Recombinant Ralstonia eutropha capable of producing polylactic acid or polylatic acid polymer, and method for producing polylactic acid or polylatic acid copolymer using same

Abstract

Provided are a recombinant Ralstonia eutropha capable of producing polylactate or a hydroxyalkanoate-lactate copolymer, and a method of preparing polylactate or a hydroxyalkanoate-lactate copolymer using the same. The recombinant Ralstonia eutropha, which is prepared by introducing a gene of an enzyme converting lactate into lactyl-CoA and a gene of a polyhydroxyalkanoate (PHA) synthase using lactyl-CoA as a substrate thereto, may be cultured, thereby efficiently preparing a lactate polymer and a lactate copolymer.

Claims

1. A recombinant Ralstonia eutropha (R. eutropha) capable of producing polylactate or a hydroxyalkanoate-lactate copolymer, wherein polyhydroxyalkanoate (PHA) biosynthesis gene operon of a wild-type R. eutropha is removed, and a gene of an enzyme converting lactate into lactyl-CoA and a gene of a PHA synthase using lactyl-CoA as a substrate are introduced, wherein the gene of the enzyme converting lactate into lactyl-CoA is a propionyl-CoA transferase (pct) gene, wherein the pct gene has a nucleotide sequence (cppct537) of SEQ ID NO: 1 comprising the T669C, A1125G, and T1158C mutations whose corresponding amino acid sequence comprises the Thr199Ile mutation.

2. The recombinant R. eutropha according to claim 1, wherein the pct gene is derived from Clostridium propionicum.

3. The recombinant R. eutropha according to claim 1, wherein the gene of the PHA synthase using lactyl-CoA as a substrate is derived from Pseudomonas sp. 6-19.

4. The recombinant R. eutropha according to claim 1, wherein the gene of the PHA synthase using lactyl-CoA as a substrate has a nucleotide sequence corresponding to the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 2 with at least one of the following mutations: E130D, S325T, L412M, S477R, S477H, S477F, S477Y, S477G, Q481M, Q481K and Q481R.

5. The recombinant R. eutropha according to claim 4, wherein the gene of the PHA synthase using lactyl-CoA as a substrate has a nucleotide sequence corresponding to at least one amino acid sequence selected from the group consisting of: the amino acid sequence (C1335) of SEQ ID NO: 2 containing the E130D, S325T, L412M, S477G and Q481M mutations; the amino acid sequence (C1310) of SEQ ID NO: 2 containing the E130D, S477F and Q481K mutations; and the amino acid sequence (C1312) of SEQ ID NO: 2 containing the E130D, S477F and Q481R mutations.

6. The recombinant R. eutropha according to claim 1, further comprising a gene coding a 3HB-CoA synthase.

7. The recombinant R. eutropha according to claim 6, wherein the gene coding the 3HB-CoA synthase includes a ketothiolase gene and an acetoacetyl-CoA reductase gene.

8. The recombinant R. eutropha according to claim 7, wherein the ketothiolase gene and the acetoacetyl-CoA reductase gene are derived from the R. eutropha.

9. The recombinant R. eutropha according to claim 1, which is capable of producing a hydroxyalkanoate-lactate copolymer of Medium Chain Length (MCL).

10. The recombinant R. eutropha according to claim 1, further comprising a PhaG gene.

11. The recombinant R. eutropha according to claim 10, wherein the PhaG gene is derived from P. Putida KT2440.

12. A method of preparing polylactate or a hydroxyalkanoate-lactate copolymer, comprising: culturing a recombinant Ralstonia eutropha of claim 1 in a medium containing a carbon source and lactate, or a carbon source, lactate and hydroxyalkanoate; and recovering polylactate or a hydroxyalkanoate-lactate copolymer from the recombinant R. eutropha.

13. The method according to claim 12, wherein hydroxyalkanoate of the hydroxyalkanoate-lactate copolymer includes at least one selected from the group consisting of 3-hydroxybutyrate, 3-hydroxyvalerate, 4-hydroxybutyrate, medium-chain-length (D)-3-hydroxycarboxylic acid with 6 to 14 carbon atoms, 2-hydroxypropionic acid, 3-hydroxypropionic acid, 3-hydroxyhexanoic acid, 3-hydroxyheptanoic acid, 3-hydroxyoctanoic acid, 3-hydroxynonanoic acid, 3-hydroxydecanoic acid, 3-hydroxyundecanoic acid, 3-hydroxydodecanoic acid, 3-hydroxytetradecanoic acid, 3-hydroxyhexadecanoic acid, 4-hydroxyvaleric acid, 4-hydroxyhexanoic acid, 4-hydroxyheptanoic acid, 4-hydroxyoctanoic acid, 4-hydroxydecanoic acid, 5-hydroxyvaleric acid, 5-hydroxyhexanoic acid, 6-hydroxydodecanoic acid, 3-hydroxy-pentenoic acid, 3-hydroxy-4-trans-hexenoic acid, 3-hydroxy-4-cis-hexenoic acid, 3-hydroxy-5-hexenoic acid, 3-hydroxy-6-trans-octenoic acid, 3-hydroxy-6-cis-octenoic acid, 3-hydroxy-7-octenoic acid, 3-hydroxy-8-nonenoic acid, 3-hydroxy-9-decenoic acid, 3-hydroxy-5-cis-dodecenoic acid, 3-hydroxy-6-cis dodecenoic acid, 3-hydroxy-5-cis tetradecenoic acid, 3-hydroxy-7-cis tetradecenoic acid, 3-hydroxy-5,8-cis-cis tetradecenoic acid, 3-hydroxy-4-methylvaleric acid, 3-hydroxy-4-methylhexanoic acid, 3-hydroxy-5-methylhexanoic acid, 3-hydroxy-6-methylheptanoic acid, 3-hydroxy-4-methyloctanoic acid, 3-hydroxy-5-methyloctanoic acid, 3-hydroxy-6-methyloctanoic acid, 3-hydroxy-7-methyloctanoic acid, 3-hydroxy-6-methylnonanoic acid, 3-hydroxy-7-methylnonanoic acid, 3-hydroxy-8-methylnonanoic acid, 3-hydroxy-7-methyldecanoic acid, 3-hydroxy-9-methyldecanoic acid, 3-hydroxy-7-methyl-6-octenoic acid, malic acid, 3-hydroxysuccinic acid-methyl ester, 3-hydroxyadipinic acid-methyl ester, 3-hydroxysuberic acid-methyl ester, 3-hydroxyazelaic acid-methyl ester, 3-hydroxysebacic acid-methyl ester, 3-hydroxysuberic acid-ethyl ester, 3-hydroxysebacic acid-ethyl ester, 3-hydroxypimelic acid-propyl ester, 3-hydroxysebacic acid-benzyl ester, 3-hydroxy-8-acetoxyoctanoic acid, 3-hydroxy-9-acetoxynonanoic acid, phenoxy-3-hydroxybutyric acid, phenoxy-3-hydroxyvaleric acid, phenoxy-3-hydroxyheptanoic acid, phenoxy-3-hydroxyoctanoic acid, para-cyanophenoxy-3-hydroxybutyric acid, para-cyanophenoxy-3-hydroxyvaleric acid, para-cyanophenoxy-3-hydroxyhexanoic acid, para-nitrophenoxy-3-hydroxyhexanoic acid, 3-hydroxy-5-phenylvaleric acid, 3-hydroxy-5-cyclohexylbutyric acid, 3,12-dihydroxydodecanoic acid, 3,8-dihydroxy-5-cis-tetradecenoic acid, 3-hydroxy-4,5-epoxydecanoic acid, 3-hydroxy-6,7-epoxydodecanoic acid, 3-hydroxy-8,9-epoxy-5,6-cis-tetradecanoic acid, 7-cyano-3-hydroxyheptanoic acid, 9-cyano-3-hydroxynonanoic acid, 3-hydroxy-7-fluoroheptanoic acid, 3-hydroxy-9-fluorononanoic acid, 3-hydroxy-6-chlorohexanoic acid, 3-hydroxy-8-chlorooctanoic acid, 3-hydroxy-6-bromohexanoic acid, 3-hydroxy-8-bromooctanoic acid, 3-hydroxy-11-bromoundecanoic acid, 3-hydroxy-2-butenoic acid, 6-hydroxy-3-dodecenoic acid, 3-hydroxy-2-methylbutyric acid, 3-hydroxy-2-methylvaleric acid, and 3-hydroxy-2,6-dimethylheptenoic acid.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1 and 2 illustrate the process of preparing a recombinant expression vector containing the mutant gene of polyhydroxyalkanoate synthase derived from Pseudomonas sp. 6-19, the mutant gene of propionyl-CoA transferase derived from C. propionicum, and a phaAB gene derived from R. eutropha.

(2) FIG. 3 illustrates a process of mating between Escherichia coli 517-1 and R. eutropha as well as the insertion of a target gene into the chromosome of R. eutropha to prepare recombinant R. eutropha.

MODE FOR INVENTION

(3) The present invention provides a recombinant strain of R. eutropha that can produce polylactate or a hydroxyalkanoate-lactate copolymer, such that the polyhydroxyalkanoate (PHA) biosynthesis gene operon of wild-type Ralstonia eutropha is removed and the gene of the enzyme converting foreign lactate to lactyl-CoA along with the gene of PHA synthase whose substrate is lactyl-CoA is introduced.

(4) In the present invention, the gene of the enzyme converting lactate to lactyl-CoA may be that of propionyl-CoA transferase (pct).

(5) In one particular embodiment, the pct gene can be derived from C. propionicum.

(6) In the present invention, the pct gene may be a mutant form that encodes propionyl-CoA transferase with equal or superior lactyl-CoA producing activity.

(7) In one particular embodiment, the pct gene may have the following nucleotide sequences: the nucleotide sequence (cp-pct) of SEQ ID NO: 1; the nucleotide sequence (cppct512) of SEQ ID NO: 1 containing the A1200G mutation; the nucleotide sequence (cppct522) of SEQ ID NO: 1 containing the T78C, T669C, A1125G, and T1158C mutations; the nucleotide sequence (cppct531) of SEQ ID NO: 1 containing the A1200G mutation whose corresponding amino acid sequence contains the Gly335Asp mutation; the nucleotide sequence (cppct532) of SEQ ID NO: 1 containing the A1200G mutation whose corresponding amino acid sequence contains the Ala243Thr mutation; the nucleotide sequence (cppct533) of SEQ ID NO: 1 containing the T669C, A1125G, and T1158C mutations whose corresponding amino acid sequence contains the Asp65Gly mutation; the nucleotide sequence (cppct534) of SEQ ID NO: 1 containing the A1200G mutation whose corresponding amino acid sequence contains the i Asp257Asn mutation; the nucleotide sequence (cppct535) of SEQ ID NO: 1 containing the T669C, A1125G, and T1158C mutations whose corresponding amino acid sequence contains the Asp65Asn mutations; the nucleotide sequence (cppct537) of SEQ ID NO: 1 containing the T669C, A1125G, and T1158C mutations whose corresponding amino acid sequence contains the Thr199Ile mutation; and the nucleotide sequence (cppct540) of SEQ ID NO: 1 containing the T78C, T669C, A1125G, and T1158C mutations whose corresponding amino acid sequence contains the Val193Ala mutation.

(8) The pct gene mutants may be prepared by the method disclosed in Korean Patent Application No. 10-2007-0081855. In one particular embodiment, the pct gene preferably have the nucleotide sequence (cppct540) of SEQ ID NO: 1 containing the T78C, T669C, A1125G, and T1158C mutations whose corresponding amino acid sequence contains the Val193Ala mutation.

(9) Meanwhile, in the present invention, the gene of PHA synthase using lactyl-CoA as its substrate may be the PHA synthase gene of Pseudomonas sp. 6-19.

(10) In the present invention, the gene of PHA synthase using lactyl-CoA as its substrate includes a mutant thereof that encodes PHA synthase having equal or superior PHA synthesizing capability.

(11) In one particular embodiment, the gene of PHA synthase using lactyl-CoA as its substrate may possess, but is not limited to, a nucleotide sequence corresponding to the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 2 with at least one of the following mutations: E130D, S325T, L412M, S477R, S477H, S477F, S477Y, S477G, Q481M, Q481K and Q481R.

(12) Mutation of the gene encoding PHA synthase using lactyl-CoA as its substrate may be performed by the method disclosed in Korean Patent Application No. 10-2008-0068607. In one particular embodiment, the PHA synthase gene have the nucleotide sequence corresponding to at least one amino acid sequence selected from the group consisting of: the amino acid sequence (C1335) of SEQ ID NO: 2 containing the E130D, S325T, L412M, S477G and Q481M mutations; the amino acid sequence (C1310) of SEQ ID NO: 2 containing the E130D, S477F and Q481K mutations; and the amino acid sequence (C1312) of SEQ ID NO: 2 containing the E130D, S477F and Q481R mutations.

(13) In the present invention, the recombinant strain of R. eutropha may further include a gene coding 3HB-CoA synthase. The gene encoding 3HB-CoA synthase allows the preparation of hydroxyalkanoate-lactate copolymer with a high molar fraction of hydroxyalkanoate, even when hydroxyalkanoate is not present in the medium.

(14) In one particular embodiment, the gene coding 3HB-CoA synthase may include a ketothiolase gene and acetoacetyl-CoA reductase gene, both of which may be derived from, but not limited to R. eutropha. In the present invention, recombinant R. eutropha may furthermore include a PhaG gene.

(15) In one particular embodiment, the PhaG gene may be derived from P. Putida KT2440. When the PhaG gene is also included in recombinant R. eutropha, recombinant R. eutropha becomes capable of producing a hydroxyalkanoate-lactate copolymer of MCL.

(16) Introduction of the gene encoding the enzyme that converts lactate to lactyl-CoA, the gene of PHA synthase that uses lactyl CoA as a substrate, the gene encoding 3HB-CoA synthase and/or the PhaG gene of recombinant R. eutropha may be performed by following a conventional method mentioned in the prior art. For example, the method may include preparation of a vector containing the gene encoding the enzyme that converts lactate to lactyl-CoA and/or the gene of PHA synthase that uses lactyl-CoA as a substrate as well as transformation of R. eutropha in which a wild-type PHA synthesis operon is removed from the recombinant vector.

(17) The term vector implies a DNA construct containing a DNA sequence operably linked to a control sequence capable of expressing DNA in a suitable host. In the present invention, the vector may be a plasmid vector, bacteriophage vector, cosmid vector or Yeast Artificial Chromosome (YAC) vector, although a plasmid vector is typically used. For example, a typical plasmid vector used herein may have (a) a replication origin for effective replication into several hundreds of plasmid vectors per host cell, (b) an antibiotic resistance gene for the selection of a host cell transformed by the plasmid vector, and (c) a restriction enzyme cutting site into which a foreign DNA fragment can be inserted. Although there is no suitable restriction enzyme cutting site, the vector may be easily ligated with foreign DNA using a synthetic oligonucleotide adaptor or linker following conventional methods.

(18) As shown in the prior art, to increase the expression of a transformed gene, the corresponding gene should be operably linked to an expression control sequence that is involved in transcription and translation in the selected expression host. Preferably, the expression control sequence and corresponding gene are included in a single expression vector containing both a bacterial selectable marker and replication origin. When the expression host is a eukaryotic cell, the expression vector should further include a useful expression marker.

(19) The term expression control sequence implies a DNA sequence that is essential for the expression of an operably linked coding sequence in a specific host. The control sequence includes a promoter for initiating transcription, a random operator sequence for controlling transcription, a sequence for coding a suitable mRNA ribosome binding site (RBS), and a sequence for controlling the termination of transcription and translation. For example, a control sequence suitable for a prokaryote cell includes a promoter, a random operator sequence, and an mRNA RBS. A control sequence suitable for a eukaryotic cell includes a promoter, a polyadenylation signal, and an enhancer. The promoter is the most critical factor that affects the gene expression in a plasmid. Therefore, a high-expression promoter such as the SR promoter or cytomegalovirus-derived promoter may be used.

(20) To express a DNA sequence using the present invention, any one of the various expression control sequences may be employed in a vector. Examples of useful expression control sequences include the early and late promoters of SV40 or adenovirus as well as lac system, trp system, TAC system, TRC system, T3 and T7 promoters, the major operator and promoter regions of phage , the control region of the fD coat protein, the promoter of the 3-phosphoglycerate kinase gene or that of a different glycolytic enzyme, the promoters of phosphatase genes, e.g., Pho5, a promoter of the yeast -mating system, and other sequences with configurations or derivations known to control the expression of prokaryotic and eukaryotic cells or their viruses, and various combinations thereof.

(21) Nucleic acid becomes operably linked to a nucleotide sequence when both are in a functional relationship. An appropriate molecule (e.g., a transcription-activating protein) may be the product of a gene and control sequence(s) that became linked in such a manner that enables gene expression. For example, the DNA encoding a pre-sequence or secretory leader is operably linked to the DNA encoding a polypeptide when expressed as a pre-protein that participates in the secretion of said polypeptide; a promoter or enhancer that affects the transcription of a coding sequence is operably linked to said coding sequence; and an RBS that affects the transcription or translation of a coding sequence is operably linked to said coding sequence. In general, operably linked implies that DNA sequences that are linked together are contiguous. Specifically, regarding the secretory leader, operably linked implies that DNA sequences are contiguous and in reading frame. However, an enhancer in contact with the coding sequence is not required. Linkage between sequences may be performed by ligation at a convenient restriction enzyme site. However, a synthetic oligonucleotide adaptor or linker may be used according to conventional methods when there is no restriction enzyme site.

(22) It should be noted that not all vectors and expression control sequences do function equally in the expression of DNA sequences according to the present invention. Similarly, all hosts do not function equally in the same expression system. However, those of ordinary skill in the art may be able to select various vectors, expression control sequences, and hosts without deviating from the scope of the present invention or increasing experimental error. For example, a vector must be selected by considering the host. In addition, on should consider the number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the corresponding vector, such as an antibiotic marker. Considering these variables, those of ordinary skill in the art may be able to determine suitable combinations of vectors, expression control sequences and hosts.

(23) The present invention also provides a method for preparation of polylactate or a hydrolxyalkanoate-lactate copolymer, culture of a recombinant R. eutropha in medium containing a carbon source and lactate, or a carbon source, lactate and hydroxyalkanoate, and recovery of polylactate or hydroxyalkanoate-lactate copolymer from recombinant R. eutropha.

(24) For example, when cultured in glucose-containing medium or medium containing glucose and hydroxyalkanoate, recombinant R. eutropha will produce either polylactate or a hydroxyalkanoate-lactate copolymer, respectively. However, when recombinant R. eutropha expresses a gene encoding 3HB-CoA synthase, hydroxyalkanoate-lactate copolymer can be prepared with a high molar fraction of hydroxyalkanoate, even when the medium is deficient in hydroxyalkanoate. When recombinant R. eutropha expresses PhaG, a hydroxyalkanoate-lactate copolymer of MCL can be prepared.

(25) The hydroxyalkanoate-lactate copolymer may include, but is not limited to, poly(3HA-co-LA), poly(3HB-co-LA), poly (3HP-co-LA), poly(3HB-co-4HB-co-LA), poly(3HP-co-4HB-co-LA), poly(3HB-co-3HV-co-LA), poly(4HB-co-LA-co-3HP), and poly(MCL 3-HA-co-LA).

(26) Specifically, the yield of hydroxyalkanoate-lactate copolymer may vary according to the type of hydroxyalkanoate contained in the medium.

(27) According to the present invention, the hydroxyalkanoate substrate for the synthesis of hydroxyalkanoate-lactate copolymer may be at least one of the following compounds: 3-hydroxybutyrate, 3-hydroxyvalerate, 4-hydroxybutyrate, medium-chain-length (D)-3-hydroxycarboxylic acid with 6 to 14 carbon atoms, 2-hydroxypropionic acid, 3-hydroxypropionic acid, 3-hydroxyhexanoic acid, 3-hydroxyheptanoic acid, 3-hydroxyoctanoic acid, 3-hydroxynonanoic acid, 3-hydroxydecanoic acid, 3-hydroxyundecanoic acid, 3-hydroxydodecanoic acid, 3-hydroxytetradecanoic acid, 3-hydroxyhexadecanoic acid, 4-hydroxyvaleric acid, 4-hydroxyhexanoic acid, 4-hydroxyheptanoic acid, 4-hydroxyoctanoic acid, 4-hydroxydecanoic acid, 5-hydroxyvaleric acid, 5-hydroxyhexanoic acid, 6-hydroxydodecanoic acid, 3-hydroxy-pentenoic acid, 3-hydroxy-4-trans-hexenoic acid, 3-hydroxy-4-cis-hexenoic acid, 3-hydroxy-5-hexenoic acid, 3-hydroxy-6-trans-octenoic acid, 3-hydroxy-6-cis-octenoic acid, 3-hydroxy-7-octenoic acid, 3-hydroxy-8-nonenoic acid, 3-hydroxy-9-decenoic acid, 3-hydroxy-5-cis-dodecenoic acid, 3-hydroxy-6-cis dodecenoic acid, 3-hydroxy-5-cis tetradecenoic acid, 3-hydroxy-7-cis tetradecenoic acid, 3-hydroxy-5,8-cis-cis tetradecenoic acid, 3-hydroxy-4-methylvaleric acid, 3-hydroxy-4-methylhexanoic acid, 3-hydroxy-5-methylhexanoic acid, 3-hydroxy-6-methylheptanoic acid, 3-hydroxy-4-methyloctanoic acid, 3-hydroxy-5-methyloctanoic acid, 3-hydroxy-6-methyloctanoic acid, 3-hydroxy-7-methyloctanoic acid, 3-hydroxy-6-methylnonanoic acid, 3-hydroxy-7-methylnonanoic acid, 3-hydroxy-8-methylnonanoic acid, 3-hydroxy-7-methyldecanoic acid, 3-hydroxy-9-methyldecanoic acid, 3-hydroxy-7-methyl-6-octenoic acid, malic acid, 3-hydroxysuccinic acid-methyl ester, 3-hydroxyadipinic acid-methyl ester, 3-hydroxysuberic acid-methyl ester, 3-hydroxyazelaic acid-methyl ester, 3-hydroxysebacic acid-methyl ester, 3-hydroxysuberic acid-ethyl ester, 3-hydroxysebacic acid-ethyl ester, 3-hydroxypimelic acid-propyl ester, 3-hydroxysebacic acid-benzyl ester, 3-hydroxy-8-acetoxyoctanoic acid, 3-hydroxy-9-acetoxynonanoic acid, phenoxy-3-hydroxybutyric acid, phenoxy-3-hydroxyvaleric acid, phenoxy-3-hydroxyheptanoic acid, phenoxy-3-hydroxyoctanoic acid, para-cyanophenoxy-3-hydroxybutyric acid, para-cyanophenoxy-3-hydroxyvaleric acid, para-cyanophenoxy-3-hydroxyhexanoic acid, para-nitrophenoxy-3-hydroxyhexanoic acid, 3-hydroxy-5-phenylvaleric acid, 3-hydroxy-5-cyclohexylbutyric acid, 3,12-dihydroxydodecanoic acid, 3,8-dihydroxy-5-cis-tetradecenoic acid, 3-hydroxy-4,5-epoxydecanoic acid, 3-hydroxy-6,7-epoxydodecanoic acid, 3-hydroxy-8,9-epoxy-5,6-cis-tetradecanoic acid, 7-cyano-3-hydroxyheptanoic acid, 9-cyano-3-hydroxynonanoic acid, 3-hydroxy-7-fluoroheptanoic acid, 3-hydroxy-9-fluorononanoic acid, 3-hydroxy-6-chlorohexanoic acid, 3-hydroxy-8-chlorooctanoic acid, 3-hydroxy-6-bromohexanoic acid, 3-hydroxy-8-bromooctanoic acid, 3-hydroxy-11-bromoundecanoic acid, 3-hydroxy-2-butenoic acid, 6-hydroxy-3-dodecenoic acid, 3-hydroxy-2-methylbutyric acid, 3-hydroxy-2-methylvaleric acid, and 3-hydroxy-2,6-dimethylheptenoic acid.

(28) The present invention provides a novel method for the preparation of polylactate or hydroxyalkanoate-lactate copolymer using a recombinant strain of Ralstonia eutropha.

(29) Exemplary embodiments of the present invention have been disclosed herein. Although specific terms are employed, they are to be interpreted only in a generic and descriptive sense and not for the purpose of limitation. Accordingly, it should be understood by those of ordinary skill in the art that various changes in form and detail are possible without deviating from the spirit and scope of the present invention as set forth in the following claims.

EXAMPLES

Preparation of R. Eutropha Having Lost PHA Production Capability

(30) To remove the PHA biosynthesis gene operon involved in the synthesis of poly(3-hydroxybutyrate)[P(3HB)] in Ralstonia eutropha (R. eutropha), a recombinant vector was prepared as follows.

(31) A DNA fragment containing the PHB-producing operon derived from R. eutropha H16 was cleaved from the pSYL105 vector (Lee et al., Biotech. Bioeng., 1994, 44:1337-1347) by BamHI/EcoRI and inserted into the BamHI/EcoRI recognition site of pBluescript II (Stratagene), thereby producing pReCAB recombinant vector.

(32) PHA synthase (phaC.sub.RE) along with monomer-supplying enzymes (phaA.sub.RE & phaB.sub.RE) were constantly expressed in a pReCAB vector under the PHB operon promoter. It is known that this vector also effectively operates in E. coli (Lee et al., Biotech. Bioeng., 1994, 44:1337-1347). The new pReCAB vector was cleaved with BstBI/NdeI to remove the genes encoding R. eutropha H16 PHA synthase (phaC.sub.RE), b-ketothiolase (phaA.sub.RE) and acetoacetyl-CoA reductase (phaB.sub.RE). A GFP gene amplified from a pEGFP plasmid (BD Biosciences Clontech) by PCR was then inserted into the vector (pCAB-GFP).

(33) EGFP_F_BstBI aaaaattcgaaac aggaaacagaat atggtgagcaag (SEQ ID NO: 3)

(34) EGFP_R_NdeI ggaattcCATATGttacttgtacagctcgtcca (SEQ ID NO: 4)

(35) The pCAB-GFP vector was next cleaved with BamHI/XhoI, thereby producing a gene segment to which the R. eutropha PHA biosythesis promoter was attached in the 5 direction and to which a transcription terminator gene was attached in the 3 direction. The gene segment was inserted into a pK18mobSacB vector (Schafer et al. Gene (1994) 145: 69-73) cleaved with BamHI/SalI, thereby producing the pK18-CAB-GFP vector. Since the pK18mobSacB vector can express sacB, a recombinant microorganism was prepared by inserting a foreign gene into the chromosome using sucrose.

(36) After the pK18-CAB-GFP vector was transformed to E. coli S17-1, the S17-1 (pK18-CAB-GFP) was cultured in an LB liquid medium containing 25 mg/l kanamycin at 37 C. for 24 hours. R. eutropha NCIMB11599 was also cultured in an LB liquid medium at 30 C. for 24 hours. These culture solutions were mixed with each other to have a volume ratio of the S17-1 (pK18-CAB-GFP) to the R. eutropha NCIMB11599 of 3:1, and added drop by drop to an LB solid medium by 100 ul. The resulting plate was cultured in a static incubator at 30 C. for 18 hours. During the culture, mating occurred, in which the pK18-CAB-GFP vector of the S17-1 was transferred to Ralstonia eutropha, resulting in, as shown in FIG. 3, a first crossover at a homology site of chromosomal DNA of Ralstonia. Since the pK18-CAB-GFP is impossible to be replicated in R. eutropha, when the pK18-CAB-GFP was normally inserted into the chromosome of R. eutropha through the first crossover between genes, R. eutropha showed resistance to the plate containing 500 mg/L kanamycin.

(37) A colony in which the pK18-CAB-GFP was inserted into the chromosome of R. eutropha through the first crossover was selected by suspending the cells mated in the LB plate in an LB liquid medium, and plating the suspension on a plate containing 500 mg/L kanamycin and 35 mg/l chloramphenicol. For a second crossover, the recombinant R. eutropha in which the first crossover was done was cultured in an LB liquid medium at 30 C. for 24 hours, and then 100 ul of the culture solution was plated on an LB plate containing 70 g/L sucrose. R. eutropha in which the second crossover occurred by a sacB gene was selected as recombinant R. eutropha through PCR (see FIG. 3). After the second crossover was normally done, the recombinant R. eutropha lost the PHA biosynthesis operon (phaCAB), but the GFP gene remained in the chromosome. Through colony PCR, the recombinant R. eutropha in which the GFP was normally inserted into the chromosome was found, and was called as R. eutropha GFP.

Preparation of Recombinant R. eutropha into which PHA Synthase from Pseudomonas sp. 6-19 (KCTC 11027BP) and Propionyl-CoA Transferase (CPPCT) from Clostridium propionicum are Inserted

(38) The pK18-CAB-GFP vector prepared in Example 1 was cleaved with BamHI/NdeI to remove GFP, and a gene segment obtained by cleaving a pPs619C1335CPPCT540 vector with BamHI/NdeI was inserted thereinto, thereby preparing a pK18-CAB-335540 vector. By using the vector, a recombinant R. eutropha 335540, in which phaCAB was removed and phaC1.sub.Ps6-19335 from Pseudomonas sp. 6-19 (KCTC 11027BP) and propionyl-CoA transferase (CPPCT540) from Clostridium propionicum were inserted into a chromosome, was prepared (see Table 1). The preparing process was performed in the same manners as Example 1 using E. coli S17-1 (see FIG. 3).

(39) TABLE-US-00001 TABLE 1 Recombinant R. eutropha Recombinant plasmid used herein R. eutropha NCIMB11599 R. eutropha GFP pK18-CAB-GFP R. eutropha 335540 pK18-CAB-335540 R. eutropha 335ReAB pK18-CAB-335ReAB R. eutropha 310540ReAB pK18-CAB-310540ReAB R. eutropha 312540ReAB pK18-CAB-312540ReAB

Preparation of Recombinant R. eutropha into which PHA Synthase from Pseudomonas sp. 6-19 (KCTC 11027BP) and Ketothiolase (phaARE) and Acetoacetyl-CoA Reductase (phaBRE) from R. eutropha H16 are Inserted

(40) The pK18-CAB-GFP vector prepared in Example 1 was cleaved with BamHI/NdeI to remove GFP, and a gene segment obtained by cleaving pPs619C1335ReAB vector with BamHI/NdeI was inserted thereinto, thereby preparing pK18-CAB-335ReAB vector. By using the vector, a recombinant R. eutropha 335ReAB, in which phaCAB was removed and phaC1.sub.Ps6-19335 from Pseudomonas sp. 6-19 (KCTC 11027BP) and PHB monomer-supplying enzymes (phaA.sub.RE & phaB.sub.RE) from R. eutropha H16 were inserted into a chromosome, was prepared (see Table 1). The preparing process was performed in the same manners as Example 1 using E. coli S17-1 (see FIG. 3).

Preparation of Recombinant R. eutropha into which PHA Synthase from Pseudomonas sp. 6-19 (KCTC 11027BP), Propionyl-CoA Transferase (CPPCT) from Clostridium propionicum, and Ketothiolase (phaARE) and Acetoacetyl-CoA Reductase (phaBRE) from R. eutropha H16 are Inserted

(41) The pK18-CAB-GFP vector prepared in Example 1 was cleaved with BamHI/NdeI to remove GFP, and gene segments obtained by cleaving pPs619C1310CPPCT540ReAB and pPs619C1312CPPCT540ReAB vectors with BamHI/NdeI were inserted thereinto, thereby preparing pK18-CAB-310540ReAB and pK18-CAB-312540ReAB vectors, respectively. By using these vectors, recombinant R. eutropha 310540ReAB and R. eutropha 312540ReABphaCAB, in which phaCAB was removed and phaC1.sub.Ps6-19310 or phaC1.sub.Ps6-19312 from Pseudomonas sp. 6-19 (KCTC 11027BP), propionyl-CoA transferase(CPPCT540) from Clostridium propionicum, and PHB monomer-supplying enzymes (phaA.sub.RE & phaB.sub.RE) from R. eutropha H16 were inserted into a chromosome, were prepared (see Table 1). The preparing process was performed in the same manners as Example 1 using E. coli 517-1 (see FIG. 3).

Biosynthesis of P (3HB-Co-LA) Copolymer Through Culture of Recombinant R. eutropha

(42) The recombinant R. eutropha shown in Table 1 was cultured in a minimal medium containing glucose as a basic substrate and 34 ug/mL chloramphenicol, resulting in biosynthesis of a P(3HB-co-LA) copolymer. The composition of the minimal medium was as follows (per L; KH.sub.2PO.sub.4, 2.65 g; Na.sub.2HPO.sub.4, 3.8 g; NH.sub.4Cl, 0.72 g; MgSO.sub.47H.sub.2O, 0.4 g; Tracer, 1 mL). In addition, the composition of tracers was as follows (per L; FeSO.sub.4.7H.sub.2O, 10 g; ZnSO.sub.4.7H.sub.2O, 2.25 g; CuSO.sub.4.5H.sub.2O, 1 g; MnSO.sub.4.5H.sub.2O, 0.5 g; CaCl.sub.2.2H.sub.2O, 2 g; Na.sub.2B.sub.4O.sub.7.7H.sub.2O, 0.23 g; (NH.sub.4).sub.6Mo.sub.7O.sub.24, 0.1 g; 35% HCl, 10 mL). Prior to a main culture, a seed culture was performed in an LB medium containing antibiotics for 30 hours. The seed-culture solution was inoculated to the minimal medium containing a substrate and antibiotics to have a concentration of 1% for the main culture for 4 days. All cultures were performed at 30 C. at a speed of 200 rpm. After the culture was completed, a cell lysate was harvested by centrifugation. The harvested cell lysate was dried in a drier at 80 C. for 48 hours, and analyzed by gas chromatography to measure the content of the P(3HB-co-LA) copolymer accumulated in the cell lysate. The result is shown in Table 2. Reference materials used in the analysis were P(3HB-co-12 mol % 3HV) copolymer and PLA polymer.

(43) TABLE-US-00002 TABLE 2 Biosynthesis of P(3HB-co-LA) copolymer through culture of recombinant R. eutropha Recombinant P(3HB-co-LA) LA R. eutropha Substrate (wt %) mol % R. eutropha 2% glucose 24.33 0.00 335540 2% glucose, 3HB* 47.73 0.00 2% glucose, NaL.sup.+ 7.72 31.71 2% glucose, 3HB, NaL.sup.+ 25.20 16.18 R. eutropha 2% glucose 46.33 0.05 310540ReAB 1.5% glucose, NaL.sup.++ 24.06 8.64 R. eutropha 2% glucose 46.50 0.06 312540ReAB 1.5% glucose, NaL.sup.++ 12.87 7.18 Nal.sup.+++ 17.97 *3HB: 3-hydroxybutyrate, 2 g/L .sup.+NaL: Sodium lactate (pH 7), 4 g/L .sup.++NaL: Sodium lactate (pH 7), 6 g/L .sup.+++NaL: Sodium lactate (pH 7), 24 g/L

Biosynthesis of P(3HB-Co-LA-Co-mcl3HA) Copolymer Through Culture of Recombinant R. eutropha

(44) The R. eutropha GFP was transformed to a vector expressing PHA synthase from Pseudomonas sp. 6-19 (KCTC 11027BP), propionyl-CoA transferase (CPPCT) from Clostridium propionicum, and PhaG from P. putida KT2440, and then cultured as described in Example 5. As a carbon source, 2% glucose was used. The content of a copolymer accumulated in a cell lysate is shown in Table 3.

(45) A process of preparing a vector was as follows.

(46) To begin with, a phaG gene amplified from P. putida KT2440 by PCR was inserted into an NdeI site of a pPs619C1300CPPCT532 or pPs619C1334CPPCT532 vector (pPs619C1300CPPCT532PhaG or pPs619C1334CPPCT532PhaG). Subsequently, the pPs619C1300CPPCT532PhaG or pPs619C1334CPPCT532PhaG was cleaved with BamHI/XhoI, a gene segment obtained thereby was inserted into the same site of pBBR1MCS2 vector, thereby preparing a recombinant plasmid replicable in R. eutropha (pMCS2Ps619C1300CPPCT532PhaG or pMCS2Ps619C1334CPPCT532PhaG). By using the vector, a recombinant R. eutropha was prepared.

(47) TABLE-US-00003 KTPhaG500f-NdeI (SEQIDNO:5) ggaattccatatgggggttggcgccgggggag KTPhaGb-2100-NdeI (SEQIDNO:6) 5-ggaattccatatgggatcggtgggtaattggcc

(48) TABLE-US-00004 TABLE 3 Biosynthesis of P(LA-co-3HB-co-mcl3HA) copolymer through culture of recombinant R. eutropha PHA PHA composition (mol %) Enzymes in content LA 3HB 3HHx 3HO 3HD 3HDD 3H5DD Plasmid (wt %) (C3) (C4) (C6) (C8) (C10) (C12) (C12) PhaC1-300.sub.Ps6-19 20.9 2.0 94.1 0.5 0.8 0.9 1.5 0.3 Pct532 PhaG PhaC1-334.sub.Ps6-19 19.7 2.7 91.7 0.5 1.2 1.3 2.3 0.3 Pct532 PhaG