Vaccines for diseases caused by viruses of the family of reoviridae

Abstract

The invention relates to methods for producing a propagation-competent strain of a mutant Reoviridae virus, and to a propagation-competent strain of a mutant Reoviridae virus that is obtainable by a method of the invention. The invention further relates to a propagation-competent strain of a mutant Reoviridae virus, comprising a deletion of a genetic region that is relevant for propagation of the virus, and to a vaccine, comprising a propagation-competent strain of a mutant Reoviridae virus.

Claims

1. A propagation-competent strain of a mutant Orbivirus, comprising a mutation of translational start codons of NS3 and NS3a, and/or comprising a deletion of at least 10 nucleotides between the translational start codon of NS3a and translational stop codon of NS3a, that abolish expression of endogenous NS3 and NS3a proteins, which mutant Orbivirus is able to propagate in a non-complementing cell line.

2. The propagation-competent strain according to claim 1, comprising a deletion of at least 10 nucleotides between the translational start codon of NS3a and translational stop codon of NS3a, in the coding region of the NS3/NS3a glycoprotein.

3. The propagation-competent strain according to claim 1, wherein said functional deletion is an alteration of an ATG translation start codon of NS3 and of NS3a.

4. The propagation-competent strain according to claim 1, which is Bluetongue virus or African horse sickness virus.

5. A vaccine, comprising the propagation-competent strain according to claim 1.

6. The vaccine according to claim 5, which is a Differentiating Infected animals from Vaccinated Animals (DIVA) vaccine.

7. The vaccine according to claim 5, wherein the propagation-competent strain is a modified live virus.

8. The propagation-competent strain according to claim 1, wherein said functional deletion is a deletion of the coding region of a NS3a glycoprotein.

Description

FIGURE LEGENDS

(1) FIG. 1 Schematic representation of NS3/NS3a

(2) NS3/NS3a protein contains several recognized domains, from N- to C-terminus; two Calpactin p11 binding domains, late domain motif (LD) binds to Tsg101, two trans membrane regions (TM1 and TM2) with a conserved glycosylation sites in-between (NLG149), and a VP2 binding domain.

(3) FIG. 2 Western blotting of (mutant) NS3/NS3a proteins. BSR cells were infected with wtBTV (lane 1), mut AUG-1 (lane 2), mut AUG-2 (lane 3), mut AUG-1+2 (lane 4), and mock infected cells (lane 5). Proteins of concentrated lysates were separated by polyacrylamide gelelectrophoresis and were transferred by blotting. Proteins were immunostained with serum from a diseased sheep (Backx et al., 2007. Vet Rec 161: 591-592). The putative molecular weights (MW) of the expressed NS3/NS3a protein(s) are indicated by the mobility of MW markers.

(4) FIG. 3 Overview of BTV mutants and BTV revertants S10 genome segments of stocks of rescued BTV mutants were completely sequenced. No virus was rescued with genome segments Deletion, BPGFP and BP. Origin of sequences are indicated, rgBTV8 (dark grey), rgBTV1 (medium grey) and GFP (light grey). The genome segment is indicated for inserted sequences originating from genome segments S1 and S2, respectively.

(5) FIG. 4 Production of modBTvac-1 in BSR cells

(6) A. Top Panel

(7) BSR monolayers were infected in duplicate with modBTvac-1 or rgBTV1 at 0.1 MOI. At indicated time points, virus titres were determined by endpoint dilution, expressed in TCID50/ml, and plotted at a logarithmic scale. The bars represent the average of two replicates.

(8) B. Middle Panel

(9) Dilutions of virus stocks of rgBTV1, BTV(S10-25), and modBTvac-1 were analyzed by panBTV PCR assays targeting genome segment S1 and S10. BTV(S10-25) contains S10 with the ORF of NS3/NS3a of BTV25. This sequence contains one mismatching nucleotide in the center of the reverse primer of the S10-based panBTV PCR assay. modBTvac-1 contains two mismatching nucleotides at the 5-end of the reverse primer. The maximum dilution detected by each of the panPCR tests was plotted for indicated viruses.

(10) C. Lower Panel

(11) Monolayers of BSR- and KC cells were infected with modBTvac-1 or rgBTV1 at 0.1 MOI. At indicated time points, samples of supernatant and cell lysate were prepared, and the virus titer was determined by endpoint dilution. The bars represent the relative virus release in the supernatant at the indicated time points.

(12) FIG. 5

(13) A. Daily rectal body temperatures are presented. Infections are indicated by arrows

(14) B. Clinical signs were monitored on indicated days. Infections are indicated by arrows.

(15) C. Viremia was measured by S10 panBTV PCR assay. Infections are indicated by arrows.

(16) D. Seroconversion was determined by VP7-ELISA, and is presented as (100x) %. Infections are indicated by arrows.

(17) FIG. 6

(18) Dilutions of serum samples were tested by VP7-ELISA (VP7-ELISA) and by SNT for neutralizing Ab titres (nAbs) against BTV serotype 1 (BTV1-VNT) for sera of 21 dpi, 42 dpi, and 63 dpi with rgBTV1. The highest dilution tested positive is indicated to quantitate the titer of VP7-directed Abs. Threshold value of the VP7-ELISA was set at 50%, meaning >50% blocking is interpreted as positive and <50% as negative.

(19) FIG. 7

(20) VaccinationBTV8 challenge. Vaccination and BTV8 challenge are indicated by arrows at 0 dpv and 21 dpv, respectively. A. Mean daily rectal temperatures per group are presented. B. Total clinical signs were monitored and calculated per group on indicated days. C and D. Mean viremia was measured by S1 and S10 panBTV PCR assays. E. Mean seroconversion was determined by VP7-ELISA, and is presented as (100x) %, with a threshold value set at 50%. F. Serum neutralizing antibodies were determined against BTV8 for sera collected on 0 dpv, 21 dpv and 42 dpv. G. Mean seroconversion was determined by NS3-ELISA, and is presented as (100x) % with a threshold value set on 50%.

(21) FIG. 8

(22) Dose response. Vaccinations are indicated by arrows. Only groups H were revaccinated at 21 dpv. A. Mean viremia was determined by S1 panBTV PCR assay. B. Mean seroconversion was determined by VP7-ELISA, and is presented as (100x) % with a threshold value set on 50%.

(23) FIG. 9

(24) Serotype specific protection and differentiating infected from vaccinated animals (DIVA). Two groups of four sheep were vaccinated twice with BT DISA (rgBTV6 with Seg-2 of serotype 8 and the NS3/NS3a knockout phenotype) with an interval of three weeks (DISA DISA). Two groups of four sheep served as control groups (BTV2 and BTV8, respectively). At 84 dpv (arrow), sheep were challenged with BTV2 or BTV8 (DISA DISA BTV2 and DISA DISA BTV8, respectively).

(25) Sheep were monitored from one week before to three weeks after challenge (78 dpv/6 dpc to 105 dpv/21 dpc). A. Mean daily rectal temperatures per group are presented. B. Total clinical signs were monitored and calculated per group on indicated days. C. Mean viremia was determined by S1 panBTV PCR assay. D. Mean seroconversion was determined by VP7-ELISA, and is presented as (100x) % with a threshold value set at 50%. E and F. Serum neutralizing antibodies against BTV2 or BTV8, respectively, were determined for sera collected on 0 dpv, 21 dpv, 42 dpv, 84 dpv and 105 dpv. G. Mean seroconversion was determined by NS3-ELISA, and is presented as (100x) % with a threshold value set at 50%.

(26) FIG. 10

(27) Hydrophobicity plot of NS3/NS3a protein. Hydrophilic EC region is flanked by high hydrophobic regions TMR1 and TMR2 between position 117-183.

(28) FIG. 11

(29) Expression and purification of truncated NS3 antigen (BTV8)NS3TM. Fractions were separated by polyacrylamide gel electrophoresis and proteins were detected by standardized Coomassie Brilliant Blue staining.

(30) FIG. 12

(31) FIG. 12A ELISA of sera from Cow 693: VP7 positive for >170 dpi. NS3 positive for >135 dpi. The VP7-Ab titer in high.

(32) FIG. 12B ELISA of sera from Cow 858: VP7 positive for >150 dpi. NS3 positive for >130 dpi.

(33) FIG. 12C ELISA of sera from Cow 859: VP7 positive fort 130 dpi. NS3 positive for 80 dpi. The VP7-Ab titer in low.

(34) FIG. 12D ELISA of sera from Heifer 860: NS3-Abs are detected earlier than VP7-Abs. NS3-Abs are declining after 100 dpi, and convert to doubtful/negative after appr. 5 month post infection.

(35) FIG. 12E ELISA of sera from Heifer 861: NS3-Abs are detected earlier than VP7-Abs. NS3-Abs are declining after 70 dpi, and convert to doubtful/negative after appr. 5 month post infection.

EXAMPLES

(36) General

(37) Cell Lines

(38) BSR cells, a clone of BHK-21 cells; gift from Polly Roy (Sato et al., 1977. Arch Virol 54, 333-343), and BHK-21 (baby hamster kidney) were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) containing 5% fetal bovine serum (FBS) and 100 IU/ml penicillin, 100 g/ml streptomycin and 2.5 ug/ml Amphotericin B.

(39) Vero (African green monkey kidney epithelial) cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) containing 5% fetal bovine serum (FBS) and 100 IU/ml penicillin, 100 g/ml streptomycin and 2.5 ug/ml Amphotericin B.

(40) KC cells (Kenyon cells of the Culicoides species C. variipennis; gift from Linda McHolland were grown in modified Schneider's Drosophila medium with 15% heat inactivated foetal bovine serum, and 100 IU/ml penicillin, 100 g/ml streptomycin and 2.5 ug/ml Amphotericin (Wechsler et al., 1989. J Invertebr Pathol 54, 385-393).

(41) Except for BTV8/net06, BTV8/net07, BTV6/net08, and AHSV4LP, all BTVs and related orbiviruses of the following serogroupsAfrican horse sickness virus (AHSV), Epizootic hemorrhagic disease virus (EHDV), and Equine encephalosis virus (EEV)were purchased from the Pirbright Institute, Pirbright, UK, and then passed once in BHK-21 cells according to standard procedures. BTV8/net06, BTV8/net07 and BTV6/net08 were isolated in The Netherlands in 2006, 2007 and 2008, respectively (www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/viruses-at-iah.htm), see below. AHSV4LP was obtained from Dr. Christiaan Potgieter, Deltamune, South Africa (Erasmus B J. 1973. Proceedings of the third International Conference of Equine Infectious Diseases. p1-11). BTV8/net07 was isolated from the Holstein Frisian cow NL441689187 from Bavel, the Netherlands, which was sampled for export purposes on Jul. 24, 2007 (van Gennip et al., 2012. PLoS ONE 7, e30540). Isolation from EDTA-blood was performed on embryonated eggs (e1) and subsequent three passages on BHK-21 cells (e1/bhk3) or subsequent three passages on KC cells (e1/kc3). BTV6/net08 was isolated from the Holstein Frisian cow NL415834681 (Oct. 24, 2008) from Heeten, the Netherlands (van Rijn et al., 2012. Vet Microbiol 158, 23-32). Isolation from EDTA-blood was performed on eggs and subsequent three passages on BHK-21 cells and once on BSR cells.

(42) All virus stocks were obtained by infection of BSR cells at low multiplicity of infection (MOI) and harvested after 100% cytopathic effect (CPE) was observed. Virus titers were determined by endpoint dilution and expressed as 50% Tissue cell infective dose per ml (TCID50/ml) (Gard and Kirkland, 1993. Australian standard diagnostic techniques for animal diseases, 1-17). Viral stocks were stored at 80 C.

(43) Monoclonal antibody (MAb) ATCC1875 was obtained from the American Tissue Cell Collection (ATCC). MAbs 33H7, 32H2, 32F1, 31E9 and 32B6, directed against NS3, were supplied by Ingenasa, Spain. Peptide serum against a part of BTV-VP5 was commercially obtained and was a generous gift from Michiel Harmsen, CVI-Lelystad. BTV reference sera raised against 24 reference BTV strains and against proposed BTV26 were kindly obtained from the Pirbright Institute, Pirbright, UK. Other BTV sera were obtained from sheep or cattle naturally or experimentally infected by BTV8/net06 or BTV6/net08 (Backx et al., 2007. Vet Rec 161, 591-592; van Gennip et al., 2012a. PLoS ONE 7, e30540; van Gennip et al., 2012b. PLoS ONE 7, e44619; van Rijn et al., 2012. Vet Microbiol 158, 23-32), or from animal trials described below.

(44) Virus isolation was carried out on embryonated chicken eggs (ECE) or by passages on monolayers of BHK-21, Vero, or KC cells according to standard procedures for orbiviruses. After one passage on ECE, homogenates were prepared and passed in BHK21, Vero, or KC cells. Homogenates and cell passages were tested by the panBTV PCR test or other appropriate PCR assays, as described below.

(45) Embryonated egg-isolated BTV8/net07/e1, cell-culture derived BTV8/net07/e1/bhk3, BTV8/net07/e1/kc3, BTV6/net08/e1/bhk3/bsr2 and AHSV4LP were completely sequenced after one extra passage on BSR cells by use of an improved strategy for sequence-independent amplification of segmented dsRNA viral genomes and pyrophosphate-based 454 (Roche GS20/FLX) sequencing at the Inqaba Biotec company, South Africa (Potgieter et al., 2009. J Gen Virol 90, 1423-1432). Sequence analysis was essentially done as described by use of Lasergene8 from DNASTAR (Potgieter et al., 2009. J Gen Virol 90, 1423-1432). Files containing the sequence information, quality values and flowgrams (sff files) were loaded into the Seqman 8 program of the Lasergene software. Contig sequences of BTV8 strains were assembled and checked manually. Sequences were compared to sequences of BTV-8nt (2006/04) (Maan et al., 2008. Virology 377, 308-318) with GenBank accession numbers AM498051-AM498060) and to sequences of BTV8/Neth2006 with GenBank accession numbers FJ183374-FJ183383 for S1-S10, respectively.

(46) Consensus sequences of BTV8 directly isolated from EDTA-blood were determined after RNA-isolation using the TRIZOL method, and reverse transcription and amplification by a one-tube system (Qiagen one-step RT-PCR kit). Overlapping DNA amplicons were sequenced using BigDye Terminator v1.1 Cycle Sequencing Kit in a ABI PRISM 3130 Genetic Analyzer Applied Biosystems.

(47) Contig sequences of BTV6/net08 were checked manually and compared to sequences of BTV6/Net2008/05 with GenBank accession numbers QG506472-QG506481 (Maan et al., 2008. Virology 377, 308-318). Contig sequences of AHSV4LP were checked manually.

(48) Sequence analysis was essentially done with software programs of Lasergene 8 or 10 from DNASTAR or DSgene, like predicted translation and alignment. Predictions of RNA structures and higher order RNA structures like hairpins and pseudoknots were studied by use of the software program Cylofold (http://cylofold.abcc.ncifcrf.gov/).

(49) cDNA of genome segments were synthesized by Genscript Corporation (Piscataway, N.J.). Genome segments S1-S10 of BTV1 were based on the sequences as submitted to GenBank with accession numbers FJ969719-FJ969728. Genome segments S1-S10 of BTV8/net07 and of BTV6/net08 were based on the consensus sequences as described (van Gennip et al., 2012a. PLoS ONE 7, e30540). Genome segments S1-S10 of AHSV4LP were based on the consensus sequences as determined. cDNAs were cloned in commercially available pUC-derivatives, pUC18, 19 or 57, or pJET1.2 (BioRad) under control of the T7 RNA-polymerase promoter and a recognition site for a restriction enzyme (RE) at the 3-terminus for defined run-off transcription as described (van Gennip et al., 2012a. PLoS ONE 7, e30540). Another set of plasmids with cDNAs of all genome segments of BTV6/net08 were flanked by T7 RNA-polymerase at the 5-end and the sequence of the RIBOzyme of hepatitis delta virus (HDV) at the 3-terminus, respectively. Another set of mammalian expression plasmids with ORFs of genome segments were flanked by the early promoter of human cytomegalovirus and a polyA-signal at the 3- terminus, respectively, as described (van Rijn et al., 1994. J Virol 68, 3934). Commercially available plasmid pET-51(+)Ek/LIC (Millipore) was used for bacterial expression of NS3 originating from BTV8/net06. Plasmids were maintained in E. coli DH5a, and were purified using the QIAfilter Plasmid Midi Kit (Qiagen).

(50) Plasmid DNA was digested at the 3-terminus with the respective restriction enzyme, and was purified by standard procedures. One g of digested plasmid DNA was used for in vitro RNA run-off transcription with 5-cap analogue using the MESSAGE mMACHINE T7 Ultra Kit (Ambion). In this reaction, a ratio of 4:1 of anti-reverse cap analogue to rGTP was used. Synthesized RNA was purified by use of MEGAclear columns (Ambion) according to the manufacturer's instructions, and eluted RNA was stored at 80 C.

(51) For all generated viruses, a proper virus stock was used for further analyses. Several passages of rescued BTV by use of improved GMS2 were analysed in more detail. In particular, the entire sequence of the mutated genome segment was checked.

(52) RNA of virus stocks was isolated and genome segments of S1, S2, S7, S10 for BTV, and S4 and S5 for AHSV were identified by different PCR assays, see PCR testing below.

(53) To discriminate between the genome segments of different viruses, amplicons of diagnostic PCR tests were sequenced by use of the BigDye Terminator v3.1 Cycle Sequencing Kit in a ABI PRISM 3130 Genetic Analyzer (both supplied by Applied Biosystems, Foster City, Iowa, USA) as described (van Rijn et al., 2012a). Alternatively, amplicons of PCR tests were digested with specific restriction enzymes and analyzed by 0.9% agarose gel electrophoresis and visualized under UV light after staining with ethidium bromide, see S10 genotyping as an example (van Gennip et al., 2012a. PLoS ONE 7, e30540).

(54) Infected BSR monolayers were prepared with indicated (mutant) Orbiviruses by use of the generated virus stocks. Infected monolayers were used for immunoperoxidase monolayer assay (IPMA) with MAbs and sera, and plaque formation assays. Alternatively, cell lysates or cell culture supernatants were used for Western blotting and other common methods. All these methods were performed according to standard procedures well-known to skilled persons.

(55) BSR monolayers were infected with indicated (mutant) Orbiviruses by use of the generated virus stocks. To study cytopathic effect (CPE), BSR monolayers were infected by tenfold dilutions of indicated viruses, and grown for two days under overlay medium (EMEM complete with 1% methylcellulose). Monolayers were fixed with methanol/aceton (1:1) and immunostained with appropriate MAb, e.g. for BTV with ATCC1875. Plaque sizes of appropriate dilutions of viruses were compared.

(56) For analysis of virus growth, confluent BSR-monolayers in M24-well plates were infected in duplicate at a multiplicity of infection (moi) of 0.1. After attachment to cells for 1.5 h at 37 C., the medium was removed and refreshed with 1 ml of DMEM with 5% FBS, 100 IU/ml penicillin, 100 g/ml streptomycin and 2.5 ug/ml Amphotericin B and incubation was continued. At indicated time points in hours post infection (hpi), samples were harvested and stored at 80 C. Virus titers were determined by titration on BSR cells and expressed as TCID50/ml (Gard and Kirkland, 1993. Australian standard diagnostic techniques for animal diseases, 1-17). Alternatively, other cell lines like KC cells were used to study virus replication kinetics. In more detail, cells and cell culture supernatants were harvested separately to study relative virus release from cells.

(57) For PCR testing, blood samples, organ samples or cell cultures were tested by the panBTV PCR test as described (van Rijn et al., 2012. J Vet Diagn Invest 24: 469). Briefly, viral RNA was isolated by an automated procedure with the High Pure Viral RNA kit (Roche). For EDTA blood, 100 l of sample diluted with PBS (1:1) was used. For virus stocks, viral RNA was isolated from 200 l virus stock or supernatant. RNA was eluted in 50 l of RNase-free H.sub.2O. Genome segments of S1, S2, S10 were detected by real time PCR assays. In some cases, amplicons were sequenced to identify the origin of the respective genome segment. Genome segments S7 and S10 were also identified by full genome amplification followed by sequencing.

(58) For panBTV PCR assays, a first reaction consisted of 0.25 M of forward and reverse primer, 0.25 M of the probe, 2.75 mM of MnCl.sub.2, 7.5 l of a commercial master mix (Roche), and 5 l of RNA in a total volume of 20 l. Thermocycling conditions were: 20 sec at 98 C., 20 min at 61 C., 30 sec at 95 C., 40(1 sec at 95 C., 10 sec at 61 C., 15 sec at 72 C.), followed by 30 sec at 40 C., and storage at 4 C. Initial denaturation of dsRNA, first strand complementary DNA (cDNA) synthesis (RT), PCR, and real-time monitoring were performed in a closed capillary. Real-time RT-PCR was performed using a thermal cycler. Amplification was monitored in real time by the ratio of the OD.sub.530 and OD.sub.640 (OD.sub.530/OD.sub.640) using commercially available LC software (Roche). A PCR test was considered valid if all negative controls were negative and positive controls were positive. In case of an invalid PCR test, the entire set of isolated RNA was tested again. A representative isolation run of 32 samples contained 6 controls resulting in a final capacity of 26 test samples per isolation run. Three negative controls (which consisted of 200 l of PBS) and 3 positive controls were part of each isolation run. Positive controls contained different dilutions of BTV grown on BHK-21 cells.

(59) The weak positive control (cut-off value) contained the highest dilution of virus with a reproducible positive signal. The strong positive control was the highest dilution of virus resulting in a maximal ratio of optical density (OD).sub.530/OD.sub.640. The third positive control (intermediate control) was a dilution of virus with a result between the weak and strong positive control. Results were evaluated as positive, doubtful, or negative according to van Rijn et al., 2012 (van Rijn et al., 2012. J Vet Diagn Invest 24: 469).

(60) For full genome amplification of genome segments S7 and S10, template RNA (6 l) was denaturated at 94 C. for 3 min and immediately cooled on ice. A one-step RT-PCR kit (Qiagen) was used to reverse transcribe RNA and amplification of cDNA in a RT-PCR containing both primers. The reaction mix contained 10 l of 5QIAGEN one-step RT-PCR buffer, 2 l of dNTP mix, 0.6 M of each primer and 2 l of the enzyme mix (containing RT and PCR reaction enzymes). RNase-free water was added to a total volume of 44 l. Six microliters of denatured RNA was added to the mix. The RNA was reverse transcribed at 45 C. for 30 min. This was followed by an activation step at 94 C. for 15 min. Forty amplification cycles were then carried out (94 C. for 1 min, 45 C. for 1 min and 72 C. for 2 min), followed by a terminal extension step at 72 C. for 10 min. The cDNA products were analysed by 0.9% agarose gel electrophoresis and visualized under UV light after staining with Ethidium Bromide.

(61) Primers and probe for panBTV PCR test targeting genome segment S1 of BTV are:

(62) TABLE-US-00001 F-panS1: (SEQIDNO:1) 5-TTAAAATGCAATGGTCGCAATC R-panS1: (SEQIDNO:2) 5-TCCGGATCAAGTTCACTCC P-panS1: (SEQIDNO:3) 5-CCGTGCAAGGTGC

(63) Sequences are indicated in the 5.fwdarw.3 order. F, R, and P indicate forward primer, reverse primer, and probe, respectively. The probe is labeled with FAM at the 5-end, and with the MGB at the 3-end (Toussaint et al., 2007. J Virol Methods 140, 115-123).

(64) PCR primers for amplification of entire genome segment S7 of BTV are:

(65) TABLE-US-00002 F-panS7/01: (SEQIDNO:4) GTTAAAAATCTATAGAGATG R-panS7/02: (SEQIDNO:5) GTAAGTGTAATCTAAGAGA F-panS7/03: (SEQIDNO:6) GTTAAAAAATCGTTCAAGATG R-panS7/04: (SEQIDNO:7) GTAAGTTTAAATCGCAAGACG

(66) Sequences are indicated in the 5.fwdarw.3 order. F and R indicate forward primer and reverse primer.

(67) PCR primers and probe for panBTV PCR test targeting genome segment S10 of BTV are:

(68) TABLE-US-00003 F-panS10: (SEQIDNO:8) AGTGTCGCTGCCATGCTATC R-panS10: (SEQIDNO:9) GCGTACGATGCGAATGCA P-panS10: (SEQIDNO:10) CGAACCTTTGGATCAGCCCGGA

(69) Sequences are indicated in the 5.fwdarw.3 order. F, R, and P indicate forward primer, reverse primer, and probe, respectively. The probe is labeled with FAM at the 5-end, and with the quencher TAMRA at the 3-end.

(70) PCR primers for amplification of entire genome segment S10 of BTV are:

(71) TABLE-US-00004 F-panS10: (SEQIDNO:11) GTTAAAAAGTGTCGCTGCCATG R-panS10: (SEQIDNO:12) GTAAGTGTGTAGTGTCGCGCAC

(72) Sequences are indicated in the 5.fwdarw.3 order. F and R indicate forward primer and reverse primer.

(73) PCR primers and probe for panAHSV PCR test targeting genome segment S4 of AHSV are:

(74) TABLE-US-00005 F-panS4: (SEQIDNO:13) TTAGGATGGAACCTTACGC R-panS4: (SEQIDNO:14) ATTCTGCCCCTCTCTAACCA P-panS4: (SEQIDNO:15) CTTTGAGTAGGTATTCGATCTCCTGCG

(75) Sequences are indicated in the 5.fwdarw.3 order. F, R, and P indicate forward primer, reverse primer, and probe, respectively. The probe is labeled with FAM at the 5-end, and with the black hole quencher (BHQ) at the 3-end.

(76) PCR primers and probe for panAHSV PCR test targeting genome segment S5 of AHSV are:

(77) TABLE-US-00006 F-panS5: (SEQIDNO:16) CGCAATCTTCGGATGTAAGC R-panS5: (SEQIDNO:17) GCACACTACCTTGGATCTCTG P-panS5: (SEQIDNO:18) TCGCCA+ TCC+ TCA+ TCATCG

(78) Sequences are indicated in the 5.fwdarw.3 order. F, R, and P indicate forward primer, reverse primer, and probe, respectively. + indicates a Locked Nucleotide Acid (LNA). The probe is labeled with FAM at the 5-end, and with the black hole quencher (BHQ) at the 3-end.

(79) A real-time PCR test for BTV has been developed in-house (van Rijn et al., 2012. J Vet Diagn Invest 24: 469). Here, the S10-based amplicons of PCR positives were sequenced (S10 genotyping). Briefly, amplified material was separated by agarose-gelelectrophoresis and purified by standard procedures. Amplicons were sequenced with forward and reverse primers by using the BigDye Terminator v1.1 Cycle Sequencing Kit in a ABI PRISM 3130 Genetic Analyzer (both supplied by Applied Biosystems, Foster City, Iowa, USA). Sequences were subject to BLAST-N analysis (NCBI). Alternatively, amplicons were digested with restriction enzymes specific for amplicons originating from BTV6 or BTV8, respectively (van Gennip et al., 2012b. PLoS ONE 7, e44619).

(80) Serotype-specific real-time PCR tests targeting genome segment 2 (S2) were developed for serotypes 1, 6 and 8 (S2 genotyping). Genetic material was isolated according to the procedures described for the panBTV-PCR test (van Rijn et al., 2012. J Vet Diagn Invest 24: 469). 5 l aliquots from one RNA extraction (50 l) were used for all real-time PCR tests. Selected PCR primers and probes for the different S2 genotyping tests are listed below. S2 genotyping was performed according to the all-in-one method as described (van Rijn et al., 2012a. Vet Microbiol 158, 23-32). One reaction consists of 0.5 M of the forward and reverse primer, 0.5 M probe, 2.75 mM Mn-Acetate, 7.5 l reaction mix, and 5 l RNA in a total volume of 20 l. Thermo-cycling conditions of the PCR test were: 20 sec., 98 C., 20 min. 61 C., 30 sec., 95 C., 40(1 sec., 95 C., 10 sec., 57 C., 15 sec, 72 C.) followed by 30 sec. at 40 C., and storage at 4 C. Amplification was monitored real-time by OD.sub.530/OD.sub.640 using the Light Cycler software, version 4.05 (Roche). The selectivity/specificity of primers was investigated with orbiviruses of the CV1 collection consisting of reference panels of BTV, African horse sickness virus, epizootic hemorrhagic disease virus, equine encephalosis virus, and a limited number of additional BTV isolates. The diagnostic sensitivity was compared with the panBTV-PCR test with previously S10 genotyped EDTA-blood samples.

(81) Alternatively, amplified material was separated by agarose-gelelectrophoresis and purified by standard procedures. Amplicons were sequenced with forward and reverse primers by using the BigDye Terminator v1.1 Cycle Sequencing Kit in a ABI PRISM 3130 Genetic Analyzer (both supplied by Applied Biosystems, Foster City, Iowa, USA). Sequences were subject to BLAST-N analysis (NCBI).

(82) PCR primers and probes for serotype specific real time PCR tests targeting genome segment 2 of BTV serotype 1, 6, and 8 are:

(83) TABLE-US-00007 BTV-serotype1 F1: (SEQIDNO:19) TTGTTGAAAGTACGAGACACAAGAG R1: (SEQIDNO:20) GTATCAGCCTTCTTTGAATCGATT P1: (SEQIDNO:21) CATCCACTGCACCCACTGGTCA BTV-serotype6 F6: (SEQIDNO:22) AGGAACAGTCGGCTTATCAC R6: (SEQIDNO:23) TTCGCTAATGTGCTTCTCCAT P6: (SEQIDNO:24) TTGTCAGCTTTACGCAAACCCCG BTV-serotype8 F8: (SEQIDNO:25) CGGAGACAGCGCAGTATGTA R8: (SEQIDNO:26) CCTCGGTAGTATCCCTCACG P8: (SEQIDNO:27) ACATACGATGCCYTCGGAGGATTCTG

(84) Sequences are indicated in the 5.fwdarw.3 order. F, R, and P indicate forward primer, reverse primer, and probe, respectively. Probes are labeled with FAM at the 5-end, and with the black hole quencher (BHQ) at the 3-end.

Example 1

(85) This example describes the generation of (mutant) bluetongue viruses (BTVs), and (mutant) African horsesickness viruses (AHSVs), virus species of the genus orbivirus within the family of Reoviridae by use of reverse genetics combined with recombinant DNA technology known as genetic modification systems (GMS). Reassorted orbivirus and mutant orbiviruses were generated by different genetic modification systems, all methods are well-known to a skilled person and have been described (Trask et al., 2012. Methods 59: 199-206), here named GMS1 (van Gennip et al., 2010. Virol J 7, 261), and GMS2 (Boyce et al., 2008. J Virol 81, 2179-2186; van Gennip et al., 2012. PLoS ONE 7, e30540), In addition, GMS3 and GMS4 were used to generate (mutant) orbiviruses (here described). Further, GMS2 was significantly improved (Improved GMS2) in order to rescue less fit BTV that did not show CPE for which immunostaining appeared to be crucial, and in order to rescue BTV revertants after several passages of transfected cells and or cell culture supernatants of these transfected/passed cells.

(86) GMS1: Incorporation of one synthetic RNA or mutated RNA was performed by transfection of this synthetic RNA to infected BSR monolayers followed by screening of uptake of this RNA by several well-known methods. As an example, genome segments S7 or S10 of BTV8/net06 was incorporated in BTV6/net08 (van Gennip et al., 2010. Virol J 7, 261). Note that no selection was performed and that therefore sequential rounds of uptake of one or more synthetic RNAs could be performed. Ultimately, after up to 10 rounds, one by one every RNA genome segment could have a synthetic ancestor and consequently, complete synthetic BTV could be generated by GMS1. Indeed, almost every single segment reassortant could be generated, demonstrating that each synthetic RNA can be incorporated one by one (van Gennip et al., 2012a. PLoS ONE 7, e30540). Note that several synthetic RNAs contain silent mutations. Thus, it was demonstrated that by use of mutated synthetic RNA, genetic modifications in any genome segment of interest can be incorporated.

(87) For GSM1, genome segments S7 and S10 were synthesized by Genscript Corporation (Piscataway, N.J.) based on the identical sequences AM498057.2 and FJ183380.1 (GenBank) for S7, and the identical sequences AM498060.1 and FJ183383.1 (GenBank) for S10. cDNAs were cloned in plasmid pUC57 under control of the DNA-dependent T7 RNA-polymerase promoter and a site for a restriction enzyme (RE) at the 3-terminus for defined run-off transcription (see below).

(88) Plasmid DNA was digested with restriction enzyme BbsI for S7 or with BsMBI for S10, and was purified by standard procedures. One g of digested plasmid DNA was used for in vitro RNA run-off transcription with 5 cap analogue using the MESSAGE mMACHINE T7 Ultra Kit (Ambion). In this reaction, a ratio of 4:1 of anti-reverse cap analogue to rGTP was used. Synthesized RNA was cleaned by use of MEGAclear columns (Ambion) according to the manufacturer's instructions, and eluted RNA was stored at 80 C.

(89) Monolayers of 10.sup.5 BSR cells were infected at a multiplicity of infection (MOI) of 0.1 with BTV6/net08. At one hour post infection (hpi), infected monolayers were transfected with 400 ng synthesized RNA transcripts of S7 or S10 using 1 l Lipofectamine 2000 (1:2.5; 1 mg/ml, Invitrogen) in Opti-MEM 1 Reduced Serum Medium according to manufacturer's conditions for 4 hrs, after which it was refreshed with 1 ml of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 5% FBS and 100 IU/ml penicillin, 100 g/ml streptomycin and 2.5 ug/ml Amphotericin B. At 40 hpi, supernatants were harvested, and virus was cloned by endpoint dilution in M96-wells on BSR cells. At 3 days post infection (dpi), supernatants were collected from wells with cells developing cytopathogenic effect (CPE). Infection of the respective monolayers was confirmed by immunostaining with monoclonal antibody (MAb) produced by ATCC-CRL-1875 directed against VP7 (MAb ATCC1875). Viruses in supernatants were multiplied in M24 wells in BSR cells by adding 75 l supernatant in 1 ml of DMEM supplemented with 5% FBS and 1% of Penicillin/Streptomycin/Fungizone. After development of CPE, 2-3 dpi, supernatants were collected and stored at 80 C.

Example 2 (GMS2)

(90) A complete set of 10 synthetic RNAs was used. In a first transfection, 6 out of 10 RNAs were used for transfection to BSR monolayers, after 18 hours a second transfection to the same monolayers was performed with all 10 RNAs. Every virus generated by this method will contain the set of 10 RNAs. As an example, recently isolated BTVs, BTV8/net06 and BTV6/net08 were regenerated by this method (van Gennip et al., 2012a. PLoS ONE 7, e30540). Regenerated virus (rgBTV) was detected and differentiated by the presence of synonymous or silent mutations with respect to encoded amino acid sequence. Further, virulence and non-virulence of rgBTV8 and rgBTV6, respectively, were confirmed by experimental infection of sheep (van Gennip et al., 2012a. PLoS ONE 7, e30540). In addition, many BTV mutants and BTV reassortants were generated (Celma and Roy, 2011. Journal of Virology 85, 4783-4791; Ratinier et al., 2011. PLoS Pathog 7, e1002477; van Gennip et al., 2012b. PLoS ONE 7, e44619).

(91) For GMS2, monolayers of 10.sup.5 BSR cells per 2 cm.sup.2 were transfected with equimolar amounts of RNA of BTV genome segments S1 [VP1], S3 [VP3], S4 [VP4], S5 [NS1], S8 [NS2], and S9 [VP6]. In total, 600 ng RNA was transfected using 1 g Lipofectamine 2000 (1:2.5; 1 mg/ml, Invitrogen) in Opti-MEM I Reduced Serum Medium according to manufacturer's conditions. Eighteen to 20 hours post transfection, monolayers were transfected again with 600 ng equimolar amounts of a complete set of ten different RNA segments S1-S10. At 4 hrs post transfection, the transfection mix was replaced with 1 ml DMEM supplemented with 5% FBS and 1% of Penicillin/Streptomycin/Fungizone. Supernatants were harvested from monolayers developing cytopathogenic effect (CPE) at 48 hrs after the 2.sup.nd transfection. BTV specific CPE was confirmed by immunostaining of fixed monolayers with monoclonal antibody (MAb) produced by ATCC1875 directed against VP7 according to standard procedures (van Gennip et al., 2012a. PLoS ONE 7, e30540; van Gennip et al., 2012b. PLoS ONE 7, e44619).

Example 3 (Improved GSM2)

(92) According to the method of example 2. However, if no visible CPE was formed after 2-3 days post transfection (e.g. due to a reduced transfection efficiency), cells of duplicate wells were passed 1:5 to rescue virus. After incubation for another three days, monolayers were screened for CPE and VP7 expression as described above. In some cases, despite the absence of visible CPE, groups of cells of the transfected monolayer were immunostained by VP7-Ab ATCC1875. Then, supernatants were passed by infection of fresh BSR monolayers to rescue the respective BTV. In many cases, sequential passages of transfected cells and/or supernatants were performed to rescue BTV, BTV mutants, or BTV revertants.

Example 4 (GMS3)

(93) The set of plasmids containing cDNAs of all genome segments of BTV6/net08 flanked by a DNA-dependent T7 RNA-polymerase and RIBOzyme were used to rescue synthetic BTV6/net08. In the sequence of cDNA encoding genome segment S2, a LguI site was mutated to a NaIV site for differentiation purposes (van Gennip et al., 2012b. PLoS ONE 7, e44619). Plasmids were purified as described above. Monolayers of 10.sup.5 BSR-T7 cells per 2 cm.sup.2 were infected by Fowlpox virus expressing T7 RNA-polymerase (Britton et al., 1996. J Gen Virol 77 (Pt 5), 963-967) with a MOI of 0.01. After 1.5 hours, in total 600 ng DNA in equimolar amounts was transfected using 1.5 g Lipofectamine 2000 (1:2.5; 1 mg/ml, Invitrogen) in Opti-MEM I Reduced Serum Medium according to manufacturer's conditions. The procedure was continued as described above for RNA transfection. Alternatively, in total 600 ng DNA in equimolar amounts was transfected, and 18 hours later transfection of DNA was repeated together with infection of Fowlpox virus T7. Again, the procedure was continued as described.

Example 5 (GMS4)

(94) For rescue of synthetic AHSV4LP, monolayers of 10.sup.5 BSR cells per 2 cm.sup.2 were transfected with equimolar amounts of mammalian expression plasmids for AHSV segments encoding VP1 (S1), VP3 (S3), VP4 (S4), VP6 S9), VP7 (S7), NS1 (S5), and NS2 (S8). In total, 300 ng DNA was transfected using 1.5 g Lipofectamine 2000 (1:2.5; 1 mg/ml, Invitrogen) in Opti-MEM I Reduced Serum Medium according to manufacturer's conditions. Twenty-four hours post transfection, monolayers were transfected again with 600 ng equimolar amounts of 10 AHSV-RNA segments according to GMS2 (van Gennip et al., 2012b. PLoS ONE 7, e44619). Supernatants were harvested from monolayers at 48 hours after the 2.sup.nd transfection. Cells of these monolayers were passed 1:5 according to improved GMS2. Then, monolayers were screened for CPE, as described. If no visible CPE was present, supernatants were used to infect fresh monolayers to pass rescued AHSV. In the absence of obvious CPE, sequential passages of transfected cells and/or supernatants were performed to rescue AHSV, AHSV mutants, or AHSV revertants. Minimal requirements for GMS4 (rescue of synthetic AHSV4LP) were determined using expression plasmids with AHSV genes optimized for expression in BHK21 cells and stability in E. coli, as is depicted in Table A.

(95) TABLE-US-00008 TABLE A Expression of VP1, VP3 and NS2 from optimized genes are essential for virus rescue in combination with capped RNAs in the second transfection. expression plasmids virus rescue * RNAs CPE IPMA all 7 capped + + VP1 capped VP3 capped VP4 capped + + VP6 capped + + VP7 capped + + NS1 capped + + NS2 capped NS1, VP7 capped + + VP1, VP3, NS2 capped + + all 7 uncapped + + VP4 uncapped VP6 uncapped VP7 uncapped NS1 uncapped + + VP1, VP3, NS2 uncapped * 300 ng in total, all optimized Except for NS1, all expression plasmids are needed when uncapped RNAs were used. Virus rescue was determined by induction of CPE and confirmed by IPMA.

Example 6

(96) Previously, it has been shown that GMS2 was not successful for some mutations. The authors had used in trans complementation to rescue and propagate BTV mutants containing lethal mutations like large deletions in genome segment S9 or small deletions in genome segment S10 (Celma and Roy, 2011. J Virol 85, 4783-4791; Matsuo and Roy, 2009. J Virol 83, 8842-8848). Here, we have rescued BTV with mutations that were assumed to be lethal according to GMS2. Therefore, transfected BSR monolayers without visible CPE were passed in 1:5 dilutions and in some cases, additional passages of transfected cells were performed to rescue BTV mutants. Further, transfected BSR monolayers were immunostained with BTV-specific MAb in order to screen for BTV mutants that did not cause CPE (see example 3). An overview of the mutations is provided in Table 1.

(97) BTV with mutated start codons in NS3/NS3a (mut AUG1+2) was rescued. This BTV mutant showed significantly reduced CPE, and could have been missed without immunostaining. After rescue by improved GMS2, this double AUG-mutant virus appeared genetically stable, and replicated in normal cells. Thus, in trans complementation of NS3 or NS3a by a cell line is not needed. Immunostaining as well as westernblot analysis confirmed the absence of both NS3 and NS3a proteins (FIG. 2). From these results, it can be concluded that NS3/NS3a protein is not essential for BTV replication in BSR cells.

(98) BTV with small insertions in S10 (filled-in StyI and filled-in BsiWI sites) resulting in an out-of-frame insertion were rescued after several passages. Here, detailed studies showed that additional changes were introduced during cell passages. These additional changes restored the NS3/NS3a expression by deletion of the inserted nucleotides. Apparently, a strong selection pressure for NS3/NS3a expression resulted in these NS3/NS3a revertants. Passaging transfected cells played a crucial role to select these revertants, since by GMS2 these revertants were not found (not shown).

(99) BTV with large deletions in S10 were rescued after several (up to seven) passages. Here, detailed studies showed that viruses comprising insertions of RNA sequences from other genomic segments in S10 were positively selected by cell passages. Apparently, a strong selection for the uptake/insertion of these RNA sequences resulted in the isolation of these BTV mutants. Again, passing transfected cells played a crucial role to select these viable mutants with insertions. Indeed, use of in vitro RNA based on S10 with the observed insertions resulted in efficient rescue by GMS2, and no extra passages were needed to isolate this virus and to prepare a virus stock.

(100) TABLE-US-00009 TABLE 1 Rescue of BTV mutants by use of improved GMS2. S10 virus rescue virus rescue additional mutation by GMS2 by improved GMS2 changes Mut AUG1 + 2 No Yes* No Mut-A No No No deletion No No No Sty filled No Yes point deletion BsiWI filled No Yes point deletion BP No Yes insertion BPGFP No Yes deletion + insertion Attempts to rescue BTV with indicated S10 genome segments by use of GMS2 was not successful (No). Mut AUG1 + 2 was likely not rescued by GMS2 because the virus shows reduce efficiency and does not induce visible CPE. Mutant AUG1 + 2 does not contain additional changes in S10, but was rescued by improved GMS2 (Yes*). Mut-A and deletion were not rescued, even not after several attempts by use of improved GMS2 (No). Other rescued BTV mutants contained additional changes as indicated and are therefore named revertants (Yes). All mutations and additional changes as observed in several revertants are presented elsewhere in more detail.

Example 7

(101) Small mutations (point mutations, small insertions) were introduced in genome segments to mutate the putative amino acid sequence of translated proteins, or to abrogate the expression of large C-terminal parts of the translated protein (see Tables 2 and 3). Here, genome S10[NS3/NS3a] was targeted, but other genome segments, e.g segment 2 of BTV6 and BTV8, have also been targeted (van Gennip et al., 2012a. PLoS ONE 7, e30540).

(102) Point mutations were made in genome segment S10 encoding recognized motifs of NS3/NS3a, like the late domain (LD), the N-terminally located trans membrane region (TM1), the conserved glycosylation site (GLN) between both TM regions and a stop codon at the 3 end was introduced resulting in C-terminal truncated NS3/NS3a according to Celma and Roy, 2009. J Virol 83, 6806-6816. Further, silent mutations in highly conserved regions in the ORF were introduced (Mut-B). BTV1 mutants were rescued as efficient as rgBTV1 and virus stocks were prepared, except for Mut-B. Sequence analyses confirmed the presence of the introduced mutations, and no other changes were detected in genome segment S10.

(103) The restriction site for StyI and BsiWI in cDNA of genome segment S10 were digested, filled-in, and re-ligated resulting in a 4-basepairs insertion.

(104) Consequently, the ORF of NS3/NS3a was interrupted and putative translation will be terminated shortly after the 4-basepairs insertion. BTV1 mutants were rescued by use of improved GMS2. Finally, virus stocks were prepared. Sequence analyses showed an additional point deletion that restored the ORF resulting in an overall insertion of one codon. In all studied mutants, the ORF of NS3/NS3a was restored by a point deletion in the vicinity of the 4-basepairs insertion. The additional point deletion was not necessarily the same in independently rescued revertants. The virus stocks were used for further analysis, and no other changes were detected in genome segment S10.

(105) TABLE-US-00010 TABLE2 ThesequencesoftheregionwithmutationsinseveralmotifsofS10 [NS3/NS3a] arepresented. Latedomain(LD)(PPRYAPSAP) Mutant PPRYAPSAP virusrescue wildtype: 124--/CCA.CCA.AGG.TAT.GCT.CCG.AGT.GCA.CCG./-- (SEQIDNO:28) Yes 36--/Pro.Pro.Arg.Tyr.Ala.Pro.Ser.Ala.Pro./-- (SEQIDNO:29) NS3-ASAP: 124--/CCA.CCA.AGG.TAT.GCT.GCA.AGT.GCA.CCG./-- (SEQIDNO:30) Yes 36--/Pro.Pro.Arg.Tyr.Ala.Ala.Ser.Ala.Pro./-- (SEQIDNO:31) NS3-GAAP: 124--/CCA.CCA.AGG.TAT.GCT.GGA.GCA.GCA.CCG./-- (SEQIDNO:32) Yes 36--/Pro.Pro.Arg.Tyr.Ala.Gly.Ala.Ala.Pro./-- (SEQIDNO:33) Reverseprimer Mutant AAFASYA virusrescue wildtype: 245--/.GCT.GCA.TTC.GCA.TCG.TAC.GCG./-- (SEQIDNO:34) Yes 82--/.Ala.Ala.Phe.Ala.Ser.Tyr.Ala./-- (SEQIDNO:35) Mut-B: 245--/.GCA.GCT.TTT.GCT.AGC.TAT.GCG./-- (SEQIDNO:36) Yes 82--/.Ala.Ala.Phe.Ala.Ser.Tyr.Ala./-- (SEQIDNO:35) Transmembraneregion(TM1) Mutant virusrescue wildtype: 410--/.GTG.GTT.GCG.CTG.TTG.ACA.TCA.GTT./-- (SEQIDNO:37) Yes --/.Val.Val.Ala.Leu.Leu.Thr.Ser.Val./-- (SEQIDNO:38) TM1ALL 410--/.GTG.GTT.GAA.GAG.GAA.ACA.TCA.GTT./-- (SEQIDNO:39) Yes ->EEE: --/.Val.Val.Asp.Asp.Asp.Thr.Ser.Val./-- (SEQIDNO:41) Glycosylationsite(GLN) Mutant NGT virusrescue wildtype: 463--/.AAG.ATA.AAT.GGA.ACT.AAA./-- (SEQIDNO:42) Yes Asn.Gly.Thr. NS3-N149S: 463--/.AAG.ATA.TCG.GGA.ACT.AAA./-- (SEQIDNO:44) Yes Ser.Gly.Thr C-terminalstop Mutant virusrescue Wildtype: 644--/.GTG.AGG.ATG.AGT.TTT.ACG.GAG./-- (SEQIDNO:46) Yes 209--/.Val.Arg.Met.Arg.Phe.Thr.Asp./-- (SEQIDNO:48) CT4stop212: 644--/.GTG.AGG.ATG.TGA.TTT.ACG.GAG./-- (SEQIDNO:49) Yes 209--/.Val.Arg.Met.STP.Phe.Thr.Asp./-- (residues1to 3ofSEQIDNO: 48andresidues 5to7ofSEQ IDNO:48) Mutations (double underlined) and changed amino acids (underlined) are indicated. Virus rescue is indicated by Yes or No. Entire S10 genome segments of virus stocks were sequenced and no additional changes were found.

(106) TABLE-US-00011 TABLE3 Sequencesoftheregionswithadditionalchangesinthevicinityofthe4-basepairs insertionsinS10[NS3/NS3a] resultinginrepairofNS3/NS3aexpressionandvirus rescue. StyIrevertants Wildtype: 124--/CCAC----CAAGGTATGCTCCGAGTGCACCGATGCCATCATCTATGCCAACGGTTGCCCTTGA/-- (SEQIDNO:50) 36PP----RYAPSAPMPSSMPTVALE/-- (SEQIDNO:52) StyIfilled: --/CCACCAAGCAAGGTATGCTCCGAGTGCACCGATGCCATCATCTATGCCAACGGITGCCCTTGA/-- (SEQIDNO:53) 36PPSKVCSECTDAIIYANGCP* (SEQIDNO:54) S-rev-1: 124--/CCACCA-GCAAGGTATGCTCCGAGTGCACCGATGCCA/-- (SEQIDNO:55) 36PPARYAPSAPMP/-- (SEQIDNO:56) S-rev-2: 124--/-CACCAAGCAAGGTATGCTCCGAGTGCACCGATGCCA/-- (SEQIDNO:57) 36HQARYAPSAPMP/-- (SEQIDNO:58) BsiWIrevertant wildtype: 242--/AAGGCTGCATTCGCATCGTAC----GCGGAAGCGTTTCGTGA/-- (SEQIDNO:59) 81KAAFASY----AEAFRD/-- (SEQIDNO:61) BsiWIfilled: 242--/AAGGCTGCATTCGCATCGTACGTACGCGGAAGCGTTTCGTGA/-- (SEQIDNO:62) 81KAAFASYVRGSVS* (SEQIDNO:63) B-rev-1: 242--/AAGGCTGCATTCGCATCGTACGTA-GCGGAAGCGTTTCGTGA/-- (SEQIDNO:64) 81KAAFASYVAEAFRD/-- (SEQIDNO:66) Entire S10 genome segments of virus stocks were sequenced. The 4-basepairs insertions and additional point deletions are double underlined. No other nucleotide changes were found. Amino acid changes compared to the wild type sequence are underlined. No virus could be isolated without additional point deletions, indicating a strong selection pressure for (mutant) NS3/NS3a expression.

Example 8

(107) Start codons of NS3 and NS3a were mutated (AUG.fwdarw.GCC) in cDNA of genome segment S10 as previously described (Celma and Roy, 2011. J Virol: 85, 4783-4791). Here, these AUG.fwdarw.GCC mutations were combined for BTV. Further, the region between both AUG start codons was deleted (deletion), or silent mutations were introduced in this region (Mut-A). These mutated S10 genome segments were used for virus rescue by improved GMS2. Despite several attempts, Mut-A and Deletion were not rescued (not shown). Stocks of BTV with AUG mutations (AUG mutant viruses) were prepared, and AUG.fwdarw.GCC mutations were confirmed by sequencing. The virus stocks were used for further analysis, and no other changes were detected in genome segment S10.

(108) TABLE-US-00012 MutantAUG1AUG2 wildtype GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCC.GGG.CTG.ATC.CAA.AGG.TTC.GAA.GAA.GAA.AAA.ATG (SEQIDNO:67) MutAUG1 GTTAAAAAGTGTCGCTGCC.GCC.CTA.TCC.GGG.CTG.ATC.CAA.AGG.TTC.GAA.GAA.GAA.AAA.ATG (SEQIDNO:69) MutAUG2 GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCC.GGG.CTG.ATC.CAA.AGG.TTC.GAA.GAA.GAA.AAA.GCC (SEQIDNO:71) MutAUG1+ 2 GTTAAAAAGTGTCGCTGCC.GCC.CTA.TCC.GGG.CTG.ATC.CAA.AGG.TTC.GAA.GAA.GAA.AAA.GCC (SEQIDNO:73) Mut-A GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCG.GGC.TTA.ATA.CAG.AGA.TTT.GAA.GAA.GAA.AAA.ATG (SEQIDNO:75) Deletion GTTAAAAAGTGTCGCTGCC.---.---.---.---.---.---.---.---.---.---.---.---.---.ATG (SEQIDNO:77) List of mutations in the 5-terminal part of S10 tested for virus rescue. Positions of start codons are indicated (AUG1 and AUG2), and mutated start codons in cDNAs are underlined. Point mutations (silent mutations) are double underlined.

(109) BTV rescue of BTV with mutations in the 5-terminal part of S10. In case of failure, several attempts were undertaken to rescue BTV mutants. Virus rescue of Mut-A was not successful (No). Mutant viruses with AUG.fwdarw.GCC mutations were generated (Yes). BSR monolayers were infected with AUG mutant viruses and immunostained with MAb ATCC1875 against VP7, or Ab directed against NS3/NS3a. Immunostaining was positive (+), negative (), or not done (nd).

(110) TABLE-US-00013 BTV virus VP7 NS3 mutant rescue staining staining Wild type Yes + + Mut AUG1 Yes + + Mut AUG2 Yes + + Mut AUG1 + 2 Yes + Mut A No nd nd

Example 9

(111) NS3/NS3a protein is not essential for BTV replication. Since rescue of BTV without S10 genomic RNA had failed (not shown), RNA sequences of genome segment S10 must be essential for virus replication. Here, RNA sequences in S10 were mapped that are important for virus replication. NTR sequences are highly conserved and are considered essential for virus replication. Therefore, the involvement of these sequences in BTV rescue were not further investigated. Several deletions in genome segment S10 were constructed and used in experiments to rescue BTV by use of GMS2.

(112) In addition, attempts to rescue virus were expanded by improved GMS2 in order to find revertants compensating for the deletion of essential RNA sequences.

(113) TABLE-US-00014 (SEQIDNO:78) G.sup.(1)TTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCG AAGAAGAAAAAATGAAACATAATCAAGACAGAGTTGAAGAGCTGAGTCT AGTACGTGTAGATGACACCATCTCTCAACCACCAAGGTATGCTCCGAGT GCACCGATGCCATCATCTATGCCAACGGTTGCCCTTGAAATATTGGACA AAGCGATGTCAAACACAACTGGTGCAACGCAAACACAAAAGGCGGAGAA GGCTGCATTCGCATCGTACGCGGAAGCGTTTCGTGATGATGTAAGACTG AGACAGATCAAGCGCCATGTGAACGAGCAGATTTTACCAAAATTAAAAA GTGATCTAAGTGGATTGAAGAAGAAACGAGCAATCATACACACTACTCT ATTAGTAGCGGCTGTGGTTGCGCTGTTGACATCAGTTTGTACCCTTTCA AGCGATATGAGTGTGGCCTTTAAGATAAATGGAACTAAAACAGAAGTGC CTTCATGGTTTAAAAGCCTTAACCCGATGCTTGGCGTGGTCAATTTGGG AGCAACTTTTCTGATGATGGTTTGCGCAAAGAGTGAAAGAGCCTTGAAC CAGCAGATAGATATGATAAAGAAGGAAGTGATGAAGAAACAATCTTATA ATGATGCGGTGAGGATGAGTTTTACAGAGTTCTCGTCAGTCCCGCTGGA TGGTTTCGAAATGCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCC GAGGTTTACGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCACT GCTGTATAACGGGGGAGGGTGCGCGACACTACACACTTAC.sup.(822) wildtype (SEQIDNO:75) GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCC.GGG.CTG.ATC.CAA. AGG.TTC.GAA.GAA.GAA.AAA.ATG.//-- Deletion (SEQIDNO:97) GTTAAAAAGTGTCGCTGCC.---.---.---.---.---.---.---. ---.---.---.---.---.---.ATG.//-- Deletion.ThesequenceoftheentireS10 genomesegmentofrgBTV(822basesinlength), includingstartcodons(bold+ underlined) andstopcodon(underlined),ispresentedin theupperpart.SequencecomparisonofDeletion andwtBTV.Thepresentationofthecomparison ofDeletion andwtBTVislimitedtothe5- terminalpartofS10(upperpart).ORF(codons separatedbydots),startcodons(bold+ underlined),andthedeletion(--)inDeletion areindicated.Virusrescuewasnotsuccessful forDeletion,despiteseveralattempts,despite theuseofimprovedGMS2,anddespiteintactNTRs andORFofNS3a. BPdel (SEQIDNO:79) G.sup.(1)TTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCG AAGAAGAAAAAATGAAACATAATCAAGACAGAGTTGAAGAGCTGAGTCT AGTACGTGTAGATGACACCATCTCTCAACCACCAAGGTATGCTCCGAGT GCACCGATGCCATCATCTATGCCAACGGTTGCCCTTGAAATATTGGACA AAGCGATGTCAAACACAACTGGTGCAACGCAAACACAAAAGGCGGAGAA GGCTGCATTCGCATCGTAC.sup.(262)T.sup.(634)AATGATGCGGTGAGGATGAGTTT TACAGAGTTCTCGTCAGTCCCGCTGGATGGTTTCGAAATGCCATTAACC TGAGGACAGTAGGTAGAGTGGCGCCCCGAGGTTTACGTCGTGCAGGGTG GTTGACCTCGCGGCGTAGACTCCCACTGCTGTATAACGGGGGAGGGTGC GCGACACTACACACTTAC.sup.(822) BPdel.SequenceofS10genomesegmentBPdel(451 basesinlength),includingstartcodons(bold+ underlined)andstopcodon(underlined).Virus rescuewasnotsuccessfulindicatingthatthis deletionalsocontainsanessentialRNAsequence forvirusrescuebyGMS2.Thisdeletionwasused torescuerevertantsbyuseofimprovedGMS2.

(114) TABLE-US-00015 S10 name virus rescue virus rescue additional mutation revertant (GMS2) (improved GMS2) changes Deletion No No nd BPGFP BPS1 No Yes deletion + insertion BP BPS1-2 No Yes insertion BP BPS2 No Yes insertion

(115) Using GMS2, rescue of BTV mutants, of which BPGFP contained an insertion of the GFP gene, has failed. By use of improved GMS2, several BTV revertants were isolated, however, rescue of BTV with a small deletion between both start codons has failed again (Deletion). S10 genome segments of rescued BTV revertants were completely sequenced and contained additional changes with respect to the original genetic modification.

(116) Since up to seven passages were needed for rescue of BTV revertants using improved GMS2. Positive selection and thus additional changes were supposed. Indeed, changes in length of the mutated S10 were shown by agarose gel electrophoresis during selection of revertants. Sequence analyses showed that rescued BTV revertants contain genetic changes with respect to the originally introduced genetic modifications. The complete sequence of these S10 genome segments were determined.

(117) A revertant of BPGFP had a deletion of the entire GFP gene and flanking sequences, which were replaced by sequences originating from genome segment S1 (BPS1).

(118) The deletion of the sequence between BsiWI and PsiI in BP was maintained in the revertants analysed, but insertions were found in other positions in S10. One of these has an insertion originating from genome segment S1 (BPS1-2). A second, independent revertant was isolated from the same experiments and contained an insertion of 68 nucleotides directly downstream from the 2.sup.nd start codon, which originated from genome segment S2 (BPS2).

(119) TABLE-US-00016 (SEQIDNO:80) G.sup.(1)TTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCGAAGAAGAAAAAAT GAAACATAATCAAGACAGAGTTGAAGAGCTGAGTCTAGTACGTGTAGATGACACCATCTCTC AACCACCAAGGTATGCTCCGAGTGCACCGATGCCATCATCTATGCCAACGGTTGCCCTTGAA ATATTGGA.sup.(192)C.sup.(333)TTGATCCGGAGGAAGAGTTCTTACGTAATTATAGAGTTTCAAGGGAG ATGACTGAAGTGGAAAAATTTATCGAATTCCGTGCTAAAAACGAGATGCAAATATACGGAGA TATACCCATTAAGGTATGGTGTTGTTTCATCAATGAACTGAGTGCGGAATTAAAACATATTC CCTTAGGGATGCAAGTTATGGCTGACTTTGTAAACCGTTTCGATTCACCATTCCATCAGGGG AATAGAGATTTATCAAATCTTGAAGATTTTCAAGTTGCATACACTACGCCGCTTTTGTTTGA AATGTGTTGCATGGAATCAATTTTAGAATTCAATATCAAAATGCGTATGCGTGAAGAAGATA TCTCGGCGCTGGAATTCGGTGAT.sup.(713)T.sup.(658)ACAGAGTTCTCGTCAGTCCCGCTGGATGGTTT CGAAATGCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGAGGTTTACGTCGTGCAGG GTGGTTGACCTCGCGGCGTAGACTCCCACTGCTGTATAACGGGGGAGGGTGCGCGACACTAC ACACTTAC.sup.(822) BPS1.SequenceoftheS10genomesegmentBPS1.Startcodonsand stopcodonofNS3/NS3aarebold+ underlined,andunderlined, respectively.Theinsertionofthe51sequenceisdoubleunderlined. Thisinsertioncorrespondingto333-713of51ofBTV1islocated betweenpositions192and658ofS10ofBTV8.S10genomesegmentBPS1 is738basesinlengthandnootherchangeswerefound. (SEQIDNO:81) G.sup.(1)TTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCGAAGAAGAAAAAAT GAAACATAATCaAGACAGAGTTGAAGAGCTGAGTCT.sup.(96)C.sup.(550)ACCATTCCATCAGGGGAAT AGAGATTTATCAAATCTTGAAGATTTTCAAGTTGCATACACTACGCCGCTTTTGTTTGAAAT GTGTTGCATGGAATCAATTTTAGAATTCAATATCAAAATGCGTATGCGTGAAGAAGATATCT CGGCGCTGGAATTCGGTGATATGAAAGTTGATCCGGTTGGACTATTGCGTGAGTTTTTCATT CTGTGCTTACCACACCCAAAGAAGATTAACAACGTTCTAAGAGCACCATACTCTTGGTTTGT AAAGATGTGGGGCGTCGGAGCTGATCCGATCGTTGTTTTACAATCTACGGCAGGCGATGACA GGAATTCAAAGGA.sup.(892)A.sup.(97)GTACGTGTAGATGACACCATCTCTCAACCACCAAGGTATGCT CCGAGTGCACCGATGCCATCATCTATGCCAACGGTTGCCCTTGAAATATTGGACAAAGCGAT GTCAAACACAACTGGTGCAACGCAAACACAAAAGGCGGAGAAGGCTGCATTCGCATC.sup.(258)gt acT.sup.(634)AATGATGCGGTGAGGATGAGTTTTACAGAGTTCTCGTCAGTCCCGCTGGATGGTTT CGAAATGCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGAGGTTTACGTCGTGCAGG GTGGTTGACCTCGCGGCGTAGACTCCCACTGCTGTATAACGGGGGAGGGTGCGCGACACTAC ACACTTAC.sup.(822) BPS1-2.SequencesoftheS10genomesegmentofBPS1-2.Start codonsandstopcodonofNS3/NS3aareboldandunderlined,and underlined,respectively.Theinsertionofthe51sequenceis doubleunderlined.This68-nucleotideinsertioncorrespondingto 550-892of51ofBTV1islocatedbetweenpositions96and97of S10ofBTV8.S10genomesegmentBPS1-2is794basesinlengthand nootherchangeswerefound. (SEQIDNO:82) G.sup.(1)TTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCGAAGAAGAAAAA.sup.(58) A.sup.(768)TTAGAGATGATATTGCGAGCTTGGATGAGATATGTAATAGGTGGATACAGAGTAGGCA CGACCCCGG.sup.(835)A.sup.(59)TGAAACATAATCaAGACAGAGTTGAAGAGCTGAGTCTAGTACGTGT AGATGACACCATCTCTCAACCACCAAGGTATGCTCCGAGTGCACCGATGCCATCATCTATGC CAACGGTTGCCCTTGAAATATTGGACAAAGCGATGTCAAACACAACTGGTGCAACGCAAACA CAAAAGGCGGAGAAGGCTGCATTCGCATC.sup.(258)gtacT.sup.(634)AATGATGCGGTGAGGATGAGTT TTACAGAGTTCTCGTCAGTCCCGCTGGATGGTTTCGAAATGCCATTAACCTGAGGACAGTAG GTAGAGTGGCGCCCCGAGGTTTACGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCA CTGCTGTATAACGGGGGAGGGTGCGCGACACTACACACTTAC.sup.(822) BPS2.SequencesoftheS10genomesegmentBPS2.Startcodonsand stopcodonofNS3/NS3aareboldandunderlined,andunderlined, respectively.TheinsertionoftheS2sequenceisdoubleunderlined. This68-nucleotideinsertioncorrespondingto768-835ofS2ofBTV1 islocatedbetweenpositions58and59ofS10ofBTV8.S10genome segmentBPS2is519basesinlengthandnootherchangeswerefound. (SEQIDNO:83) G.sup.(1)TTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCGAAGAAGAAAAA.sup.(58) A.sup.(768)TTAGAGATGATATTGCGAGCTTGGATGAGATATGTAATAGGTGGATACAGAGTAGGCA CGACCCCG.sup.(834)CCA(59)TGT.sup.(634)AATGATGCGGTGAGGATGAGTTTTACAGAGTTCTCGTCA GTCCCGCTGGATGGTTTCGAAATGCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGA GGTTTACGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCACTGCTGTATAACGGGGG AGGGTGCGCGACACTACACACTTAC.sup.(822) BPS2del.SequenceoftheS10genomesegmentBPS2del.BPS2was syntheticallyderivedwithafewmodificationstoincorporate NcoIandPsiIcloningsites.Subsequently,thesequencebetween thesesiteswasdeletedresultinginBPS2del.Startcodonsand stopcodonofNS3/NS3aareboldandunderlined,andunderlined, respectively.TheinsertionoftheS2sequenceisdoubleunderlined. This67-nucleotideinsertioncorrespondingto768-834ofS2ofBTV1 andtwoextraCresiduesarelocatedbetweenpositions58and59of S10ofBTV8.S10genomesegmentBPS2delis319basesinlengthand nootherchangeswerefound.

(120) An overview of the deleted viruses, and the revertants thereof, is provided in FIG. 3.

Example 10

(121) cDNAs of S10 genome segments of BPS1 and BSP2 were cloned in appropriate plasmids for in vitro RNA synthesis. These RNAs were used to rescue BTV with S10 genome segment BPS1 or BPS2. This rescue of BPS1 and BPS2 was successful with GMS2, and the efficiency was comparable to that of rgBTV1. No extra passages of transfected cells were needed to prepare virus stocks. This indicates that no further selection was needed. Indeed, the sequences of S10 genome segment BPS1 and BPS2 of these virus stocks were confirmed. A virus stock of BPS2 was prepared and used for further studies, this virus was named modBTvac-1.

(122) Representative examples of the production of modBTvac-1 in BSR cells, detection of modBTvac-1 by panBTV PCR assays, and virus release of modBTvac-1 from BSR and KC cells are provided in FIG. 4.

(123) The stability of the S10 genome segment BPS2 and BPS2del of these NS3/NS3a minus BTV mutants was further analyzed. These viruses were successively passed on BSR cells for at least 10 passages. NS3/NS3a expression remained negative as studied by IPMA for the highest passage number available. Stability of genome segment S10 was studied by PCR followed by agarose gel electrophoresis. The sequence of the complete genome segment S10 of the highest available passage number was confirmed.

Example 11

(124) Genome segment S10 of modBTvac-1 (BPS2) was used to rescue BTV variants with this mutated genome segment S10. S10 genome segment BPS2 contains a large deletion from the BsiWI to the PsiI site, and 68 base pairs from genome segment S2 inserted directly downstream from the 2.sup.nd AUG start codon.

(125) BTV mutant BPS2 as described in example 9, was rescued directly with S10 RNA based on BPS2 and was named modBTvac-1. Note that modBTvac-1 and rgBTV1 only differ in the S10 genome segment.

(126) S10 genome segment BPS2 was used in combination with genome segment S2[VP2] of rgBTV8 (van Gennip et al., 2012a. PLoS ONE 7, e30540). The set of 10 genome segments was completed with genome segments of rgBTV1 and virus was rescued. The rescued virus was named modBTvac-8. Similarly, several modBTvac-x viruses were generated for BTV serotypes 4, 6, and 9.

(127) S10 genome segment BPS2 was completed with genome segments S1-S9 of virulent rgBTV8 (van Gennip et al., 2012a. PLoS ONE 7, e30540). Virus was rescued comparable to the efficiency of rgBTV8, and no additional passages were needed for the preparation of a virus stock. The rescued virus was named rgBTV8-BPS2, and the virus stock was obtained for further analysis. Genome segment S10 was completely sequenced and indeed no additional changes were found.

(128) In addition, S10 genome segment BPS2 was completed with genome segments S1-S9 of non-virulent rgBTV6 (van Gennip et al., 2012a. PLoS ONE 7, e30540). Despite several attempts, rescue of rgBTV6-BPS2 had failed. Apparently, incorporation of S10 genome segment BPS2 is not possible in all virus backgrounds.

(129) An overview of BTV variants with S10 genome segment BPS2 is provided below:

(130) TABLE-US-00017 BTV rescue with genome segment BPS2. virus virus S2 VP7 NS3 name rescue genotyping staining staining rgBTV1 + 1 + + modBTvac-1 + 1 + modBTvac-2 nd nd nd modBTvac-4 + 4 + modBTvac-6 + 6 + modBTvac-8 + 8 + modBTvac-9 + 9 + modBTvac-16 nd nd nd rgBTV8 + 8 + + rgBTV8-BPS2 + 8 + rgBTV6 + 6 + + rgBTV6-BPS2 nd nd nd This segment was used in combination with rgBTV1 segments (modBTvac-1), rgBTV6 (failed), and rgBTV8 (rgBTV8-BPS2). Similar to modBTvac-1, BPS2 was used in combination with S2 genome segments originating from other BTV serotypes and rgBTV1 segments (modBTvac-x, in which x represents the BTV serotype). All rescued viruses were immunostained with VP7 MAb ATCC1875, and the respective S2 genotyping assay. modBTvac-x viruses and rgBTV8-BPS2 were negative for NS3/NS3a expression.

Example 12

(131) Infection experiments were performed in sheep as representative of most susceptible animal for Bluetongue. Clinical disease, viremia, induction of protection and the induction of immune responses like neutralizing and non-neutralizing antibody responses raised against different viral proteins were investigated in infected sheep. Sheep trials were monitored by standard methods as previously described ((van Gennip et al., 2012a. PLoS ONE 7, e30540; van Gennip et al., 2012b. PLoS ONE 7, e44619). Rectal body temperatures and clinical scores were recorded daily. The presence of BTV genomic RNA was determined by panBTV PCR assays. The presence of panBTV antibodies was determined by the VP7-ELISA and displayed as 100-value with a threshold value set at 50%. Antibodies raised against NS3/NS3a were detected by NS3/NS3a-IPMA and/or an experimental NS3/NS3a-ELISA. BTV-serotype specific neutralizing antibodies were determined by SNT with the indicated BTV serotypes.

(132) All experiments with live animals were performed under the guidelines of the European Community (86/609) after approving by the Committee on the Ethics of animal experiments of the Central Veterinary Institute.

(133) Female sheep of the same breed of 6-24 months old and free of BTV and BTV-antibodies were commercially sourced from the same flock of a Dutch farm. The sheep were randomly allocated to groups. On day 0 (0 day post immunization/vaccination [0 dpv] or infection/challenge [0 dpi/dpc]), the 1.sup.st injection was performed as indicated. Subsequent injections were performed on the indicated days. Per injection, 1 ml of 10.sup.5 TCID.sub.50/ml of BTV was injected subcutaneously (s.c.) between the shoulder blades left and right from the spinal cord and/or were injected intravenously (i.v.). Negative control groups received growth medium of mock-infected cells or were not injected.

(134) Body temperature was recorded daily, and fever was defined as above the average temperature plus two times the standard deviation. Clinical signs were daily recorded according to the clinical score table for BTV8 animal trials (Backx et al., 2007. Vet Rec 161: 591-592; Backx et al., 2009. Vet Microbiol 138: 235-243; van Gennip et al., 2012a. PLoS ONE 7, e30540). Clinical signs were quantified by an adapted clinical reaction index (CRI) as described ((Huismans et al., 1987. Virology 157, 172-179). A maximum score of 12 was given to the cumulative total of fever readings (a) as described above from days 4 to 15 post each inoculation (dpi), a clinical score according the clinical score table (b). An additional 4 points were added to the sum of a and b if death occurred within 14 dpi. Generally, the efficacy of vaccine candidates is measured by reduction of the CRI, seroconversion in general, induction of neutralizing immune response, and by reduction of viremia as measured by PCR testing.

(135) EDTA-blood samples were collected by indicated intervals. Generally, the first week after each injection daily followed by sampling every other day until the end of the trial. EDTA-blood samples were tested by panPCR BTV assays for detection of BTV RNA, or by specific PCR tests for detection of certain genome segments. Occasionally, amplicons were sequenced to identify specific genome segments.

(136) Serum samples were collected more frequently in the second week after each injection. Sera were tested by BTV-specific ELISAs and/or SNT for the detection of BTV-serotype specific (neutralizing) antibodies. Occasionally, sera were used to immunostain transiently expressed BTV proteins.

(137) rgBTV1 and modBTvac-1 were compared after infection of sheep. rgBTV1 and modBTvac-1 share 9 out of 10 genome segments, and differ only in genome segment S10. Groups of two sheep were s.c. and i.v. infected with rgBTV1 or modBTvac-1. Each route of administration contained 1 ml 10*5 TCID50/ml. The sheep were re-infected twice with an interval of 3 weeks with the same virus. The sheep were monitored up to nine weeks (63 dpi). No obvious clinical signs were observed (see FIG. 5), and no increase of body temperature was measured for sheep infected with modBTvac-1. Unfortunately, no records of body temperature were available for 0-10 dpi. ModBTvac-1 infected sheep were tested negative by panBTV PCR assay, whereas seroconversion was demonstrated by VP7-ELISA (FIG. 5). The antibody titer against VP7 and VP2 was comparable to that of sheep infected with rgBTV1 (FIG. 6). From these results, it can be concluded that modBTvac-1 is as protective as rgBTV-1, whereas virulence and viremia are reduced.

Example 13

(138) Infection of BTV lacking NS3/NS3a expression will not raise antibodies (Abs) directed against this protein. However, the immune response by NS3/NS3a is not extensively studied at all. It is not known whether the NS3 humoral response is conserved, although immunogenic regions were mapped that are extremely conserved. Further, studies regarding long lasting humoral responses were mainly limited to the response against VP2 which are important for neutralization (nAbs), and against VP7 which are high and conserved and thus used in commercially available ELISAs. Here, the response against NS3 after infection by reference BTV strains is studied. Further, the response against NS3/NS3a after experimental and natural infection by BTV8/net06 as BTV representative is investigated.

(139) NS3/NS3a expression from the gene of wtNS3/NS3a and from of BPS2 was studied. Transfected BSR monolayers expression NS3/NS3a, BPS2-NS3/NS3a, or VP7 were immunostained by sera raised against different BTV serotypes (IPMA).

(140) TABLE-US-00018 FP-T7 infected BSR monolayers were transfected with plasmids with genes under transcriptional control of the T7-promoter, as described for GMS2). NS3/NS3a serum BTV-ref mutant 887 1-10 NS3/NS3a + + BPS2 VP7 ++ ++ Expression of the wtNS3/NS3a gene, the BPS2 gene or of the VP7 gene was studied. Expression was studied by immunostaining with BTV reference sera that were raised against BTV serotypes 1 to 10 (BTV-ref 1-10). Serum 887 raised against BTV8/net06 (Backx et al., 2007. Vet Rec 161, 591-592) served as positive control. Immunostaining was compared to that of expressed VP7. Other BTV reference sera are not tested yet.

(141) 43 cattle sera and 31 sheep sera from of naturally infected animals were collected in 2007 and 2008 were confirmed to be positive by a commercially available VP7-ELISA (ID SCREEN; ID.VET). These were tested by an indirect ELISA for VP7, and an experimental indirect ELISA based on NS3/NS3a (Ingenasa; Spain). The latter two ELISAs were performed by Ingenasa according to their instructions.

(142) TABLE-US-00019 VP7 Cattle + NS3 + 37 0 0 6* VP7: OD average: 1.121 (SD: 0.419) NS3: OD average: 0.591 (SD: 0.197)

(143) In general terms, all seropositive animals (by VP7-cELISA with a cut-off value of 50% inhibition (ID.VET) were also positive to NS3-Abs. The asterix (*) indicates six cows that were tested negative by indirect NS3-ELISA (Ingenasa), and were also negative or close to negative by indirect VP7-ELISA by use of a cut-off value of 0.4 (Ingenasa).

(144) TABLE-US-00020 VP7 sheep + NS3 + 31 0 0 0 VP7: OD average: 1.041 (SD: 0.384) NS3: OD average: 0.765 (SD: 0.242)

Example 14

(145) Longitudinally collected sera from three cows naturally infected by BTV8/net06 and two heifers experimentally infected by BTV8/net06 were used (van Rijn et al., 2012b. J Vet Diagn Invest 24: 469). Pregnant cows 693, 858, and 859 were removed from the infected zone during the starting BT-8 outbreak in Autumn 2006. It was estimated that these cows has been infected at least 50 days earlier. EDTA blood from these cows was collected, washed and pooled. Three heifers were injected with this washed EDTA blood, but only heifers 860 and 861 were successfully infected. Sera were tested with the competition VP7-ELISA (ID.VET), the indirect VP7-ELISA (Ingenasa), and an experimental indirect ELISA based on NS3/NS3a. All ELISAs were performed according to the instructions of the suppliers (see FIGS. 12A-12E).

(146) The conclusion of these experiments is that VP7-Abs are present for longer time than NS3-Abs. Titers of NS3-Abs start to decline after approximately three months, and convert to doubtful/negative at 4-5 months post infection in this experimental ELISA with a cut off of 0.4.

Example 15

(147) BPS2del (see example 9) and Segment-2 of BTV8 were incorporated in rgBTV1 (BTV1 backbone). StartSdel (see example 9, FIG. 3) and Segment-2 of BTV8 were incorporated in rgBTV6 (BTV6 backbone). BPS2del was also incorporated in rgBTV8 (BTV8 backbone).

(148) In short, all three generated BTV backbones contain Segment-2 of serotype 8 and the NS3/NS3a knockout phenotype, whereas the other eight genome segments originates from BTV1, BTV6 or BTV8, respectively. Equal amounts of BTV8 were inactivated by standard bromo-ethylimine (BEI) treatment.

(149) Groups of four sheep were subcutaneously vaccinated with 2 ml 10*5 TCID50/ml of each BTV backbone or with equal amounts of inactivated BTV8. One group served as negative control. At 21 days post vaccination (21 dpv), sheep were infected with 4 ml 10*5 TCID50/ml virulent BTV8. The sheep were monitored up to 42 dpv (21 days after virus challenge).

(150) After vaccination, no increase of body temperature was measured (FIG. 7A), and no clinical signs were observed (FIG. 7B). Up to 21 dpv (prior challenge), all groups were negative by panBTV S10 PCR assay as well as in the panBTVS1 PCR assay (FIGS. 7C and D). Serological tests showed seroconversion for vaccinated animals, whereas inactivated BTV8 did not induce a significant VP7 ELISA signal (FIG. 7E). The group vaccinated with BTV6 backbone showed neutralizing antibodies directed against BTV serotype 8 (FIG. 7F). All groups, including vaccinated groups, remained seronegative for NS3-Abs (FIG. 7G).

(151) Groups vaccinated with the BTV6 and BTV8 backbone were protected against BTV8-mediated disease (no fever and no clinical signs) (FIGS. 7A and 7B). Except for BTV6 backbone, viremia was detected by both PCR tests for all groups after challenge (21 dpv/0 dpc to 42 dpv/21 dpc) (FIGS. 7C and 7D). All groups responded to the BTV8 challenge by induction of an immune response, as is indicated by the positive VP7 ELISA and neutralizing Abs titers (VP2 antibodies) (FIGS. 7E and 7F). All groups also responded to the BTV8 challenge by induction of a NS3-mediated immune response, as is indicated by the NS3 ELISA, although groups vaccinated with the BTV6 and BTV8 backbone remain negative as these showed a blocking percentage below the threshold set at 50% (FIG. 7G).

Example 16

(152) rgBTV6 with Seg-2 of serotype 8 and the NS3/NS3a knockout phenotype (see BTV6 backbone in example 15) is a bluetongue virus DISA vaccine 8. Groups of four sheep were subcutaneously vaccinated with this DISA vaccine: two groups with 2 ml 10*5 TCID50/ml (H), one group with 2 ml 10*4 TCID50/ml (M), and one group with 2 ml 10*3 TCID50/ml (L). At 21 dpv, both groups H were subcutaneously vaccinated again with 2 ml 10*5 TCID50/ml again (DISA DISA), whereas group M and L were not boosted. Group M and L were euthanized at 42 dpv, while monitoring of groups DISA DISA (H) was continued.

(153) All groups remained negative by panBTVS1 PCR testing (FIG. 8A). Three sheep from different groups showed a very low PCR signal (high Ct value) for one day. Seroconversion was observed in all vaccinated groups. VP7 ELISA signals declined in the second week post vaccination in all groups. Revaccination of both groups H animals resulted in an increase of the VP7 ELISA signal (see FIG. 8B). VP7 ELISA signals in group M and L further decreased, and finally became negative after about 4 weeks post vaccination (FIG. 8B). Vaccinated and revaccinated groups showed neither an increase in body temperature nor clinical signs.

(154) At 78 dpv, two new groups of four sheep, free of BTV and BTV Abs, were included as control groups. Control groups and vaccinated groups H were infected with 4 ml 10*5 TCID50/ml at 84 dpv (0 days post challenge (dpc)): one vaccinated and one control group were infected with virulent BTV2 (DISA DISA BTV2, and BTV2), and the other two groups with virulent BTV8 (DISA DISA BTV8, and BTV8). The sheep were monitored up to 105 dpv/21 dpc.

(155) In contrast to the vaccinated group challenged with BTV8, which were completely protected, increase in body temperature and clinical signs were observed in the other groups. Thus, virulent BTV2 induced increased body temperature and clinical signs after vaccination with BT DISA vaccine 8. However, these were less pronounced than in the BTV2 control group suggesting partial protection by BT DISA vaccine 8 (FIG. 9A-B). Partial protection was further confirmed by S1 panBTV PCR testing and by the NS3 ELISA (FIGS. 9C and 9G). Finally, all groups showed seroconversion/boosting after challenge in VP7 ELISA, NS3 ELISA and serum neutralization tests, except for the vaccinated group challenged with BTV8 which remained negative in the NS3 ELISA (FIGS. 9D, 9E, 9F and 9G). Apparently, protection is serotype specific and related to the immune response against VP2 of serotype 8 as present in BT DISA vaccine 8.

Example 17

(156) Several Seg-10 mutants were generated containing mutations in Seg-10 of BTV8 or BTV6. A various number of AUG>GCC mutations in the NS3-ORF were generated; AUG3 tm 13, AUG total, NS3b His-tag for Seg-10 of BTV8, and AUG total DIVA, and NS3knockout DIVA for Seg-10 of BTV6. Further, STOP codons downstream from AUG2 were introduced in NS3b His-tag (for BTV8 Seg-10) and in NS3knockout DIVA (for BTV6 Seg-10). Finally, to detect C-terminal expression of NS3 six codons encoding a His-tag were introduced in-frame and adjacent upstream from the STOP codon of NS3/NS3a (NS3b His-tag). Mutations (underlined), mutated AUG codons and introduced STOP codons (bold), and His codons encoding the His-tag (small, underlined and bold) are indicated.

(157) TABLE-US-00021 BTV8Seg-10ofAUG3tm13' (SEQIDNO:84) GTTAAAAAGTGTCGCTGCCATGCTATCCGGGCTGATCCAAAGGTTCGAA GAAGAAAAAATGAAACATAATCAAGACAGAGTTGAAGAGCTGAGTCTAG TACGTGTAGATGACACCATCTCTCAACCACCAAGGTATGCTCCGAGTGC ACCGGCCCCATCATCTGCCCCAACGGTTGCCCTTGAAATATTGGACAAA GCGGCCTCAAACACAACTGGTGCAACGCAAACACAAAAGGCGGAGAAGG CTGCATTCGCATCGTACGCGGAAGCGTTTCGTGATGATGTAAGACTGAG ACAGATCAAGCGCCATGTGAACGAGCAGATTTTACCAAAATTAAAAAGT GATCTAAGTGGATTGAAGAAGAAACGAGCAATCATACACACTACTCTAT TAGTAGCGGCTGTGGTTGCGCTGTTGACATCAGTTTGTACCCTTTCAAG CGATGCCAGTGTGGCCTTTAAGATAAATGGAACTAAAACAGAAGTGCCT TCATGGTTTAAAAGCCTTAACCCGGCCCTTGGCGTGGTCAATTTGGGAG CAACTTTTCTGGCCGCCGTTTGCGCAAAGAGTGAAAGAGCCTTGAACCA GCAGATAGATGCCATAAAGAAGGAAGTGGCCAAGAAACAATCTTATAAT GATGCGGTGAGGGCCAGTTTTACAGAGTTCTCGTCAGTCCCGCTGGATG GTTTCGAAGCCCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGA GGTTTACGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCACTGC TGTATAACGGGGGAGGGTGCGCGACACTACACACTTAC BTV8Seg-10ofAUGtotal (SEQIDNO:85) GTTAAAAAGTGTCGCTGCCGCCCTATCCGGGCTGATCCAAAGGTTCGAA GAAGAAAAAGCCAAACATAATCAAGACAGAGTTGAAGAGCTGAGTCTAG TACGTGTAGATGACACCATCTCTCAACCACCAAGGTATGCTCCGAGTGC ACCGGCCCCATCATCTGCCCCAACGGTTGCCCTTGAAATATTGGACAAA GCGGCCTCAAACACAACTGGTGCAACGCAAACACAAAAGGCGGAGAAGG CTGCATTCGCATCGTACGCGGAAGCGTTTCGTGATGATGTAAGACTGAG ACAGATCAAGCGCCATGTGAACGAGCAGATTTTACCAAAATTAAAAAGT GATCTAAGTGGATTGAAGAAGAAACGAGCAATCATACACACTACTCTAT TAGTAGCGGCTGTGGTTGCGCTGTTGACATCAGTTTGTACCCTTTCAAG CGATGCCAGTGTGGCCTTTAAGATAAATGGAACTAAAACAGAAGTGCCT TCATGGTTTAAAAGCCTTAACCCGGCCCTTGGCGTGGTCAATTTGGGAG CAACTTTTCTGGCCGCCGTTTGCGCAAAGAGTGAAAGAGCCTTGAACCA GCAGATAGATGCCATAAAGAAGGAAGTGGCCAAGAAACAATCTTATAAT GATGCGGTGAGGGCCAGTTTTACAGAGTTCTCGTCAGTCCCGCTGGATG GTTTCGAAGCCCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGA GGTTTACGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCACTGC TGTATAACGGGGGAGGGTGCGCGACACTACACACTTAC *A)BTV8Seg-10ofNS3bHis-tag (SEQIDNO:86) GTTAAAAAGTGTCGCTGCCGCCCTATCCGGGCTGATCCAAAGGTTCGAA GAAGAAAAAGCCAAACATAATCAAGACAGAGTTGAAGAGCTGAGTCTAG TACGTGTAGATGACACCATCTAGCAACCACCAAGGTATGTAGTAGGTGC ACCGATGCCATCATCGATGCCAACGGTTGCCCTTGAAATATTGGACAAA GCGATGTCAAACACAACTGGTGCAACGCAAACACAAAAGGCGGAGAAGG CTGCATTCGCATCGTACGCGGAAGCGTTTCGTGATGATGTAAGACTGAG ACAGATCAAGCGCCATGTGAACGAGCAGATTTTACCAAAATTAAAAAGT GATCTAAGTGGATTGAAGAAGAAACGAGCAATCATACACACTACTCTAT TAGTAGCGGCTGTGGTTGCGCTGTTGACATCAGTTTGTACCCTTTCAAG CGATATGAGTGTGGCCTTTAAGATAAATGGAACTAAAACAGAAGTGCCT TCATGGTTTAAAAGCCTTAACCCGATGCTTGGCGTGGTCAATTTGGGAG CAACTTTTCTGATGATGGTTTGCGCAAAGAGTGAAAGAGCCTTGAACCA GCAGATAGATATGATAAAGAAGGAAGTGATGAAGAAACAATCTTATAAT GATGCGGTGAGGATGAGTTTTACAGAGTTCTCGTCAGTCCCGCTGGATG GTTTCGAAATGCCATTAACCCATcatcaccatcaccacTGAGGACAGTA GGTAGAGTGGCGCCCCGAGGTTTACGTCGTGCAGGGTGGTTGACCTCGC GGCGTAGACTCCCACTGCTGTATAACGGGGGAGGGTGCGCGACACTACA CACTTAC *B)BTV6Seg-10ofAUGtotalDIVA (SEQIDNO:87) GTTAAAAAGTGTCGCTGCCGCCCTATCCGGGCTGATCCAAAGGTTCGAA GAAGAAAGGGCCAAACACAATCAAGATAGAGTTGAAGAGCTGAGTCTAG TGCGTGTAGATGATACCATTTCTCAACCACCAAGGTATGCCCCGAGTGC GCCGGCCCCATCATCTGCCCCAACGGTTGCCCTTGAAATATTGGACAAG GCGGCCTCAAACACAACTGGTGCAACGCAAACACAGAAAGCGGAGAAGG CAGCTTTTGCTAGCTATGCGGAAGCGTTTCGTGATGATGTGAGATTGAG ACAGATCAAACGCCATGTGAACGAGCAGATTTTACCAAAATTAAAAAGT GATCTAAGTGGATTGAAGAAGAAGCGAGCAATCATACACACTACTCTAT TGGTAGCTGCTGTGGTTGCGCTGTTGACATCAGTTTGCACCCTTTCAAG CGATGCCAGTGTGGCCTTTAAGATAAATGGAACTAAGACAGAAGTGCCT TCATGGTTTAAAAGCCTTAACCCGGCCCTTGGCGTTGTCAATTTGGGAG CAACTTTTTTGGCCGCCGTTTGCGCAAAGAGTGAAAGAGCCTTGAACCA GCAGATAGATGCCATAAAGAAGGAGGTGGCCAAGAAACAATCTTATAAT GACGCGGTGAGGGCCAGTTTTACGGAGTTCTCGTCAATCCCGCTGGATG GTTTCGAAGCCCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGA GGTTTGCGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCACTGC TGTATAACGGGGGAGGGTGCGCGACACTACACACTTAC *C)BTV6Seg-10ofNS3knockoutDIVA (SEQIDNO:88) GTTAAAAAGTGTCGCTGCCGCCCTATCCGGGCTGATCCAAAGGTTCGAA GAAGAAAGGGCCAAACACAATCAAGATAGAGTTGAAGAGCTGAGTCTAG TGCGTGTATAGGATACCATTTCTCAACCACCAAGGTAGGCCCCGAGTGC GCCGGCCCCATCATCTGCCCCAACGGTTGCCCTTGAAATATTGGACAAG GCGGCCTCAAACACAACTGGTGCAACGCAAACACAGAAAGCGGAGAAGG CAGCTTTTGCTAGCTATGCGGAAGCGTTTCGTGATGATGTGAGATTGAG ACAGATCAAACGCCATGTGAACGAGCAGATTTTACCAAAATTAAAAAGT GATCTAAGTGGATTGAAGAAGAAGCGAGCAATCATACACACTACTCTAT TGGTAGCTGCTGTGGTTGCGCTGTTGACATCAGTTTGCACCCTTTCAAG CGATGCCAGTGTGGCCTTTAAGATAAATGGAACTAAGACAGAAGTGCCT TCATGGTTTAAAAGCCTTAACCCGGCCCTTGGCGTTGTCAATTTGGGAG CAACTTTTTTGGCCGCCGTTTGCGCAAAGAGTGAAAGAGCCTTGAACCA GCAGATAGATGCCATAAAGAAGGAGGTGGCCAAGAAACAATCTTATAAT GACGCGGTGAGGGCCAGTTTTACGGAGTTCTCGTCAATCCCGCTGGATG GTTTCGAAGCCCCATTAACCTGAGGACAGTAGGTAGAGTGGCGCCCCGA GGTTTGCGTCGTGCAGGGTGGTTGACCTCGCGGCGTAGACTCCCACTGC TGTATAACGGGGGAGGGTGCGCGACACTACACACTTAC

(158) BTV mutants with mutated Seg-10 were generated. Mutations in Seg-10 were confirmed by sequencing of Seg-10. Overview of results is indicated in Table 4.

(159) TABLE-US-00022 TABLE 4 Seg of origin mutation IPMA name of BTV1 of Seg-10 in Seg-10 VP7 NS3 His CPE 1-9 8 + + + AUG3 tm 13 1-9 8 AUG.sup.3+13 > GCC.sup.3+13 + nd nd + AUG total 1-9 8 AUG.sup.1+13 > GCC.sup.1+13 + nd nd in-frame His-tag 1-9 8 insert of 6 His codons + + + + NS3b His-tag 1-9 8 *A + + small AUG total DIVA 6 *B nd nd nd nd NS3knockout DIVA 6 *C nd nd nd nd CPE phenotype in BSR infected monolayers was scored as similar to BTV1 (+), smaller CPE plaques (small), or no CPE (). IPMA was performed on infected monolayers with VP7 Ab ATCC1875, MAbs raised against BTV-NS3/NS3a or with His-tag Abs (+: staining, : no staining, nd: not done). Mutations in Seg-10 are indicated, referred to the complete sequence as given above (*A to *C), or no mutations ().

Example 18

(160) Several AHSV4LP mutants were generated with mutations in Seg-10 (AUG1, AUG1+2, AUG1+2 & STOPS, deILD, AUGtotal, NS3knockout DIVA, AUG1+2 & delTMR1), and delTMR2AUG1+2 & delTMR2. Mutations are underlined and mutated AUG codons and introduced STOP codons are in bold.

(161) TABLE-US-00023 Seg-10ofAHSV4LP: (SEQIDNO:89) GTTAAAATTATCCCTTGTCATGAATCTAGCTACAATCGCCAAGAATTATA GCATGCATAATGGAGAGTCGGGGGCGATCGTCCCTTATGTGCCACCACCA TACAATTTCGCAAGTGCTCCGACGTTTTCTCAGCGTACGAGTCAAATGGA GTCCGTGTCGCTTGGGATACTTAACCAAGCCATGTCAAGTACAACTGGTG CGAGTGGGGCGCTTAAAGATGAAAAAGCAGCATTCGGTGCTATGGCGGAA GCATTGCGTGATCCAGAACCCATACGTCAAATTAAAAAGCAGGTGGGTAT CAGAACTTTAAAGAACCTAAAGATGGAGTTAGCAACAATGCGTCGAAAGA AATCGGCATTAAAAATAATGATCTTTATTAGTGGATGCGTAACGTTAGCT ACATCGATGGTTGGGGGATTGAGTATCGTTGACGACGAAATATTAAGAGA TTATAAGAACAACGATTGGTTAATGAAGACTATACATGGGCTGAATTTGT TATGTACTACAGTTTTGTTAGCGGCGGGTAAGATTTCCGATAAAATGCAA GAGGAGATTTCACGGACTAAACGTGACATTGCGAAAAGAGAGTCTTACGT GTCAGCGGCGAGTATGTCGTGGAGTGGAGATACTGAGATGTTATTACAGG GAATTAAGTATGGCGAGAGCTAGTATGACCTCCACGAGCGGAAAATCCAT CGTGTTGGATGGATGGAACGCCTAGATCGTTTTCTAGGGAGTGGGATAAC AACTTAC *1)AUG->GCCmutationsofstartcodonsofNS3and NS3aandSTOPcodonsdownstreamofAUG2: (SEQIDNO:90) GTTAAAATTATCCCTTGTCGCCAATCTAGCTACAATCGCCAAGAATTATA GCGCCCATAATGGAGAGTGAGGGGCGATCGTCCCTTAAGTGCCACCACCA TAGAATTTCGCAAGTGCTCCGACGTTTTCTCAGCGTACGAGTCAAATGGA GTCCGTGTCGCTTGGGATACTTAACCAAGCCATGTCAAGTACAACTGGTG CGAGTGGGGCGCTTAAAGATGAAAAAGCAGCATTCGGTGCTATGGCGGAA GCATTGCGTGATCCAGAACCCATACGTCAAATTAAAAAGCAGGTGGGTAT CAGAACTTTAAAGAACCTAAAGATGGAGTTAGCAACAATGCGTCGAAAGA AATCGGCATTAAAAATAATGATCTTTATTAGTGGATGCGTAACGTTAGCT ACATCGATGGTTGGGGGATTGAGTATCGTTGACGACGAAATATTAAGAGA TTATAAGAACAACGATTGGTTAATGAAGACTATACATGGGCTGAATTTGT TATGTACTACAGTTTTGTTAGCGGCGGGTAAGATTTCCGATAAAATGCAA GAGGAGATTTCACGGACTAAACGTGACATTGCGAAAAGAGAGTCTTACGT GTCAGCGGCGAGTATGTCGTGGAGTGGAGATACTGAGATGTTATTACAGG GAATTAAGTATGGCGAGAGCTAGTATGACCTCCACGAGCGGAAAATCCAT CGTGTTGGATGGATGGAACGCCTAGATCGTTTTCTAGGGAGTGGGATAAC AACTTAC *2)DeletionoftheputativeLateDomainresulting inanout-of-framemutation: (SEQIDNO:91) GTTAAAATTATCCCTTGTCATGAATCTAGCTACAATCGCCAAGAATTATA GCATGCATAATGGAGAGTCGGGGGCGATCGTCCCTTATGTG--------- -----------------------GTTTTCTCAGCGTACGAGTCAAATGGA GTCCGTGTCGCTTGGGATACTTAACCAAGCCATGTCAAGTACAACTGGTG CGAGTGGGGCGCTTAAAGATGAAAAAGCAGCATTCGGTGCTATGGCGGAA GCATTGCGTGATCCAGAACCCATACGTCAAATTAAAAAGCAGGTGGGTAT CAGAACTTTAAAGAACCTAAAGATGGAGTTAGCAACAATGCGTCGAAAGA AATCGGCATTAAAAATAATGATCTTTATTAGTGGATGCGTAACGTTAGCT ACATCGATGGTTGGGGGATTGAGTATCGTTGACGACGAAATATTAAGAGA TTATAAGAACAACGATTGGTTAATGAAGACTATACATGGGCTGAATTTGT TATGTACTACAGTTTTGTTAGCGGCGGGTAAGATTTCCGATAAAATGCAA GAGGAGATTTCACGGACTAAACGTGACATTGCGAAAAGAGAGTCTTACGT GTCAGCGGCGAGTATGTCGTGGAGTGGAGATACTGAGATGTTATTACAGG GAATTAAGTATGGCGAGAGCTAGTATGACCTCCACGAGCGGAAAATCCAT CGTGTTGGATGGATGGAACGCCTAGATCGTTTTCTAGGGAGTGGGATAAC AACTTAC *3)AUG->GCCmutationofallAUGcodonsinORFof NS3/NS3a: (SEQIDNO:92) GTTAAAATTATCCCTTGTCGCCAATCTAGCTACAATCGCCAAGAATTATA GCGCCCATAATGGAGAGTCGGGGGCGATCGTCCCTTATGTGCCACCACCA TACAATTTCGCAAGTGCTCCGACGTTTTCTCAGCGTACGAGTCAAGCCGA GTCCGTGTCGCTTGGGATACTTAACCAAGCCGCCTCAAGTACAACTGGTG CGAGTGGGGCGCTTAAAGATGAAAAAGCAGCATTCGGTGCTGCCGCGGAA GCATTGCGTGATCCAGAACCCATACGTCAAATTAAAAAGCAGGTGGGTAT CAGAACTTTAAAGAACCTAAAGGCCGAGTTAGCAACAGCCCGTCGAAAGA AATCGGCATTAAAAATAGCCATCTTTATTAGTGGATGCGTAACGTTAGCT ACATCGGCCGTTGGGGGATTGAGTATCGTTGACGACGAAATATTAAGAGA TTATAAGAACAACGATTGGTTAGCCAAGACTATACATGGGCTGAATTTGT TATGTACTACAGTTTTGTTAGCGGCGGGTAAGATTTCCGATAAAGCCCAA GAGGAGATTTCACGGACTAAACGTGACATTGCGAAAAGAGAGTCTTACGT GTCAGCGGCGAGTGCCTCGTGGAGTGGAGATACTGAGGCCTTATTACAGG GAATTAAGTATGGCGAGAGCTAGTATGACCTCCACGAGCGGAAAATCCAT CGTGTTGGATGGATGGAACGCCTAGATCGTTTTCTAGGGAGTGGGATAAC AACTTAC *4)1*+ 3*andmutationsinaconservedregionas possibletargetforapotentialpanAHSVS10PCR assay(NS3knockoutDIVA): (SEQIDNO:93) GTTAAAATTATCCCTTGTCGCCAATCTAGCTACAATCGCCAAGAATTATA GCGCCCATAATGGAGAGTGAGGGGCGATCGTCCCTTAAGTGCCACCACCA TAGAATTTCGCAAGTGCTCCGACGTTTTCTCAGCGTACGAGTCAAGCCGA AAGTGTAAGTTTAGGGATACTTAACCAAGCCGCCTCAAGTACAACTGGTG CGAGTGGGGCGCTTAAAGATGAAAAAGCAGCATTCGGTGCTGCCGCGGAA GCATTGCGTGATCCAGAACCCATACGTCAAATTAAAAAGCAGGTGGGTAT CAGAACTTTAAAGAACCTAAAGGCCGAGTTAGCAACAGCCCGTCGAAAGA AATCGGCATTAAAAATAGCCATCTTTATTAGTGGATGCGTAACGTTAGCT ACATCGGCCGTTGGGGGATTGAGTATCGTTGACGACGAAATATTAAGAGA TTATAAGAACAACGATTGGTTAGCCAAGACTATACATGGGCTGAATTTGT TATGTACTACAGTTTTGTTAGCGGCGGGTAAGATTTCCGATAAAGCCCAA GAGGAGATTTCACGGACTAAACGTGACATTGCGAAAAGAGAGTCTTACGT GTCAGCGGCGAGTGCCTCGTGGAGTGGAGATACTGAGGCCTTATTACAGG GAATTAAGTATGGCGAGAGCTAGTATGACCTCCACGAGCGGAAAATCCAT CGTGTTGGATGGATGGAACGCCTAGATCGTTTTCTAGGGAGTGGGATAAC AACTTAC *5)delTMR1:AUG1+ 2incombinationwitha deletioninSeg-10encompassingtransmembrane region1(TM1): (SEQIDNO:94) GTTAAAATTATCCCTTGTCATGAATCTAGCTACAATCGCCAAGAATTATA GCGCCCATAATGGAGAGTCGGGGGCGATCGTCCCTTATGTGCCACCACCA TACAATTTCGCAAGTGCTCCGACGTTTTCTCAGCGTAC------------ -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---TAAGAACAACGATTGGTTAATGAAGACTATACATGGGCTGAATTTGT TATGTACTACAGTTTTGTTAGCGGCGGGTAAGATTTCCGATAAAATGCAA GAGGAGATTTCACGGACTAAACGTGACATTGCGAAAAGAGAGTCTTACGT GTCAGCGGCGAGTATGTCGTGGAGTGGAGATACTGAGATGTTATTACAGG GAATTAAGTATGGCGAGAGCTAGTATGACCTCCACGAGCGGAAAATCCAT CGTGTTGGATGGATGGAACGCCTAGATCGTTTTCTAGGGAGTGGGATAAC AACTTAC *6)de1lTMR2:AUG1+ 2incombinationwitha deletionDeletioninSeg-10encompassingtrans- membraneregion2(TM2): (SEQIDNO:95) GTTAAAATTATCCCTTGTCGCCAATCTAGCTACAATCGCCAAGAATTATAG CGCCCATAATGGAGAGTCGGGGGCGATCGTCCCTTATGTGCCACCACCATA CAATTTCGCAAGTGCTCCGACGTTTTCTCAGCGTACGAGTCAAATGGAGTC CGTGTCGCTTGGGATACTTAACCAAGCCATGTCAAGTACAACTGGTGCGAG TGGGGCGCTTAAAGATGAAAAAGCAGCATTCGGTGCTATGGCGGAAGCATT GCGTGATCCAGAACCCATACGTCAAATTAAAAAGCAGGTGGGTATCAGAAC TTTAAAGAACCTAAAGATGGAGTTAGCAACAATGCGTCGAAAGAAATCGGC ATTAAAAATAATGATCTTTATTAGTGGATGCGTAACGTTAGCTACATCGAT GGTTGGGGGATTGAGTATCGTTGACGACGAAATATTAAGAGATTA------ --------------------------------------------------- --------------------------------------------------- ------------------------------------GTGTCAGCGGCGAGT ATGTCGTGGAGTGGAGATACTGAGATGTTATTACAGGGAATTAAGTATGGC GAGAGCTAGTATGACCTCCACGAGCGGAAAATCCATCGTGTTGGATGGATG GAACGCCTAGATCGTTTTCTAGGGAGTGGGATAACAACTTAC

(162) Mutants of AHSV4LP with Seg-2[VP2] and Seg-6[VP5] encoding both outer shell proteins of different serotypes were generated (serotyped). Further, AHSV4LP mutants with Seg-2[VP2] of each of the nine AHSV serotypes were generated (AHSVxLP). Finally, combinations of mutated Seg-10 and Seg-2 of each of the nine AHSV serotypes were combined in AHSV4LP resulting in Seg-2 serotyped AHSV without expression from ORF-NS3 (AHS DISA vaccine x). Exchange of Seg-2 and mutations in Seg-10 were confirmed by (partial) sequencing of the respective genome segments. Overview of results is indicated in Table 5.

(163) TABLE-US-00024 TABLE 5 Seg-2 Seg of mutation IPMA name typed of AHSV4LP in Seg-10 CPE VP5* VP2** NS3*** AHSV4LP 1-10 + + nd + AUG1 1-9 AUG.sup.1 > GCC.sup.1 + + nd + AUG1+2 1-9 AUG.sup.1+2 > GCC.sup.1+2 small + nd mutAUG1 + 2 & STOPS 1-9 *1 small + nd delLD 1-9 *2 small + nd AUG total 1-9 *3 + nd NS3knockout DIVA 1-9 *4 + nd delTMR1 1-9 *5 + nd delTMR2 1-9 *6 + nd serotyped 3 (VP2/VP5).sup.3 1, 3-5, 7-10 + nd 3 nd AHSV4LP 1-10 + + 4 + serotyped 6 (VP2/VP5).sup.6 1, 3-5, 7-10 + nd 6 nd AHSV1LP 1 1, 3-10 + nd 1 nd AHSV2LP 2 1, 3-10 + nd 2 nd AHSV3LP 3 1, 3-10 + nd 3 nd AHSV4LP 1-10 + + 4 + AHSV5LP 5 1, 3-10 + nd 5 nd AHSV6LP 6 1, 3-10 + nd 6 nd AHSV7LP 7 1, 3-10 + + 7 nd AHSV8LP 8 1, 3-10 + nd 8 nd AHSV9LP 9 1, 3-10 + nd 9 nd AHSV1LP-(NS3/NS3a).sup.minus 1 1, 3-9 *1 small nd 1 nd AHSV8LP-(NS3/NS3a).sup.minus 8 1, 3-9 *1 small nd 8 nd AHS DISA vaccine 1 1 1, 3-9 *4 nd 1 AHS DISA vaccine 2 2 1, 3-9 *4 nd 2 AHS DISA vaccine 3 3 1, 3-9 *4 nd 3 AHS DISA vaccine 4 1-9 *4 nd 4 AHS DISA vaccine 5 5 1, 3-9 *4 nd 5 AHS DISA vaccine 6 6 1, 3-9 *4 nd 6 AHS DISA vaccine 7 7 1, 3-9 *4 nd 7 AHS DISA vaccine 8 8 1, 3-9 *4 nd 8 AHS DISA vaccine 9 9 1, 3-9 *4 nd 9 CPE phenotype in BSR infected monolayers was scored as similar to AHSV4LP (+), smaller CPE plaques (small), or no CPE (). IPMA was performed on infected monolayers with VPS serum, with sera raised against baculovirus expressed AHSV-VP2 proteins of each of the nine AHSV serotypes (VP2**) (Yuta et al., in prep.), or with MAbs raised against AHSV-NS3/NS3a (+: staining, : no staining, nd: not done). Mutations in Seg-10 are indicated by referring to the complete sequence as given above (*1 to *6), or no mutations ().

Example 19

(164) Mutants of BTV with mutated Seg-10 were used to map epitopes on NS3/NS3a proteins, as is indicated in Table 6.

(165) TABLE-US-00025 TABLE 6 BTV mutants with mutated Seg-10 as described in previous examples were used to map epitopes on NS3/NS3a proteins. IPMA was performed on BSR monolayers infected with BTV mutants with MAbs raised against NS3/NS3a proteins. IPMA with MAb 1875 against VP7 served as positive control. (+: staining, : no staining). BTV amino acid virus VP7 NS3 NS3 NS3 NS3 NS3 mutant changes rescue 1875 33H7 32H2 32F1 31E9 32B6 Wild type none Yes + + + + + + Mut AUG1 Met-4 > Ala Yes + + + + + + Mut AUG2 Met-14 > Ala Yes + + + + + + Mut AUG1 + 2 Met-1/Met-14 > Ala/Ala Yes + Mut-B none Yes + + + + + + PSAP >ASAP YAPSAP >YAASAP Yes + + + + PSAP >GAAP YAPSAP > YAGAAP Yes + + + + S-rev-1 PPRYAP > PP(A)RYAP Yes + + + + S-rev-2 PPRYAP > (H)QRYAP Yes + + + + TM1 ALL > EEE Yes + + + + + + N149S NGT > SGT Yes + + + + + + CT4-212 Arg > STP-212 Yes + + + + + + B-rev-1 FASYAE > FASY(V)AE Yes + + + + + + BPS2 truncated at Met-14 Yes +

Example 20 Expression of NS3

(166) NS3 ELISA. Available full length nucleotide sequences of genome segment 10 (Seg-10) were putatively translated to NS3/NS3a proteins and compared by freely available software program protein blast, which is available at (http://blast.ncbi.nlm.nih.gov).

(167) The comparison showed that many regions in NS3/NS3a proteins are highly conserved among 24 recognized serotypes within the BTV serogroup, such as the immunogenic Late Domain region QPPRYAPSAP (position 35-44) in which MAbs 33H7, 32F1, 31E9 and 32B6 have been mapped.

(168) A hydrophobicity plot is indicated in FIG. 10. The sequence encoding TMR1, EC and TMR2 (aa 117-183) in the NS3 open reading frame of Seg-10 was removed by an in-frame deletion in BTV8)NS3TM to increase NS3 antigen production in bacteria.

(169) TABLE-US-00026 BTV8)NS3TM: (SEQIDNO:96) ATGCTGTCGGGTCTGATCCAACGCTTTGAAGAAGAAAAAATGAAACATA ACCAAGATCGTGTCGAAGAACTGTCACTGGTCCGTGTGGATGACACCAT TTCACAGCCGCCGCGTTATGCACCGTCGGCTCCGATGCCGAGCTCTATG CCGACCGTTGCCCTGGAAATCCTGGATAAAGCAATGTCTAACACCACGG GCGCAACCCAGACGCAAAAGGCTGAAAAAGCGGCCTTTGCGAGCTACGC GGAAGCCTTCCGTGATGACGTTCGTCTGCGCCAGATTAAACGCCATGTC AATGAACAAATCCTGCCGAAGCTGAAAAGCGATCTGTCTGGCCTGAAAA AGAAA-------------------------------------------- ------------------------------------------------- ------------------------------------------------- ------------------------------------------------- ----------AGTGAACGTGCCCTGAACCAGCAAATCGATATGATCAAG AAAGAAGTCATGAAGAAACAGAGCTATAATGACGCCGTGCGCATGTCTT TTACCGAATTCTCATCGGTTCCGCTGGATGGTTTCGAAATGCCGCTGAC G*

(170) Deletion Seg-10 cloned in pET-51b(+)Ek/LIC for bacterial expression of truncated NS3 antigen (BTV8)NS3TM according to the supplier. Start codons of NS3 and NS3a are indicated in bold/underlined and the STOP codon is indicated by *.

(171) Expression and purification of truncated NS3 antigen (BTV8)NS3 TM is shown in FIG. 11.

(172) Plasmid pET-51(+)Ek/LIC expressing truncated NS3 antigen originating from BTV8/net06 was used for production. Regions encoding TM1, EC and TM2 were deleted by in-frame deletion to increase production of immunogenic parts of NS3, such as the immunogenic Late Domain region QPPRYAPSAP in which MAbs 33H7, 32F1, 31E9 and 32B6 are mapped. Indicated fractions were separated by polyacrylamide gel electrophoresis and proteins were detected by standardized Coomassie Brilliant Blue staining. Typically, truncated NS3 antigen was purified and eluted in a concentration of 100-200 ug/ml.

Example 21

(173) A competitive ELISA was developed for detection of antibodies directed against NS3/NS3a (NS3 ELISA), in particularly those competing for binding with MAb 33H7. Therefore, truncated NS3 was produced in bacteria and after purification used as antigen (see Example 20). NS3 antigen was bound to the bottom of ELISA plates (coating). After pre-incubation with serum samples (from sheep trials as described in previous examples), plates were washed and incubation was continued with mouse MAb 33H7 to occupy free epitopes on coated NS3 antigen (competition). After extensive washing to remove unbound MAb 33H7, incubation was continued with commercially available rabbit anti-mouse IgG Abs conjugated with peroxidase. After washing to remove free conjugated Abs, staining with TMB was performed according to standard procedures. Seroconversion as determined by NS3-ELISA is presented as (100x) % with a threshold value set on 50% (see FIGS. 7G and 9G).