Chimeric molecule involving oligomerized FasL extracellular domain
09920119 ยท 2018-03-20
Assignee
Inventors
- Jean-Luc Taupin (Bordeaux, FR)
- Sophie Daburon (Tresses, FR)
- Jean-Francois Moreau (Merignac, FR)
- Myriam Capone (Le Bouscat, FR)
Cpc classification
C07K14/715
CHEMISTRY; METALLURGY
C07K2319/75
CHEMISTRY; METALLURGY
A61P31/00
HUMAN NECESSITIES
C07K14/70575
CHEMISTRY; METALLURGY
C07K16/24
CHEMISTRY; METALLURGY
C07K2319/01
CHEMISTRY; METALLURGY
C07K2319/32
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K14/705
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
A61K38/16
HUMAN NECESSITIES
C07K4/00
CHEMISTRY; METALLURGY
C07K14/715
CHEMISTRY; METALLURGY
C07K16/24
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
Abstract
New chimeric molecules involving in their structure, a combination of the extracellular domain (EC) of the FasL protein and a domain enabling oligomerisation of this Fas Ligand (FasL) EC domain, such as the Ig-like (so-called Ig in the following pages) domain of the gp190 receptor for the Leukemia Inhibitory Factor (LIF), or involving in their structure variants of the domains. Also, compositions including the chimeric molecule defined herein and the use of these chimeric molecules especially to trigger cytotoxic activity toward cells sensitive to FasL.
Claims
1. A chimeric molecule comprising a monomeric structure (IgFasL), the monomeric structure consisting of, from the N-terminal end to the C-terminal end, the following domains directly fused to each other in that order: a) an Ig-like domain of the human Leukemia Inhibitory Factor (LIF) receptor gp190 consisting of the amino acid sequence of SEQ ID NO: 4; b) a peptide linker consisting of the amino acid sequence of SEQ ID NO: 6; and c) an extracellular domain of the human FasL protein consisting of the amino acid sequence of SEQ ID NO: 8; wherein the chimeric molecule is a polymer of at least 6 repeats of said monomeric structure, said polymer being able to bind to and/or activate the Fas transmembrane receptor on Fas expressing cells, said polymer having a cytotoxic activity toward Fas expressing cells.
2. The chimeric molecule according to claim 1, which comprises a homohexameric structure of the extracellular domain of said FasL protein or comprises a homododecameric structure of the extracellular domain of said FasL protein.
3. The chimeric molecule according to claim 1, wherein the molecule binds the Fas receptor expressed on cells and triggers a conformational change of said Fas receptor.
4. The chimeric molecule according to claim 3, wherein the cells are human cells.
5. The chimeric molecule according to claim 1, further comprising a heterologous polypeptidic domain suitable for targeting specific cells or for targeting receptors on specific cells, said heterologous polypeptidic domain consisting of the extracellular domain of the human CD80 ligand consisting of the amino acid sequence of SEQ ID NO: 16.
6. The chimeric molecule according to claim 5, comprising the amino acid sequence of SEQ ID NO: 18.
7. The chimeric molecule according to claim 5, wherein the heterologous polypeptidic domain is suitable for targeting tumor antigens on specific cells.
8. The chimeric molecule according to claim 1, wherein the molecule is a heteropolymer chimeric molecule comprising monomers consisting of said IgFasL, and monomers of soluble human FasL (sFasL), wherein the proportion of sFasL with respect to said IgFasL is less than 50% .
9. The chimeric molecule according to claim 8, wherein the proportion of sFasL with respect to said IgFasL is from 10% to 20% .
10. The chimeric molecule according to claim 1, wherein the polymer is a homopolymer.
11. The chimeric molecule according to claim 1, wherein the monomeric structure consists of the amino acid sequence of SEQ ID NO: 12.
12. The chimeric molecule according to claim 1, comprising a signal peptide before said IgFasL monomer for production in cells and secretion from the cells, the signal peptide comprising the amino acid sequence of SEQ ID NO: 10.
13. The chimeric molecule according to claim 12, comprising the amino acid sequence of SEQ ID NO: 2.
14. A nucleic acid molecule which encodes the chimeric molecule of claim 1.
15. The nucleic acid molecule according to claim 14, which comprises the following functional domains directly fused to each other and organized as follows from its 5 to its 3 end: (i) optionally a nucleotide sequence encoding a signal peptide for production in cells and secretion, and consisting of the sequence of SEQ ID NO: 9; (ii) optionally a nucleotide sequence encoding the extracellular domain of the human CD80 ligand suitable for targeting cells and consisting of the sequence of SEQ ID NO: 15; (iii) a nucleotide sequence encoding an Ig-like domain of the Leukemia Inhibitory Factor receptor gp190 and consisting of the sequence of SEQ ID NO: 3; (iv) a nucleotide sequence encoding a peptide linker and consisting of the sequence of SEQ ID NO: 5; (v) a nucleotide sequence encoding an extracellar domain of the human FasL protein and consisting of the sequence of SEQ ID NO: 7.
16. The nucleic acid molecule according to claim 14, comprising at least one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 11, and SEQ ID NO: 17.
17. An expression vector comprising the nucleic acid molecule of claim 14.
18. The expression vector according to claim 17, which is a plasmid or a viral or a lentiviral vector.
19. An isolated or cultured cell which is transfected or transduced with the nucleic acid molecule of claim 14.
20. An anti-tumor therapeutic composition which comprises, as an active ingredient against tumor development, the chimeric molecule according to claim 1, and a pharmaceutical excipient suitable for administration by injection to a human patient.
21. A method for treating a human patient diagnosed with transformed cells or with uncontrolled proliferative cells or for treating a human patient diagnosed for infection, wherein said transformed, proliferative or infected cells express the Fas cellular receptor, the method comprising administering to said human patient an effective amount of the chimeric molecule according to claim 1 as a cytotoxic agent.
22. A method for inducing cellular apoptosis in a human patient, comprising administering to said human patient an effective amount of the chimeric molecule according to claim 1.
23. A method for treating cancer, comprising administering to a subject in need thereof an effective amount of the chimeric molecule according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2) Panel A: Modules constituting gp190 and FasL are depicted as mature proteins. EC, TM and IC represent the extracellular, transmembrane and intracellular domains, respectively. N and C represent the N- and C-terminal regions. The numbers depict the domain boundaries used to create the chimeras. Cleaved FasL (cFasL) is spontaneously generated by a metalloprotease cleaving between aminoacids 126 and 127. Panel B: Representation of the cleaved FasL (cFasL) and the gp190/FasL chimeras. Panel C: Serial dilutions of supernatants from COS cells transfected with the FasL constructs or the empty vector (control) were incubated with Jurkat cells. Cell death was measured using the MTT assay. As a positive control, we used the commercially available antibody-cross-linked FasL (recFasL). Calculated C50 are indicated on the graph. Results from one representative experiment out of 5 are depicted.
(3)
(4) Panel A: Supernatants from COS cells transfected with the FasL constructs were quantified by ELISA and 10 g of FasL protein were loaded per lane. Migrations were performed under reducing (SDS-PAGE) or non-reducing (BN-PAGE) conditions. FasL was revealed by immunoblot. Panel B: 2 g of FasL construct were loaded on the gel filtration column. FasL was quantified by ELISA in elution fractions, and cytotoxicity was measured using the MTT assay. Panel C: Affinity measurement using Biacore. Fas-Fc was immobilized on the chip, before the indicated soluble FasL constructs were analyzed. A range of concentrations was tested for each analyte, but only the graph obtained with the highest concentration is displayed. Panel D: The apparent molecular weights and degree of oligo/polymerization of the FasL chimeras were estimated from the non denaturing gel electrophoresis and gel filtration experiments.
(5)
(6) Panel A: Description of the model used to analyze the requirement for a Fas conformational change during its activation. The Fas-gp130 hybrid receptor is stably expressed in the IL-3 dependent BA/F3 cell line. Panel B: Cell surface staining of parent BA/F3 cells (upper panel) and on a representative clone stably expressing the Fas-gp130 chimera (lower panel), with an isotype-matched control (dotted line), anti-murine Fas JO2 (dashed line) and anti-human Fas DX2 (continuous line). Panel C: Fas-gp130 BA/F3 cells were incubated with the indicated Fas triggers or controls, and proliferation was measured using a MTT assay. Results are expressed as percentages of the maximum proliferation obtained with a saturating IL-3 concentration. Proliferation of parent and transfected cells was also measured in the absence of any IL-3 or Fas trigger. Values are the meansd of 3 independent experiments.
(7)
(8) Panel A: Tumor growth in mice having received subcutaneously 10.sup.5 A431 cells at day 0, and 0.1 mL of concentrated IgFasL (white boxes) or IgFasL-free control (grey boxes) locally at days 2 and 7 (n=6 mice per group). Tumor volumes are expressed in mm.sup.3. Values are presented as median, 25.sup.th and 75.sup.th percentiles (horizontal line, bottom and top of boxes), and 10.sup.th and 90.sup.th percentiles (bottom and top range bars) (**p=0.04, * p=0.05). Panel B: Kaplan-Meier analysis of cumulative survival without cancer of mice bearing A431 cells xenograft treated with IgFasL (black circles) or IgFasL-free control (black squares) (p=0.02). n=20 mice per group, from two experiments pooled.
(9)
(10) SEQ ID No 9: cDNA sequence of the secretion signal peptide at the 5 end of the IgFasL chimeric gene: underlined: the SpeI enzyme restriction site used to build the chimeric gene; bold characters: the signal sequence of the gp190 protein
(11) SEQ ID No 3: cDNA sequence of Ig, the Ig-like module of the IgFasL chimeric gene
(12) SEQ ID No 5: cDNA sequence of the linker stretch located between Ig and FasL in the IgFasL chimeric gene: underlined: the XbaI enzyme restriction site used to build the chimeric gene: bold characters: beginning of the EcoNI enzyme restriction site used to build the chimeric gene
(13) SEQ ID No 7: cDNA sequence of sFasL, the secreted portion of FasL in the IgFasL chimeric gene: bold characters: end of the EcoNI enzyme restriction site used to build the chimeric gene; underlined: stop codon
(14) SEQ ID No 1: complete cDNA sequence of the IgFasL chimeric gene:underligned: stop codon SEQ ID No 1 encompasses SEQ ID No 11, which starts with the codon at nucleotide 148 in SEQ ID No 1 and ends with the final codon of SEQ ID No 1.
(15) SEQ ID No 10: Amino acid sequence of the secretion signal peptide at the 5 end of the IgFasL chimeric protein: underlined: the two amino acid residues added to the Ig sequence to generate the cDNA construct; bold characters: the signal sequence peptide (44 aa).
(16) SEQ ID No 4: Amino acid sequence of Ig, the Ig-like module of the IgFasL chimeric gene
(17) SEQ ID No 6: amino acid sequence of the linker stretch located between Ig and FasL in the IgFasL chimeric protein.
(18) Seq ID No 8: amino acid sequence of sFasL, the secreted portion of FasL in the IgFasL chimeric protein.
(19) SEQ ID No 2: complete amino acid sequence of the IgFasL chimeric protein (secretion signal sequence included).
(20) SEQ ID No 2 encompasses SEQ ID No 12, which starts with amino acid residue Isoleucine (I) at position 50 in SEQ ID No 2 and ends with the final residue of SEQ ID No 2.
(21)
(22) DNA sequence of CD80 extracellular domain (Bold characters: start codon of human CD80 cDNAUnderlined: at the 5 end: sequence coding for the signal peptide; at the 3 end: XbaI restriction site used for cloning 5 to the IgFasL construct) and its corresponding amino acid sequence (Underlined: at the N-terminal end: signal peptide; at the C-terminal end: amino acid residues encoded by the XbaI restriction site used for cloning 5 to the IgFasL construct); DNA sequence of CD80IgFasL (Bold and underlined: the XbaI/SpeI joining sequence resulting from the fusion of CD80 extracellular region to IgFasL) and its corresponding amino acid sequence (Bold and underlined: amino acid residues encoded by the XbaI/SpeI restriction site used for cloning 5 to the IgFasL construct).
(23)
(24)
(25) HEK cells were transduced with a vector encoding sFasL and Green Fluorescent Protein. The resulting HEK-sFasL+ cell line and the wild-type HEK were transduced with a vector encoding pfFasL and Tomato. Cells were FACS-sorted for weak (HEK-pfFasL+) or strong (HEK-pfFasL++) Tomato expression. Secreted pfFasL was quantified with the Flag ELISA.
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35) TABLE-US-00001 TABLE 1 Association/dissociation constants of the soluble FasL chimeras. Ligand Kon (1/Ms) Koff (Vs) KD (M) Chit DlIgD2FasL 1.3 10.sup.5 3.3 10.sup.3 2.56 10.sup.8 8.34 D2FasL 1.6 10.sup.5 6.0 10.sup.3 3.85 10.sup.8 3.37 IgFasL 2.5 10.sup.4 4.1 10.sup.4 1.16 10.sup.8 2.75 cFasL 8.4 10.sup.4 5.9 10.sup.3 6.94 10.sup.8 16
(36) TABLE-US-00002 TABLE 2 IgFasL does not induce liver damage. Mice were injected with the indicated ligands as described in Materials and Methods. Blood samples were harvested at the indicated time points and the levels of alanine amino transferase (ALAT) and aspartate amino transferase (ASAT) were measured in the serum. GOT (IU/ml) GPT (IU/ml) Fas trigger 6 hours 30 hours 6 hours 30 hours Control (no PBS) 66 48 43 27 Control (PBS) 84 61 49 58 Anti-Fas (JO2) 12383 ND.sup.1 876 ND.sup.1 Anti-Fas (JO2) 1419 1650 27 6197 IgFasL 81 63 55 37 IgFasL 80 205 31 50 IgFasL 69 82 96 58 .sup.1not determined
(37) TABLE-US-00003 TABLE 3 Main characteristics of the FasL-derived proteins used in the present study, in terms of production, size and cytotoxic activity. Molecular Polymeric EC50 Proteins weight (kDa) structure (ng/mL) EC50 (pM) n.sup.1 sFasL 27-30 Trimer >3000 5 sfFasL 29-32 Trimer >3000 5 sfFasL + Hexamer 3 +/ 1.3 98 +/ 43 5 anti-Flag pfFasL 37-40 Hexamer 0.6 +/ 0.4 15.5 +/ 11.5 8 Dodecamer TCR-pfFasL 79 Tetramer 3.7 +/ 1.3 46.7 +/ 16.2 10 Hexamer HLA-pfFasL 85 Tetramer 1.6 +/ 0.4 19.8 +/ 5.1. 11 Hexamer .sup.1number of experiments conducted from different transfection supernatants used for the determination of the cytotoxicity EC50 values on the Jurkat cell line.
EXAMPLES
Example I
Preparation of Functional Ig-FasL Polymers
(38) The general aims of the inventors were to develop new isoforms of functional FasL which do not require any crosslinking agent to become cytotoxic, to use them for deciphering the functional requirements leading to Fas activation, and to test them for in vivo anti-tumor activity. To reach the first goal, the inventors fused the ectodomain of FasL to the modules of the extracellular domain of the Leukemia Inhibitory Factor (LIF) cytokine receptor gp190 (9) which display a propensity to self-associate (10, 11). The gp190 belongs to the family of the hematopoietin receptors, characterized by the extracellular consensus cytokine binding domain (CBD). The gp190 harbors two CBDs (D1 and D2) separated by an immunoglobulin-like (Ig) module. Therefore, the trimeric structure of the sFasL moiety, combined to the propensity of the gp190 modules to self-associate, could lead to differently aggregated sFasL chimeras with distinct apoptotic abilities.
(39) To reach the second goal, the inventors hypothesized that the distinct sizes of the gp190 modules (i.e. around 20, 40 and 100 kDa for Ig, D2 and D1IgD2 respectively), could exert different steric effects, distinctly impinging on the ability to trigger a productive apoptotic signal independently of the polymerization of FasL. In addition, given that Fas activation requires oligomers beyond the trimeric stage, the inventors reasoned that either aggregation of the trimers, or a particular conformational change within a single trimer triggered by a polymeric ligand, or both, is mandatory. Therefore, the inventors wondered whether anti-Fas antibody, naturally occurring sFasL and the chimeras, would be able to stimulate a chimeric Fas receptor which would only require dimerization to transmit a signal, and whether or not this property would correlate with the ability to trigger cell apoptosis. To explore this possibility, the inventors used the gp130 signal transducing cytokine receptor, another member of the hematopoietin receptors, which is pre-assembled as dimers (12) and requires a ligand-induced conformational change to become activated. Gp130 triggers cytokine-dependent proliferation of various cell lines via the Jak-STAT pathway (13). The inventors fused transmembrane and intracellular regions of gp130 to the extracellular region of Fas, generating the Fas-gp130 receptor, and expressed it in the BA/F3 cell line.
(40) To reach the third goal, in vivo toxicity in normal mouse, and ability to counteract tumor development in a model of human solid tumor transplanted into immunodeficient mice were explored for the determined most efficient sFasL chimera.
(41) Materials and Methods
(42) Antibodies and Reagents
(43) Anti-FasL mAb 14C2 and 10F2 used for the FasL ELISA (14), IgG anti-human Fas mAb 5D7 (14), isotype-matched negative controls 1F10 (IgG) and 10C9 (IgM) mAbs (15) were all generated in the laboratory. Chimeric Fas-Fc receptor was produced in the laboratory and was affinity-purified on protein A. Anti-FasL mAb (G247) used for immunoblots and anti-human Fas non agonistic mAb DX2 were purchased from BD Biosciences (Le-Pont-De-Claix, France). Recombinant sFasL (recFasL) was purchased from Alexis Corporation (Coger, Paris, France), and used with its cross-linking enhancer reagent, as recommended by the manufacturer. Anti-human Fas agonistic mAb 7C11 (IgM) was from Immunotech (Marseille, France). Anti-murine Fas agonistic mAb (JO2) was from Bender MedSystems (Vienna, Austria).
(44) Construction of the FasL Chimeras
(45) The isolation of the gp190 receptor modules Ig, D2 and D1IgD2 was described previously (10). They were fused to the extracellular domain of hFasL (amino acids 108 to 281) isolated by PCR. To generate the Fas-gp130 chimera, the Fas extracellular region and the transmembrane and intracellular domains of gp130 were isolated by site-directed mutagenesis and fused together.
(46) Cell Lines and Transfections
(47) The cells were grown in a 5% CO2 incubator at 37 C. without antibiotics in medium supplemented with 8% FCS (Sigma, Saint-Quentin-Fallavier, France). Culture medium was RPMI for the human Jurkat T-lymphoma and the BA/F3 pro-B-lymphocytic murine cell lines, and DMEM for the human skin carcinoma A431 and the simian epithelial COS cell lines.
(48) COS cells were transiently transfected using the DEAE-dextran method, with 5 g of plasmid DNA, and supernatants were harvested 5 days later. Large scale production of IgFasL was performed in serum-free Opti-MEM medium (Invitrogen).
(49) The BA/F3 culture medium was supplemented with 10% WEHI cell-conditioned medium as a source of murine interleukin-3. BA/F3 cells (5.Math.10.sup.6 cells in 300 l) were electroporated (BTM 830 electroporator, BTX Instruments, Holliston, Mass.). G418 at 1 g/ml (Invitrogen) was added at day 1. The G418-resistant cells were cloned by limiting dilution in the presence of murine IL-3. Stable transfectants were selected for membrane expression of the Fas-gp130 molecule by flow cytometry with the anti-Fas antibody 5D7. BA/F3 cell proliferation was estimated using the MTT proliferation assay, as described previously (10), after three washes of the cells to remove IL-3. The maximum value and the blank value were obtained with a saturating concentration of IL-3 or without IL3, respectively.
(50) The BA/F3, Jurkat, COS and A431 cell lines were obtained respectively in 1991, 1995, 1992 and 2004 from Drs D'Andrea (16), Anderson (17), Kaufman (18) and Nagata (19). They are mycoplasma-tested every 6 months by PCR (20) and Hoechst 33258 staining (21). Absence of cross-contamination is verified almost daily by morphology check for all the cell lines, and by growth curve analysis in the presence and absence of IL-3 for the BA/F3 cell line.
(51) ELISA for sFasL
(52) FasL was quantified in cell culture supernatants using a conformation-dependent home made sandwich ELISA based on mAb 14C2 (10 g/ml) as a capture antibody and biotinylated mAb 10F2 (1 g/ml) as a tracer. All steps were performed exactly as reported for our anti-human LIF ELISA (22).
(53) Western Blot Analysis
(54) Supernatants from transfected cells were harvested and debris were removed by centrifugation. FasL was quantified and 100 ng of the FasL protein were resuspended in 5 Laemmli buffer and separated by SDS-PAGE on 12% gels. Proteins were transferred to a polyvinyldifluoride membrane (Amersham, Buckinghamshire, England) and immunoblots were performed as previously described (23). The anti-FasL mAb G247 (1 g/ml) was incubated overnight at 4 C. BN-PAGE was carried out as described by Schgger (24) with the following modifications. A separating 4-18% w/v acrylamide linear gradient was used. Before loading, 1 L of sample buffer (500 mM 6-amino-n-caproic acid, 5% w/v Serva Blue G) was added to the sample. The gel was run overnight at 4 C. with 1 W. Thyroglobulin (669 kDa) and BSA (66 kDa) were used as size standards (Sigma).
(55) Surface Plasmon Resonance Analysis of the FasL Chimeras Binding to Fas
(56) The experiments were carried out on a BIAcore 3000 optical biosensor (GE healthcare, Chalfont, UK). The FasL chimeras were produced as COS supernatants in Opti-MEM medium, concentrated 100 times, dialyzed against PBS and sterilized by filtration. Recombinant Fas-Fc (R&Dsystems, Minneapolis, Minn.) was covalently coupled to a carboxymethyl dextran flow cell (CM5, BIAcore) following the manufacturer's recommendations. The level of immobilization was 2,000 resonance units (RU). Binding of the FasL chimeras was assayed at concentrations ranging from 0.2 to 100 nM for IgFasL, 0.2 to 44 nM for cFasL, 0.2 to 37.5 nM for D2FasL, and 0.25 to 8 nM for D1IgD2FasL, in Hepes-buffered saline, at a 30 l/min flow rate. Association was monitored for 5 min before initiating the dissociation phase for another 11 min with Hepes-buffered saline. The flow cell was regenerated with 4M MgCl2. The sensorgrams were analyzed using the BIAeval 4.1 software (BIAcore). The background of the Opti-MEM medium was at 30 RU.
(57) Cell Cytotoxicity Assays
(58) The cytotoxic activity of the FasL chimeras was measured using the MTT viability assay as previously described (14). The percent of specific cytotoxic activity of FasL was calculated as follows: 100(experimental absorbancebackground absorbance)/(control absorbancebackground absorbance)100.
(59) Immunoprecipitation Experiments
(60) For .sup.35S metabolic labelling experiments, COS cells were transfected and the radioactive substrate (.sup.35S-Translabel, ICN Pharmaceuticals, Orsay) was added at day 3 for an overnight incubation. The supernatants (500 l) were incubated with 5 Ug of anti-FasL mAb 14C2 or 5 g of purified Fas-Fc for 2 h before 40 l of protein G beads (Sigma) were added for 1 h at 4 C. The beads were pelleted and washed 3 times with 1 ml of washing buffer (50 mM Tris, 1 mM EDTA, 150 mM sodium chloride, 0.2% Nonidet P-40, pH 8), and then resuspended in 40 l of 5 Laemmli's buffer, boiled 5 min and the proteins were separated by SDS-PAGE using 12% gels.
(61) Gel Filtration Experiments
(62) The molecular size of the FasL constructs was determined using the size exclusion S-200-HR and S-300-HR Sephacryl columns (Amersham Pharmacia, Orsay, France). COS supernatants were concentrated with Centricon-30 (Millipore, Saint-Quentin-en-Yvelines, France) to reach 2 g/ml for each sFasL form. One microgram was loaded onto a column and eluted in PBS at 0.3 ml/min. Fractions were analyzed for the presence of FasL protein by ELISA and for cytotoxicity using the MTT assay.
(63) FasL Purification and Mice Injection
(64) Experiments with normal Balb/cByJCr1 mice used immunoaffinity purified IgFasL. Supernatant from transfected COS cells (500 mL) was immunoprecipitated using 1 ml of anti-FasL mAb (14C2)-coupled NHS-activated sepharose beads (Amersham), overnight at 4 C. Beads were pelleted and washed in PBS, and IgFasL was eluted at pH 2 (50 mM glycine, 1 M NaCl). The eluate was immediately neutralized by adding 0.25 volume of 1 M Tris-HCl buffer at pH 8. After overnight dialysis against PBS, FasL was quantified by ELISA. Male BALB/cByJCr1 mice (8 wk old) were injected intraperitoneally with 500 l PBS containing 10 g of IgFasL, or of anti-Fas agonistic mAb JO2, or with PBS alone. Blood was collected at 6 and 30 h for liver enzymes measurement. The mice were euthanasied at 30 h post-injection.
(65) For tumor experiments, COS cells were transfected with IgFasL or empty vector as a control, and grown in Opti-MEM medium. Supernatants were harvested at day 5, centrifuged, concentrated 60 times against polyethylene glycol flakes, adjusted to 100 g/ml and sterilized by filtration. Immunodeficient Rag.sup./c.sup./ mice, a gift from Dr Di Santo (25), were used at 7-10 weeks of age, and housed in appropriate animal facility under pathogen-free conditions. At day 0, mice received 10.sup.5 A431 cells in 0.1 ml of culture medium subcutaneously into the right flank. Injections of IgFasL (10 g in 0.1 ml) or control were performed after tumor implantation, either subcutaneously at days 2 and 7, or intraperitoneally everyday between days 0 and 7, then at days 9, 11 and 14. Tumor growth was monitored by measuring maximal and minimal diameters with a calliper, three times a week, and tumor volume was estimated with the formula: tumor volume (mm.sup.3)=length (mm)width.sup.2 (mm).
(66) Statistical Analysis of Tumor Growth
(67) The Mann Whitney test was used for the comparison between the two groups in the experiment with subcutaneous injection of IgFasL. The Kaplan-Meier analysis was used to establish the survival curves without cancer, and comparison between the two groups was made using the log-rank test. Analyses were performed with Statview Software (Abacus Concepts, Berkeley, Calif.). For all experiments, a p0.05 was considered significant.
(68) Results
(69) Generation and Production of Soluble Potentially Multimeric FasL/Gp190 Chimeras
(70) The inventors fused the Ig, D2 and D1IgD2 modules of gp190 to the FasL extracellular region (
(71) Biochemical Characterization of the FasL/Gp190 Chimeras
(72) Identical amounts of the .sup.35S-labeled FasL constructs were separated by SDS-PAGE (
(73) The affinity of the FasL chimeras for Fas was measured using the surface plasmon resonance Biacore method, against recombinant Fas-Fc immobilized on a chip. IgFasL, D2FasL, D1IgD2FasL and sFasL as a control, were produced as supernatants in COS cells cultured in serum-free medium, concentrated 100 times, and dialysed against PBS. The sensorgrams are depicted in
(74) FasL Chimeras and Agonistic Antibody Differentially Act on Fas Conformation.
(75) To determine whether a conformational change in the Fas receptor is required to produce the apoptotic signal, the inventors generated a fusion protein between the extracellular region of Fas and the transmembrane and intracellular region of the gp130 hematopoietin receptor (
(76) The inventors then analyzed the effect on cell survival and proliferation of serial dilutions of the 7C11 agonistic anti-Fas antibody, of the FasL chimeras, and of spontaneously cleaved FasL (cFasL) (
(77) Anti-Tumor Activity of IgFasL
(78) The IgFasL chimera exerted its cytotoxic activity against various human tumor cells from distinct origins, both hematopoietic (OEM and H9 T-lymphoma cells, SKW6.4 and JY B-lymphoma cells, with C50 ranging from 0.01 to 0.1 g/ml), and non-hematopoietic (A431 melanoma cells, with C50=0.15 g/ml) (results not shown).
(79) To determine the hepatotoxicity of IgFasL, the inventors injected the ligand in mice and we analyzed in peripheral blood the markers of liver injury aspartate amino transferase (ASAT) and alanine amino transferase (ALAT). Mice were injected intraperitoneally with 10 g (0.7 g/g) of affinity-purified IgFasL diluted in PBS. As controls, one mouse was injected with an identical volume of PBS and another one was left untreated. As a positive control, two mice were injected intraperitoneally with 10 g of the agonistic anti-murine Fas antibody JO2 in the same volume of PBS. One of these mice developed a fulminant hepatitis and was sacrificed 6 hours after antibody injection. The anti-Fas JO2 mAb triggered a rapid and considerable increase of both serum amino transferases, whereas sera from the negative control mice and mice injected with the purified IgFasL did not show any sign of liver cytolysis (Table 2).
(80) The anti-tumor activity of IgFasL was estimated in a mouse model, using human A431 cells transplanted subcutaneously to Rag.sup./c.sup./ immunodeficient mice. In a first experiment (
(81) Discussion
(82) Our IgFasL, D2FasL and D11gD2FasL chimeras allowed us to analyze the structure-function relationships enabling FasL to activate Fas. The cytotoxic activity strongly depended on both the polymerization level of the chimera and the size of its constitutive monomers, more than on the affinity for Fas, which was very close for all three. Indeed, the most efficient construct was IgFasL, the most polymeric (dodecameric) but also the shortest one at the monomeric level. However, it is noteworthy that hexameric D1IgD2FasL was 10 times less cytotoxic than hexameric D2FasL, suggesting that the polymerization degree is not the only parameter to be important. In line with this, the IgM agonistic antibody 7C11 displays ten potential binding sites for Fas, and therefore should behave closely to the dodecameric IgFasL. However, the inventors recently demonstrated that FasL can trigger apoptosis in cells harboring a mutation in the Fas death domain at the hemizygous state, which were completely insensitive to the agonistic antibody (23). Therefore, the results of the inventors confirmed that the extent of FasL oligomerization is essential but not sufficient for triggering the apoptotic signal. The inventors therefore hypothesized that a Fas conformational change might be required as well.
(83) The inventors explored this possibility with the cellular assay using the Fas-gp130 chimeric receptor. Trimeric cFasL, IgFasL and hexameric D2FasL efficiently triggered proliferation, but hexameric D1IgD2-FasL did not. It is possible that the voluminous D1IgD2 domain impairs the conformational change in the gp130 domain while maintaining Fas binding. This could similarly explain why it lacks cytotoxicity towards wild-type Fas. The agonistic anti-Fas antibody is also unable to trigger cell proliferation through Fas-gp130, although it efficiently triggers apoptosis (14, 26). As for D1IgD2FasL, this could be explained by structural constraints due to the IgM isotype. The apoptotic effect of the IgM mAb would then result from a large aggregation of Fas trimers, leading to caspase activation. In line with this, the non apoptotic cFasL is expected to trigger strong cell proliferation, as it is Fas natural ligand and as such must display the best fit for this receptor. As IgFasL is capable of triggering the adequate Fas conformational change and is also polymeric, this would therefore explain why it can kill cells which normally resist to the agonistic antibodies (23). These results overall confirm the inventors' reported finding that FasL and antibodies do not stimulate identically the Fas signalling machinery (26), and confirm the requirement of minimal Fas aggregation by a multimeric ligand trigger (8).
(84) The IgFasL chimera demonstrated a very potent apoptotic activity, in the absence of any cross-linking enhancing agent. Using experiments in mouse, the inventors detected no liver damage after intravenous injection. Although these findings seem in contradiction with data showing that Fas engagement in mice induce an acute liver injury, it is noteworthy that these reports used in fact the anti-Fas JO2 agonistic antibody and not FasL (3, 27-30). The liver destruction observed following injection of anti-Fas antibodies may simply be the consequence of an antibody-dependent cell-mediated cytotoxicity reaction, as the production of inflammatory cytokines by Fc receptor-bearing Kupffer cells has been observed (31). In addition, the inventors' results confirm another report, which showed that injection of a polymeric leucine-zipper chimeric FasL in rats only triggered a mild liver damage (32). Therefore, the inventors predict that all forms of polymeric FasL which would depend on antibody-mediated cross-linking will be toxic. Using a transplanted human tumor mouse model, we then demonstrated an anti-tumor effect of a non-toxic dose of IgFasL, administered several times, locally or intraperitoneally at a distance from the tumor site. Therefore, IgFasL also demonstrated in vivo activity, by reducing tumor development. Although more experiments and higher doses are still required to better describe IgFasL toxicity and activity, it appears that for a future therapeutic use in cancer treatment, the design of soluble FasL forms spontaneously reaching a high degree of polymerization should also consider their ability to trigger the adequate Fas receptor conformational adaptation.
Example II
Preparation of Polymeric Ig-FasL (pFasL) Based Chimeras Containing a Cell-Targeting Entity Consisting of Extracellular Portions of the HLA-A2 Molecule or of a Human Gamma-Delta TCR: Cell-Targeting Chimeras.
(85) In the following pFasL designation is used to describe polymeric Ig-FasL as defined in the present application and in particular in example I.
(86) In Example I, report was provided of the generation of a soluble FasL chimera by fusing the immunoglobulin-like domain of the Leukemia Inhibitory Factor receptor gp190 to the extracellular region of human FasL, which enabled spontaneous homotypic polymerization of FasL in particular dodecamers production. This polymeric FasL (pFasL) displayed anti-tumoral activity in vitro and in vivo without systemic cytotoxicity in mouse. Following this work, the inventors focused on the improvement of pFasL, with two complementary objectives. Firstly, they developed more complex pFasL-based chimeras that contained a cell-targeting module. Secondly, they attempted to improve the level of production and/or the specific activity of pFasL and of the cell-targeting chimeras. Two chimeras were thus designed by fusing to pFasL the extracellular portions of the HLA-A2 molecule or of a human gamma-delta TCR, and analyzed the consequences of co-expressing these molecules or pFasL together with sFasL on their heterotopic cell production. This strategy allowed to significantly enhance the production of pFasL and of the two chimeras, as well as the cytotoxic activity of the two chimeras but not of pFasL. These results provide the proof of concept for an optimization of FasL-based chimeric proteins for a therapeutical purpose.
(87) Two chimeras, called HLA-pfFasL and TCR-pfFasL were constructed, in which a Flag-tagged form of pFasL was respectively C-terminally linked to a beta-2 microglobulin/HLA-A*02:01 fusion molecule or to the extracellular portions of a V4V5 gamma-delta TCR able to recognize the cellular Endothelial Protein C receptor (EPCR). These targeting modules were selected as possible strategies to eliminate by Fas-mediated apoptosis respectively HLA-alloreactive T-lymphocytes in a transplantation setting, or carcinoma cells as EPCR is a stress self antigen over-expressed in various cancer cell types and recognized by the V4V5 TCR [33]. To verify their hypothesis, the inventors co-expressed with the cDNA encoding pFasL or the chimera, the one encoding the very weakly apoptotic sFasL, expecting it to be incorporated into the secreted chimeric polymer and therefore able to improve overall structure of the complex while maintaining its activity. The biochemical and functional characteristics of the complexes generated are reported here.
(88) Materials and Methods
(89) Cell Lines, Chemicals and Antibodies
(90) The human Fc receptor CD32 transfected mouse fibroblastic L-cells [34], the simian epithelial COS-7 [35] and the human epithelial HEK 293T [36] cell lines were maintained in culture with DMEM (Invitrogen Gibco, Fisher Scientific, Illkirch, France). The human T-lymphoma Jurkat cells [37] were cultivated in RPMI 1640 (Invitrogen Gibco). Culture media were supplemented with 8% heat-inactivated FCS (GeHealthcare, Buckinghamshire, UK) and 2 mM L-glutamine (Sigma, Saint-Louis, USA). The PE-labelled anti-CD32 and anti-mouse IgG mAbs used for cell staining were from Immunotech Beckman Coulter (Marseille, France). The anti-mouse Fas (clone JO-2) and the anti-human FasL (clone G247-4) mAbs were from BD Biosciences (Pont de Claix, France). The purified anti-Flag (clone M2), anti-2 microglobulin (clone B2M-01) and anti-CD32 (clone AT10) mAbs were from Sigma, Pierce technology (Rockford, USA) and Abcam, (Cambridge, USA), respectively. The mouse anti-human FasL clones 10F2 (neutralizing) and 14C2 (non-neutralizing) mAbs were home-made [14]. The remaining chemical reagents were purchased from Sigma unless otherwise specified.
(91) Plasmid Constructs
(92) All the constructs were subcloned into the 5370 bp pEDr mammalian expression vector [38]. The soluble FasL (sFasL) and the soluble polymeric FasL (pFasL) constructs were described [Example I]. Regarding the TCR-pFasL, two constructs were generated by fusing the extracellular regions of the gamma4 TCR chain (aa 20 to 295) or of the delta5 TCR chain (aa 27 to 272) to the pFasL coding sequence as follows. The portion encoding the extracellular domain of the gamma4 TCR chain or of the delta5 TCR chain [33] were obtained by PCR using 5-AATCTAGACAGCAAGTTAAGCAAAATTC-3 (SEQ ID No:19) and 5-AAACTAGTTGTGAGGGACATCATGTTC-3 (SEQ ID No:20) primers for the 65 chain or 5AATCTAGAAACTTGGAAGGGAGAACG 3 (SEQ ID No:21) and 5-AAACTAGTCAGGAGGAGGTACATGTA-3 (SEQ ID No:22) primers for the 4 chain. The PCR fragments were digested by XbaI and SpeI enzymes and ligated into the pEDR-pFasL vector into the SpeI cloning site. For the HLA-pFasL construct, the extracellular domain of the HLA-A*02:01 sequence fused 3-terminally to the beta2-microglobulin whole coding sequence kindly provided by Dr Jar-How Lee (One Lambda, Canoga Park, Calif.), was subcloned into the pFasL plasmid as follows. The fragment encompassing the signal peptide and extracellular portion of this chimera (aa 1 to 386) were isolated by PCR using 5-AGATCTAAGGAGATATAGATATGTCTCGCTCCGTGGCC-3 (SEQ ID No:23) and 5-ACTAGTACTACCGGCACCTCCCAGGGGAGGGGCTTGGG-3 (SEQ ID No:24) primers. A 15 bp linker (GGAGGTGCCGGTAGT) (SEQ ID No:25) was added to the 3 overhang by PCR. The whole PCR fragment was ligated into the pEDr-pFasL vector between the BglII and SpeI cloning sites. A 21-bp Flag tag sequence containing 5XbaI and 3SpeI overhangs was added between the TCR or HLA modules and the pFasL portion by direct ligation into a SpeI site, generating the TCR-pfFasL constructs. Similarly, a pfFasL and a sfFasL were obtained. All the constructs were verified by sequencing (Beckman Coulter Genomics, Takeley, UK). The final plasmids encoding sFasL, sfFasL, pfFasL, TCR-pfFasL and HLA-pfFasL displayed a nucleotide length in the range of 6000, 6000, 6300, 7100 and 7400 base pairs. For the transfection experiments using mixed plasmids, the percentage of added sFasL plasmid was determined on a molar basis.
(93) Production of the Soluble Chimeras by Calcium Phosphate Transient Transfection
(94) The human sFasL, sfFasL, pfFasL and HLA-pfFasL recombinant proteins were produced by transient expression in COS-7 cells whereas TCR-pfFasL was expressed in HEK 293T cells as higher amounts were produced in this cell line, according to the protocol optimized by Jordan et al [39]. One day before transfection, 1.5.Math.10.sup.6 cells were seeded in a 10 cm Petri dish in complete medium. The medium was replaced 3 to 4 hours prior to transfection. The plasmid DNA (7.6 pmol, corresponding to 30 g in the case the sfFasL encoding plasmid) was diluted to the indicated concentration with ultrapure water and 2 M calcium chloride (70 L/dish) to a final volume of 0.5 mL. After adding one volume of 2HBS buffer (pH 7.05; 1.5 mM Na.sub.2HPO.sub.4, 55 mM HEPES, 274 mM NaCl) the mix was allowed to precipitate for 10 min at room temperature and added dropwise onto the plated cells. The supernatants containing targeted soluble chimeras were collected 4 days after the transfection and centrifuged 20 min at 4000 rpm at 4 C. and the pelleted debris were removed. For the TCR-pfFasL, the plasmids containing the TCR 4 chain and the TCR 5 chain were co-transfected in equal amounts (w/w).
(95) Protein Quantification
(96) The concentration of the chimeras was quantified in cell culture using specific sandwich ELISA assays. The anti-FasL 14C2 or the anti-Flag mAbs were pre-coated overnight onto 96 well ELISA plates (Maxisorp Nunc, Thermo Scientific, Rochester, USA) respectively at 1 g or 0.25 g/well in hydrogenocarbonate coating buffer (pH=9.6). The plate was washed 3 times with PBS containing 0.05% Tween 20 and saturated with PBS containing 1% BSA. Known quantities of sfFasL or untagged pFasL were used as standards, respectively. After a 2-hour incubation with 100 L/well of the chimeras to be measured, the plate was washed and incubated 1 h with biotinylated anti-human FasL mAb 10F2 at 0.1 g/well in 100 L diluted in PBS with 1% BSA. After 3 washes, the plate was incubated for 1 h with peroxidase-labelled streptavidin (GEHealthcare) diluted 1/2000 in PBS with 1% BSA. After a 1 h incubation and a final wash step, the tetramethylbenzidine substrate (60 g/ml in pH 5.5 citrate buffer) was added (100 L/well). The reaction was stopped after 15 min with 1 M sulfuric acid (50 L/well) and the plate was read at 450 nm on a spectrophotometer.
(97) Cytotoxicity Assays
(98) The cytotoxic activity of the chimeras was evaluated on Jurkat cells using the MTT viability assay. Cells (3.Math.10.sup.4/well) were seeded in duplicate in flat-bottomed 96 well-plates and incubated overnight with the chimeras in a final volume of 100 L. Then, cells were incubated for 4 h at 37 C. with the tetrazolium salt [3-(4,5-dimethyl thiazol-2yl)]-2,5-diphenyl tetrazolium bromide (Sigma), 15 L/well at 5 mg/mL in PBS. After addition of 105 L/well of 5% formic acid in isopropanol to solubilise the formazan precipitate, optical density was measured at 570 nm. The percentage of specific cytotoxicity of the chimera on the cells was then calculated as follows: 100[(experimental absorbancebackground absorbance Jurkat cells alone)/(control absorbancebackground absorbance)]100.
(99) The enhancing effect of the chimera-targeting module was analyzed on L-cells stably expressing human CD32 using a propidium iodide cytotoxicity assay as follows. The HLA-pfFasL chimera was incubated during 1 h at room temperature with an anti-2 microglobulin at 0.12 g/ml, the anti-Flag mAb at 0.04 g/ml or an IgG1 isotype-matched negative control at 0.12 g/ml, to a final volume of 50 L. These concentrations provided the optimal cross-linking effect in dose-response experiments with the L-cells. Then, 20000 L-cells were added to a final volume of 0.1 mL. Regarding the blocking experiments, L-cells were pre-incubated 30 min at RT with anti-CD32 (clone AT10) or with anti-FasL (clone 10F2) blocking mAbs at 5 g/ml, respectively. The plates were incubated at 37 C. during 36 h. Cells and apoptotic bodies were centrifugated 10 min at 4000 rpm and resuspended with propidium iodide solution (50 g/mL) (Sigma) diluted in hypotonic solution (0.1% trisodium citrate, 0.1% triton X100) and the percentage of cells in sub-G1 was analyzed by flow cytometry (Fortessa, BD Biosciences).
(100) Immunoprecipitation and Immunoblot Experiments
(101) Chimera immunoprecipitations were performed using Pansorbin from S. aureus cells (EMD Millipore, Darmstadt, Germany). Pansorbin (4 L/condition) pre-saturated with PBS containing 3% BSA was incubated overnight at 4 C. with 3 g of purified anti-Flag or anti-FasL 10F2 mAbs in a total volume of 1 mL. The excess of unbound mAb was removed by adding 1 mL of washing buffer (25 mM HEPES pH 7.4, 40 mM Na.sub.4P.sub.2O.sub.7, 100 mM NaF, 40 mM Na.sub.3VO.sub.4, protease cocktail inhibitor, Triton 0.5%), followed by centrifugation (5500 rpm, 5 min, 4 C.). A fixed concentration of the chimera quantitated with the Flag/FasL ELISA was then added to the pellet to a final volume of 0.7 mL. After 4 h incubation at 4 C., the pellet was centrifuged and washed 4 times with the washing buffer. The proteins were released by heating (95 C., 5 min) in reducing loading buffer before SDS-PAGE separation.
(102) For the immunoblot experiments, either supernatant or immunoprecipitated proteins were electrophoretically separated by SDS-PAGE on 10 or 15% gels in reducing conditions, and transferred onto nitrocellulose membrane (Biotrace NT, VWR, Fontenay-sous-bois, France) by semi-dry transfer. The membranes were stained with Ponceau red and saturated with 2.5% BSA in TBST buffer (192 mM Glycine, 25 mM Tris, 0.1% SDS, 0.05% Tween 20, pH 7.9). Immunoblots were performed with the mouse anti-human FasL G247-4 antibody at 1 g/mL in TBST and with an IRDye@ 800CW labelled anti-mouse IgG antibody (LICOR ScienceTech, Courtaboeuf, France) at a 1/10000 dilution in TBST. Then, the luminescence signal were visualized and quantified by densitometry with the Odyssey Infrared Imaging system (LICOR).
(103) Size Exclusion Liquid Chromatography
(104) The apparent molecular size of the chimeras was evaluated using the Superose 6 column (GeHealthcare). The pfFasL protein was first concentrated using ammonium sulfate precipitation (47.8 g/100 ml) then dialysed overnight against PBS. The chimera was loaded in a volume of 0.2 mL onto the columns, and eluted in equilibration buffer (50 mM HEPES, 200 mM NaCl, 0.1 mM EDTA, 10% glycerol) at 0.4 mL/min. Fractions of 0.25 mL were collected. The elution profile of the recombinant proteins was evaluated by the ELISA FasL using the 14C2 and 10F2 mAbs as described above.
(105) Statistical Analysis
(106) Statistics were calculated with the t test using Statview (SAS Institute Corporation, Version 5.0, Cary, N.C.) software.
(107) Results
(108) Description of the FasL-Based Proteins
(109) The 6 FasL-derived recombinant proteins used are depicted in
(110) The recombinant proteins were all secreted as soluble forms in the supernatant of transfected mammalian cells. The TCR being a heterodimeric protein, the TCR-pfFasL protein was produced upon co-transfection of equal amounts of the plasmids encoding 4-pfFasL and 5-pfFasL. As expected, the pfFasL, TCR-pfFasL and HLA-pfFasL chimeras were polymeric, and under reducing conditions displayed apparent sizes of 37-40, 79 and 85 kDa respectively (result not shown). The low molecular weight sFasL, sfFasL and pfFasL monomers appeared as two distinct forms traducing different levels of glycosylation, as previously reported [40] and
(111) Enhancement of FasL-Derived Chimera Production in the Presence of sFasL
(112) In order to improve the production of our FasL chimeras, the inventors hypothesised that decreasing the size of the polymer could enhance its release in the supernatant. To answer this point, the sFasL encoding plasmid was co-transfected together with the one encoding the Flag-tagged chimera (
(113) First the effect on pfFasL and sfFasL production, of the co-transfection of increasing amounts of the sFasL encoding construct together a fixed amount of these plasmids was tested (
(114) The higher molecular weight chimeras TCR-pfFasL and HLA-pfFasL were also examined. A significant enhancing effect of sFasL was obtained on the production of both Flag-tagged constructs, with a maximum for 12.5% and 12.5 to 25% of the amount of the TCR-pfFasL and HLA-pfFasL, respectively. This allowed to increase the amount of the chimeras by 2 and 5 fold above the plateau of production when transfected alone. In addition, as observed for pfFasL, the total amount of FasL containing protein increased with the amount of plasmid transfected, but the quantity of the Flag-tagged chimera produced significantly decreased for amounts of sFasL plasmid above the plateau value. The apparent increase in Flag-tagged protein production in the presence of sFasL, as measured with ELISA, was verified by directly immunoblotting with the anti-FasL antibody the cell culture supernatant obtained at the optimal condition of plasmid ratio. As shown in
(115) Direct Incorporation of sFasL into the pfFasL-Containing Aggregates
(116) The inventors then assayed whether the observed increased production of the pfFasL-derived ligands in the presence of co-expressed sFasL was coincided with its incorporation into the polymeric chimera. For this purpose, the pfFasL construct was used as the prototypic example (
(117) At first, immunoprecipitation experiments were carried out with anti-FasL or anti-Flag antibodies, followed by immunoblotting with an anti-FasL antibody. The untagged sFasL produced alone as a control was immunoprecipitated with the anti-FasL but not with the anti-Flag antibody. No sFasL was detected in the anti-FasL immunoprecipitates of the pfFasL expressed alone, and as expected it was detected after co-transfection of both plasmids. The anti-Flag antibody immunoprecipitated pfFasL when it was expressed alone or with the sFasL plasmid, and co-precipitated sFasL after co-expression of both constructs, thereby confirming our hypothesis. A densitometric analysis of the immunoblot showed that incorporation of sFasL increased with the amount of plasmid co-transfected into the cells, for an identical amount of immunoprecipitated pfFasL as quantitated with the ELISA specific for Flag-tagged FasL (
(118) Secondly, the inventors wondered whether the presence of sFasL into the aggregates of the pfFasL chimera would modify its polymeric state and/or size. They analysed by gel filtration the protein complexes produced in the absence and in the presence of 25 or 50% of the sFasL plasmid. Total FasL was then measured in the elution fractions with the ELISA specific for FasL (
(119) Enhancement of the Cytotoxic Activity of the FasL-Derived Chimeras in the Presence of sFasL
(120) The effect of sFasL addition within the Flag-tagged FasL complexes, on their capacity to induce apoptosis was assessed on the Fas-sensitive Jurkat cell line (
(121) Incorporation of sFasL does not Hinder Cell Targeting of the FasL Chimera
(122) The apparent size decrease of the pfFasL protein complexes observed upon co-expression with sFasL, reflecting its dilution with short sFasL within the complexes, might as a corollary also diminish the cell targeting potential of the chimeras. To investigate this possibility, we analysed the ability of the HLA-pfFasL chimeric protein to target Fas-sensitive cells in a specific manner. For that purpose, we used murine fibroblastic L-cells stably expressing the human IgG Fc receptor CD32 and murine Fas (
(123) Discussion
(124) In this report, an approach was described to improve the design of polymeric FasL-based chimeric proteins, toward a better heterotopic cellular production, and a better biological activity. This was achieved by co-expressing the chimeric protein of interest together with sFasL leading to the secretion of heteromeric complexes. At first glance, this may appear as highly counter-intuitive, as sFasL is known to display a very weak cytotoxic activity, which was confirmed in the experiments as it was at least 5000 times less active than pfFasL. However, the inventors observed that the presence of sFasL into the FasL-derived chimeras increased both their recovery in the culture supernatant and their proapoptotic functional activity.
(125) The gain in net production relied on the complexity and/or the size of the FasL-based unit constituting the polymer, which by itself already greatly influenced the level of production that could be spontaneously reached. No effect was observed of coexpressed sFasL on the net production of the trimeric sfFasL, which is already produced at saturating levels when expressed alone in the optimized experimental conditions used. For pfFasL, which is polymeric and consists mainly of hexamers and dodecamers, the production of this chimera was enhanced by up to 10 fold in the presence of sFasL, allowing to reach an optimal production level close to that obtained for sFasL at its maximum. For more complex FasL-based units, such as HLA-pfFasL and TCR-pfFasL, the production was also improved although to a lower 2 to 5-fold extent. As these chimeras were secreted at much lower levels than the smaller forms, the inventors concluded that significantly improving their production is indeed possible but that intrinsic constraints, such as are e.g. the size of the monomer, of the final polymer or of both, will nevertheless auto-limit the capacity of the cell to produce and/or release them. The phenomenon described in the present report did not appear to be limited neither to a specific chimeric construct, as it was successfully observed it with three different ones, nor to be dependent on a cell production system, as the TCR and HLA chimeras were produced in HEK and COS cells, respectively. In experiments not shown, similar results were obtained for the pfFasL alone or in combination with sFasL in a very different context, i.e. a stable production system following transduction of HEK cells with two retroviral constructs each encoding one FasL-derived molecule. The obtained results also showed that the gain in protein production reached a maximum before decreasing when the proportion of sFasL becomes too important, as was observed for sfFasL, pfFasL, HLA-pfFasL and TCR-pfFasL. This could suggest that an overwhelming production of sFasL tends to divert the cellular machinery from the manufacturing of the HLA-pfFasL and TCR-pfFasL chimeras.
(126) The gain in function observed was also dependent on the complexity of the FasL-based unit composing the polymer, with some differences when compared to the improvement in production. For sfFasL, no cytotoxic function appeared whichever the proportion of non-tagged sFasL was present, consistent with the fact that sFasL is not expected to be able to alter the polymerisation level of sfFasL, which by itself is trimeric as sFasL is [41]. No gain in function was noticed either in the presence of the cross-linking anti-Flag antibody, suggesting that the spatial intrinsic organisation of the sfFasL +anti-Flag antibody is close to its functional optimum, and therefore can not be improved further with sFasL. This is confirmed with the pfFasL chimera, as no improvement in cytotoxic efficiency was observed in the presence of sFasL, although we reported a strong increase in the amount of protein produced. This discrepancy between these two criteria also suggests that the spatial organisation of the pfFasL chimera is already optimal in the absence of sFasL, and that only its intracellular processing or release can be optimized. For the HLA-pfFasL and TCR-pfFasL species, which were produced to much lower amounts, the cytotoxic activity was significantly enhanced, in addition to an improvement in cell production, in the presence of sFasL. Therefore, the gain occurs at both steps. However, although the overall raise might be considered as modest at each step, this may be explained by the nature of the chimeras that were produced. Indeed, a 45 TCR is a non covalently-linked heterodimeric protein with a natural propensity for the two chains to interact with each other into a stable dimer. In experiments not shown, it was noticed that none of the two chimeric chains was produced alone, in the absence of the co-transfection of its partner, suggesting that the pre-association of the TCR chains is a pre-requisite to the release of the TCR-pfFasL chimera. Therefore, such a polymeric chimera is intrinsically complex in terms of structure, which may explain why the spontaneous production level is low, and also why it cannot drastically be improved. An alternative would be to generate a single chain construct, on the model of what has been done for a TCR of the alpha-beta type. In the case of HLA-pfFasL, the construct used consisted in a first single chain beta-2 microglobulin HLA fusion, secondly attached to the FasL moiety, so it was also in itself a complex molecule. In addition, HLA stability is highly dependent on the presence of a peptide into the peptide-binding groove, which may also impinge on the overall 30 stability of the chimera. Results obtained also showed that the gain in cytotoxic activity for HLA-pfFasL and TCR-pfFasL reached a maximum before decreasing in the presence of higher proportions of sFasL. This could reflect a decrease in the overall size of the chimeric proteins, below the minimal degree of polymerization required for a biologically active molecule.
(127) The gel filtration experiments which were conducted showed a progressive decrease in the average size of the pfFasL chimera as the amount of sFasL increased: the high molecular weight compound disappeared at the benefit of smaller forms. This would explain both the increase in production due to the handling by the cell machinery of smaller complexes, and the enhancement of the activity if assuming that the most polymeric complexes are not the most efficient ones. However, and as observed for the production of the chimeras, the gain in activity may also be followed by a significant loss when the proportion of sFasL becomes too important, as it was indeed observed for HLA-pfFasL and TCR-pfFasL. This suggests that an overwhelming production of sFasL leads to the decrease in the proportion of chimera polymers of a size compatible with a biological activity.
(128) The present work demonstrates that the production and/or apoptotic activity of FasL-derived chimeras can be enhanced by incorporating the almost non cytotoxic ligand sFasL, thereby improving the obtention of more complex chimeric proteins equipped with a cell targeting module. The results suggest that this design could improve the efficacy of cell type-selective chimeras, as the inventors describe that the cytotoxicity of the HLA-pfFasL towards Fas-sensitive cells is indeed specifically improved in a cellular model where the chimera is tethered onto the surface of a presenting cell via an anti-beta2 microglobulin or an anti-Flag antibody. Then, the approach described here suggests that the design of FasL-derived chimeras associating two different cell-targeting modules is possible, with possibly a synergy as the coexpression of two different monomers could lead to a copolymer with a higher activity than each constitutive compound.
Example III
Preparation of Polymeric Ig-FasL (pFasL) Based Chimeras Containing a Cell-Targeting Entity Consisting of CD80 Extracellular Domain
(129) In the present work, a CD80-pFasL chimera to target human myeloma cells was designed, because, 1) they are known to express the CD80 receptor CD28 and 2) the expression level of CD28 is correlated with rapid disease progression and worse prognostic. Using the T-lymphoblast Jurkat and myeloma cell lines, the inventors demonstrated that the CD80-pFasL chimera was cytotoxic in a Fas-dependent manner and that its activity was significantly enhanced by the CD80/CD28 interaction. The CD28 synergistic activity was independent of any signalling through the CD28 intracellular domain, and was correlated with the expression level of CD28 on the target cell. The co-expression of soluble FasL (sFasL) together with the chimera increased its cytotoxic activity without impairing its ability to target the CD28-expressing cells. These results suggest that the CD28 tumor-enhancing receptor is a potential target for immunotherapy in myeloma.
(130) The inventors constructed the CD80-pFasL (also designated CD80-IgFasL polymeric chimera), with the objective to eliminate in a selective manner the tumoral plasmocytes in the multiple myeloma disease. Myeloma cells express CD28, the CD80 receptor, and the expression level of CD28 is correlated with rapid disease progression and a worse prognostic. CD28 is known to participate in cell survival and proliferation, via the activation of the NF-kB pathway. CD28 is expressed on normal plasmocytes as well, but is absent from the surface of other cells of the B-lymphocyte lineage. CD28 is also expressed on normal resting and activated T-lymphocytes, and for these cells is a prototypic co-stimulator, which is required for nave T-cells to be activated into effector lymphocytes, in conjunction to the signal triggered by interaction between the cognate peptide-HLA complex and the T-cell antigen receptor (TCR). In the present report, the biochemical and functional characteristics of the CD80-pFasL molecule are described, focusing on its ability to trigger apoptosis of myeloma cell lines.
(131) Materials and Methods
(132) Cell Lines, Chemicals and Antibodies
(133) The human epithelial HEK 293T (36) cell line was maintained in culture with DMEM (Invitrogen Gibco, Fisher Scientific, Illkirch, France). The human T-lymphoma Jurkat cells (37) and the human myeloma cell lines RPMI8226 and U266 were cultivated in RPMI 1640 (Invitrogen Gibco). Culture media were supplemented with 8% heat-inactivated FCS (GeHealthcare, Buckinghamshire, UK) and 2 mM L-glutamine (Sigma, Saint-Louis, USA). The PE-labelled anti-Fas, anti-CD80, anti-CD28 (clone CD28.2) and anti-mouse IgG mAbs were from Immunotech Beckman Coulter (Marseille, France). The anti-mouse Fas (clone JO-2) and the anti-human FasL (clone G247-4) mAbs were from BD Biosciences (Pont de Claix, France). The purified anti-Flag (clone M2) mAb was from Sigma. The mouse anti-human FasL clones 10F2 (neutralizing) and 14C2 (non-neutralizing) mAbs were home-made (14). The remaining chemical reagents were purchased from Sigma unless otherwise specified.
(134) Plasmid Constructs
(135) All the constructs were subcloned into the 5370 bp pEDr mammalian expression vector (38). The soluble FasL (sFasL) and the soluble polymeric FasL (pFasL) constructs were described above (Example I). The CD80-pFasL was obtained by subcloning the 720 bp fragment encoding the extracellular region of human CD80, upstream the immunoglobulin-like module of the pFasL construct, done for the reported pFasL chimers (in Example II). The CD80-pFasL construct was verified by sequencing (Beckman Coulter Genomics, Takeley, UK).
(136) Production of the Soluble Chimeras by Calcium Phosphate Transient Transfection
(137) The human sFasL, pFasL and CD80-pFasL recombinant proteins were produced by transient expression in HEK 293T cells according to the protocol optimized by Jordan et al (39). One day before transfection, 1.5.Math.10.sup.6 cells were seeded in a 10 cm Petri dish in complete medium. The medium was replaced 3 to 4 hours prior to transfection. The plasmid DNA (30 g) was diluted with ultrapure water and 2 M calcium chloride (70 L/dish) to a final volume of 0.5 mL. After adding one volume of 2HBS buffer (pH 7.05; 1.5 mM Na.sub.2HPO.sub.4, 55 mM HEPES, 274 mM NaCl) the mix was allowed to precipitate for 10 min at room temperature and added dropwise onto the plated cells. The supernatants were collected 4 days after the transfection and centrifuged 20 min at 4000 rpm at 4 C. and the pelleted debris were removed. For experiments using the co-transfection of two different plasmids, 30 g of the CD80-encoding plasmid was used, to which was added the indicated amount of the second plasmid.
(138) Protein Quantification
(139) The concentration of the chimeras was quantified in cell culture using specific sandwich ELISA assays. The anti-FasL 14C2 or the anti-Flag mAbs were pre-coated overnight onto 96 well ELISA plates (Maxisorp Nunc, Thermo Scientific, Rochester, USA) respectively at 1 g or 0.25 g/well in hydrogenocarbonate coating buffer (pH=9.6). The plate was washed 3 times with PBS containing 0.05% Tween 20 and saturated with PBS containing 1% BSA. Known quantities of sfFasL or untagged pFasL were used as standards, respectively. After a 2-hour incubation with 100 L/well of the chimeras to be measured, the plate was washed and incubated 1 h with biotinylated anti-human FasL mAb 10F2 at 0.1 g/well in 100 L diluted in PBS with 1% BSA. After 3 washes, the plate was incubated for 1 h with peroxidase-labelled streptavidin (GEHealthcare) diluted 1/2000 in PBS with 1% BSA. After a 1 h incubation and a final wash step, the tetramethylbenzidine substrate (60 g/ml in pH 5.5 citrate buffer) was added (100 L/well). The reaction was stopped after 15 min with 1 M sulfuric acid (50 L/well) and the plate was read at 450 nm on a spectrophotometer.
(140) ELISA for CD80-pFasL
(141) The sandwich ELISA used to quantitate the CD80-pFasL molecule was performed using as the capture antibody the anti-CD80 (5 g/mL) and as the tracing antibody the biotinylated 14C2 anti-FasL mAb. The ELISA procedure was performed exactly as described for the other ELISA assays we reported to quantitate our FasL-derived chimeras (Example II).
(142) Cytotoxicity Assays
(143) The cytotoxic activity of the chimeras was evaluated on the indicated cells using the MTT viability assay. Cells (3.Math.10.sup.4/well) were seeded in duplicate in flat-bottomed 96 well-plates and incubated overnight with the chimeras in a final volume of 100 L. Then, cells were incubated for 4 h at 37 C. with the tetrazolium salt [3-(4,5-dimethyl thiazol-2yl)]-2,5-diphenyl tetrazolium bromide (Sigma), 15 L/well at 5 mg/mL in PBS. After addition of 105 L/well of 5% formic acid in isopropanol to solubilise the formazan precipitate, optical density was measured at 570 nm. The percentage of specific cytotoxicity of the chimera on the cells was then calculated as follows: 100[(experimental absorbancebackground absorbance of cells alone)/(control absorbancebackground absorbance)]100.
(144) The enhancing effect of the CD80 module was analyzed on the indicated target cells as follows. The cells or the chimera were incubated during 30 min at 37 C. or at room temperature, respectively, with the indicated antibody at the indicated concentration in a total volume of 50 l. Then, 20000 L-cells were added to a final volume of 0.1 mL, and the plates were incubated at 37 C. for 24 h, before measuring cell viability with the MTT assay.
(145) Immunoprecipitation and Immunoblot Experiments
(146) Chimera immunoprecipitations were performed using Pansorbin from S. aureus cells (EMD Millipore, Darmstadt, Germany). Pansorbin (4 L/condition) pre-saturated with PBS containing 3% BSA was incubated overnight at 4 C. with 3 g of purified anti-CD28 mAb in a total volume of 1 mL. The excess of unbound mAb was removed by adding 1 mL of washing buffer (25 mM HEPES pH 7.4, 40 mM Na.sub.4P.sub.2O.sub.7, 100 mM NaF, 40 mM Na.sub.3VO.sub.4, protease cocktail inhibitor, Triton 0.5%), followed by centrifugation (5500 rpm, 5 min, 4 C.). A fixed concentration of the chimera quantitated with the CD80/FasL ELISA was then added to the pellet to a final volume of 0.7 mL. After 4 h incubation at 4 C., the pellet was centrifuged and washed 4 times with the washing buffer. The proteins were released by heating (95 C., 5 min) in reducing loading buffer before SDS-PAGE separation.
(147) For the immunoblot experiments, either supernatant or immunoprecipitated proteins were electrophoretically separated by SDS-PAGE on 10 or 15% gels in reducing conditions, and transferred onto nitrocellulose membrane (Biotrace NT, VWR, Fontenay-sous-bois, France) by semi-dry transfer. The membranes were stained with Ponceau red and saturated with 2.5% BSA in TBST buffer (192 mM Glycine, 25 mM Tris, 0.1% SDS, 0.05% Tween 20, pH 7.9). Immunoblots were performed with the mouse anti-human FasL G247-4 antibody at 1 g/mL in TBST and with an IRDye 800CW labelled anti-mouse IgG antibody (LICOR ScienceTech, Courtaboeuf, France) at a 1/10000 dilution in TBST. Then, the luminescence signal were visualized and quantified by densitometry with the Odyssey Infrared Imaging system (LICOR).
(148) Statistical Analysis
(149) Statistics were calculated with the t test using Statview (SAS Institute Corporation, Version 5.0, Cary, N.C.) software.
(150) Results and Discussion
(151) Description of the FasL-Based Proteins
(152) The FasL-derived recombinant proteins used are depicted in
(153) Involvement of CD28 Binding but not Signalling in Apoptosis Induced by CD80-pfFasL
(154) To analyse the cytotoxic activity of the CD80-pFasL chimera, the T-lymphoblastic cell line Jurkat, which is highly sensitive to Fas-mediated cell death, and also expresses CD28 was used (
(155) In terms of apoptotic activity (
(156) To analyse this possibility, the inventors conducted experiments where CD28 was blocked using a neutralising antibody. The blocking of CD28 led to a partial inhibition of cell death on the JKCD28high cell line, whereas no effect was evidenced on the JKCD28low cell line, which expresses almost no CD28 on the cell surface. This demonstrated that the CD80 module indeed bound to CD28 to trigger cell death via the FasL module. In addition, because the blocking of this interaction strongly impaired cell killing, this suggests that the binding through CD28 did not diminish the efficiency of the chimeric protein, as the killing would have increased in the presence of the blocking anti-CD28 antibody (
(157) Effect of CD80-pFasL on Human Myeloma Cell Lines
(158) The human myeloma cell lines RPMI8226 and U266 coexpress Fas and CD28 on the cell surface (
(159) Improvement of CD80-pfFasL in the Presence of sFasL
(160) As demonstrated (Example II) with two different pFasL-derived chimeric proteins, the inventors observed that the cell supernatant production of CD80-pFasL was enhanced upon co-expression together with sFasL, with a maximal effect in the presence of 1.5 to 50% of the sFasL plasmid (
REFERENCES
(161) 1. Bodmer, J. L., Schneider, P., and Tschopp, J. The molecular architecture of the TNF superfamily. Trends Biochem Sci, 27: 19-26, 2002. 2. Krueger, A., Fas, S. C., Baumann, S., and Krammer, P. H. The role of CD95 in the regulation of peripheral T-cell apoptosis. Immunol Rev, 193: 58-69, 2003. 3. Ogasawara, J., Watanabe-Fukunaga, R., Adachi, M., Matsuzawa, A., Kasugai, T., Kitamura, Y., Itoh, N., Suda, T., and Nagata, S. Lethal effect of the anti-Fas antibody in mice. Nature, 364: 806-809, 1993. 4. Kayagaki, N., Kawasaki, A., Ebata, T., Ohmoto, H., Ikeda, S., Inoue, S., Yoshino, K., Okumura, K., and Yagita, H. Metalloproteinase-mediated release of human Fas ligand. J Exp Med, 182: 1777-1783, 1995. 5. Mariani, S. M., Matiba, B., Baumler, C., and Krammer, P. H. Regulation of cell surface APO-1/Fas (CD95) ligand expression by metalloproteases. Eur J Immunol, 25: 2303-2307, 1995. 6. Suda, T., Hashimoto, H., Tanaka, M., Ochi, T., and Nagata, S. Membrane Fas ligand kills human peripheral blood T lymphocytes, and soluble Fas ligand blocks the killing. J Exp Med, 186: 2045-2050, 1997. 7. Schneider, P., Holler, N., Bodmer, J. L., Hahne, M., Frei, K., Fontana, A., and Tschopp, J. Conversion of membrane-bound Fas(CD95) ligand to its soluble form is associated with downregulation of its proapoptotic activity and loss of liver toxicity. J Exp Med, 187: 1205-1213, 1998. 8. Holler, N., Tardivel, A., Kovacsovics-Bankowski, M., Hertig, S., Gaide, O., Martinon, F., Tinel, A., Deperthes, D., Calderara, S., Schulthess, T., Engel, J., Schneider, P., and Tschopp, J. Two adjacent trimeric Fas ligands are required for Fas signaling and formation of a death-inducing signaling complex. Mol Cell Biol, 23: 1428-1440, 2003. 9. Gearing, D. P., Thut, C. J., VandeBos, T., Gimpel, S. D., Delaney, P. B., King, J., Price, V., Cosman, D., and Beckmann, M. P. Leukemia inhibitory factor receptor is structurally related to the IL-6 signal transducer, gp130. Embo J, 10: 2839-2848, 1991. 10. Taupin, J. L., Miossec, V., Pitard, V., Blanchard, F., Daburon, S., Raher, S., Jacques, Y., Godard, A., and Moreau, J. F. Binding of leukemia inhibitory factor (LIF) to mutants of its low affinity receptor, gp190, reveals a LIF binding site outside and interactions between the two cytokine binding domains. J Biol Chem, 274: 14482-14489, 1999. 11. Voisin, M. B., Bitard, J., Daburon, S., Moreau, J. F., and Taupin, J. L. Separate functions for the two modules of the membrane-proximal cytokine binding domain of glycoprotein 190, the leukemia inhibitory factor low affinity receptor, in ligand binding and receptor activation. J Biol Chem, 277: 13682-13692, 2002. 12. Tenhumberg, S., Schuster, B., Zhu, L., Kovaleva, M., Scheller, J., Kallen, K. J., and Rose-John, S. gp130 dimerization in the absence of ligand: preformed cytokine receptor complexes. Biochem Biophys Res Commun, 346: 649-657, 2006. 13. Boulanger, M. J. and Garcia, K. C. Shared cytokine signaling receptors: structural insights from the gp130 system. Adv Protein Chem, 68: 107-146, 2004. 14. Legembre, P., Moreau, P., Daburon, S., Moreau, J. F., and Taupin, J. L. Potentiation of Fas-mediated apoptosis by an engineered glycosylphosphatidylinositol-linked Fas. Cell Death Differ, 9: 329-339, 2002. 15. Taupin, J. L., Acres, B., Dott, K., Schmitt, D., Kieny, M. P., Gualde, N., and Moreau, J. F. Immunogenicity of HILDA/LIF either in a soluble or in a membrane anchored form expressed in vivo by recombinant vaccinia viruses. Scand J Immunol, 38: 293-301, 1993. 16. D'Andrea, A. D., Yoshimura, A., Youssoufian, H., Zon, L. I., Koo, J. W., and Lodish, H. F. The cytoplasmic region of the erythropoietin receptor contains nonoverlapping positive and negative growth-regulatory domains. Mol Cell Biol, 11: 1980-1987, 1991. 17. Tian, Q., Taupin, J., Elledge, S., Robertson, M., and Anderson, P. Fas-activated serine/threonine kinase (FAST) phosphorylates TIA-1 during Fas-mediated apoptosis. J Exp Med, 182: 865-874, 1995. 18. Messier, T. L., Pittman, D. D., Long, G. L., Kaufman, R. J., and Church, W. R. Cloning and expression in COS-1 cells of a full-length cDNA encoding human coagulation factor X. Gene, 99: 291-294, 1991. 19. Nagata, S., Onda, M., Numata, Y., Santora, K., Beers, R., Kreitman, R. J., and Pastan, I. Novel anti-CD30 recombinant immunotoxins containing disulfide-stabilized Fv fragments. Clin Cancer Res, 8: 2345-2355, 2002. 20. Uphoff, C. C. and Drexler, H. G. Detection of mycoplasma contaminations. Methods Mol Biol, 290: 13-23, 2005. 21. Chen, T. R. In situ detection of mycoplasma contamination in cell cultures by fluorescent Hoechst 33258 stain. Exp Cell Res, 104: 255-262, 1977. 22. Taupin, J. L., Gualde, N., and Moreau, J. F. A monoclonal antibody based elisa for quantitation of human leukaemia inhibitory factor. Cytokine, 9: 112-118, 1997. 23. Beneteau, M., Daburon, S., Moreau, J. F., Taupin, J. L., and Legembre, P. Dominant-negative Fas mutation is reversed by down-expression of c-FLIP. Cancer Res, 67: 108-115, 2007. 24. Schagger, H. Respiratory chain supercomplexes of mitochondria and bacteria. Biochim Biophys Acta, 1555: 154-159, 2002. 25. Goldman, J. P., Blundell, M. P., Lopes, L., Kinnon, C., Di Santo, J. P., and Thrasher, A. J. Enhanced human cell engraftment in mice deficient in RAG2 and the common cytokine receptor gamma chain. Br J Haematol, 103: 335-342, 1998. 26. Legembre, P., Beneteau, M., Daburon, S., Moreau, J. F., and Taupin, J. L. Cutting edge: SDS-stable Fas microaggregates: an early event of Fas activation occurring with agonistic anti-Fas antibody but not with Fas ligand. J Immunol, 171: 5659-5662, 2003. 27. Chida, Y., Sudo, N., Takaki, A., and Kubo, C. The hepatic sympathetic nerve plays a critical role in preventing Fas induced liver injury in mice. Gut, 54: 994-1002, 2005. 28. Descamps, D., Vigant, F., Esselin, S., Connault, E., Opolon, P., Perricaudet, M., and Benihoud, K. Expression of non-signaling membrane-anchored death receptors protects murine livers in different models of hepatitis. Hepatology, 44: 399-409, 2006. 29. Krautwald, S., Ziegler, E., Tiede, K., Pust, R., and Kunzendorf, U. Transduction of the TAT-FLIP fusion protein results in transient resistance to Fas-induced apoptosis in vivo. J Biol Chem, 279: 44005-44011, 2004. 30. Song, E., Lee, S. K., Wang, J., Ince, N., Ouyang, N., Min, J., Chen, J., Shankar, P., and Lieberman, J. RNA interference targeting Fas protects mice from fulminant hepatitis. Nat Med, 9: 347-351, 2003. 31. Matsuda, Y., Toda, M., Kato, T., Kuribayashi, K., and Kakimi, K. Fulminant liver failure triggered by therapeutic antibody treatment in a mouse model. Int J Oncol, 29: 1119-1125, 2006. 32. Shiraishi, T., Suzuyama, K., Okamoto, H., Mineta, T., Tabuchi, K., Nakayama, K., Shimizu, Y., Tohma, J., Ogihara, T., Naba, H., Mochizuki, H., and Nagata, S. Increased cytotoxicity of soluble Fas ligand by fusing isoleucine zipper motif. Biochem Biophys Res Commun, 322: 197-202, 2004. 33. Willcox C, Pitard V, Netzer S, Couzi L, Salim M, et al. (2012) Cytomegalovirus and tumor stress-surveillance by human T cell receptor binding to Endothelial Protein C Receptor. Nat Immunol 13: 872-879. 34. Banchereau J, de Paoli P, Valle A, Garcia E, Rousset F (1991) Long-term human B cell lines dependent on interleukin-4 and antibody to CD40. Science 251: 70-72. 35. Gluzman Y (1981) SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23: 175-182. 36. Sena-Esteves M, Saeki Y, Camp S M, Chiocca E A, Breakefield X O (1999) Single-step conversion of cells to retrovirus vector producers with herpes simplex virus-Epstein-Barr virus hybrid amplicons. J Virol 73: 10426-10439. 37. Vivier E, Rochet N, Ackerly M, Petrini J, Levine H, et al. (1992) Signaling function of reconstituted CD16: zeta: gamma receptor complex isoforms. Int Immunol 4: 1313-1323. 38. Kaufman R J, Davies M V, Wasley L C, Michnick D (1991) Improved vectors for stable expression of foreign genes in mammalian cells by use of the untranslated leader sequence from EMC virus. Nucleic Acids Res 19: 4485-4490. 39. Jordan M, Wurm F (2004) Transfection of adherent and suspended cells by calcium phosphate. Methods 33: 136-143. 40. Schneider P, Bodmer J L, Holler N, Mattmann C, Scuderi P, et al. (1997) Characterization of Fas (Apo-1, CD95)-Fas ligand interaction. J Biol Chem 272: 18827-18833. 41. Holler N, Tardivel A, Kovacsovics-Bankowski M, Hertig S, Gaide O, et al. (2003) Two adjacent trimeric Fas ligands are required for Fas signaling and formation of a death-inducing signaling complex. Mol Cell Biol 23: 1428-1440. 42. Belmont H J, Price-Schiavi S, Liu B, Card K F, Lee H I, et al. (2006) Potent antitumor activity of a tumor-specific soluble TCR/IL-2 fusion protein. Clin Immunol 121: 29-39. 43. Legembre P, Daburon S, Moreau P, Moreau J F, Taupin J L. Modulation of Fas-mediated apoptosis by lipid rafts in T lymphocytes. J Immunol 2006 Jan. 15; 176 (2): 716-720.