCGATACCGCGCATGTGGATGTGTATTTTAATGAGATCAACCTCCATGA AGCGTAACTAGGGGGCCTCCCACTGAGGCACTACCGGCTTAGCAGCTGAC TAACACAGTATAAAACGTGAGAAGAAATCAGTCTCATGCGCCATTAGCGC TAGGCTAGTTAGCGTGGAGGACCGGAGCGCTACCGCCAGCAGTTTCATCC GCCTGGTTACGGGTTTGTTAACACCTACCGGTGTTTTACCGCTACCATA.
mCherry-reporter plasmids containing the shortened promoters were transfected in cell cultures and inspected by fluorescence microscopy. While the p430 activity was comparable to that of the 600 bp version (4pgG600), the activity of the p455 was significantly increased over the activity of the 4pMCP600. This result was in accordance with the results of the transfection/superinfection experiments using the 600 bp versions of the two promoters, namely, that presence of EHV-1 replication in the same cell provided a mechanism of transactivation of the 4pMCP600 promoter increasing its activity strongly while the transactivation of the 4pgG600 promoter was visible but less pronounced.
[0508] In addition to two new promoters also a new polyA sequence was needed for expression from the new orf70 insertion site. The element is called 71 pA. Its nucleotide sequence was synthesized and cloned downstream of the mCherry orf in a transfer plasmid containing the p455 targeted for the orf70 insertion site in pRacH-SE.
[0509] Next, rEHV-1 RacH-SE were generated to assay promoter activities in the background of viral replication (Table 1). The two EHV-4 promoters (p430 and p455), the CMV promoter and the mouse cytomegalovirus IE1 promoter (MCMV) were used to direct expression of mCherry in combination with a BGH polyA signal to increase mRNA stability. The MCMV IE1 promoter (enhancer) as described by Dorsch-Hsler et al. (1985) was synthesized and cloned in a plasmid vector from which it was subcloned into the transfer plasmid. In addition, the p455 was also cloned into the new insertion site in orf70 driving expression of mCherry in combination with the new polyA signal 71 pA. As another control rEHV-1 RacHmC70 was included in the experiments. Cells infected with this recombinant virus express mCherry under control of the endogenous gG promoter (egGp) (Table 1)
TABLE-US-00005 TABLE 1 Orf1/3 insertion site Orf70 insertion site name promoter reporter polyA Promoter reporter polyA 1/3-CMV-mC HCMV IE1 mCherry BGH none none none 1/3-MCMV-mC MCMV IE1 mCherry BGH none none none 1/3-p455-mC p455 mCherry BGH none none none 1/3-p430-mC p430 mCherry BGH none none none 70-egGp-mC none none none endogenous gG mCherry BGH 70-p455-mC none none none p455 mCherry 71pA
[0510] VERO or PK/WRL cells were infected with all six mCherry expressing viruses at a m.o.i. (multiplicity of infection) of 1. Infected cells were collected at 0, 4, 8, and 12 hours p.i. and total RNA was prepared. Viral and cellular genomic DNA contaminating the RNA preparations was destroyed by DNAse I digestion. Integrity of the RNA and removal of viral DNA was shown by reverse transcription with and without addition of reverse transcriptase followed by PCR with a primer pair specific for orf72 (primers no 1130/1131, (TGTCTACCTTCAAGCTTATG (SEQ ID NO:5)/CTAGCGCAGTCGCGTTG (SEQ ID NO:6)) encoding the essential structural glycoprotein D of EHV-1. The expected 196 bp PCR product was amplified only from reverse transcribed samples (cDNA) where reverse transcriptase had been added, specifically the samples prepared at t1=4 h p.i., t2=8 h p.i., and t3=12 h p.i., not from the samples prepared at t0=0 h p.i. All samples where reverse transcriptase had not been added to the reaction did not produce any PCR product as expected. Thus it was shown that the samples (cDNA) that would be used as templates for qPCR did not contain viral genomic DNA.
[0511] The cDNAs obtained from the reverse transcription with added enzyme were then analyzed by qPCR using a primer pair specific for mCherry (primers no. 1079/1080, (GCGAGGAGGATAACATGG (SEQ ID NO:7)/ACCCTTGGTCACCTTCAG (SEQ ID NO:8)) and the orf72 primer pair 1130/1131 (TGTCTACCTTCAAGCTTATG (SEQ ID NO:5)/CTAGCGCAGTCGCGTTG (SEQ ID NO:6)). Ct (cycle threshold) values for the orf72 qPCR were used to assess comparability of the different virus infections run in parallel and to normalize the Ct values for the mCherry qPCR. Thus, transcription of mCherry was quantified relative to the time after infection and to the different viruses (
[0512] As shown
[0513] In a different type of graph two experiments, one using VERO-EU cells (V) and one using PK/WRL cells (P) were combined (
[0514] Although the two experiments in VERO (V) or PK/WRL (P) cells cannot directly be compared, the higher expression levels in PK/WRL cells most likely reflect the superior permissivity of PK/WRL cells for EHV-1 replication which routinely results in ten times higher titers of infectious virus. While activities of the EHV-derived promoters p430, p455 and egGp are almost the same at the respective times p.i. for the used cell line, irrespective of their insertion site or the used poly A (BGH or 71 pA), activities of the CMV- and MCMV promoters are higher in the PK/WRL cells. In VERO-EU cells, only the MCMV promoter was shown to have higher activity, the CMV promoter was not superior to the EHV-promoters.
[0515] From these experiments it was concluded that the EHV-4 promoters p430 and p455 were suitable to be used in the EHV-1 RacH backbone to drive expression of inserted transgenes from both the orf1/3 and the orf70 insertion sites.
Example 3
Use of the New p455 Promoter in Recombinant EHV-1 Vector Vaccines and Construction of a Recombinant Virus
[0516] The p455 Promoter:
[0517] For a first animal experiment an Influenza hemagglutinin subtype H3 from a swine origin Influenza A virus (A/swine/Italy/7680/2001(H3N2), GenBank accession no.: ABS50302.2), SEQ ID NO:27 was used. Its coding sequence was synthesized and subcloned into transfer vector pU70-p455-71K71 (
[0518] By en passant mutagenesis using the RED recombination system (Tischer et al. 2006) the expression cassette p455-H3-71 was inserted in orf70 of pRacH-SE to generate pRacH-SE70-p455-H3 (
[0519] PK/WRL cells were transfected with pRacH-SE70-p455-H3, recombinant virus rEHV-1 RacH-SE70-p455-H3 was rescued and plaque-purified twice. Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA,
[0520] Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot (
[0521] The two blots shown in
[0522] By double immunofluorescence assay (dIFA) of viral plaques in cells infected with P20 using a monoclonal anti-H3 antibody and a horse anti-EHV antiserum, it was confirmed that virtually all EHV-1 induced plaques also express H3 (not shown). All tests confirmed stability of the recombinant EHV-1 RacH-SE-70-p455-H3.
Example 4
Proof of Concept Animal Study (POC I) Using the p455 Promoter and Assessment of the Serological Response
[0523] Test Animals: Inclusion Criteria and Experimental Design:
[0524] Five groups of ten piglets born from Influenza A-naive sows were included in the POC-I study as summarized in table 2.
TABLE-US-00006 TABLE 2 Group No. of animals Route Dose Vaccine Treatment 1 1x NaCl; 10 i.m. 2 ml NaCl; 1x EHV1 vector vaccine 2 ml EHV1, 1.00 107 TCID50 2 2x EHV1 vector vaccine 10 i.m. 2 2 ml EHV1, 1.00 107 TCID50 3 2x NaCl 10 i.m. 2 2 ml NaCl 4 2x Inactivated vaccine 10 i.m. 2 2 ml Inact. 5 2x NaCl 10 i.m. 2 2 ml NaCl Challenge Treatment 1 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 107 VIRUS FROM SWINE TCID50/ml 2 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 107 VIRUS FROM SWINE TCID50/ml 3 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 107 VIRUS FROM SWINE TCID50/ml 4 H3N2 INFLUENZA A 10 Intratracheal 8 ml; 1.00 107 VIRUS FROM SWINE TCID50/ml 5 cell culture medium 10 Intratracheal 8 ml (Negative Control)
[0525] An infectious dose of 110.sup.7 TCID.sub.50 of rEHV-1 RacH-70-p455-H3 (EHV-1) was applied either once at five weeks of age or twice at two and five weeks of age. For comparison commercially available inactivated vaccine (Inact) was applied twice at two and five weeks of age. All piglets were free of maternally derived antibodies in order not to abolish the effect of the inactivated vaccine (Inact). Two groups were not vaccinated but received injections with physiological sodium chloride solution (NaCl) to serve as challenge control or strict negative control, respectively. 21 days after the second vaccination all groups except the strict negative control group were challenged with 110.sup.7 TCID.sub.50 of a heterologous Influenza A (IAV) strain (H3N2 INFLUENZA A VIRUS FROM SWINE R452-14, challenge isolate owned by BI). While in the non-vaccinated challenge control group (Chall ctrl) all pigs had high influenza virus titers in their lungs at one and three days after challenge infection, all pigs in the strict negative control group (neg ctrl) and the group that had been vaccinated twice (EHV 2) with rEHV-1 RacH-SE-70-p455-H3 were negative for IAV at both days. In the group vaccinated twice with the inactivated control vaccine (Inact 2), one of five animals had a low IAV titer at day three after challenge. In the group vaccinated once (EHV 1) 21 days prior to challenge with rEHV-1 RacH-SE-70-455-H3, two of five animals had low IAV titers in their lungs one day after challenge infection and one of five at three days after challenge. (
[0526] Two vaccinations with 110.sup.7 TCID.sub.50 of rEHV-1 RacH-SE-70-p455-H3 completely protected pigs against challenge infection with a heterologous IAV, subtype H3N2. It was demonstrated that the EHV-1 vector RacH-SE is suitable for vaccination of pigs and that the new promoter 455 is functional in driving immunogenic expression of IAV hemagglutinin in vaccinated pigs.
Example 5
Use of the New p430 Promoter in Recombinant EHV-1 Vector Vaccines and Construction of a Recombinant Virus
[0527] The p430 Promoter:
[0528] The newly identified p430 promoter was used to drive expression of another Influenza hemagglutinin from an H1N1 virus ((A/swine/Gent/132/2005(H1N1), GenBank accession no.: AFR76623.1), SEQ ID NO:28. Since the hemagglutinin gene in this virus isolate is from a Swine IAV of the avian type IAV it will be referred to as H1av. H1av was synthesized and subcloned in a transfer vector for the orf1/3 insertion region, pU1/3-p430-BGH_K_BGH (
[0529] By en passant mutagenesis using the RED recombination system (Tischer et al. 2006) the expression cassette p430-H1av-BGH was inserted in orf1/3 of pRacH-SE to generate pRacH-SE1/3-p430-H1av (
[0530] PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av, recombinant virus rEHV-1 RacH-SE1/3-p430-H1av was rescued and plaque-purified twice. Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA) and Western blot using commercially available monoclonal and polyclonal antibodies (
[0531] Specific detection of a broad band migrating at 75 kDa by antibody PA-34929 is in concordance with the expected appearance of the recombinant HA glycoprotein as predicted from its sequence. Apparent staining of cellular membranes with the monoclonal antibody C102 is in line with the subcellular localization as expected (
[0532] In order to test whether the expressed recombinant hemagglutinins were processed and transported as expected, VERO-cells were infected with rEHV-1 RacH-SE-1/3-p430-H1av, rEHV-1 RacH-SE-70-p455-H3, rEHV-1 RacH-SE (parent) at an m.o.i. of 0.01, or left uninfected. 24 h p.i. live infected and uninfected cells were incubated with a suspension of chicken erythrocytes in PBS, washed with PBS and stained with the fluorescent Hoechst 33342 nuclear stain. Since erythrocytes of birds contain cell nuclei they can be stained with Hoechst33342 and appear as tiny blue specks by fluorescence microscopy, Compared with cells that were infected with rEHV-1 RacH-SE that does not express hemagglutinin, adsorption of chicken erythrocytes was significantly increased on cells infected with either rEHV-1 RacH-SE-1/3-p430-H1av or rEHV-1 RacH-SE-70-p455-H3 (not shown). From this it can be concluded that the hemagglutinins were translated, processed and transported to the plasma membrane of vector virus infected cells in a manner as if they were produced by authentic influenza virus infection.
[0533] The clear phenotype of hemadsorption of infected cells supports the findings of the Western blots and immunofluorescence assays showing efficient expression of the transgenic proteins and suggesting formation of functional HA trimers on the cell surface of EHV-1 vector infected cells.
Example 6
Use of the Two New Promoters p455 and p430 in Recombinant EHV-1 Vector Vaccines in Two Insertion Sites in Parallel
[0534] To show that the two new promoters can be used in parallel a recombinant EHV-1 RacH was generated expressing two different hemagglutinins of two different Influenza A virus subtypes.
[0535] Specificity and lack of cross-reactivity of the polyclonal commercial antibodies to H3 (PA5-34930) and H1 (PA5-34929) was verified by Western blots of infected cells infected with single-insert viruses rEHV-1 RacH-SE-70-p455-H3 and rEHV-1 RacH-SE-1/3-p430-H1av (not shown).
[0536] Starting with the recombinant BAC pRacH-SE-70-p455-H3, the expression cassette p430-H1av-BGH as assembled in the transfer vector pU1/3-p430-H1av-BGHKBGH (
[0537] The short designation for this recombinant virus is rEHV-1 RacH-SE_B. Correct insertion of the expression cassette was verified by sequencing of high-fidelity PCR products of the insertion regions together with flanking sequences. Expression of the transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blot using commercially available monoclonal and polyclonal antibodies (
[0538] As shown in
[0539] The two new promoters p430 and p455 were shown to be functional in the context of rEHV1-RacH replication in cell cultures. Activity levels during the viral replication cycle appear to be very similar as deduced from in vitro promoter kinetic experiments. These properties allow creation of recombinant vector vaccines based on EHV-1 RacH or other vector platforms expressing two different antigens in parallel with similar efficiency. If a vaccine target consists of two different pathogens application of the two new promoters in two insertion sites combined with two polyadenylation sequences can reduce cost of goods significantly and represents a clear advantage over a vector expressing only one antigenic component.
Example 7
Generation, In Vitro Characterization and In Vivo Testing of a Monovalent Ehv-1 Vectored Influenza a Virus Vaccine (H3 Vaccine) for Swine
[0540] Swine IAV Influenza virus hemagglutinin of serotype H3 (SEQ ID NO 27) (A/swine/Italy/7680/2001(H3N2), GenBank accession no.: ABS50302.2) was chosen as antigen to be tested for vaccination study in pigs. This new vaccine against swine IAV provides a DIVA feature, e.g. by detection of antibodies against Swine IAV proteins NP or NA in animals that were infected by Swine IAV field strains but not in animals only vaccinated with the vaccine described here since it only expresses one Swine IAV HA protein. Its coding sequence was synthesized and subcloned generating the transfer vector pU70-p455-H3-71K71, placing H3 under control of the new p455 promoter and the new 71 pA polyadenylation signal and framing the cassette with the recombination regions for insertion into orf70 (
[0541] By en-passant mutagenesis using the RED recombination system the expression cassette p455-H3-71 was inserted in orf70 of pRacH-SE to generate pRacH-SE70-p455-H3.
[0542] PK/WRL cells were transfected with pRacH-SE70-p455-H3, recombinant virus rEHV-1 RacH-SE70-p455-H3 was rescued and plaque-purified twice (
[0543] Correct insertion of the expression cassette was verified by sequencing of a high-fidelity PCR product of the insertion region. Expression of the transgene in infected cells was analyzed by indirect immunofluorescence assay (IFA,
[0544] Restoration of orf71 encoding EHV-1 gpII was confirmed by IFA (not shown) and Western blot (
[0545] The two blots shown in
[0546] By double immunofluorescence assay (dIFA) of viral plaques in cells infected with P20 using a monoclonal anti-H3 antibody and a horse anti-EHV antiserum, it was confirmed that virtually all EHV-1 induced plaques also express H3 (not shown). All tests confirmed stability of the recombinant EHV-1 RacH-SE-70-p455-H3.
[0547] To investigate its properties as a vectored vaccine in young piglets, rEHV-1 RacH-SE-70-p455-H3 was tested in a vaccination-challenge study. In detail, piglets without maternally derived immunity against Swine IAV (no maternal antibodies) were vaccinated twice with cell culture supernatant containing RacH-SE-70-p455-H3 at a dose of 1107 TCID50 intramuscularly at an age of two and five weeks (two-shot vaccination, 2EHV-1), or at an age of five weeks only (one-shot vaccination, 1EHV-1). A non-vaccinated group served as negative control and a group of animals that were vaccinated at two and five weeks of age with a commercially available inactivated Swine IAV vaccine according to the manufacturer's instructions (but for the time points of vaccination) served as positive control (killed). At an age of 8 weeks, all animals but the negative control were challenged by an intratracheally applied dosage of 1107 TCID50 of an H3N2 Swine IAV challenge strain (European field virus isolate R452-14 whose H3 is being heterologous to the H3 vaccine antigen used in RacH-SE-70-p455-H3). Non-vaccinated and unchallenged animals served as negative control, while non-vaccinated but challenged animals served as challenge control. At and after vaccinations and before and after challenge, body temperatures were measured and blood samples were taken at different time points. One day after challenge, half of the animals per group were killed and the lungs were scored for lesions typical for Swine IAV infection, three lung samples per left and right lung were taken per animal, respectively, to determine infectious Swine IAV titers in lung homogenates, and bronchi alveolar lavage fluid (BALF) was sampled. The same procedure was performed with the remaining half on animals per group three days after challenge.
[0548] When investigating the body temperature rise after Swine IAV challenge virus application, non-vaccinated animals showed a body temperature increase of about 1 C. 1 day after challenge. This body temperature increase 1 day after challenge was prevented for the group vaccinated twice with the RacH-SE-70-p455-H3 vaccine (
[0549] Assessment of the lung scores from animals killed at 1 or 3 days after Swine IAV challenge virus application revealed that the negative control showed no lung lesions typical for Swine IAV infection, the challenge control showed lung lesions in the mean range of 6-7%, and that regarding the group mean values lung lesion scores were strongly reduced to one to less than 4% for the group vaccinated twice with the RacH-SE-70-p455-H3 vaccine (
[0550] The mean Swine IAV lung titers from animals killed at 1 or 3 days after Swine IAV challenge virus application showed that the negative control showed no Swine IAV in lung samples, whereas the challenge control showed virus titers per g lung tissue in the range of more than 5 (day 3) to more than 7 logs (day 1). In stark contrast, the group mean values were strongly reduced to about two logs or less for the group vaccinated once with the RacH-SE-70-p455-H3 vaccine and reduced to undetectable levels for the group vaccinated twice with the RacH-SE-70-p455-H3 vaccine (
[0551] When testing the induction of Swine IAV neutralizing antibodies after vaccination, sera from animals vaccinated once with the RacH-SE-70-p455-H3 vaccine showed reciprocal neutralization titers in the range of about 160 three weeks after first vaccination and sera from animals vaccinated twice with the RacH-SE-70-p455-H3 vaccine showed neutralizing titers of about 2560 three weeks after 2.sup.nd vaccination, while sera from the non-vaccinated groups had no detectable Swine IAV neutralizing antibody levels (
[0552] When determining the amounts of pro-inflammatory cytokine IL-1 in BALF from animals 1 or 3 days after Swine IAV challenge, IL-1 levels of more than 100 pg/ml up to 900 pg/ml were detectable in three of four animals tested at day 1, whereas these levels were reduced to 100-300 pg/ml IL-1 for BALFs from animals vaccinated once with the RacH-SE-70-p455-H3 vaccine and even further reduced to levels of 0 to less than 100 pg/ml IL-1 for all animals vaccinated twice with the RacH-SE-70-p455-H3 vaccine (
[0553] When testing restimulation of peripheral blood mononuclear cells (PBMCs) sampled at study day 28 and using different stimuli, stimulation of PBMCs from non-vaccinated animals showed less than 75/1106 counts in IFN-ELISpot irrespective of the stimuli used (
Example 8
Generation, In Vitro Characterization and In Vivo Testing of a Tetravalent Ehv-1 Vectored Influenza A Virus Vaccine for Swine
[0554] As described below, in the described invention the four above-described Swine IAV hemagglutinin (HA) antigens derived from H1N2, H3N2, H1N1 avian, and H1N1 pandemic Swine IAV sub-/serotypes are expressed by two recombinant EHV-1 vector viruses. This new tetravalent vaccine against swine IAV provides a DIVA feature, e.g. by detection of antibodies against Swine IAV proteins NP or NA in animals that were infected by Swine IAV field strains but not in animals only vaccinated with the vaccine described here since it only expresses the Swine IAV HA proteins.
[0555] The new tetravalent Swine IAV vaccine was characterized in vitro and is tested in vivo for its efficacy against Swine IAV.
[0556] The newly identified p430 promoter was used to drive expression of Swine IAV H1N1 ((A/swine/Gent/132/2005(H1N1), GenBank accession no.: AFR76623.1). Since the hemagglutinin gene in this virus isolate originated from an avian IAV it will be referred to as H1av. H1av was synthesized and subcloned in a transfer vector for the orf1/3 insertion region to generate pU1/3-p430-H1av-BGH_K_BGH. Expression of H1av was placed under control of the p430 promoter and the bovine growth hormone (BGH) polyA signal and framed with the recombination regions for insertion into orf1/3 (
[0557] By en-passant mutagenesis using the RED recombination system the expression cassette p430-H1av-BGH was inserted in orf1/3 of pRacH-SE to generate pRacH-SE1/3-p430-H1av. PK/WRL cells were transfected with pRacH-SE1/3-p430-H1av, recombinant virus rEHV-1 RacH-SE1/3-p430-H1av (
[0558] Specific detection of a broad band migrating at 75 kDa by antibody PA-34929 is in concordance with the expected appearance of the recombinant HA glycoprotein as predicted from its sequence. Apparent staining of cellular membranes with the monoclonal antibody C102 is in line with the subcellular localization as expected.
[0559] In order to test whether the expressed recombinant hemagglutinins were processed and transported as expected, VERO-cells were infected with rEHV-1 RacH-SE-1/3-p430-H1av, rEHV-1 RacH-SE-70-p455-H3, rEHV-1 RacH-SE (parent) at an m.o.i. of 0.01, or left uninfected. 24 h p.i. live infected and uninfected cells were incubated with a suspension of chicken erythrocytes in PBS, washed with PBS and stained with the fluorescent Hoechst 33342 nuclear stain. Since erythrocytes of birds contain cell nuclei they can be stained with Hoechst 33342 and appear as tiny blue specks by fluorescence microscopy, compared with cells that were infected with rEHV-1 RacH-SE that does not express hemagglutinin, adsorption of chicken erythrocytes was significantly increased on cells infected with either rEHV-1 RacH-SE-1/3-p430-H1av or rEHV-1 RacH-SE-70-p455-H3 (not shown). From this it can be concluded that the hemagglutinins were translated, processed and transported to the plasma membrane of vector virus infected cells in a manner as if they were produced by authentic influenza virus replication. The phenotype of hemadsorption of infected cells supports the findings of the Western blots and immunofluorescence assays (for H1av,
[0560] Specificity and lack of cross-reactivity of the polyclonal commercial antibodies to H3 (PA5-34930) and H1 (PA5-34929) was verified by Western blots of infected cells infected with single-insert viruses rEHV-1 RacH-SE-70-p455-H3 and rEHV-1 RacH-SE-1/3-p430-H1av (not shown).
[0561] Next, a recombinant EHV-1 RacH-SE was generated expressing two different hemagglutinins of two different Influenza A virus sub-/serotypes.
[0562] Starting with the recombinant BAC pRacH-SE-70-p455-H3, the expression cassette p430-H1av-BGH as assembled in the transfer vector pU1/3-p430-H1av-BGH_K_BGH (
[0563] Expression of the transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blot using commercially available monoclonal and polyclonal antibodies (
[0564] Both transgenes H3 and H1av were expressed in parallel in cell cultures infected with the dual insert recombinant rEHV-1 RacH-SE_B. Transgene expression was stable and did not impair viral titers tested until passage 11 in PK/WRL cells.
[0565] The enhanced EHV-1 vector with two insertion sites and two new promoters was shown to express two Influenza virus hemagglutinins in parallel. Subcellular localization as determined by IFA and mobility in SDS-PAGE as determined by Western blot corresponded to authentic hemagglutinins expressed in Influenza A virus infected cells known from the literature.
[0566] Next, a second double-insert rEHV-1 RacH expressing hemagglutinins H1hu, SEQ ID NO:29, (A/swine/Italy/4675/2003(H1N2); GenBank accession no. ADK98476.1) and H1pdm, SEQ ID NO:26, (A/swine/Italy/116114/2010(H1N2); GenBank accession no. ADR01746.1) was generated.
[0567] The coding sequence of H1hu was synthesized and subcloned in a transfer vector for the orf1/3 insertion region to generate pU1/3-p430-H1hu-BGHKBGH. Expression of H1hu was placed under control of the p430 promoter and the bovine growth hormone (BGH) polyA signal and framed with the recombination regions for insertion into orf1/3 (
[0568] The coding sequence of H1pdm was synthesized and subcloned generating the transfer vector pU70-p455-H1pdm-71K71, placing H1pdm under control of the new p455 promoter and the new 71 pA polyadenylation signal and framing the cassette with the recombination regions for insertion into orf70 (
[0569] Subsequently, the expression cassettes p430-H1av-BGH and p455-H1pdm-71 were inserted into pRacH-SE by en-passant mutagenesis using the RED recombination system, generating pRacH-SE-1/3-p430-H1hu first. Using this modified BAC as the target, p455-H1pdm-71 was inserted by en passant mutagenesis using the RED recombination system, generating pRacH-SE-1/3-p430-H1hu-70-p455-H1pdm. pRacH-SE-1/3-p430-H1hu-70-p455-H1pdm was transfected in PK/WRL cells and rEHV-1 RacH-SE-1/3-p430-H1hu-70-p455-H1pdm was rescued and plaque purified three times. The short designation of the new recombinant vector virus is rEHV-1 RacH-SE_D (
[0570] Expression of the transgenes in infected cells was analyzed by indirect immunofluorescence assay (IFA, not shown) and Western blot using commercially available monoclonal and polyclonal antibodies (
[0571] Genetic and phenotypic stabilities of the recombinant rEHV-1 were shown by passaging in cell culture, determining viral titers every 5 passages. Sequences of the insertion regions were confirmed every ten passages as well as transgene expression by Western blot (not shown). Expression fidelity was assessed by double IFA of plaques under methocel-overlay, counting plaques stained with anti-EHV-antibodies and transgene-specific antibodies (not shown).
[0572] To investigate its properties as a vectored vaccine in young piglets, the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D is tested in a vaccination-challenge study. In detail, piglets with maternally derived immunity against Swine IAV (positive for maternal antibodies) are vaccinated twice with rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D at a dose of 1107 TCID50 per vaccine strain intramuscularly at an age of one and four weeks (two-shot vaccination, 2EHV-1) or at an age of four weeks only (one-shot vaccination, 1EHV-1). A non-vaccinated group serves as negative control. At an age of 11 weeks, all animals but the negative control are challenged by an intratracheally applied dosage of 1106 TCID50 of an H3N2 Swine IAV challenge strain (European field virus isolate R452-14 whose H3 is being heterologous to the H3 vaccine antigen used in rEHV-1 RacH-SE_B). Non-vaccinated and unchallenged animals serve as negative control, while non-vaccinated but challenged animals serve as challenge control. At and after vaccinations and before and after challenge, body temperatures are measured and blood samples are taken at different time points. One day after challenge, half of the animals per group are killed and the lungs are scored for lesions typical for Swine IAV infection, three lung samples per left and right lung are taken per animal, respectively, to determine infectious Swine IAV titers in lung homogenates, and bronchi alveolar lavage fluid (BALF) is sampled. The same procedure is performed with the remaining half on animals per group three days after challenge. Sample material and collected data is analyzed to determine, among others, body temperature changes after challenge, clinical signs after Swine IAV infection, lung scores, Swine IAV lung titers, histological changes in lung tissue, Swine IAV serum neutralization titers, cytokine levels in BALF, restimulation of PBMCS as measured by IFN-ELISpot, and B-cell activation.
Example 9
Induction of a Neutralizing Antibody Response Against Two Antigens in Mice Vaccinated with a Bivalent Rehv-1 Rach Vector Vaccine
[0573] The rEHV-1 RacH SE_B (rEHV-1 RacH-SE-1/3-p430-H1av-7-p455-H3 see
[0574] In detail, three groups of five Balb/c mice per group, 3-5 weeks of age, were intranasally inoculated on study days 0 and 21 either with 40 l of rEHV-1 RacH SE_B (rEHV-1 RacH-SE-1/3-430-H1av-7-455-H3, group 1), or 40 l of empty vector (rEHV-1 RacH-SE, group 2, vector control), or 40 l of tissue culture medium (group 3 negative control), respectively. For groups 1 and 2, infectious recombinant EHV-1 dosages were 1105 TCID50/40 l, respectively. Mice were bled on study days 0 (before 1.sup.st inoculation), 7, 14, 21 (before 2.sup.nd inoculation), 28, and 35. Serum was prepared from the blood samples and stored frozen at 80 C.
[0575] Immunofluorescence Assay for Detection of Antibodies Against the Vector Virus
[0576] AI-ST cells were infected at a multiplicity of infection (MOI) of 0.001 with rEHV-1 RacH-SE1212, a virus rescued from the empty vector BAC pRacH-SE1.2. 24 hours p.i. distinctive plaques were observed and cells were processed for indirect immunofluorescence assay (IFA). Sera of all three groups of the final bleeds (obtained 14 days after the second vaccination) diluted 1:50 in PBS were tested. As positive control serum from an EHV-1 vaccinated horse was used in a dilution of 1:500. Secondary antibodies were commercially available FITC-conjugated rabbit anti-mouse IgG for the mice sera and Cy5-conjugated goat-anti horse IgG for the horse serum and used at 1:200 dilution. Antibody binding was evaluated by fluorescence microscopy. All vaccinated mice had developed antibodies reactive in IFA with rEHV-1 RacH-SE-infected cells. Uninfected cells were not bound by any of the tested sera. Sera from the negative control group of mice did not show any specific binding neither to infected nor to uninfected cells. Data are summarized in the table below.
TABLE-US-00007 TABLE 3 Fluorescence microscopy results of IFA for anti-EHV-1 antibodies Unin- In- Mouse ID in ex- fected fected Treatment number periment dilution cells cells Group 3 1 1 1:50 neg neg (Negative control) 2 2 1:50 neg neg 3 3 1:50 neg neg 4 4 1:50 neg neg 5 5 1:50 neg neg Group 2 (Empty 1 6 1:50 neg pos vector) 2 7 1:50 neg pos 3 8 1:50 neg pos 4 9 1:50 neg pos 5 10 1:50 neg pos Group 1 (rEHV- 1 11 1:50 neg pos 1 RacH SE B) 2 12 1:50 neg pos 3 13 1:50 neg pos 4 14 1:50 neg pos 5 15 1:50 neg pos Control Specific for antibody Horse serum EHV-1 22 1:500 neg pos Secondary Specific for antibodies FITC-goat anti- mouse 23 1:200 neg neg Cy5 goat anti- horse 24 1:200 neg neg
[0577] From this it can be concluded that inoculation of the rEHV-1 into the nostrils of the mice resulted in infection and viral replication, so that the mice immune systems were stimulated to produce anti-EHV-1 antibodies.
[0578] Virus Neutralization Tests
[0579] In order to show induction of protective immunity against the expressed transgenes originating either from Influenza A virus (IAV) (A/swine/Italy/7680/2001(H3N2)) or (A/swine/Gent/132/2005(H1N1)) the mice sera were tested for neutralizing activity against the respective viruses (Allwinn et al. 2010; Trombetta et al. 2014). IAV used for neutralization tests were isolates from pigs in Germany from 2014, specifically A/swine/Germany/AR452/2014 (H3N2) and A/swine/Germany/AR1181/2014 (H1N1). As these are heterologous from the strains the vaccine targets were derived from, any neutralization of these viruses by the mouse sera will be indicative of broad and efficient induction of protective immunity by the rEHV-1 vaccination.
[0580] As a negative control serum, a serum from a pig which had been shown to be negative for Influenza virus antibodies was used.
[0581] Influenza A Virus Neutralization Tests (VNT):
[0582] MDCK cells for virus neutralization as well as back-titration in 96-well plates were incubated for two days at 37 C./5% CO.sub.2 prior to use. The respective IAV stocks H3N2 and H1 avN1 were thawed on ice and diluted in MEM containing Gentamycin and the double concentration of trypsin (MEM/Genta/2 trypsin).
[0583] Sera tested were from the final bleeds of group 1 (rEHV-1 RacH SE B), group 2 (empty vector), a positive control (serum from a pig vaccinated with inactivated multivalent IAV vaccine, and a negative control.
[0584] Sera were heat inactivated and in two and three independent tests, respectively, serially 1:2 diluted starting at 1:16 up to 1:4096. IAV was diluted to approximately 100 TCID50/neutralization reaction. Neutralization reactions were incubated for 2 hours at 37 C., 5% CO.sub.2. Back-titration of used virus was done in quadruplicate. Growth medium was removed and MDCK-cells were washed with medium containing Gentamycin and trypsin before adding the neutralization reactions or the virus dilutions of the back-titrations. VNT and titration plates were incubated at 37 C./5% CO.sub.2 for 1 h after addition of neutralization reaction or virus dilutions to the MDCK-cells, respectively. Thereafter inocula were removed and cells were overlaid with fresh medium containing Gentamycin and trypsin. Five days p.i. CPE was monitored and documented. Actually used virus titer in the test was calculated as TCID50/ml according to Reed and Munch and dilutions at which the tested sera prevented induction of Influenza virus-typical CPE were reported, see tables below.
TABLE-US-00008 TABLE 4 Results Influenza H1avN1 VNT H1avN1 VNT#1 VNT#2 VNT#3 146 32 181 TCID50/well TCID50/well TCID50/well Reciprocal Reciprocal Reciprocal Average SD neutralizing neutralizing neutralizing neutralizing (standard mouse dilution capacity dilution capacity dilution capacity capacity deviation) rEHV-1 32 4672 128 4096 32 5792 4853 862 RacH SE B-1 rEHV-1 16 2336 64 2048 neg 2192 204 RacH SE B-2 rEHV-1 32 4672 128 4096 16 2896 3888 906 RacH SE B-3 rEHV-1 128 18688 512 16384 64 11584 15552 3624 RacH SE B-4 rEHV-1 32 4672 256 8192 16 2896 5253 2695 RacH SE B-5 Empty n.d. n/a neg n/a neg n/a n/a n/a vector-1 Empty n.d. n/a neg n/a neg n/a n/a n/a vector-2 Empty n.d. n/a neg n/a neg n/a n/a n/a vector-3 Empty neg n/a neg n/a neg n/a n/a n/a vector-4 Empty n.d. n/a neg n/a neg n/a n/a n/a vector-5 Pos 32 n/a n.d n/a n.d n/a n/a n/a control pig serum
TABLE-US-00009 TABLE 5 Results Influenza H3N2 VNT H3N2 VNT#1 VNT#2 VNT#3 16 24 15 TCID50/well TCID50/well TCID50/well Reciprocal Reciprocal Reciprocal Average neutralizing neutralizing neutralizing neutralizing mouse dilution capacity dilution capacity dilution capacity capacity SD rEHV-1 4096 65536 1024 24576 2048 30720 40277 22089 RacH SE B-1 rEHV-1 1024 16384 512 12288 128 1920 10197 7455 RacH SE B-2 rEHV-1 1024 16384 512 12288 256 3840 10837 6397 RacH SE B-3 rEHV-1 256 4096 256 6144 64 960 3733 2611 RacH SE B-4 rEHV-1 256 4096 128 3072 64 960 2709 1599 RacH SE B-5 Empty neg n/a neg n/a neg n/a n/a n/a vector-1 Empty neg n/a neg n/a neg n/a n/a n/a vector-2 Empty neg n/a neg n/a neg n/a n/a n/a vector-3
[0585] In order to compare results of independent tests neutralizing capacity was calculated by multiplication of the reciprocal serum dilution and the respective titer that was neutralized by it. Averages of three tests were then divided by 100 to reflect neutralization of 100 TCID50 (Tables 3, 4 and 5). Data are summarized and shown graphically in
[0586] All mice vaccinated with rEHV-1 RacH SE B had developed neutralizing antibodies against the respective IAV, heterologous strains of subtypes H3N2 and H1avN1. Thus, twofold intranasal application of rEHV-1 RacH-SE expressing hemagglutinins of IAV from the orf70 insertion site under control of the p455 promoter (H3) and in parallel from the orf1/3 insertion site under control of the p430 promoter (H1av), successfully stimulated protective immune response in BALB/c mice.
[0587] It can be concluded that the vector rEHV-1 RacH-SE can be used for parallel expression of two different transgenes to stimulate immune response after intranasal vaccination.
Example 10
Efficacy of Tetravalent Swine IAV Vaccine Consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D Against Swine IAV H3N2 Challenge in Piglets
[0588] To investigate its properties as a vectored vaccine in young piglets, the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B (rEHV-1 RacH-SE-1/3-p430-H1av-70-p455-H3, see
[0589] In this second study, piglets from unvaccinated sows and tested serologically negative for swine IAV-specific antibodies by use of an H3-specific ELISA (
[0590] One day after challenge, half of the animals per group were killed and three lung samples per left and per right lung were taken per animal, respectively. Then, infectious swine IAV titers per gram lung homogenate were determined for each animal as an average of the left and right lungs per animal that each were obtained from homogenates of the pooled three samples per left or right lung and that were normalized to the total weight of the three samples of the left or the right lung, respectively. The same procedure was performed with the remaining half of animals per group three days after challenge. For all vaccinated groups, the medians of titers of infectious swine IAV obtained from individual animals in the group were statistically significantly reduced for samples taken at day one after challenge (CH+1) when compared to the challenge control group, while all animals from the negative control group showed no infectious swine IAV virus titers in their lung homogenates (
[0591] Moreover, serum taken from study animals at study day 0 (SD0, before first vaccination), at study day 21 (SD21, before second vaccination), and at study days 42 or 43 (SD42/43, before application of challenge material) was analyzed by an enzyme-linked immunosorbent assay (ELISA) specific for swine immunoglobulin G (IgG) directed against a recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B. While mean OD values of sera from the negative control group gave only very low values for all time points measured, sera from vaccinated groups demonstrated a strong increase of OD values after two intramuscular applications (2IM; SD21 and SD42/43), after first intranasal and then intramuscular application (IN+IM; SD42/43), and after two intranasal applications (2IN; SD42/43);
[0592] In addition, peripheral blood mononuclear cells (PBMCs) were purified from blood taken from study animals at study day 28 (SD28). The PBMCs then were restimulated either with H3N2 swine IAV challenge strain R452-14 at a multiplicity on infection of 1 (H3N2 MOI 1) or with recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B at a concentration of 1 g/ml (rH3 1 g/ml). Using the restimulated PBMCs, an interferon gamma-specific enzyme-linked immunosorbent spot assay (IFN ELISpot) was performed, and the obtained values normalized to 106 cells and calculated as means per group, respectively (
[0593] Thus, vaccination of piglets with tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a detectable serological and cellular immune response in piglets and demonstrated vaccine efficacy by statistically significantly reducing swine IAV loads in lung homogenates one and three days after heterologous swine IAV challenge.
Example 11
Efficacy of Tetravalent Swine IAV Vaccine Consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D Against Swine IAV H3N2 Challenge in Piglets with Maternally Derived Antibodies
[0594] To investigate its properties as a vectored vaccine in young piglets, the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D was tested in a third vaccination-challenge study.
[0595] In this third study, piglets born by and colostrum- and milk-fed by sows that were vaccinated twice during pregnancy with a commercially available inactivated vaccine against swine IAV were used. Piglets were tested serologically positive for swine IAV-specific antibodies by use of a H3-specific ELISA (
[0596] Five days after challenge animals were killed and three lung samples per left and per right lung were taken per animal, respectively. Then, infectious swine IAV titers per gram lung homogenate were determined for each animal as an average of the left and right lungs per animal that each were obtained from homogenates of the pooled three samples per left or right lung and that were normalized to the total weight of the three samples of the left or the right lung, respectively. For all vaccinated groups, the medians of titers of infectious swine IAV obtained from individual animals in the group were statistically significantly reduced for samples taken at day five after challenge (CH+5) when compared to the challenge control group, while all animals from the negative control group showed no infectious swine IAV virus titers in their lung homogenates (
[0597] Moreover, serum taken from study animals at study day 0 (SD0, before first vaccination), at study day 21 (SD21, before second vaccination), and at study day 35 (SD35, two weeks after second vaccination) was analyzed by an enzyme-linked immunosorbent assay (ELISA) specific for swine immunoglobulin G (IgG) directed against a recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B. While mean OD values of sera from the negative control group gave only very low values for SD21 and SD35, sera from vaccinated groups demonstrated a strong increase of OD values after two intramuscular applications (2IM; SD35), after first intranasal and then intramuscular application (IN+IM; SD35), and after two intranasal applications (2IN; SD35);
[0598] In addition, peripheral blood mononuclear cells (PBMCs) were purified from blood taken from study animals at study day 28 (SD28). The PBMCs then were restimulated either with H3N2 swine IAV challenge strain R452-14 at a multiplicity on infection of 1 (H3N2 MOI 1) or with recombinantly expressed swine IAV H3 antigen being homologous to the H3 expressed by vaccine strain rEHV-1 RacH-SE_B at a concentration of 1 g/ml (rH3 1 g/ml). Using the restimulated PBMCs, an interferon gamma-specific enzyme-linked immunosorbent spot assay (IFN ELISpot) was performed, and the obtained values normalized to 106 cells and calculated as means per group, respectively (
[0599] Thus, vaccination of piglets with tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D induced a detectable serological and cellular immune response in piglets and demonstrated vaccine efficacy by statistically significantly reducing swine IAV loads in lung homogenates five days after heterologous swine IAV challenge.
Example 12
The Tetravalent Swine IAV Vaccine Consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D Provides a Diagnostic Differentiation of Infected from Vaccinated Animals (DIVA) Feature Based on IAV Nucleoprotein (NP)-Specific Antibodies
[0600] To assess the serological DIVA properties of the tetravalent Swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D, piglets born by and colostrum- and milk-fed by sows that were vaccinated twice during pregnancy with a commercially available inactivated vaccine against swine IAV were vaccinated twice with the tetravalent vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D. Animals were vaccinated the first time in their first week of life and the second time in their fourth week of life, respectively, either intramuscularly and then intramuscularly (2IM), or first intranasally and then intramuscularly (IN+IM), or twice intranasally (2IN), at a dose of 1107 TCID50 in a 2 ml dose per vaccine strain, animal, and vaccination, respectively. A non-vaccinated group served as negative control (neg. ctrl.). For the 2IM, IN+IM, 2IN, and neg. ctrl. groups, five animals per group were used and serum samples were taken before first vaccination (
[0601] The sera described above were tested in an ELISA detecting swine IAV nucleoprotein (NP)-specific IgG (
[0602] The fact that the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D did not induce a strong induction of detectable NP-specific antibodies in vaccinated piglets demonstrated a serological diagnostic marker allowing a differentiation of infected from vaccinated animals (DIVA) and a differentiation of vaccinated animals from animals that were vaccinated with a conventional NP-containing inactivated swine IAV vaccine.
[0603] This DIVA feature is exploited for commercial test development accompanying the use of the tetravalent swine IAV vaccine consisting of rEHV-1 RacH-SE_B and rEHV-1 RacH-SE_D and to support eradication measures against swine IAV.
[0604] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the following claims.
REFERENCES
[0605] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0606] 1. Allwinn R, Geiler J, Berger A, Cinatl J, Doerr H W. 2010. Determination of serum antibodies against swine-origin influenza A virus H1N1/09 by immunofluorescence, haemagglutination inhibition, and by neutralization tests: how is the prevalence rate of protecting antibodies in humans? Med Microbiol Immunol. 199(2):117-21. doi: 10.1007/s00430-010-0143-4. Epub 2010 Feb. 17. [0607] 2. Boshart M, Weber F, Jahn G, Dorsch-Hsler K, Fleckenstein B, Schaffner W. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41(2):521-30. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus Author links open the overlay panel. [0608] 3. Brown, I. H., Chakraverty P., Harris P. A., Alexander D. J. 1995. Disease outbreaks in pigs in Great Britain due to an influenza A virus of H1N2 subtype. Vet Rec., (13):328-9. [0609] 4. Brown I H. The epidemiology and evolution of influenza viruses in pigs. 2000. Vet Microbiol., 74(1-2):29-46 [0610] 5. Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A., and Alcami, A. 2003. Glycoprotein G isoforms from some alpha herpesviruses function as broad-spectrum chemokine binding proteins. The EMBO Journal Vol. 22 (4): 833-846. [0611] 6. Bustin, S. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology 25(2): 169-193. [0612] 7. Colle, C. F. 3rd, O'Callaghan, D. J. 1995. Transcriptional analyses of the unique short segment of EHV-1 strain Kentucky A. Virus Genes; 9(3):257-68. [0613] 8. Dorsch-Hsler, K., Keil, G. M., Weber, F., Jasin, M. Schaffner, W., and Koszinowski, U. H. 1985. A long and complex enhancer activates transcription of the gene coding for the highly abundant immediate early mRNA in murine cytomegalovirus. PNAS Vol. 82: 8325-8329. [0614] 9. Drummer, H. E., Studdert, M. J., Crabb, B. S. 1998. Equine herpesvirus-4 glycoprotein G is secreted as a disulphide-linked homodimer and is present as two homodimeric species in the virion. J. Gen. Virol. 79: 1205-1213 [0615] 10. Goodwin, E. C. & Rottman, F. M. 1992. The 3 flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J. Biol. Chem. 267: 16330-16334. [0616] 11. Hbert, P. H., Birkenmaier, S., Rziha, H.-J. and Osterrieder, N. (1996), Alterations in the Equine Herpesvirus Type-1 (EHV-1) Strain RacH During Attenuation. Journal of Veterinary Medicine, Series B, 43: 1-14. doi:10.1111/j.1439-0450.1996.tb00282.x [0617] 12. Luke, G A and Ryan, M D. 2013. The protein coexpression problem in biotechnology and biomedicine: virus 2A and 2A-like sequences provide a solution. Future Virology, Vol. 8, No. 10, Pages 983-996. [0618] 13. Ma, G., Eschbaumer, M., Said, A., Hoffmann, B., Beer, M., Osterrieder, N. 2012. An equine herpesvirus type 1 (EHV-1) expressing VP2 and VP5 of serotype 8 bluetongue virus (BTV-8) induces protection in a murine infection model. PLoS One. 2012; 7(4):e34425. doi: 10.1371/journal.pone.0034425. Epub 2012 Apr. 12 [0619] 14. Ma, G., Azab, W., Osterrieder, N. 2013. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol. 167(1-2):123-34. [0620] 15. Nolan, T. Rebecca E Hands, R. E., and Bustin S. A. 2006. Quantification of mRNA using real-time RT-PCR Nature Protocols 1: 1559-1582 [0621] 16. Osterrieder, N., Neubauer, A., Brandmller, C., Kaaden, O. R., and O'Callaghan, D. J. 1996. The equine herpesvirus 1 IR6 protein influences virus growth at elevated temperature and is a major determinant of virulence. Virology 226:243-251. [0622] 17. Ptashne, M. 2014. The Chemistry of Regulation of Genes and Other Things The Journal of Biological Chemistry Vol. 289, (9) 5417-5435. Reed, L. J., and Muench, H. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. (27) 3; 493-497. [0623] 18. Rajao D S, Sandbulte M R, Gauger P C, Kitikoon P, Platt R, Roth J A, Perez D R, Loving C L, Vincent A L. 2016. Heterologous challenge in the presence of maternally-derived antibodies results in vaccine-associated enhanced respiratory disease in weaned piglets. Virology. 2016 April; 491:79-88. [0624] 19. Rosas, C. T., Konig, P., Beer, M., Dubovi, E. J., Tischer, B. K., Osterrieder, N., 2007a. Evaluation of the vaccine potential of an equine herpesvirus type 1 vector expressing bovine viral diarrhea virus structural proteins. J. Gen. Virol. 88 (3), 748-757. [0625] 20. Rosas, C. T., B. K. Tischer, G. A. Perkins, B. Wagner, L. B. Goodman, N. Osterrieder. 2007b. Live-attenuated recombinant equine herpesvirus type 1 (EHV-1) induces a neutralizing antibody response against West Nile virus (WNV) Virus Research, 125, pp. 69-78. [0626] 21. Rosas, C. T., Van de Walle, G. R., Metzger, S. M., Loelzer, K., Dubovi, E. J., Kim, S. G., Parrish, C. R., Osterrieder, N., 2008. Evaluation of a vectored equine herpesvirus type 1 (EHV-1) vaccine expressing H3 hemagglutinin in the protection of dogs against canine influenza. Vaccine 26 (19), 2335-3234. [0627] 22. Said, A., Elke Lange, E., Beer, M. Damiani, A., Osterrieder, N. 2013. Recombinant equine herpesvirus 1 (EHV-1) vaccine protects pigs against challenge with influenza A(H1N1)pmd09 Virus Research 173: 371-376 [0628] 23. Shaner, N.C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N., Palmer, A. E., Tsien, R, Y. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. December; 22(12):1567-72. Epub 2004 Nov. 21. [0629] 24. Thacker, E. and Janke, B. 2008. Swine Influenza Virus: Zoonotic Potential and Vaccination Strategies for the Control of Avian and Swine Influenzas J Infect Dis. (2008) 197 (Supplement 1): S19-S24 doi:10.1086/524988 [0630] 25. Tischer, B. K, Smith, G. A., and Osterrieder, N. in: Jeff Braman (ed.), In Vitro Mutagenesis Protocols: Third Edition, Methods in Molecular Biology, vol. 634, DOI 10.1007/978-1-60761-652-8_30, Springer Science+Business Media, LLC 2010, Chapter 30: En Passant Mutagenesis: A Two Step Markerless Red Recombination System. [0631] 26. Tischer, B. K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechnol. Tech. 40, 191-197. [0632] 27. Trapp, S., von Einem, J., Hofmann, H., Kostler, J., Wild, J., Wagner, R., Beer, M., Osterrieder, N., 2005. Potential of equine herpesvirus 1 as a vector for immunization. J. Virol. 79, 5445-5454. [0633] 28. Trombetta C M, Perini D, Mather S, Temperton N, Montomoli E. 2014. Overview of Serological Techniques for Influenza Vaccine Evaluation: Past, Present and Future. Vaccines (Base1) 13; 2(4):707-34. doi: 10.3390/vaccines2040707. [0634] 29. Watson S. J., Langat P., Reid S. M., Lam T. T., Cotten M., Kelly M., Van Reeth K., Qiu Y., Simon G., Bonin E., Foni E., Chiapponi C., Larsen L., Hjulsager C., Markowska-Daniel I., Urbaniak K., Drrwald R., Schlegel M., Huovilainen A., Davidson I., Dn ., Loeffen W., Edwards S., Bublot M., Vila T., Maldonado J., Valls L.; ESNIP3 Consortium, Brown I. H., Pybus O. G., Kellam P. Molecular Epidemiology and Evolution of Influenza Viruses Circulating within European Swine between 2009 and 2013. 2015, J Virol. October; 89(19):9920-31.