NOVEL 7-SUBSTITUTED SULFONIMIDOYLPURINONE COMPOUNDS AND DERIVATIVES FOR THE TREATMENT AND PROPHYLAXIS OF VIRUS INFECTION
20180072730 ยท 2018-03-15
Assignee
Inventors
- Lu Gao (Shanghai, CN)
- Chungen LIANG (Shanghai, CN)
- Hongying Yun (Shanghai, CN)
- Xiufang Zheng (Shanghai, CN)
- Jianping WANG (Shanghai, CN)
- Kun MIAO (Shanghai, CN)
- Bo Zhang (Shanghai, CN)
Cpc classification
A61P43/00
HUMAN NECESSITIES
A61P31/00
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to compounds of formula (I),
##STR00001## wherein R.sup.1, R.sup.2 and R.sup.3 are as described herein, and their prodrugs or pharmaceutically acceptable salt, enantiomer or diastereomer thereof, and compositions including the compounds and methods of using the compounds.
Claims
1. A compound of formula (I), ##STR00185## wherein R.sup.1 is C.sub.1-6alkyl; R.sup.2 is benzyl, said benzyl being unsubstituted or substituted by one, two or three substituents independently selected from halogen and C.sub.1-6alkyl; R.sup.3 is NR.sup.4R.sup.5, wherein R.sup.4 is C.sub.1-6alkyl or C.sub.1-6alkoxyC.sub.1-6alkyl; and R.sup.5 is (C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl, C.sub.1-6alkoxyC.sub.1-6alkyl, C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl, C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl, C.sub.1-6alkoxycarbonylC.sub.1-6alkyl, C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl, C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or pyrrolidinylcarbamoyloxyC.sub.1-6alkyl; or R.sup.4 and R.sup.5 together with the nitrogen they are attached to form a heterocyclyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof; with the proviso that 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7-(pyrrolidine-1-carbonyl)purin-8-one; 6-amino-9-benzyl-7-(piperidine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; 6-amino-9-benzyl-7-(morpholine-4-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; 6-amino-9-benzyl-7-(3,3-dimethylpyrrolidine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; ethyl 1-[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]pyrrolidine-2-carboxylate; 6-amino-7-(2-azaspiro[3.3]heptane-2-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8-one; 6-amino-9-benzyl-7-(2-oxa-6-azaspiro [3.3]heptane-6-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; 6-amino-9-benzyl-7-(3,3-difluoropyrrolidine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; and 6-amino-9-benzyl-7-(3-fluoro-3-methyl-pyrrolidine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; and their enantiomers and diastereomers are excluded.
2. A compound according to claim 1, wherein R.sup.1 is C.sub.1-6alkyl; R.sup.2 is benzyl, said benzyl being unsubstituted or substituted by halogen or C.sub.1-6alkyl; R.sup.3 is azetidinyl; piperazinyl substituted by C.sub.1-6alkyl; piperidinyl substituted by piperidinyl; pyrrolidinyl; or NR.sup.4R.sup.5, wherein R.sup.4 is C.sub.1-6alkyl or C.sub.1-6alkoxyC.sub.1-6alkyl; and R.sup.5 is (C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl, C.sub.1-6alkoxyC.sub.1-6alkyl, C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl, C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl, C.sub.1-6alkoxycarbonylC.sub.1-6alkyl, C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl, C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or pyrrolidinylcarbamoyloxyC.sub.1-6alkyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
3. A compound according to claim 1, wherein R.sup.1 is ethyl or propyl; R.sup.2 is benzyl, bromobenzyl, chlorobenzyl, fluorobenzyl or methylbenzyl; R.sup.3 is azetidinyl; 4-methylpiperazinyl; piperidinylpiperidinyl; pyrrolidinyl; or NR.sup.4R.sup.5, wherein R.sup.4 is methyl, ethyl, propyl or methoxyethyl; and R.sup.5 is acetyl(methyl)aminoethyl, butyl, butyl(methyl)carbamoyloxyethyl, diethylcarbamoyloxyethyl, ethoxycarbonyl(methyl)aminoethyl, ethoxycarbonylethyl, ethoxycarbonylisobutyl, ethoxycarbonylisopentyl, ethoxycarbonylmethyl, ethoxycarbonyloxyethyl, ethoxycarbonyl(phenyl)ethyl, ethyl, isobutyl, isopropoxycarbonylisopentyl, isopropoxycarbonyl(phenyl)ethyl, isopropyl, methoxycarbonyl(methyl)aminoethyl, methoxyethyl, methoxypropyl, propyl, propyl(methyl)carbamoyloxyethyl, pyrrolidinylcarbamoyloxyethyl, tert-butoxycarbonyl(methyl)aminoethyl, tert-butoxycarbonylethyl, tert-butoxycarbonylisopentyl or tert-butoxycarbonyl(phenyl)ethyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
4. A compound according to claim 3, wherein R.sup.3 is azetidinyl, 4-methylpiperazinyl, piperidinylpiperidinyl, pyrrolidinyl, acetyl(methyl)aminoethyl(methyl)amino, bis(methoxyethyl)amino, butyl(ethyl)amino, butyl(methyl)amino, butyl(methyl)carbamoyloxyethyl(methyl)amino, diethylcarbamoyloxyethyl(methyl)amino, ethoxycarbonyl(methyl)aminoethyl(methyl)amino, ethoxycarbonylethyl(methyl)amino, ethoxycarbonylisobutyl(methyl)amino, ethoxycarbonylisopentyl(methyl)amino, ethoxycarbonylmethyl(methyl)amino, ethoxycarbonyloxyethyl(methyl)amino, ethoxycarbonyl(phenyl)ethyl(methyl)amino, ethyl(methyl)amino, isobutyl(methyl)amino, isopropoxycarbonylisopentyl(methyl)amino, isopropoxycarbonyl(phenyl)ethyl(methyl)amino, isopropyl(methyl)amino, methoxycarbonyl(methyl)aminoethyl(methyl)amino, methoxyethyl(ethyl)amino, methoxyethyl(methyl)amino, methoxyethyl(propyl)amino, methoxypropyl(methyl)amino, propyl(ethyl)amino, propyl(methyl)amino, propyl(methyl)carbamoyloxyethyl(methyl)amino, pyrrolidinylcarbamoyloxyethyl(methyl)amino, tert-butoxycarbonyl(methyl)aminoethyl(methyl)amino, tert-butoxycarbonylethyl(methyl)amino, tert-butoxycarbonylisopentyl(methyl)amino or tert-butoxycarbonyl(phenyl)ethyl(methyl)amino; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
5. A compound according to claim 1, wherein R.sup.1 is ethyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
6. A compound according to claim 1, wherein R.sup.2 is benzyl substituted by halogen or C.sub.1-6alkyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
7. A compound according to claim 1, wherein R.sup.2 is bromobenzyl, chlorobenzyl, fluorobenzyl or methylbenzyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
8. A compound according to claim 7, wherein R.sup.2 is bromobenzyl, chlorobenzyl or fluorobenzyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
9. A compound according to claim 1, wherein R.sup.3 is NR.sup.4R.sup.5, wherein R.sup.4 is C.sub.1-6alkyl, R.sup.5 is C.sub.1-6alkyl; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
10. A compound according to claim 9, wherein R.sup.3 is propyl(methyl)amino or ethyl(methyl)amino; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
11. A compound according to claim 1, wherein R.sup.1 is C.sub.1-6alkyl; R.sup.2 is benzyl, said benzyl being substituted by halogen or C.sub.1-6alkyl; and R.sup.3 is NR.sup.4R.sup.5, wherein R.sup.4 is C.sub.1-6alkyl, and R.sup.5 is C.sub.1-6alkyl or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
12. A compound according to claim 11, wherein R.sup.1 is ethyl; R.sup.2 is methylbenzyl, bromobenzyl, chlorobenzyl or fluorobenzyl; and R.sup.3 is propyl(methyl)amino or ethyl(methyl)amino; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
13. A compound selected from: 6-Amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfonimidoyl)purin-8-one; 6-Amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8-one; 6-Amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one; 6-Amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; Ethyl 2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]acetate; Ethyl 3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate; tert-Butyl 3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate; Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate; tert-Butyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate; Isopropyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate; Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-methyl-butanoate; Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate; Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate; Isopropyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate; tert-Butyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate; N-[2-[Acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; Methyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate; tert-Butyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate; Ethyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate; 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N-butyl-N-methyl-carbamate; 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl pyrrolidine-1-carboxylate; 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N-methyl-N-propyl-carbamate; 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N,N-diethylcarbamate; 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl ethyl carbonate; 6-Amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]purine-7-carboxamide; 6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-2-[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-carbonyl)purin-8-one; 6-Amino-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-carbonyl)purin-8-one; 6-Amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-methyl-8-oxo-purine-7-carboxamide; and 6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-methyl-8-oxo-purine-7-carboxamide; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
14. A compound according to claim 13, selected from: 6-Amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide; 6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide; 6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide; 6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; 6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; and 6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
15. A process for the preparation of a compound according to claim 1 comprising the following step: the reaction of a compound of formula (II), ##STR00186## with carbamoyl chloride in the presence of a mixed base; wherein the mixed base is pyridine and triethylamine, pyridine and DIPEA, DMAP and triethylamine, or DMAP and DIPEA.
16. (canceled)
17. A pharmaceutical composition comprising a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof, and a therapeutically inert carrier.
18.-24. (canceled)
25. A compound which is 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
26. A compound which is 6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
27. A compound which is 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
28. A compound which is 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
29. A compound which is 6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
30. A compound which is 6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
31. A compound which is 6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-propyl-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
32. A compound which is 6-amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
33. A compound which is 6-amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
34. A compound which is 6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
35. A compound which is 6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-methyl-8-oxo-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
36. A compound which is 6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-methyl-8-oxo-purine-7-carboxamide, or a pharmaceutically acceptable salt thereof.
37. A method for the treatment or prophylaxis of hepatitis B virus infection, which method comprises administering a therapeutically effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
38. A method for agonizing TLR7, which method comprises administering a therapeutically effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
39. A method for inducing production of interferon-a, which method comprises administering a therapeutically effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
EXAMPLES
[0230] The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.
[0231] Abbreviations [0232] aq. aqueous [0233] BSA: N,O-bis(trimethylsilyl)acetamide [0234] CDI: N,N-carbonyl diimidazole [0235] DIEPA: N,N-diethylpropylamine [0236] DBU: 1,8-Diazabicycloundec-7-ene [0237] DPPA: diphenylphosphoryl azide [0238] EC.sub.50: the molar concentration of an agonist, which produces 50% of the maximum possible response for that agonist. [0239] EDC: N1-((ethylimino)methylene)-N3,N3-dimethyipropane-1,3-diamine [0240] EtOAc or EA: ethyl acetate [0241] HATU: (1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate) [0242] hr(s): hour(s) [0243] HPLC: high performance liquid chromatography [0244] HOBt: N-hydroxybenzotriazole [0245] MS (ESI): mass spectroscopy (electron spray ionization) [0246] m-CPBA: 3-chioroperbenzoic acid [0247] MTEB: methyl tert-butyl ether [0248] NMP: N-methylpyrrolidone [0249] obsd. observed [0250] PE: petroleum ether [0251] PMB: p-methoxybenzyl [0252] PPA: polyphosphoric acid [0253] QOD every other day [0254] QW once a week [0255] RT or rt: room temperature [0256] sat. saturated [0257] TFA: trifluoroacetic acid [0258] TEA: triethylamine [0259] V/V volume ratio
General Experimental Conditions
[0260] Intermediates and final compounds were purified by flash chromatography using one of the following instruments: i) Biotage SP1 system and the Quad 12/25 Cartridge module. ii) ISCO combi-flash chromatography instrument. Silica gel Brand and pore size: i) KP-SIL 60 , particle size: 40-60 m; ii) CAS registry NO: Silica Gel: 63231-67-4, particle size: 47-60 micron silica gel; iii) ZCX from Qingdao Haiyang Chemical Co., Ltd, pore: 200-300 or 300-400.
[0261] Intermediates and final compounds were purified by preparative HPLC on reversed phase column using X Bridge Perp C.sub.18 (5 m, OBD 30100 mm) column or SunFire Perp C.sub.18 (5 m, OBD 30100 mm) column.
[0262] LC/MS spectra were obtained using a Waters UPLC-SQD Mass. Standard LC/MS conditions were as follows (running time 3 minutes): [0263] Acidic condition: A: 0.1% formic acid and 1% acetonitrile in H.sub.2O; B: 0.1% formic acid in acetonitrile; [0264] Basic condition: A: 0.05% NH.sub.3.H.sub.2O in H.sub.2O; B: acetonitrile.
[0265] Mass spectra (MS): generally only ions which indicate the parent mass are reported, and unless otherwise stated the mass ion quoted is the positive mass ion (M+H).sup.+.
[0266] NMR Spectra were obtained using Bruker Avance 400 MHz.
[0267] All reactions involving air-sensitive reagents were performed under an argon atmosphere. Reagents were used as received from commercial suppliers without further purification unless otherwise noted.
PREPARATIVE EXAMPLES
Preparation of Intermediate
Intermediate AA
N-methyl-N-propyl-carbamoyl chloride
[0268] ##STR00009##
[0269] To a mixture of N-methylpropan-1-amine (5 g, 68.4 mmol) and sodium hydrogencarbonate (11.5 g, 137 mmol) in DCM (70 mL) at 0 C. was added bis(trichloromethyl) carbonate (8.11 g, 27.3 mmol) in DCM (30 mL) dropwise. The mixture was stirred at room temperature for 2 hrs and filtered. The filtrate was concentrated in vacuo. The obtained N-methyl-N-propyl-carbamoyl chloride (7.2 g, Intermediate AA) was used for next step without further purification.
Intermediate AB
N-(2-Methoxyethyl)-N-methyl-carbamoyl chloride
[0270] ##STR00010##
[0271] Intermediate AB was prepared in analogy to Intermediate AA by using 2-methoxy-N-methyl-ethanamine instead of N-methylpropan-1-amine. N-(2-Methoxyethyl)-N-methyl-carbamoyl chloride (8 g, Intermediate AB) was obtained and used for next step without further purification.
Intermediate AC
N-Ethyl-N-propyl-carbamoyl chloride
[0272] ##STR00011##
[0273] Intermediate AC was prepared in analogy to Intermediate AA by using N-ethylpropan-1-amine instead of N-methylpropan-1-amine. N-Ethyl-N-propyl-carbamoyl chloride (12.6 g, Intermediate AC) was obtained as a yellow oil and used for next step without further purification.
Intermediate AD
N-Ethyl-N-(2-methoxyethyl)carbamoyl chloride
[0274] ##STR00012##
[0275] Intermediate AD was prepared in analogy to Intermediate AA by using N-ethyl-2-methoxyethanamine instead of N-methylpropan-1-amine. The crude N-ethyl-N-(2-methoxyethyl)carbamoyl chloride (2.5 g, Intermediate AD) was obtained as a light yellow oil and used for next step without further purification.
Intermediate AE
N-Butyl-N-ethyl-carbamoyl chloride
[0276] ##STR00013##
[0277] Intermediate AE was prepared in analogy to Intermediate AA by using N-ethylbutan-1-amine (5 g) instead of N-methylpropan-1-amine. The crude N-butyl-N-ethyl-carbamoyl chloride (6.3 g, Intermediate AE) was obtained as a light yellow oil and used for next step without further purification.
Intermediate AF
N-(2-Methoxyethyl)-N-propyl-carbamoyl chloride
[0278] ##STR00014##
[0279] Intermediate AF was prepared in analogy to Intermediate AA by using N-(2-methoxyethyl)propan-1-amine (2 g, 17.1 mmol) instead of N-methylpropan-1-amine. The crude N-(2-methoxyethyl)-N-propyl-carbamoyl chloride (2.5 g, Intermediate AF) was obtained as a light yellow oil and used for next step without further purification.
Intermediate AG
N,N-Bis(2-methoxyethyl)carbamoyl chloride
[0280] ##STR00015##
[0281] Intermediate AG was prepared in analogy to Intermediate AA by using of bis(2-methoxyethyl)amine (2 g, 15 mmol) instead of N-methylpropan-1-amine. The crude product N,N-bis(2-methoxyethyl)carbamoyl chloride (2.6 g, Intermediate AG) was obtained as a light yellow oil and used for next step without further purification.
Intermediate AH
Azetidine-1-carbonyl chloride
[0282] ##STR00016##
[0283] Intermediate AH was prepared in analogy to Intermediate AA by using azetidine hydrochloride (10.7 g, 107 mmol) and sodium bicarbonate (3 equiv.) instead of N-methylpropan-1-amine and sodium bicarbonate (2 equiv.). The crude azetidine-1-carbonyl chloride (1.5 g, Intermediate AH) was obtained as a light yellow oil and used for next step without further purification.
Intermediate AI
N-Isopropyl-N-methyl-carbamoyl chloride
[0284] ##STR00017##
[0285] Intermediate AI was prepared in analogy to Intermediate AA by using N-methylpropan-2-amine (5 g, 19.4 mmol) instead of N-methylpropan-1-amine. The crude N-isopropyl-N-methyl-carbamoyl chloride (8.6 g, Intermediate AI) was obtained as a yellow oil and used for next step without further purification.
Intermediate AL
N-Isobutyl-N-methyl-carbamoyl chloride
[0286] ##STR00018##
[0287] Intermediate AL was prepared in analogy to Intermediate AA by using N-2-dimethylpropan-1-amine (4.8 g) instead of N-methylpropan-1-amine. The crude N-isobutyl-N-methyl-carbamoyl chloride (8.1 g, Intermediate AL) was obtained as a light yellow oil and used for next step without further purification.
Intermediate AP
Ethyl 2-[chlorocarboyl(methyl)amino]acetate
[0288] ##STR00019##
[0289] To a solution of triphosgene (728 mg, 2.45 mmol) in DCM (5 mL) was added a solution of ethyl 2-(methylamino)acetate hydrochloride (1.3 g, 8.46 mmol) and pyridine (1 mL) in DCM (5 mL) dropwise at 0 C. The reaction mixture became orange and a yellow precipitate appeared, then it was allowed to warm to room temperature. After stirred for 1 hr, aqueous HCl (0.1N, 25 mL) was added to the reaction mixture, the organic layer was separated, washed with 0.1 N HCl (10 mL) twice, brine (10 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude ethyl 2-[chlorocarbonyl(methyl)amino]acetate (2.0 g, Intermediate AP) as a light yellow oil and used for next step without further purification.
Intermediate AR
tert-Butyl 3-[chlorocarboyl(methyl)amino]propanoate
[0290] ##STR00020##
Step 1: Preparation of tert-butyl 3-(methylamino)propanoate (Compound AR-1)
[0291] ##STR00021##
[0292] To a solution of tert-butyl acrylate (3 g) in DMF (40 mL) was added methylamine hydrochloride (4.74 g, 70 mmol) and DBU (21.4 g, 140 mmol) at 45 C. Then the reaction temperature was allowed to warm to 10 C. The reaction mixture was stirred at the same temperature for 2.5 hrs. Et.sub.2O (200 mL) was added and the resulting mixture was washed with brine (50 mL) four times. The separated organic layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo to afford tert-butyl 3-(methylamino)propanoate (3.5 g, Compound AR-1) as a light yellow oil.
Step 2: Preparation of tert-butyl 3-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AR)
[0293] ##STR00022##
[0294] Intermediate AR was prepared in analogy to Intermediate AP by using tert-butyl 3-(methylamino)propanoate (3.4 g, Compound AR-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude tert-butyl 3-[chlorocarbonyl(methyl)amino]propanoate (3.5 g, Intermediate AR) was obtained and used for next step without further purification.
Intermediate AS
Ethyl(2S)-2-[chlorocarbonyl(methyl)amino]propanoate
[0295] ##STR00023##
Step 1: Preparation of ethyl(2S)-2-(methylamino)propanoate hydrochloride (Compound AS-1)
[0296] ##STR00024##
[0297] To a solution of (2S)-2-(methylamino)propanoic acid (1 g, 9.70 mmol) in EtOH (10 mL) was added SOCl.sub.2 (1.50 g, 12.61 mmol) dropwise at 0 C. in 0.5 hr. The reaction mixture was stirred at 25 C. for 15.5 hrs, then diluted with EA (20 mL), washed with H.sub.2O (5 mL) and brine (5 mL). The organic layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo. Ethyl (2S)-2-(methylamino)propanoate hydrochloride (1.8 g, Compound AS-1) was obtained as a yellow oil and used for next step without further purification.
Step 2: Preparation of ethyl(2S)-2-(methylamino)propanoate (Compound AS-2)
[0298] ##STR00025##
[0299] A solution of ethyl (2S)-2-(methylamino)propanoate hydrochloride (1.8 g, Compound AS-1) in EA (10 mL) was adjusted to pH=8 with 10 wt. % aqueous NaHCO.sub.3. The reaction mixture was stirred at room temperature for 0.5 hr. The organic layer was washed with brine (5 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. Ethyl (2S)-2-(methylamino)propanoate (620 mg, Compound AS-2) was obtained as a yellow oil and used for the next step without further purification.
Step 3: Preparation of ethyl(2S)-2-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AS)
[0300] ##STR00026##
[0301] Intermediate AS was prepared in analogy to Intermediate AP by using ethyl (2S)-2-(methylamino)propanoate (260 mg, Compound AS-2) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude ethyl (2S)-2-[chlorocarbonyl(methyl)amino]propanoate (200 mg, Intermediate AS) was obtained as a yellow oil and used for the next step without further purification.
Intermediate AT
tert-Butyl(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
[0302] ##STR00027##
Step 1: Preparation of tert-butyl(2S)-4-methyl-2-(methylamino)pentanoate (Compound AT-1)
[0303] ##STR00028##
[0304] 2-Methylpropene (25 g, 446 mmol) was bubbled into DCM (50 mL) at 78 C. Then the 2-methylpropene solution was added to a solution of (S)-4-methyl-2-(methylamino)pentanoic acid hydrochloride (500 mg, 2.75 mmol) and H.sub.2SO.sub.4 (3.68 g, 2 mL, 37.5 mmol) in dioxane (20 mL) at 0 C. The reaction mixture was stirred at room temperature for 18 hrs in a sealed tube. The reaction solution was poured into an ice cold aqueous KOH solution (8.4 g in water (30 mL)) and the resulting mixture was extracted with DCM (50 mL) twice. The combined organic layer was washed with brine (30 mL) twice, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to afford the crude product tert-butyl (2S)-4-methyl-2-(methylamino)pentanoate (Compound AT-1) as a light yellow oil.
Step 2: Preparation of tert-butyl(2S)-2-[chlorocarboyl(methyl)amino]-4-methyl-pentanoate (Intermediate AT)
[0305] ##STR00029##
[0306] Intermediate AT was prepared in analogy to Intermediate AP by using tert-butyl (2S)-4-methyl-2-(methylamino)pentanoate (300 mg, Compound AT-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude tert-butyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (350 mg, Intermediate AT) was obtained as a light yellow oil and used for the next step without further purification.
Intermediate AU
Isopropyl(2S)-2-[chlorocarboyl(methyl)amino]-4-methyl-pentanoate
[0307] ##STR00030##
Step 1: Preparation of isopropyl(2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (Compound AU-1)
[0308] ##STR00031##
[0309] To a solution of (S)-4-methyl-2-(methylamino)pentanoic acid hydrochloride (0.5 g) in i-PrOH (7.8 g, 10 mL) was added thionyl chloride (655 mg, 402 L) dropwise at room temperature. The resulting mixture was stirred and refluxed for 16 hrs and then concentrated in vacuo. The residue was basified with saturated aqueous NaHCO.sub.3 (30 mL) and extracted with DCM (50 mL). The organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was salified with HCl/EtOAc (10 mL, 1 mmol/mL) and concentrated to afford isopropyl (2S)-4-methyl-2-(methyl amino)pentanoate hydrochloride (510 mg, Compound AU-I) as a white solid.
Step 2: Preparation of isopropyl(2S)-2-[chlorocarboyl(methyl)amino]-4-methyl-pentanoate (Intermediate AU)
[0310] ##STR00032##
[0311] Intermediate AU was prepared in analogy to Intermediate AP by using isopropyl (2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (500 mg, Compound AU-I) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude isopropyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (650 mg, Intermediate AU) was obtained as a light yellow oil and used for the next step without further purification.
Intermediate AV
Ethyl(2S)-2-[chlorocarboyl(methyl)amino]-3-methyl-butanoate
[0312] ##STR00033##
Step 1: Preparation of ethyl(2S)-3-methyl-2-(methylamino)butanoate hydrochloride (Compound AV-1)
[0313] ##STR00034##
[0314] To a solution of (2S)-3-methyl-2-(methylamino)butanoic acid (1.0 g, 7.6 mmol) in EtOH (10 mL) was added thionyl chloride (2.45 g, 21 mmol) dropwise at room temperature. The resulting mixture was stirred and refluxed for 16 hrs and then concentrated in vacuo. The residue was basified with saturated aqueous NaHCO.sub.3 (30 mL) and extracted with DCM (50 mL) twice. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was dissolved in HCl/EtOAc (10 mL, 1 M) and concentrated to afford ethyl (2S)-3-methyl-2-(methylamino)butanoate hydrochloride (1.9 g, Compound AV-1) as a white solid.
Step 2: Preparation of ethyl(2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate (Intermediate AV)
[0315] ##STR00035##
[0316] Intermediate AV was prepared in analogy to Intermediate AP by using ethyl (2S)-3-methyl-2-(methylamino)butanoate hydrochloride (500 mg, Compound AV-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate (600 mg, Intermediate AV) was obtained as a light yellow oil and used for the next step without further purification.
Intermediate AW
Ethyl(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
[0317] ##STR00036##
Step 1: Preparation of ethyl(2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (Compound AW-1)
[0318] ##STR00037##
[0319] To a solution of (2S)-4-methyl-2-(methylamino)pentanoic acid (1 g, 6.9 mmol) in EtOH (10 mL) was added thionyl chloride (1.07 g, 8.3 mmol) dropwise at room temperature. The resulting mixture was stirred at reflux for 16 hrs and then concentrated in vacuo. The residue was basified with saturated aqueous NaHCO.sub.3 (30 mL) and extracted with DCM (50 mL). The organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was salified with HCl/EtOAc (10 mL, 1 mmol/mL) and concentrated to give ethyl (2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (1.8 g, Compound AW-1) as a white solid.
Step 2: Preparation of ethyl(2S)-2-[chlorocarboyl(methyl)amino]-4-methyl-pentanoate (Intermediate AW)
[0320] ##STR00038##
[0321] Intermediate AW was prepared in analogy to Intermediate AP by using ethyl (2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (610 mg, AW-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (280 mg, Intermediate AW) was obtained as a light yellow oil and used for the next step without further purification.
Intermediate AX
Ethyl(2S)-2-[chlorocarboyl(methyl)amino]-3-phenyl-propanoate
[0322] ##STR00039##
[0323] Intermediate AX was prepared in analogy to Intermediate AP by using (S)-ethyl-2-(methylamino)-3-phenylpropanoate instead of ethyl 2-(methylamino)acetate hydrochloride. The crude ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (200 mg, Intermediate AX) was obtained as a light yellow oil and used for the next step without further purification
Intermediate AY
Isopropyl(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate
[0324] ##STR00040##
[0325] Intermediate AY was prepared in analogy to Intermediate AP by using isopropyl (2S)-2-(methylamino)-3-phenyl-propanoate (190 mg) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude isopropyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (220 mg, Intermediate AY) was obtained as light brown oil and used for the next step without further purification.
Intermediate AZ
(S)-tert-butyl 2-((chlorocarbonyl)(methyl)amino)-3-phenylpropanoate
[0326] ##STR00041##
Step 1: Preparation of tert-butyl(2S)-2-(methylamino)-3-phenyl-propanoate (Compound AZ-1)
[0327] ##STR00042##
[0328] 2-Methylpropene (25 g, 446 mmol) was bubbled into DCM (50 mL) at 78 C. Then the 2-methylpropene solution was added to a solution of (S)-2-(methylamino)-3-phenylpropanoic acid (500 mg) and H.sub.2SO.sub.4 (3.68 g, 2 mL) in dioxane (20 mL) at 0 C. The reaction mixture was stirred at room temperature for 18 hrs in a sealed tube. The reaction mixture was poured into an ice cold aqueous KOH solution (8.4 g in water (30 mL)) and the resulting mixture was extracted with DCM (50 mL) twice. The organic layer was washed with brine (30 mL) 2 times, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to afford tert-butyl (2S)-2-(methylamino)-3-phenyl-propanoate (710 mg, Compound AZ-1) as a light yellow oil.
Step 2: Preparation of (S)-tert-butyl 2-((chlorocarbonyl)(methyl)amino)-3-phenylpropanoate (Intermediate AZ)
[0329] ##STR00043##
[0330] Intermediate AZ was prepared in analogy to intermediate AP by using tert-butyl (2S)-2-(methylamino)-3-phenyl-propanoate (Compound AZ-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude tert-butyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (360 mg, Intermediate AZ) was obtained as a light yellow oil and used for next step without further purification
Intermediate BA
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride
[0331] ##STR00044##
Step 1: Preparation of tert-butyl N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamate (Compound BA-1)
[0332] ##STR00045##
[0333] To a solution of tert-butyl methyl(2-(methylamino)ethyl)carbamate (1.13 g, 6 mmol) in pyridine (10 mL) was added acetic anhydride (3.06 g, 30 mmol) dropwise at 0 C. Then the solution was stirred at room temperature for 0.5 hr. The solvent was removed in vacuo and the residue was partitioned between EtOAc (50 mL) and saturated aqueous NaHCO.sub.3 (25 mL). The organic layer was separated, washed with brine (20 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo to afford tert-butyl N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamate (1.28 g, Compound BA-1) as a yellow oil.
Step 2: Preparation of N-methyl-N-(2-(methylamino)ethyl)acetamide hydrochloride (Compound BA-2)
[0334] ##STR00046##
[0335] A mixture of tert-butyl N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamate (1.1 g, Compound BA-1) in HCl/EtOAc (10 mL, 1N HCl in EtOAc) was stirred at room temperature for 2 hrs, then the mixture was filtered. The collected solid was washed with EtOAc (5 mL) three times and dried in vacuo to afford the crude N-methyl-N-(2-(methylamino)ethyl)acetamide hydrochloride (460 mg, Compound BA-2) as a white solid.
Step 3: Preparation of N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride (Intermediate BA)
[0336] ##STR00047##
[0337] Intermediate BA was prepared in analogy to Intermediate AP by using N-methyl-N-(2-(methylamino)ethyl)acetamide hydrochloride (200 mg, Compound BA-2) instead of ethyl 2-(methylamino)acetate hydrochloride The crude N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride (300 mg, Intermediate BA) was obtained and used for next step without further purification.
Intermediate BB
Methyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
[0338] ##STR00048##
Step 1: Preparation of methyl N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BB-1)
[0339] ##STR00049##
[0340] To a solution of N,N-dimethylethane-1,2-diamine (10 g) in THF (40 mL) was added methyl chloroformate (1.92 g) dropwise at 70 C. in 1 hr. The mixture was stirred at 25 C. for 15 hrs and then filtered and washed with water and brine. The organic layer was dried and concentrated to afford a yellow residue, which was purified by column chromatography to afford methyl N-methyl-N-[2-(methylamino)ethyl]carbamate (2 g, Compound BB-1) as a colorless oil.
Step 2: Preparation of methyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (Intermediate BB)
[0341] ##STR00050##
[0342] Intermediate BB was prepared in analogy to Intermediate AP by using methyl N-methyl-N-[2-(methylamino)ethyl]carbamate (2.0 g, Compound BB-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude methyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (2.2 g, Intermediate BB) was obtained and used for next step without further purification.
Intermediate BC
tert-Butyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
[0343] ##STR00051##
Step 1: Preparation of tert-butyl N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BC-1)
[0344] ##STR00052##
[0345] To a solution of N,N-dimethylethane-1,2-diamine (40.4 g) in DCM (300 mL) was added a solution of Boc.sub.2O (10 g, 10.6 mL, 45.8 mmol) in DCM (100 mL) dropwise at 0 C. over 1 hr. The reaction mixture was stirred at room temperature for 18 hrs. The organic layer was washed with saturated aqueous NaHCO.sub.3 (50 mL), brine (50 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography to afford tert-butyl N-methyl-N-[2-(methylamino)ethyl]carbamate (6.8 g, Compound BC-1) as a yellow oil. .sup.1H NMR (400 MHz, CDCl.sub.3) ppm: 3.34 (br. s., 2H), 2.89 (s, 3H), 2.74 (t, J=6.7 Hz, 2H), 2.46 (s, 3H), 1.47 (s, 9H).
Step 2: Preparation of tert-butyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (Intermediate BC)
[0346] ##STR00053##
[0347] Intermediate BC was prepared in analogy to Intermediate AP by using tert-butyl N-methyl-N-[2-(methylamino)ethyl]carbamate (1.15 g, Compound BC-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude tert-butyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (1.3 g, Intermediate BC) was obtained and used for the next step without further purification.
Intermediate BD
Ethyl N-[2-[chlorocarboyl(methyl)amino]ethyl]-N-methyl-carbamate
[0348] ##STR00054##
Step 1: Preparation of ethyl N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BD-1)
[0349] ##STR00055##
[0350] To a solution of N,N-dimethylethane-1,2-diamine (10 g) in DCM (40 mL) was added ethyl chloroformate (2.58 g) dropwise at 70 C. in 1 hr. The reaction mixture was stirred at 25 C. for 15 hrs and then filtered and washed with water and brine. The organic layer was dried and concentrated in vacuo. The yellow residue was purified by column chromatography to afford ethyl N-methyl-N-[2-(methylamino)ethyl]carbamate (2 g, Compound BD-1) as a colorless oil.
Step 2: Preparation of ethyl N-[2-[chlorocarboyl(methyl)amino]ethyl]-N-methyl-carbamate (Intermediate BD)
[0351] ##STR00056##
[0352] Intermediate BD was prepared in analogy to Intermediate AA by using ethyl N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BD-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude ethyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (2.2 g, Intermediate BD) was obtained and used for the next step without further purification.
Intermediate BE
2-[Chlorocarboyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate
[0353] ##STR00057##
Step 1: Preparation of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BE-1)
[0354] ##STR00058##
[0355] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol) in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at 25 C. The mixture was stirred at 25 C. for 16 hrs and then concentrated. The residue was purified by column chromatography to afford tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BE-1) as a colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate (Compound BE-2)
[0356] ##STR00059##
[0357] To a solution of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (880 mg, Compound BE-1) and Et.sub.3N (1 g, 10.08 mmol) in DCM (10 mL) was added N-butyl-N-methyl-carbamoyl chloride (903 mg, 7.04 mmol) dropwise at 10 C. in 1 hr. The reaction mixture was stirred at 25 C. for 15 hrs and then filtered and washed with water and brine. The organic layer was dried and concentrated to afford 2-[tert-butoxycarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate (2 g, Compound BE-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl N-butyl-N-methyl-carbamate hydrochloride (Compound BE-3)
[0358] ##STR00060##
[0359] To a solution of 2-[tert-butoxycarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate (1 g, Compound BE-2) was added HCl/EA (40 mL, 1M). The reaction mixture was stirred at 0 C. for 0.5 hr and warmed to 25 C. and stirred for another 15.5 hrs. The reaction mixture was concentrated to afford 2-(methylamino)ethyl-N-butyl-N-methyl-carbamate hydrochloride (400 mg, Compound BE-3) as a colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate (Intermediate BE)
[0360] ##STR00061##
[0361] Intermediate BE was prepared in analogy to Intermediate AP by using 2-(methylamino)ethyl N-butyl-N-methyl-carbamate hydrochloride (374 mg, Compound BE-3) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude 2-[chlorocarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate (330 mg, Intermediate BE) was obtained and used for next step without further purification.
Intermediate BF
2-[Chlorocarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate
[0362] ##STR00062##
Step 1: Preparation of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BF-1)
[0363] ##STR00063##
[0364] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol) in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at 25 C. The mixture was stirred at 25 C. for 16 hrs. The reaction mixture was concentrated to give the residue, which was purified by column chromatography to afford tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BF-1) as a colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (Compound BF-2)
[0365] ##STR00064##
[0366] To a solution of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (300 mg, 1.71 mmol, Compound BF-1) and Et.sub.3N (578 mg, 5.71 mmol) in DCM (5 mL) was added pyrrolidine-1-carbonyl chloride (458 mg, 3.4 mmol) dropwise at 0 C. for 0.5 hr and then stirred at 25 C. for 15.5 hrs. After filtration, the filtrate was washed with water and brine. The organic layer was dried and concentrated to afford the 2-[tert-butoxycarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (335 mg, Compound BF-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl pyrrolidine-1-carboxylate hydrochloride (Compound BF-3)
[0367] ##STR00065##
[0368] 2-[tert-butoxycarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (335 mg, Compound BF-2) was added to HCl in EA (12.3 mL, 1M) and the mixture was stirred at 0 C. for 0.5 hr and then at 25 C. for another 15.5 hrs. The reaction mixture was concentrated to afford 2-(methylamino)ethyl pyrrolidine-1-carboxylate hydrochloride (300 mg, Compound BF-3) as a colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (Intermediate BF)
[0369] ##STR00066##
[0370] Intermediate BF was prepared in analogy to Intermediate AP by using the 2-(methylamino)ethyl pyrrolidine-1-carboxylate hydrochloride (299 mg, Compound BF-3) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude 2-[chlorocarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (230 mg, Intermediate BF) was obtained and used for next step without further purification.
Intermediate BG
2-[Chlorocarbonyl(methyl)amino]ethyl N-methyl-N-propyl-carbamate
[0371] ##STR00067##
Step 1: Preparation of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BG-1)
[0372] ##STR00068##
[0373] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol) in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at 25 C. The reaction mixture was stirred at 25 C. for 16 hrs, then concentrated to give the residue, which was purified by column chromatography to afford tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BG-1) as a colorless oil.
Step 2: Preparation of tert-butyl-N-methyl-N-[2-[methyl(propyl)carbamoyl]oxyethyl]carbamate (Compound BG-2)
[0374] ##STR00069##
[0375] To a solution of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (265 mg, Compound BG-1) and Et.sub.3N (1 mL, 5.71 mmol) in DCM (5 mL) was added N-methyl-N-propyl-carbamoyl chloride (410 mg, 1.83 mmol) dropwise at 0 C. for 0.5 hr. The reaction mixture was stirred at 25 C. for 15.5 hrs and then filtered and the filtrate was washed with water and brine. The organic layer was dried and concentrated to afford tert-butyl N-methyl-N-[2-[methyl(propyl)carbamoyl]oxyethyl]carbamate (380 mg, Compound BG-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl N-methyl-N-propyl-carbamate hydrochloride (Compound BG-3)
[0376] ##STR00070##
[0377] tert-butyl N-methyl-N-[2-[methyl(propyl)carbamoyl]oxyethyl]carbamate (380 mg, Compound BG-2) was added to HCl in EA (13.7 mL, 1M). The mixture was stirred at 0 C. for 0.5 hr. Then the mixture was stirred at 25 C. for another 15.5 hrs and concentrated to afford 2-(methylamino)ethyl N-methyl-N-propyl-carbamate hydrochloride (300 mg, Compound BG-3) as a colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl N-methyl-N-propyl-carbamate (Intermediate BG)
[0378] ##STR00071##
[0379] Intermediate BG was prepared in analogy to Intermediate AP by using 2-(methylamino)ethyl N-methyl-N-propyl-carbamate hydrochloride (330 mg, Compound BG-3) instead of ethyl 2-(methylamino)acetate hydrochloride. The 2-[chlorocarbonyl(methyl)amino]ethyl-N-methyl-N-propyl-carbamate (300 mg, Intermediate BG) was obtained and used for next step without further purification.
Intermediate BH
2-[Chlorocarboyl(methyl)amino]ethyl N,N-diethylcarbamate
[0380] ##STR00072##
Step 1: Preparation of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BH-1)
[0381] ##STR00073##
[0382] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol) in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at 25 C. The mixture was stirred at 25 C. for 16 hrs and then concentrated, the residue was purified by column chromatography to afford tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BH-1) as a colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl-N,N-diethylcarbamate (Compound BH-2)
[0383] ##STR00074##
[0384] To a solution of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (200 mg, 1.14 mmol, Compound BH-1) and Et.sub.3N (578 mg, 5.71 mmol) in DCM (5 mL) was added N,N-diethylcarbamoyl chloride (248 mg, 1.83 mmol) dropwise at 0 C. for 0.5 hr and stirred at 25 C. for 15.5 hrs. After filtration, the filtrate was washed with water and brine. The organic layer was dried and concentrated to afford the 2-[tert-butoxycarbonyl(methyl)amino]ethyl N,N-diethylcarbamate (313 mg, Compound BH-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl N,N-diethylcarbamate hydrochloride (Compound BH-3)
[0385] ##STR00075##
[0386] 2-[tert-butoxycarbonyl(methyl)amino]ethyl N,N-diethylcarbamate (436 mg, 1.77 mmol, Compound BH-2) was added to HCl in EA (17 mL, 1M). The mixture was stirred at 0 C. for 0.5 hr. Then the mixture was stirred at 25 C. for another 15.5 hrs and concentrated to afford 2-(methylamino)ethyl N,N-diethylcarbamate hydrochloride (230 mg, Compound BH-3) as a colorless oil.
Step 4: Preparation of 2-[chlorocarboyl(methyl)amino]ethyl N,N-diethylcarbamate (Intermediate BH)
[0387] ##STR00076##
[0388] Intermediate BH was prepared in analogy to Intermediate AP by using 2-(methylamino)ethyl N,N-diethylcarbamate hydrochloride (274 mg, Compound BH-3) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude 2-[chlorocarbonyl(methyl)amino]ethyl N,N-diethylcarbamate (250 mg, Intermediate BH) was obtained and used for next step without further purification.
Intermediate BI
2-[Chlorocarboyl(methyl)amino]ethyl ethyl carbonate
[0389] ##STR00077##
Step 1: Preparation of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BI-1)
[0390] ##STR00078##
[0391] To a solution of 2-(methylamino)ethanol (1 g, 13.31 mmol) in DCM (10 mL) was added Boc.sub.2O (3.49 g, 15.98 mmol) at 25 C. The reaction mixture was stirred at 25 C. for 16 hrs, then concentrated to give the crude product, which was purified by column chromatography to afford tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (1.6 g, Compound BI-1) as a colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl methyl carbonate (Compound BI-2)
[0392] ##STR00079##
[0393] To a solution of tert-butyl N-(2-hydroxyethyl)-N-methyl-carbamate (1 g, Compound BI-1), DMAP (0.1 g) and pyridine (1.15 g, 11.41 mmol) in EA (20 mL) was added methyl chloroformate (1.21 g, 11.15 mmol) dropwise at 10 C. The mixture was stirred at 10 C. for 1 hr. The reaction mixture was filtered and the filtrate was washed with 5% citric acid and brine. The organic layer was dried and concentrated to afford 2-[tert-butoxycarbonyl(methyl)amino]ethyl methyl carbonate (1.22 g, Compound BI-2) as a colorless oil.
Step 3: Preparation of ethyl 2-(methylamino)ethyl carbonate hydrochloride (Compound BI-3)
[0394] ##STR00080##
[0395] 2-[tert-butoxycarbonyl(methyl)amino]ethyl methyl carbonate (1.22 g, 4.94 mmol, Compound BI-2) was added to HCl in EA (10 mL, 40 mmol) and the mixture was stirred at 0 C. for 0.5 hr and at 25 C. for another 15.5 hrs. The reaction mixture was concentrated to afford ethyl 2-(methylamino)ethyl carbonate hydrochloride (1.06 g, Compound BI-3).
Step 4: Preparation of 2-[chlorocarboyl(methyl)amino]ethyl ethyl carbonate (Intermediate BI)
[0396] ##STR00081##
[0397] Intermediate BI was prepared in analogy to Intermediate AP by using ethyl 2-(methylamino)ethyl carbonate hydrochloride (150 mg, Intermediate BI-3) instead of ethyl 2-(methylamino)acetate hydrochloride. The crude 2-[chlorocarbonyl(methyl)amino]ethyl ethyl carbonate (145 mg, Intermediate BI) was obtained and used for next step without further purification.
PREPARATIVE EXAMPLES
Example 1
6-Amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide
[0398] ##STR00082##
Method A:
Step 1: Preparation of 4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (Compound 1a)
[0399] ##STR00083##
[0400] To a solution of aminomalononitrilep-toluenesulfonate (25 g, 98.5 mmol, TCI, Catalog number: A1119-25G) in dry THF (100 mL) was added benzyl isocyanate (13.2 g, 98.5 mmol) and TEA (10.2 g, 79.0 mmol) at RT. After stirred at RT for 24 hrs, the reaction was concentrated in vacuo and the residue was partitioned between EtOAc (500 mL) and water (250 mL). The separated organic layer was washed with brine (50 mL) twice, and extracted with sodium hydroxide solution (50 mL, 1N) twice. The combined sodium hydroxide solution layer was neutralized with 10 wt. % sodium hydrogen sulfate solution and extracted with EtOAc. The separated organic layer was washed with brine, dried over Na.sub.2SO.sub.4, filtered and concentrated in vacuo. The residue was triturated in 2-isopropoxypropane and then the suspension was filtered to give 4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (15 g, Compound 1a) as a yellow solid. The product was used for the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 215.
Step 2: Preparation of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b)
[0401] ##STR00084##
[0402] To a solution of 4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (15.0 g, 70.0 mmol, Compound 1a) in THF (700 mL) was added benzoylisothiocyanate (28.6 g, 175.1 mmol, TCI, Catalog number: A11596-100G) dropwise. After stirred at RT for 12 hrs, the reaction mixture was concentrated in vacuo. The residue was triturated in diethyl ether (100 mL) and the resulting precipitate was collected by filtration.
[0403] To a solution of the obtained precipitate in THF (700 mL) was added sodium hydroxide (70 mL, 2 N). The mixture was refluxed for 50 hrs, and then acidified to pH=3 with 10 wt. % aqueous sodium hydrogen sulfate solution. The resulting precipitate was collected by filtration to give a crude 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (8.1 g, Compound 1b) as a yellow solid. The product was used for the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 274.
Step 3: Preparation of 6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (Compound 1c)
[0404] ##STR00085##
[0405] To a solution of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (5.46 g, 20.0 mmol, Compound 1b) in DMF was added potassium carbonate (2.76 g, 20.0 mmol). And then 1-bromopropane (2.44 g, 20.0 mmol, TCI, Catalog number: B0638-500G) in DMF (5.0 mL) was slowly added to previous solution. After stirred at RT for 12 hrs, the reaction mixture was poured into water (200 mL), then acidified with 10 wt. % aqueous sodium hydrogen sulfate solution and extracted with EtOAc (100 mL) twice. The organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude product, which was purified by flash chromatography on silica gel to give 6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (4.8 g, Compound 1c) as a white solid. MS obsd. (ESI.sup.) [(M+H).sup.+]: 316.
Step 4: Preparation of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d)
[0406] ##STR00086##
[0407] To a suspension of compound 6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (2.7 g, 8.7 mmol, Compound 1c) in DCM/MeOH (500 mL, V/V=1:1) was added 3-chloroperbenzoic acid (2.15 g, 8.7 mmol, 70% purity, Aldrich, Catalog number: 273031-100G). After reaction mixture was stirred for 2 hrs, the volume of reaction mixture was reduced in vacuo to about 50 mL. The resulting precipitate was collected by filtration, washed with methanol and dried to give 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (1.0 g, Compound 1d) as a white solid. The product was used for the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 332.
Step 5: Preparation of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e)
[0408] ##STR00087##
[0409] To a solution of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (1.52 g, 4.6 mmol, Compound 1d) in Eaton's reagent (40 mL, phosphorus pentoxide, 7.5 wt. % in methanesulphonic acid, Aldrich, Catalog number: 380814-100ML) was added sodium azide (360 mg, 5.5 mmol) at 50 C. After being stirred at this temperature for 30 minutes, the reaction mixture was cooled to RT and poured into sat. aqueous sodium bicarbonate solution. The reaction mixture was extracted with n-BuOH (100 mL) twice, and the organic phase was concentrated in vacuo. The residue was submitted for purification by prep-HPLC to give 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (1.2 g, Compound 1e) as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.65 (br. s., 1H), 7.26-7.37 (m, 5H), 6.98 (br. s., 2H), 4.97 (s, 2H), 4.02 (s, 1H), 3.33 (t, J=7.53 Hz, 2H), 1.55-1.74 (m, 2H), 0.92 (t, J=7.53 Hz, 3H). MS obsd. (ESI.sup.+) [(M.sup.+H).sup.+]: 347.
[0410] Separation of compound 1e by chiral HPLC afforded Compound 1e-A (slower eluting, 500 mg) and Compound 1e-B (faster eluting, 490 mg) as white solid. (Separation condition: methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AS-3 column.)
[0411] Compound 1e-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz) ppm: 10.56 (s, 1H), 7.21-7.46 (m, 5H), 7.03 (s, 2H), 4.96 (s, 2H), 4.04 (s, 1H), 3.25-3.33 (m, 2H), 1.59-1.67 (m, 2H), 0.92 (t, J=7.4 Hz, 3H).
[0412] Compound 1e-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz) ppm: 10.57 (s, 1H), 7.23-7.39 (m, 5H), 6.97 (s, 2H), 4.96 (s, 2H), 4.05 (s, 1H), 3.31-3.30 (m, 2H), 1.49-1.74 (m, 2H), 0.91 (t, J=7.4 Hz, 3H).
Step 6: Preparation of 6-amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide (Example 1)
[0413] ##STR00088##
[0414] To a solution of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (300 mg, Compound 1e), pyridine (329 mg, 4.2 mmol) and DIPEA (538 mg, 4.2 mmol) in NMP (5 mL) was added N-methyl-N-propyl-carbamoyl chloride (564 mg, 4.2 mmol, Intermediate AA) at RT. The mixture was stirred at RT for 10 hrs. The reaction mixture was concentrated and the residue was purified by prep-HPLC to give 6-amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide (108 mg, Example 1) as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.45-7.24 (m, 5H), 6.89 (s, 2H), 5.01 (s, 2H), 4.17 (s, 1H), 3.44-3.34 (m, 2H), 3.36-3.34 (m, 2H), 3.10-3.00 (m, 3H), 1.74-1.52 (m, 4H), 1.01-0.72 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.
[0415] Separation of compound of Example 1 by chiral HPLC afforded Example 1-A (slower eluting, 50 mg) and Example 1-B (faster eluting, 40 mg) as white solid with isopropanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0416] Example 1-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.44-7.24 (m, 5H), 6.89 (s, 2H), 5.01 (s, 2H), 4.17 (s, 1H), 3.44-3.37 (m, 2H), 3.37-3.35 (m, 2H), 3.10-3.00 (m, 3H), 1.74-1.52 (m, 4H), 1.00-0.72 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.
[0417] Example 1-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.45-7.26 (m, 5H), 6.88 (s, 2H), 5.01 (s, 2H), 4.15 (s, 1H), 3.44-3.36 (m, 2H), 3.34 (s, 2H), 3.10-3.01 (m, 3H), 1.77-1.52 (m, 4H), 1.02-0.67 (m, 6H). MS obsd. (ESI.sup.) [(M+H).sup.+]: 446.
Method B: Alternative method to prepare 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e)
[0418] ##STR00089##
Step 1: Preparation of N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine (Compound 1f)
[0419] ##STR00090##
[0420] To a solution of 4,6-dichloro-5-nitro-2-propylsulfanylpyrimidine (150.0 g, 559.5 mmol) and DIPEA (108.5 g, 839.2 mmol) in THF(1.5 L) was added phenylmethanamine (60.0 g, 559.5 mmol) in THF(200 mL) slowly at 78 C. After addition, the mixture was warmed to 25 C., and stirred at this temperature for 16 hrs. The resulting mixture was diluted with EA (1 L), washed with water (400 mL) three times and brine (500 mL). The separated organic phase was dried over Na.sub.2SO.sub.4, filtered and concentrated in vacuo to give N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine (180.0 g, Compound 1f) as a yellow solid and used for next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 339.1.
Step 2: Preparation of N4-benzyl-6-chloro-2-propylsulfanyl-pyrimidine-4,5-diamine (Compound 1g)
[0421] ##STR00091##
[0422] To a solution of N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine (180 g, Compound 1f) and HOAc (319 g, 5.31 mol) in THF(3.0 L) was added Zn (174 g, 2.66 mol) slowly at 25 C. After the addition, the mixture was stirred at 25 C. for 16 hrs. The reaction was filtered and the filtrate was basified with saturated aq. NaHCO.sub.3 (800 mL), extracted with EA (400 mL) three times, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel chromatography to give N4-benzyl-6-chloro-2-propylsulfanyl-pyrimidine-4,5-diamine (125 g, Compound 1g) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 309.1.
Step 3: Preparation of 9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (Compound 1h)
[0423] ##STR00092##
[0424] To a solution of N-benzyl-6-chloro-2-(propylsulfanyl)pyrimidine-4,5-diamine (72.0 g, 233.1 mmol, Compound 1g) and CDI (75.2 g, 233.1 mmol) in THF(800mL) was stirred at 80 C. for 16 hrs. The resulting mixture was diluted with EA (400 mL), washed with water (200 mL) twice and brine (200 mL). The separated organic layer was dried over Na.sub.2SO.sub.4, concentrated in vacuo. The residue was washed with MTBE (200 mL) to give 9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (58.0 g, Compound 1h) as a white solid and was used in next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 335.1.
Step 4: Preparation of 9-benzyl-6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-7H-purin-8-one (Compound 1i)
[0425] ##STR00093##
[0426] A solution of 9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (58.0 g, Compound 1h) and PMBNH.sub.2 (54.7 g, 398.42 mmol) in n-BuOH (600 mL) was stirred at 120 C. for 20 hrs. The reaction was concentrated and the residue was washed with MTBE (400 mL) to give 9-benzyl-6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-7H-purin-8-one (75 g, Compound 1i) as a white solid and was used in next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.2.
Step 5: Preparation of 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c)
[0427] ##STR00094##
[0428] 9-Benzyl-6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-7H-purin-8-one (87.0 g, Compound 1i) in TFA (200 mL) was stirred at 80 C. for 16 hrs. The resulting reaction mixture was concentrated, basified with saturated aq. NaHCO.sub.3 (600 mL). The resulting precipitate was collected by filtration and washed with (PE/DCM=2:1, 400 mL) to give 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (38.0 g, Compound 1c) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 316.1.
Step 6: Preparation of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d)
[0429] ##STR00095##
[0430] To a solution of m-CPBA(22.98 g, 113.2 mmol) in THF (50 mL) was added dropwise to a suspension of 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (35.0 g, compound 1c) in THF (200 mL) at 0 C. After the addition, the reaction mixture was stirred at 25 C. for 0.5 hr. The mixture was filtered and washed with MeCN (400 mL), MTBE (500 mL) to give 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (35.1 g, Compound 1d) as a white solid, which was used for the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 332.1.
Step 7: Preparation of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e)
[0431] ##STR00096##
[0432] To a solution of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (34.0 g, Compound 1d) in Eaton's reagent (170.0 mL, 7.5 wt. % in methanesulphonic acid) was added NaN.sub.3 (15.34 g, 253.97 mmol) at 60 C. slowly. Then the mixture was stirred at 60 C. for 30 mins. The resulting reaction mixture was cooled to 25 C., poured into ice cold NH.sub.3.H.sub.2O (500 mL, 1 mol/L), extracted with n-BuOH (100 mL) four times and concentrated in vacuo. The residue was purified by prep-HPLC to give 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (10 g, Compound 1e). .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.65 (br. s., 1H), 7.26-7.37 (m, 5H), 6.98 (br. s., 2H), 4.97 (s, 2H), 4.02 (s, 1H), 3.33 (t, J=7.53 Hz, 2H), 1.55-1.74 (m, 2H), 0.92 (t, J=7.53 Hz, 3H). MS obsd. (ESI.sup.+) [(M.sup.+H).sup.]: 347.
Example 2
6-Amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0433] ##STR00097##
[0434] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-(2-methoxyethyl)-N-methyl-carbamoyl chloride (Intermediate AB) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propyl sulfonimidoyl)purine-7-carboxamide (120 mg, Example 2) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.39 (m, 5H), 6.89 (br. s., 1H), 6.78 (br. s., 1H), 5.00 (s, 2H), 4.16 (br. d, J=4 Hz, 1H), 3.62 (br. dd, J=4, 12 Hz, 2H), 3.28-3.42 (m, 6H), 3.12 (d, J=12 Hz, 3H), 3.05 (s, 1H), 1.58-1.72 (m, 2H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 462.
[0435] Separation of compound of Example 2 by chiral HPLC afforded Example 2-A (faster eluting, 33 mg) and Example 2-B (slower eluting, 46 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak OJ-3 column.
[0436] Example 2-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.39 (m, 5H), 6.89 (br. s., 1H), 6.78 (br. s., 1H), 5.00 (s, 2H), 4.16 (br. d, J=4 Hz, 1H), 3.62 (br. dd, J=4, 12 Hz, 2H), 3.28-3.42 (m, 6H), 3.12 (d, J=12 Hz, 3H), 3.05 (s, 1H), 1.58-1.72 (m, 2H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 462.
[0437] Example 2-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.39 (m, 5H), 6.89 (br. s., 1H), 6.78 (br. s., 1H), 5.00 (s, 2H), 4.16 (br. d, J=4 Hz, 1H), 3.62 (br. dd, J=4, 12 Hz, 2H), 3.28-3.42 (m, 6H), 3.12 (d, J=12 Hz, 3H), 3.05 (s, 1H), 1.58-1.72 (m, 2H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 462.
Example 3
6-Amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide
[0438] ##STR00098##
[0439] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-ethyl-N-propyl-carbamoyl chloride (Intermediate AC) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide (51 mg, Example 3) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.39 (m, 5H), 6.85 (br. s., 2H), 4.99 (s, 2H), 4.20 (br. d, J=8.0 Hz, 1H), 3.13-3.54 (m, 4H), 1.46-1.72 (m, 4H), 1.30-1.39 (m, 1H), 1.00-1.26 (m, 6H), 0.81-0.95 (m, 5H), 0.73 (t, J=8 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 474.
Example 4
6-Amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfonimidoyl)purin-8-one
[0440] ##STR00099##
[0441] The title compound was prepared in analogy to Example 1, Method A , Step 6 by using (1,4-bipiperidine)-1-carbonyl chloride instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfonimidoyl)purin-8-one (55 mg, Example 4) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.39-7.27 (m, 5H), 6.97 (br. s., 2H), 4.99 (s, 2H), 4.20 (br. s., 2H), 3.85 (d, J=12.5 Hz, 1H), 3.43-3.15 (m, 3H), 2.96 (t, J=12.3 Hz, 2H), 2.56 (m, 4H), 1.83 (m, 1H), 1.79-1.54 (m, 4H), 1.50 (br. s., 4H), 1.45-1.33 (m, 3H), 0.93 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 541.2.
Example 5
6-Amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0442] ##STR00100##
[0443] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-ethyl-N-(2-methoxyethyl)carbamoyl chloride (Intermediate AD) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (34 mg, Example 5) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.39-7.28 (m, 5H), 6.89 (br. s., 1H), 6.74 (br. s., 1H), 4.99 (s, 2H), 4.17 (d, J=8.1 Hz, 1H), 3.67 (br. s., 2H), 3.63-3.51 (m, 2H), 3.50-3.34 (m, 4H), 3.29 (s, 1H), 3.11 (s, 2H), 1.73-1.59 (m, 2H), 1.23-1.07 (m, 3H), 0.93 (t, J=7.5 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 476.3.
Example 6
6-Amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0444] ##STR00101##
[0445] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-butyl-N-ethyl-carbamoyl chloride (Intermediate AE) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (51 mg, Example 6) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.39 (m, 5H), 6.85 (br. s., 2H), 4.99 (s, 2H), 4.20 (br. d, J=8.0 Hz, 1H), 3.13-3.54 (m, 4H), 1.46-1.72 (m, 4H), 1.30-1.39 (m, 1H), 1.00-1.26 (m, 6H), 0.81-0.95 (m, 5H), 0.73 (t, J=8 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 474.
Example 7
6-Amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide
[0446] ##STR00102##
[0447] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-ethyl-N-(2-methoxyethyl)carbamoyl chloride (Intermediate AF) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-carboxamide (35 mg, Example 7) was obtained as a white powder. .sup.1HNMR (400 MHz, DMSO-d.sub.6) ppm: 7.40-7.28 (m, 5H), 6.89 (br. s., 1H), 6.75 (br. s., 1H), 5.00 (d, J=5.5 Hz, 2H), 4.24-4.16 (m, 1H), 3.77 (br. s., 1H), 3.67 (br. s., 1H), 3.62-3.53 (m, 1H), 3.42-3.27 (m, 5H), 3.23-3.02 (m, 3H), 1.66-1.38 (m, 4H), 0.96-0.70 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 490.5.
Example 8
6-Amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0448] ##STR00103##
[0449] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using bis(2-methoxyethyl)carbamic chloride (Intermediate AG) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (35 mg, Example 8) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.40-7.28 (m, 5H), 6.83 (br. s., 2H), 4.99 (s, 2H), 3.71 (br. s., 3H), 3.52-3.27 (m, 11H), 3.09 (s, 3H), 1.73-1.59 (m, 2H), 0.93 (t, J=7.5 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 506.
Example 9
6-Amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8-one
[0450] ##STR00104##
[0451] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using azetidine-1-carbonyl chloride (Intermediate AH) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8-one (120 mg, Example 9) was obtained as a white powder. .sup.1HNMR (400 MHz, DMSO-d.sub.6) ppm: 7.02-7.43 (m, 7H), 4.99 (s, 2H), 4.31 (t, J=7.65 Hz, 2H), 4.08-4.23 (m, 3H), 3.34-3.41 (m, 2H), 2.28 (m, 2H), 1.56-1.73 (m, 2H), 0.93 (t, J=7.40 Hz, 3H). MS obsd. (ESI.sup.) [(M+H).sup.+]: 430.
Example 10
6-Amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0452] ##STR00105##
[0453] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-isopropyl-N-methyl-carbamoyl chloride (Intermediate AI) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (97 mg, Example 10) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.39 (m, 5H), 6.87 (br. s., 2H), 4.99 (s, 2H), 4.38-4.45 (m, 1H), 4.09-4.21 (m, 1H), 3.29-3.43 (m, 2H), 2.89-2.95 (m, 3H), 1.58-1.73 (m, 2H), 1.21 (br d, J=8 Hz, 6H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.
Example 11
6-Amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one
[0454] ##STR00106##
[0455] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 4-methylpiperazine-1-carbonyl chloride instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-one (59.5 mg, Example 11) was obtained as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.39-7.31 (m, 5H), 6.99 (s, 2H), 4.98 (s, 2H), 4.18 (s, 1H), 3.58-3.49 (m, 6H), 2.42 (m, 4H), 2.22 (s, 3H), 1.66-1.61 (m, 2H), 0.95-0.91 (t, J=7.2 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 473.
Example 12
6-Amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0456] ##STR00107##
[0457] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-(3-methoxypropyl)-N-methyl-carbamoyl chloride instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (92.2 mg, Example 12) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.23-7.45 (m, 5H), 6.94 (s., 2H), 4.93-5.08 (m, 2H), 4.19 (s, 1H), 3.30-3.62 (m, 6H), 3.25 (s, 3H), 3.02-3.10 (m, 3H), 1.74-1.90 (m, 2H), 1.55-1.77 (m, 2H), 0.98-0.82 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 476.3.
Example 13
6-Amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0458] ##STR00108##
[0459] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-isobutyl-N-methyl-carbamoyl chloride (Intermediate AL) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (64 mg, Example 13) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27-7.40 (m, 5H), 6.89 (br. s., 2H), 5.00 (s, 2H), 4.16 (br. s., 1H), 3.25-3.44 (m, 4H), 3.07 (s, 2H), 3.03 (s, 1H), 1.87-2.09 (m, 1H), 1.57-1.74 (m, 2H), 0.75-0.99 (m, 9H). MS obsd. (ESI.sup.) [(M+H).sup.+]: 460.
Example 14
Ethyl 2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]acetate
[0460] ##STR00109##
[0461] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl 2-((chlorocarbonyl)(methyl)amino)acetate (Intermediate AP) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl 2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]acetate (38 mg, Example 14) was obtained as a light yellow powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.41-7.27 (m, 5H), 6.82 (br. s., 1H), 5.04-4.95 (m, 2H), 4.35 (br. s., 1H), 4.28 (br. s., 1H), 4.23-4.16 (m, 2H), 4.08 (q, J=7.2 Hz, 1H), 3.43-3.28 (m, 3H), 3.15 (s, 2H), 3.08 (s, 1H), 1.71-1.58 (m, 2H), 1.24 (t, J=7.0 Hz, 2H), 1.12 (t, J=7.0 Hz, 1H), 0.93 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 490.
Example 15
Ethyl 3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate
[0462] ##STR00110##
[0463] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl 3-((chlorocarbonyl)(methyl)amino)propanoate instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl 3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate (35 mg, Example 15) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.26 (m, 5H), 6.93 (br. s., 2H), 4.99 (s, 2H), 4.16 (s, 1H), 4.08 (q, J=7.1 Hz, 1H), 3.99 (d, J=7.0 Hz, 1H), 3.67 (br. s., 2H), 3.40-3.29 (m, 2H), 3.08 (s, 2H), 2.99 (s, 1H), 2.71 (t, J=6.4 Hz, 2H), 1.74-1.56 (m, 2H), 1.27-1.05 (m, 3H), 0.93 (t, J=7.5 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 504.
Example 16
tert-Butyl 3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate
[0464] ##STR00111##
[0465] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using tert-butyl 3-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AR) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). tert-Butyl 3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate (60 mg, Example 16) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.41-7.27 (m, 5H), 6.93 (br. s., 2H), 4.99 (s, 2H), 4.15 (s, 1H), 3.64 (br. s., 2H), 3.51-3.33 (m, 2H), 3.08 (s, 2H), 2.98 (s, 1H), 2.62 (t, J=6.9 Hz, 2H), 1.71-1.57 (m, 2H), 1.41 (s, 6H), 1.34 (s, 3H), 0.93 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 532.
Example 17
Ethyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate
[0466] ##STR00112##
[0467] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl (2S)-2-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AS) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]propanoate (34.1 mg, Example 17) was obtained as a yellow solid. .sup.1H NMR (300 MHz, DMSO-d.sub.6) ppm: 7.22-7.49 (m, 5 H), 6.78 (br. s., 2H), 4.93-5.08 (m, 2H), 4.75 (br. s., 1H), 3.96-4.29 (m, 3H), 3.30-3.46 (m, 2H), 3.09 (s, 2H), 2.93 (br. s., 1H), 1.55-1.77 (m, 2H), 1.48 (d, J=7.16 Hz, 3H), 1.09-1.29 (m, 3H), 0.94 (t, J=7.44 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 504.2.
Example 18
tert-Butyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate
[0468] ##STR00113##
[0469] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using tert-butyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (Intermediate AT) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). tert-Butyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate (22 mg, Example 18) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.42-7.27 (m, 5H), 6.78 (br. s., 2H), 5.05-4.96 (m, 2H), 4.78 (br. s., 1H), 4.33 (br. s., 1H), 3.51-3.37 (m, 2H), 3.01 (s, 3H), 1.75-1.54 (m, 4H), 1.44 (s, 8H), 1.33-1.11 (m, 2H), 0.99-0.82 (m, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 574.3.
Example 19
Isopropyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate
[0470] ##STR00114##
[0471] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using isopropyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (Intermediate AU) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Isopropyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate (43 mg, Example 19) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.27 (m, 5H), 6.75 (br. s., 2H), 5.05-4.94 (m, 3H), 4.88 (br. s., 1H), 4.19 (br. s., 1H), 3.43-3.34 (m, 2H), 3.01 (s, 3H), 1.91 (br. s., 1H), 1.77-1.56 (m, 4H), 1.25-1.16 (m, 6H), 0.99-0.83 (m, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 560.3.
Example 20
Ethyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-methyl-butanoate
[0472] ##STR00115##
[0473] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate (Intermediate AV) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-methyl-butanoate (51.5 mg, Example 20) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.23-7.51 (m, 5H), 6.76 (br. s., 2H), 5.01 (br. s., 2H), 4.42 (br. s., 1H), 3.97-4.26 (m, 3H), 3.34-3.45 (m, 2H), 3.12 (br. s., 3H), 2.24 (br. s., 1H), 1.65 (br. s., 2H), 1.13-1.29 (m, 3H), 0.88-1.10 (m, 9H). MS obsd. (ESI.sup.+) [M+H.sup.]: 532.2.
Example 21
Ethyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate
[0474] ##STR00116##
[0475] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (Intermediate AW) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate (17.3 mg, Example 21) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.26-7.45 (m, 5H), 6.73 (br. s., 2H), 4.91-5.09 (m, 3H), 4.06-4.25 (m, 3H), 3.34-3.45 (m, 2H), 3.04 (br. s., 3H), 1.93 (br. s., 1H), 1.54-1.78 (m, 4H), 1.22 (t, J=7.09 Hz, 3H), 0.77-1.01 (m, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 546.3.
Example 22
Ethyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate
[0476] ##STR00117##
[0477] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (Intermediate AX) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate (30 mg, Example 22) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.42-7.16 (m, 10H), 4.97 (s, 3H), 4.19 (q, J=7.1 Hz, 2H), 3.35-3.15 (m, 6H), 3.10-2.90 (m, 3H), 1.71-1.46 (m, 2H), 1.28-1.18 (m, 4H), 0.97-0.85 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.]: 580.
Example 23
Isopropyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate
[0478] ##STR00118##
[0479] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using isopropyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (Intermediate AY) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Isopropyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate (22 mg, Example 23) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.35-7.01 (m, 10H), 5.02-4.89 (m, 3H), 3.37-3.17 (m, 3H), 3.02-3.09 (m, 3H), 3.10-2.90 (m, 3H), 1.66-1.62 (m, 2H), 1.22-1.11 (m, 8H), 0.92 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 594.
Example 24
tert-Butyl(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate
[0480] ##STR00119##
[0481] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using tert-butyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (Intermediate AZ) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). tert-Butyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate (34 mg, Example 24) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.42-7.16 (m, 10H), 5.03-4.90 (m, 3H), 3.68-3.24 (m, 5H), 3.24-3.09 (m, 2H), 3.01 (s, 3H), 1.68-1.57 (m, 2H), 1.43 (s, 9H), 0.99-0.85 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 608.3.
Example 25
N-[2-[Acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0482] ##STR00120##
[0483] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride (Intermediate BA) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). N-[2-[Acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (26.1 mg, Example 25) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.27 (m, 5H), 7.02 (br, 2H), 5.04-4.97 (m, 2H), 4.19-4.13 (m, 1H), 3.57 (d, J=5.5 Hz, 2H), 3.49-3.34 (m, 2H), 3.14 (s, 1H), 3.12-3.02 (m, 4H), 2.86 (d, J=7.5 Hz, 2H), 2.69-2.64 (m, 1H), 2.05 (s, 1H), 1.99 (s, 1H), 1.91-1.83 (m, 1H), 1.70-1.59 (m, 2H), 0.97-0.90 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 503.2.
Example 26
Methyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate
[0484] ##STR00121##
[0485] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using methyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (Intermediate BB) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Methyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate (65 mg, Example 26) was obtained as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) ppm: 7.29-7.49 (m, 5H), 5.63-5.92 (m, 2H), 5.03-5.17 (m, 2H), 3.43-3.69 (m, 8H), 3.13-3.27 (m, 3H), 2.96-3.05 (m, 2H), 2.72 (br. s., 1H), 1.05 (t, J=7.40 Hz, 3H), 1.87 (dd, J=14.12, 6.96 Hz, 2H). MS obsd. (ESI) [(M+H).sup.+]: 519.2.
Example 27
tert-Butyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate
[0486] ##STR00122##
[0487] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using tert-butyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (Intermediate BC) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). tert-Butyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate (32 mg, Example 27) was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.26 (m, 5H), 6.89 (br. s., 2H), 4.99 (d, J=5.0 Hz, 2H), 4.16 (s, 1H), 3.55 (br. s., 2H), 3.48-3.34 (m, 2H), 3.10 (s, 2H), 3.07 (s, 1H), 2.86 (d, J=12.8 Hz, 2H), 2.74 (d, J=9.5 Hz, 1H), 2.70-2.60 (m, 1H), 1.72-1.54 (m, 2H), 1.39 (s, 6H), 1.23 (s, 2H), 1.13 (s, 2H), 0.93 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 562.
Example 28
Ethyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate
[0488] ##STR00123##
[0489] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using ethyl N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (Intermediate BD) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate (87 mg, Example 28) was obtained as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) ppm: 7.29-7.53 (m, 5H), 5.65-5.90 (m, 2H), 5.02-5.14 (m, 2H), 3.38-4.21 (m, 9H), 3.14-3.26 (m, 3H), 3.00 (br. s., 2H), 2.73 (s, 1H), 1.76-1.99 (m, 2H), 1.22-1.31 (m, 3H), 1.05 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.]: 533.2.
Example 29
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N-butyl-N-methyl-carbamate
[0490] ##STR00124##
[0491] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate (Intermediate BE) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N-butyl-N-methyl-carbamate (19 mg, Compound 29) was obtained as yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.25-7.48 (m, 5H), 6.96 (br. s., 2H), 4.99 (s, 2H), 4.06-4.36 (m, 3H), 3.59-3.83 (m, 1H), 3.33-3.49 (m, 3H), 3.07-3.21 (m, 4H), 2.79 (s, 2H), 1.65 (br. s., 2H), 1.05-1.47 (m, 6H), 0.93 (t, J=7.40 Hz, 3H), 0.70-0.87 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 561.2.
Example 30
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl pyrrolidine-1-carboxylate
[0492] ##STR00125##
[0493] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (Intermediate BF) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]ethyl-amino]ethyl pyrrolidine-1-carboxylate (10.0 mg, Example 30) was obtained as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.26-7.41 (m, 5H), 6.96 (br.s., 2H), 4.99 (s, 2H), 4.01-4.35 (m, 4H), 3.29-3.47 (m, 3H), 3.23 (br. s., 3H), 3.03-3.17 (m, 4H), 1.52-1.84 (m, 6H), 0.90-0.96 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 545.2.
Example 31
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N-methyl-N-propyl-carbamate
[0494] ##STR00126##
[0495] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl N-methyl-N-propyl-carbamate (Intermediate BG) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N-methyl-N-propyl-carbamate (3.7 mg, Example 31) was obtained as a yellow solid. .sup.1H NMR (400 MHz, CD.sub.3OD) ppm: 7.22-7.48 (m, 5H), 5.09-5.22 (m, 4H), 4.55 (s, 2H), 3.38-3.57 (m, 4H), 3.13 (s, 3H), 1.61-1.85 (m, 4H), 1.22-1.41 (m, 3H), 0.88-1.13 (m, 6H). MS obsd. (ESI.sup.) [(M+H).sup.+]: 547.2.
Example 32
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N,N-diethylcarbamate
[0496] ##STR00127##
[0497] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl N,N-diethylcarbamate (Intermediate BH) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl N,N-diethylcarbamate (21.7 mg, Example 32) was obtained as yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.25-7.41 (m, 5H), 6.96 (br. s., 2H), 4.99 (s, 2H), 4.08-4.36 (m, 3H), 3.70 (br, 1H), 3.33-3.46 (m, 3H), 3.01-3.24 (m, 7H), 1.55-1.74 (m, 2H), 0.86-1.05 (m, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.]: 547.2.
Example 33
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl ethyl carbonate
[0498] ##STR00128##
[0499] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl ethyl carbonate (Intermediate BI) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl ethyl carbonate (46 mg, Example 33) was obtained as yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 0.82-0.99 (m, 3H), 1.02-1.28 (m, 3H), 1.56-1.76 (m, 2H), 3.05-3.18 (m, 3H), 3.35-3.48 (m, 3H), 3.73 (t, J=5.08 Hz, 2H), 4.08-4.27 (m, 3H), 4.37 (br. s., 1H), 5.00 (s, 2H), 6.76-7.11 (m, 2H), 7.22-7.45 (m, 5H). MS obsd. (ESI) [(M+H).sup.+]: 520.
Example 34-A and Example 34-B
6-Amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]purine-7-carboxamide and 6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]purine-7-carboxamide
[0500] ##STR00129##
Step 1: Preparation of 4-amino-3-[(4-chlorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (Compound 34a)
[0501] ##STR00130##
[0502] Compound 34a was prepared in analogy to Example 1, Method A, Step 1 by using 4-chlorobenzyl isocyanate instead of benzyl isocyanate. 4-Amino-3-[(4-chlorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (8.0 g, Compound 34a) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 249.
Step 2: Preparation of 6-amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 34b)
[0503] ##STR00131##
[0504] Compound 34b was prepared in analogy to Example 1, Method A, Step 2 by using 4-Amino-3-[(4-chlorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (Compound 34a) instead of 4-amino-3-phenylmethyl-2-oxo-1H-imidazole-5-carbonitrile (Compound 1a). 6-Amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (6.4 g, Compound 34b) was obtained as a yellow solid and was used for the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 308.
Step 3: Preparation of 6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfanyl-7H-purin-8-one (Compound 34c)
[0505] ##STR00132##
[0506] Compound 34c was prepared in analogy to Example 1, Method A, Step 3 by using 6-amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 34b) instead of 6-amino-9-phenylmethyl-2-sulfanyl-7H-purin-8-one (Compound 1b). 6-Amino-9-[(4-chlorophenyl)methyl]-2-propylsulfanyl-7H-purin-8-one (800 mg, Compound 34c) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 350.
Step 4: Preparation of 6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfinyl-7H-purin-8-one (Compound 34d)
[0507] ##STR00133##
[0508] Compound 34d was prepared in analogy to Example 1, Method A, Step 4 by using 6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfanyl-7H-purin-8-one (Compound 34c) instead of 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c). 6-Amino-9-[(4-chlorophenyl)methyl]-2-propylsulfinyl-7H-purin-8-one (150 mg, Compound 34d) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 366.
Step 5: Preparation of 6-amino-9-[(4-chlorophenyl)methyl]-2-(propylsulfonimidoyl)-7H-purin-8-one (compound 34e), 6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-propylsulfonimidoyl)-7H-purin-8-one and 6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-propylsulfonimidoyl)-7H-purin-8-one (Compound 34e-A and Compound 34e-B)
[0509] ##STR00134##
[0510] Compound 34e was prepared in analogy to Example 1, Method A, Step 5 by using 6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfinyl-7H-purin-8-one (Compound 34d) instead of 6-amino-9-benzyl-2-(2-propylsulfinyl)-7H-purin-8-one (Compound 1d). 6-Amino-9-[(4-chlorophenyl)methyl]-2-(propylsulfonimidoyl)-7H-purin-8-one (250 mg, compound 34e) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.60 (br. s, 1H), 7.32-7.42 (m, 4H), 6.98 (br. s, 2H), 4.96 (s, 2H), 4.03 (s, 1H), 3.25-3.41 (m, 2H), 1.56-1.68 (m, 2H), 0.91 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M.sup.+H).sup.+]: 381.
[0511] Separation of compound of Compound 34e by chiral HPLC afforded Compound 34e-A (faster eluting, 110 mg) and Compound 34e-B (slower eluting, 100 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak OJ-3 column.
[0512] Compound 34e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.63 (br. s, 1H), 7.33-7.42 (m, 4H), 6.99 (br. s, 2H), 4.96 (s, 2H), 4.05 (br. s, 1H), 3.26-3.39 (m, 2H), 1.53-1.69 (m, 2H), 0.91 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 381.
[0513] Compound 34e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.63 (br. s, 1H), 7.33-7.42 (m, 4H), 6.99 (br. s, 2H), 4.96 (s, 2H), 4.05 (br. s, 1H), 3.26-3.40 (m, 2H), 1.54-1.69 (m, 2H), 0.91 (t, J=7.5 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 381.
Step 6: 6-Amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]purine-7-carboxamide and 6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]purine-7-carboxamide (Example 34-A and Example 34-B)
[0514] ##STR00135##
[0515] Example 34-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 34e-A and N-butyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
[0516] Example 34-A (160 mg): .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.37-7.45 (m, 4H), 6.91 (br. s., 2H), 4.99 (s, 2H), 4.17 (s, 1H), 3.28-3.40 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H), 1.49-1.70 (m, 4H), 1.15-1.37 (m, 2H), 0.89-0.94 (m, 5H), 0.76 (t, J=8 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 494.
[0517] Example 34-B (167 mg) was prepared in analogy to Example 34-A by using Compound 34e-B instead of Compound 34e-A.
[0518] Example 34-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.36-7.45 (m, 4H), 6.91 (br. s., 2H), 4.99 (s, 2H), 4.17 (s, 1H), 3.28-3.41 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H), 1.50-1.71 (m, 4H), 1.15-1.37 (m, 2H), 0.89-0.94 (m, 5H), 0.76 (t, J=7.4 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 494.
Example 35
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide
[0519] ##STR00136##
[0520] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 6-amino-9-[(4-chlorophenyl)methyl]-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 34e) and N-ethyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carboxamide (60 mg, Example 35) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.40 (s, 4H), 6.91 (br s, 2H), 4.99 (s, 2H), 4.16 (s, 1H), 3.34-3.44 (m, 4H), 3.05 (s, 2H), 3.01 (s, 1H), 1.58-1.67 (m, 2H), 1.18 (t, J=8.0 Hz, 3H), 0.92 (t, J=8.0 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 466.
Example 36-A and Example 36-B
6-Amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide and 6-amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide
[0521] ##STR00137##
Step 1: Preparation of 6-chloro-5-nitro-2-propylsulfanyl-N-(p-tolylmethyl)pyrimidin-4-amine (Compound 36a)
[0522] ##STR00138##
[0523] Compound 36a was prepared in analogy to Example 1, Method B, Step 1 by using p-tolylmethylamine instead of phenylmethanamine. 6-Chloro-5-nitro-2-propylsulfanyl-N-(p-tolylmethyl)pyrimidin-4-amine (3.9 g, Compound 36a) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 353.
Step 2: Preparation of 6-chloro-2-propylsulfanyl-N4-(p-tolylmethyl)pyrimidine-4,5-diamine (Compound 36b)
[0524] ##STR00139##
[0525] Compound 36b was prepared in analogy to Example 1, Method B, Step 2 by using 6-chloro-5-nitro-2-propylsulfanyl-N-(p-tolylmethyl)pyrimidin-4-amine (Compound 36a) instead of N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine (Compound 1f). 6-Chloro-2-propylsulfanyl-N4-(p-tolylmethyl)pyrimidine-4,5-diamine (2.2 g, Compound 36b) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 323.
Step 3: Preparation of 6-chloro-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36c)
[0526] ##STR00140##
[0527] Compound 36c was prepared in analogy to Example 1, Method B, Step 3 by using 6-chloro-2-propylsulfanyl-N4-(p-tolylmethyl)pyrimidine-4,5-diamine (Compound 36b) instead of N-benzyl-6-chloro-2-(propylsulfanyl)pyrimidine-4,5-diamine (Compound 1g). 6-Chloro-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (2.2 g, Compound 36c) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 349.
Step 4: Preparation of 6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36d)
[0528] ##STR00141##
[0529] Compound 36d was prepared in analogy to Example 1, Method B, Step 4, by using 6-chloro-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36c) instead of 9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (Compound 1h). 6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (2.0 g, Compound 36d) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.]: 450.
Step 5: Preparation of 6-amino-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36e)
[0530] ##STR00142##
[0531] Compound 36e was prepared in analogy to Example 1, Method B, Step 5 by using 6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36d) instead of 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1i). 6-amino-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (1.0 g, Compound 36e) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.
Step 6: Preparation of 6-amino-2-propylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36f)
[0532] ##STR00143##
[0533] Compound 36f was prepared in analogy to Example 1, Method B, Step 6 by using 6-amino-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36e) instead of 6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (Compound 1c). 6-amino-2-propylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (220 mg, Compound 360 was obtained as a white solid MS obsd. (ESI.sup.+) [(M+H).sup.+]: 345.
Step 7: Preparation of 6-amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36g)
[0534] ##STR00144##
[0535] Compound 36g was prepared in analogy to Example 1, Method B, Step 7 by using 6-amino-2-propylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36f) instead of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d). 6-Amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one (127 mg, Compound 36g) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.67 (br. s., 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d, J=8.0 Hz, 2H), 6.98 (br. s., 2H), 4.91 (s, 2H), 4.05 (s, 1H), 3.34-3.27 (m, 2H), 2.26 (s, 3H), 1.67-1.62 (m, 2H), 0.92 (t, J=8.0 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.]: 361.
[0536] Separation of compound 36g by chiral HPLC afforded compound 36g-A (faster eluting, 50 mg) and compound 36g-B (slower eluting, 49 mg) as white solid with 30% isopropanol (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0537] Compound 36g-A: .sup.1H NMR: (400 MHz, DMSO-d.sub.6) ppm: 10.51 (s, 1 H), 7.22 (d, J=8.0 Hz, 2H), 7.12 (d, J=8.0 Hz, 2H), 7.00 (s, 2 H), 4.91 (s, 2H), 4.03 (s, 1H), 3.35-3.31 (m, 2H), 2.26 (s, 3H), 1.70-1.58 (m, 2H), 0.93 (t, J=7.40 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 361.
[0538] Compound 36g-B: .sup.1h NMR: (400 MHz, DMSO-d.sub.6) ppm: 10.54 (s, 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d, J=8.0 Hz, 2H), 6.97 (s, 2H), 4.91 (s, 2H), 4.04 (s, 1H), 3.34-3.30 (m, 2H), 2.26 (s, 3H), 1.72-1.57 (m, 2H), 0.93 (t, J=7.40 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 361.
Step 8: Preparation of 6-Amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide and 6-amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide (Example 36-A and Example 36-B)
[0539] ##STR00145##
[0540] Example 36-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 36g-A instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). Example 36-A (108 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27 (d, J=8 Hz, 2H), 7.14 (d, J=8 Hz, 2H), 6.87 (br. s., 2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.33-3.57 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H), 2.26 (s, 3H), 1.52-1.73 (m, 4H), 0.75-0.97 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 460.
[0541] Example 36-B was prepared in analogy to Example 1, Method A, Step 6 by using Compound 36g-B instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (compound 1e). Example 36-B(125 mg): .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.27 (d, J=8 Hz, 2H), 7.14 (d, J=8 Hz, 2H), 6.87 (br. s., 2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.33-3.57 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H), 2.26 (s, 3H), 1.52-1.73 (m, 4H), 0.75-0.97 (m, 5H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 460.
Example 37-A and Example 37-B
6-Amino-2-[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-carbonyl)purin-8-one and 6-amino-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-carbonyl)purin-8-one
[0542] ##STR00146##
[0543] Example 37-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 36g-A and pyrrolidine-1-carbonyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
[0544] Example 37-A (390 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.31-7.11 (m, 4H), 7.04 (s, 2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.65-3.47 (m, 4H), 3.37 (m, 2H), 2.27 (s, 3H), 1.97-1.81 (m, 4H), 1.71-1.59 (m, 2H), 0.94 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 458.2.
[0545] Example 37-B (125 mg) was prepared in analogy to Example 37-A by using Compound 36g-B instead of Compound 36g-A. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.28-7.14 (m, 4H), 7.04 (s, 2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.65-3.47 (m, 4H), 3.37 (m, 2H), 2.27 (s, 3H), 1.93-1.84 (m, 4H), 1.65-1.60 (m, 2H), 0.95 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 458.3.
Example 38-A and Example 38-B
6-Amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]-(p-tolylmethyl)purine-7-carboxamide and 6-amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)purine-7-carboxamide
[0546] ##STR00147##
[0547] Example 38-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 36g-A and N-(2-methoxyethyl)-N-methyl-carbamoyl chloride (Intermediate AB) instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
[0548] Example 38-A (57.8 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.26 (d, J=7.6 Hz, 2H), 7.14 (d, J=7.6 Hz, 2H), 6.89-6.78 (m, 2H), 4.95 (s, 2H), 4.18 (s, 1H), 3.62-3.58 (m, 2H), 3.43-3.37 (m, 2H), 3.30-3.10 (m, 3H), 3.09-3.08 (m, 3H), 3.08-3.05 (m, 2H), 2.27 (s, 3H), 1.77-1.54 (m, 2H), 0.95 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 476.3.
[0549] Example 38-B (46.6 mg) was prepared in analogy to Example 38-A by using Compound 36g-B instead of Compound 36g-A. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.26 (d, J=7.6 Hz, 2H), 7.14 (d, J=7.6 Hz, 2H), 6.89-6.78 (m, 2H), 4.95 (s, 2H), 4.18 (s, 1H), 3.62-3.58 (m, 2H), 3.43-3.37 (m, 2H), 3.30-3.10 (m, 3H), 3.09-3.08 (m, 3H), 3.08-3.05 (m, 2H), 2.27 (s, 3H), 1.77-1.54 (m, 2H), 0.95 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.) [(M+H).sup.+]: 476.3.
Example 39
6-Amino-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide
[0550] ##STR00148##
[0551] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using N-ethyl-N-methyl-carbamoyl chloride and 6-amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36g) instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA) and 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide (141.8 mg, Example 39) was obtained as a light yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.26 (d, J=7.9 Hz, 2H), 7.15 (d, J=7.9 Hz, 2H), 6.89 (s, 2H), 4.95 (s, 2H), 4.24-4.07 (m, 1H), 3.52-3.35 (m, 4H), 3.10-2.95 (m, 3H), 2.26 (s, 3H), 1.77-1.55 (m, 2H), 1.24-1.10 (m, 3H), 0.95 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.1.
Example 40
6-Amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide
[0552] ##STR00149##
[0553] The title compound was prepared in analogy to Example 1, Method A, Step 6 by using 6-amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one (Compound 36g) and N-butyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide (32 mg, Example 40) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.28-7.14 (m, 4H), 6.88 (s, 2H), 4.95 (s, 2H), 4.16 (s, 1H), 3.41-3.36 (m, 2H), 3.10-2.99 (m, 3H), 2.53-2.51 (m, 2H), 2.27 (s, 3H), 1.71-1.63 (m, 2H), 1.62-1.51 (m, 2H), 1.42-1.26 (m, 2H), 0.97-0.74 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 474.3
Example 41-A and Example 41-B
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-A) and 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-B)
[0554] ##STR00150##
Step 1: Preparation of 6-amino-9-[(4-chlorophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-one (Compound 41a)
[0555] ##STR00151##
[0556] Compound 41a was prepared in analogy to Example 1, Method A, Step 3 by using iodoethane and 6-amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 34b) instead of bromopropane and 6-amino-9-phenylmethyl-2-sulfanyl-7H-purin-8-one (Compound 1b). 6-Amino-9-[(4-chlorophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-one (2.5 g, Compound 41a) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 336.
Step 2: Preparation of 6-amino-9-(4-chlorobenzyl)-2-ethylsulfinyl-7H-purin-8-one (Compound 41b)
[0557] ##STR00152##
[0558] Compound 41b was prepared in analogy to Example 1, Method A, Step 4 by using 6-amino-9-[(4-chlorophenyl)methyl]-2-ethyl sulfanyl-7H-purin-8-one (Compound 41a) instead of 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c). 6-Amino-9-(4-chlorobenzyl)-2-ethylsulfinyl-7H-purin-8-one (1.94 g, Compound 41b) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 352.
Step 3: Preparation of 6-amino-9-[(4-chlorophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one (Compound 41c)
[0559] ##STR00153##
[0560] Compound 41c was prepared in analogy to Example 1, Method A, Step 5 by using 6-amino-9-(4-chlorobenzyl)-2-ethylsulfinyl-7H-purin-8-one (Compound 41b) instead of 6-amino-9-benzyl-2-(2-methylsulfinyl)-7H-purin-8-one (Compound 1d). 6-Amino-9-[(4-chlorophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one (217 mg, Example 41c) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.61 (s, 1H), 7.42-7.35 (m, 4H), 6.98 (s, 2H), 4.96 (s, 2H), 4.05 (s, 1H), 3.42-3.37 (m, 2H), 1.16 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 367.0.
[0561] Separation of compound of Compound 41c by chiral HPLC afforded Compound 41c-A (faster eluting, 31.8 mg) and Compound 41c-B (slower eluting, 10 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak IC-3 column.
##STR00154##
[0562] Compound 41c-A: .sup.1Hl NMR (400 MHz, DMSO-d.sub.6) ppm: 10.76 (s, 1H), 7.45-7.33 (m, 4H), 7.01 (s, 2H), 4.96 (s, 2H), 4.03 (s, 1H), 3.40-3.34 (m, 2H), 1.17 (t, J =7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 367.0.
##STR00155##
[0563] Compound 41c-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.70 (s, 1H), 7.46-7.28 (m, 4H), 7.01 (s, 2H), 4.96 (s, 2H), 4.03 (s, 1H), 3.44-3.36 (m, 2H), 1.17 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 367.0.
Step 4: 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-A) and 6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-B)
[0564] ##STR00156##
[0565] Example 41-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 41c-B instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-A, 78 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.41 (m, 4H), 6.90 (s, 2H), 5.00 (s, 2H), 4.19 (s, 1H), 3.46-3.39 (m, 2H), 3.39-3.38 (m, 2H), 3.09-2.99 (m, 3H), 1.69-1.52 (m, 2H), 1.19 (t, J=7.28 Hz, 3H), 0.95-0.66 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 466.1.
[0566] Example 41-B (125 mg) was prepared in analogy to Example 1, Method A, Step 6 by using Compound 41c-A instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-B, 38 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.41 (m, 4H), 6.90 (s, 2H), 5.00 (s, 2H), 4.20 (s, 1H), 3.46-3.41 (m, 2H), 3.40-3.39 (m, 2H), 3.10-3.00 (m, 3H), 1.69-1.50 (m, 2H), 1.24-1.12 (m, 3H), 0.93-0.73 (m, 3H). (MS obsd. (ESI.sup.+) [(M+H).sup.+]: 466.2.
[0567] The stereochemistry of Example 41-B was determined by single crystal X-ray diffraction shown in
Example 42-A and Example 42-B
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide (Example 42-A) and 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide (Example 42-B)
[0568] ##STR00157##
[0569] Example 42-A was prepared in analogy to Example 1, Method A, step 6 by using Compound 41c-A and N-ethyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide (Example 42-A, 40 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.41 (m, 4H), 6.90 (s, 2H), 4.99 (s, 2H), 4.18 (s, 1H), 3.48-3.40 (m, 2H), 3.39 (s, 2H), 3.05-3.01 (m, 3H), 1.20-1.14 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 452.2.
[0570] Example 42-B was prepared in analogy to Example 1, Method A, Step 6 by using Compound 41c-B and N-ethyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-purine-7-carboxamide (Example 42-B, 38 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.43-7.41 (m, 4H), 6.91 (s, 2H), 4.98 (s, 2H), 4.19 (s, 1H), 3.48-3.40 (m, 2H), 3.39 (s, 2H), 3.09-2.97 (m, 3H), 1.23-1.11 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 452.2.
[0571] The stereochemistry of Example 42-A was determined by single crystal X-ray diffraction shown in
Example 43-A and Example 43-B
6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide (Example 43-A) and 6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide (Example 43-B)
[0572] ##STR00158##
Step 1: Preparation of 4-amino-2-oxo-3-(p-tolylmethyl)-1H-imidazole-5-carbonitrile (Compound 43a)
[0573] ##STR00159##
[0574] Compound 43a was prepared in analogy to Example 1, Method A, Step 1 by using 4-methylbenzyl isocyanate instead of benzyl isocyanate. 4-Amino-2-oxo-3-(p-tolylmethyl)-1H-imidazole-5-carbonitrile (26.6 g, Compound 43a) was obtained as a grey solid and used directly for next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 229.2.
Step 2: Preparation of 6-amino-9-(p-tolylmethyl)-2-sulfanyl-7H-purin-8-one (Compound 43b)
[0575] ##STR00160##
[0576] Compound 43b was prepared in analogy to Example 1, Method A, Step 2 by using of 4-amino-2-oxo-3-(p-tolylmethyl)-1H-imidazole-5-carbonitrile (compound 43a) instead of 4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (Compound 1a). 6-Amino-9-(p-tolylmethyl)-2-sulfanyl-7H-purin-8-one (20.0 g, Compound 43b) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 288.
Step 3: Preparation of 6-amino-2-ethylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 43c)
[0577] ##STR00161##
[0578] Compound 43c was prepared in analogy to Example 1, Method A, Step 3 by using 6-amino-9-(p-tolylmethyl)-2-sulfanyl-7H-purin-8-one (Compound 43b) and iodoethane instead of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b) and bromopropane. 6-Amino-2-ethylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (13 g, Compound 43c) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 316.
Step 4: Preparation of 6-amino-2-ethylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 43d)
[0579] ##STR00162##
[0580] Compound 43d was prepared in analogy to Example 1, Method A, Step 4 by using 6-amino-2-ethylsulfanyl-9-(mtolylmethyl)-7H-purin-8-one (Compound 43c) instead of 6-amino-9-benzyl-2-methylsulfanyl-7H-purin-8-one (Compound 1c). 6-Amino-2-ethylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one6 (3.5 g, Compound 43d) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 332.
Step 5: Preparation of 6-amino-2-(ethylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one (Compound 43e)
[0581] ##STR00163##
[0582] Compound 43e was prepared in analogy to Example 1, Method A, Step 5 by using 6-amino-2-ethyl sulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 43d) instead of 6-amino-9-benzyl-2-methylsulfinyl-7H-purin-8-one (Compound 1d). 6-Amino-2-(ethylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one (530 mg, Compound 43e) was obtained as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.53 (s, 1H), 7.24 (d, J=8.03 Hz, 2H), 7.13 (d, J=8.03 Hz, 2H), 6.94 (br. s., 2H), 4.91 (s, 2H), 4.03 (s, 1H), 3.36-3.41 (m, 2H), 2.26 (s, 3H), 1.18 (t, J=7.28 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.]: 347.
[0583] Separation of compound of Compound 43e by chiral HPLC afforded Compound 43e-A (faster eluting, 56.8 mg) and Compound 43e-B (slower eluting, 56.7 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column.
##STR00164##
[0584] Compound 43e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.52 (br. s., 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d, J=7.9 Hz, 2H), 6.94 (br. s., 2H), 4.90 (s, 2H), 4.03 (s, 1H), 3.42-3.33 (m, 2H), 2.25 (s, 3H), 1.17 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 347.
##STR00165##
[0585] Compound 43e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.56 (br. s., 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d, J =8.0 Hz, 2H), 6.95 (br. s., 2H), 4.90 (s, 2H) 4.03 (s, 1H), 3.44-3.29 (m, 2H), 2.25 (s, 3H), 1.17 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 347.
Step 6: Preparation of 6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide (Example 43-A) and 6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide (Example 43-B)
[0586] ##STR00166##
[0587] Example 43-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 43e-A instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide (Example 43-A, 58.1 mg, faster eluting, isopropanol from 5% to 40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.28 (d, J=7.8 Hz, 2H), 7.15 (d, J=7.8 Hz, 2H), 6.88 (br. s., 2H), 5.03-4.87 (m, 2H), 4.19 (s, 1H), 3.61-3.36 (m, 4H), 3.11-2.96 (m, 3H), 2.26 (s, 3H), 1.72-1.45 (m, 2H), 1.20 (t, J=7.2 Hz, 3H), 0.97-0.65 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.
[0588] Example 43-B was prepared in analogy to Example 1, Method A, Step 6 by using Compound 43e-B instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmethyl)purine-7-carboxamide (Example 43-B, 40.1 mg, slower eluting, isopropanol from 5% to 40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column) was obtained as a white solid: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.28 (d, J=7.5 Hz, 2H), 7.15 (d, J=7.5 Hz, 2H), 6.89 (br. s., 2H), 5.03-4.86 (m, 2H), 4.19 (s, 1H), 3.49-3.37 (m, 4H), 3.08-3.00 (m, 3H), 2.27 (s, 3H), 1.70-1.48 (m, 2H), 1.20 (t, J=7.2 Hz, 3H), 0.95-0.71 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.3.
[0589] The stereochemistry of Example 43-B was determined by single crystal X-ray diffraction shown in
Example 44-A and Example 44-B
6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide (Example 44-A) and 6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide (Example 44-B)
[0590] ##STR00167##
[0591] Example 44-A was prepared in analogy to Example 1, Method A, Step 6 by using Compound 43e-B and N-ethyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide (Example 44-A, 73.1 mg) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.28 (d, J=7.8 Hz, 2H), 7.15 (d, J=7.8 Hz, 2H), 6.90 (br. s., 2H), 4.95 (s, 2H), 4.19 (br. s., 1H), 3.48-3.39 (m, 4H), 3.06-3.00 (m, 3H), 2.27 (s, 3H), 1.29-1.04 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 432.
[0592] Example 44-B was prepared in analogy to Example 1, Method A, Step 6 by using Compound 43e-A and N-ethyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl)purine-7-carboxamide (Example 44-B, 46.7 mg) was obtained as a white solid: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.28 (d, J=7.9 Hz, 2H), 7.15 (d, J=7.9 Hz, 2H), 6.90 (br. s., 2H), 4.95 (s, 2H), 4.19 (br. s., 1H), 3.50-3.39 (m, 4H), 3.10-2.96 (m, 3H), 2.27 (s, 3H), 1.27-1.10 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 432.
Example 45-A and Example 45-B
6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide and 6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide
[0593] ##STR00168##
Step 1: Preparation of 4-amino-3-[(4-fluorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (Compound 45a)
[0594] ##STR00169##
[0595] Compound 45a was prepared in analogy to Example 1, Method A, Step 1 by using 4-fluorobenzyl isocyanate instead of benzyl isocyanate. 4-Amino-3-[(4-fluorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (48 g, Compound 45a) was obtained as a light yellow solid and was used directly for next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 233.
Step 2: Preparation of 6-amino-9-[(4-fluorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 45b)
[0596] ##STR00170##
[0597] Compound 45b was prepared in analogy to Example 1, Method A, Step 2 by using of 4-amino-3-[(4-fluorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (Compound 45a) instead of 4-amino-3-phenylmethyl-2-oxo-1H-imidazole-5-carbonitrile (Compound 1a). 6-Amino-9-[(4-fluorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (32.0 g, Compound 45b) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 292.
Step 3: Preparation of 6-amino-2-ethylsulfanyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45c)
[0598] ##STR00171##
[0599] Compound 45c was prepared in analogy to Example 1, Method A, Step 3 by using 6-amino-9-[(4-fluorophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 45b) and iodoethane instead of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b) and bromopropane. 6-Amino-2-ethylsulfanyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (5.6 g, Compound 45c) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 320.
Step 5: Preparation of 6-amino-2-ethylsulfinyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45d)
[0600] ##STR00172##
[0601] Compound 45d was prepared in analogy to Example 1, Method A, Step 4 by using 6-amino-2-ethylsulfanyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45c) instead of 6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c). 6-Amino-2-ethylsulfinyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (4.8 g, Compound 45d) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 332.
Step 6: Preparation of 6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45e)
[0602] ##STR00173##
[0603] Compound 45e was prepared in analogy to Example 1, Method A, Step 5 by using 6-amino-2-ethylsulfinyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45d) instead of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d). 6-Amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (2.9 g, Compound 45e) was obtained as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.57 (br. s., 1H), 7.40 (dd, J=8.5, 5.5 Hz, 2H), 7.16 (t, J=8.9 Hz, 2H), 6.97 (br. s., 2H), 4.94 (s, 2H), 4.07 (s, 1H), 3.43-3.36 (m, 2H), 1.17 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 351.
[0604] Separation of compound of Compound 45e by chiral HPLC afforded Compound 45e-A (faster eluting, 85.4 mg) and Compound 45e-B (slower eluting, 36.4 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0605] Compound 45e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.53 (br. s., 1H), 7.41 (dd, J=8.5, 5.5 Hz, 2H), 7.17 (t, J=8.9 Hz, 2H), 6.98 (br. s., 2H), 4.95 (s, 2H), 4.07 (s, 1H), 3.45-3.36 (m, 2H), 1.17 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 351.
[0606] Compound 45e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.53 (br. s., 1H), 7.41 (dd, J=8.5, 5.5 Hz, 2H), 7.17 (t, J=8.9 Hz, 2H), 6.98 (br. s., 2H), 4.95 (s, 2H), 4.07 (s, 1H), 3.44-3.37 (m, 2H) 1.17 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 351.
Step 7: Preparation of 6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 45), 6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide and 6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 45-A and Example 45-B)
[0607] ##STR00174##
[0608] Example 45 was prepared in analogy to Example 1, Method A, Step 6 by using 6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45e) instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (162.4 mg, Example 45) was obtained as a white solid.
[0609] Separation of compound of Example 45 by chiral HPLC afforded Example 45-A (faster eluting, 85.3 mg) and Example 45-B (slower eluting, 52 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column
[0610] Example 45-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.53-7.38 (m, 2H), 7.18 (t, J=8.9 Hz, 2H), 6.90 (br. s., 2H), 4.99 (s, 2H), 4.21 (s, 1H), 3.48-3.37 (m, 4H), 3.10-3.01 (m, 3H), 1.69-1.49 (m, 2H), 1.25-1.14 (m, 3H), 0.94-0.72 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.]: 450.
[0611] Example 45-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.54-7.38 (m, 2H), 7.18 (t, J=8.9 Hz, 2H), 7.01-6.72 (m, 2H), 4.99 (s, 2H), 4.21 (s, 1H), 3.46-3.38 (m, 4H), 3.10-3.01 (m, 3H), 1.76-1.50 (m, 2H), 1.25-1.16 (m, 3H), 0.99-0.69 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 450.
Example 46-A and Example 46-B
6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide (Example 46), 6-amino-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide and 6-amino-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide (Example 46-A and Example 46-B)
[0612] ##STR00175##
[0613] Example 46 was prepared in analogy to Example 1, Method A, Step 6 by using 6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (Compound 45e) and N-ethyl-N-methyl carbamoyl chloride instead of 6-amino-9-benzyl-2-(propyl sulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-purine-7-carboxamide (51 mg, Example 46) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.46-7.43 (m, 2H), 7.20-7.15 (m, 2H), 6.90 (br. s., 2H), 4.98 (s, 2H), 4.18 (s, 1H), 3.47-3.32 (m, 4H), 3.05-3.01 (m, 3H), 1.21-1.14 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.
[0614] Separation of compound of Example 46 by chiral HPLC afforded Example 46-A (faster eluting, 72 mg) and Example 46-B (slower eluting, 45 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column
[0615] Example 46-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.46-7.43 (m, 2H), 7.20-7.16 (m, 2H), 6.90 (br. s., 2H), 4.98 (s, 2H), 4.18 (s, 1H), 3.47-3.32 (m, 4H), 3.05-3.01 (m, 3H), 1.21-1.14 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.
[0616] Example 46-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.46-7.43 (m, 2H), 7.20-7.14 (m, 2H), 6.92 (br. s., 2H), 4.98 (s, 2H), 4.20 (br. s., 1H), 3.47-3.32 (m, 4H), 3.05-3.01 (m, 3H), 1.23-1.19 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.
Example 47-A and Example 47-B
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 47), 6-amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide and 6-amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide
[0617] ##STR00176##
Step 1: Preparation of 4-amino-3-[(4-bromophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (Compound 47a)
[0618] ##STR00177##
[0619] Compound 47a was prepared in analogy to Example 1, Method A, Step 1 by using 4-bromobenzyl isocyanate instead of benzyl isocyanate. 4-Amino-3-[(4-bromophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (500 mg, Compound 47a) was obtained as a light yellow solid and was used directly for next step without further purification. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 9.94 (S, 1H), 7.55-7.53 (d, J=8.0 Hz, 2H), 7.20-7.18 (d, J =8.0 Hz, 2H), 6.52 (br. s., 2H), 4.74 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 293.
Step 2: Preparation of 6-amino-9-[(4-bromophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 47b)
[0620] ##STR00178##
[0621] Compound 47b was prepared in analogy to Example 1, Method A, Step 2 by using of 4-amino-3-[(4-bromophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile (Compound 47a) instead of 4-amino-3-phenylmethyl-2-oxo-1H-imidazole-5-carbonitrile (Compound 1a). 6-Amino-9-[(4-bromophenyl)methyl]-2-sulfanyl-7H-purin-8-one (300 mg, Compound 47b) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 352.
Step 3: Preparation of 6-amino-2-ethylsulfanyl-9-[(4-bromophenyl)methyl]-7H-purin-8-one (Compound 47c)
[0622] ##STR00179##
[0623] Compound 47c was prepared in analogy to Example 1, Method A, Step 3 by using 6-amino-9-[(4-bromophenyl)methyl]-2-sulfanyl-7H-purin-8-one (Compound 45b) and iodoethane instead of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b) and bromopropane. 6-Amino-2-ethylsulfanyl-9-[(4-bromophenyl)methyl]-7H-purin-8-one (5.6 g, Compound 47c) was obtained as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 380.
Step 4: Preparation of 6-amino-9-[(4-bromophenyl)methyl]-2-ethylsulfinyl-7H-purin-8-one (Compound 47d)
[0624] ##STR00180##
[0625] Compound 47d was prepared in analogy to Example 1, Method B, Step 6 by using 6-amino-9-[(4-bromophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-one (Compound 47c) instead of 6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (Compound 1c). 6-Amino-9-[(4-bromophenyl)methyl]-2-ethylsulfinyl-7H-purin-8-one (3.2 g, Compound 47d) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 396.
Step 5: Preparation of 6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one (Compound 47e)
[0626] ##STR00181##
[0627] Compound 47e was prepared in analogy to Example 1, Method B, Step 7 by using 6-amino-9-[(4-bromophenyl)methyl]-2-ethylsulfinyl-7H-purin-8-one (Compound 47d) instead of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d). 6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one (4.0 g, Compound 47e) was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 411.
##STR00182##
[0628] Separation of compound of Compound 47e by chiral HPLC afforded Compound 47e-A (faster eluting, 112 mg) and Compound 47e-B (slower eluting, 99 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0629] Compound 47e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.58 (br. s., 1H), 7.52-7.54 (d, J=8.0, 2H), 7.31-7.29 (t, J=8.0 Hz, 2H), 6.54 (br. s., 2H), 4.93 (s, 2H), 4.05 (s, 1H), 3.42-3.31 (m, 2H), 1.15 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 411.
[0630] Compound 47e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 10.58 (br. s., 1H), 7.54-7.52 (d, J=8.0, 2H), 7.31-7.29 (t, J=8.0 Hz, 2H), 6.98 (br. s., 2H), 4.93 (s, 2H), 4.06 (s, 1H), 3.40-3.37 (m, 2H), 1.15 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 411.
Step 6: Preparation of 6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 47), 6-amino-9-[(4-bromophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide and 6-amino-9-[(4-bromophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (Example 47-A and Example 47-B)
[0631] ##STR00183##
[0632] Example 47 was prepared in analogy to Example 1, Method A, Step 6 by using 6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one (Compound 47e) instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound 1e). 6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (570 mg, Example 47) was obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.56-7.53 (m, 2H), 7.36-7.34 (m, 2H), 6.92 (br. s., 2H), 4.97 (s, 2H), 4.18 (s, 1H), 3.45-3.38 (m, 4H), 3.05-3.02 (m, 3H), 1.65-1.56 (m, 2H), 1.19 (t, J=8.0 Hz, 3H), 0.93-0.75 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 510.
[0633] Separation of compound of Example 47 by chiral HPLC afforded Example 47-A (faster eluting, 260 mg) and Example 47-B (slower eluting, 266 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column
[0634] Example 47-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.33 (d, J=8,0 Hz, 2H), 6.90 (br. s., 2H), 4.97 (s, 2H), 4.21 (s, 1H), 3.46-3.41 (m, 4H), 3.05-3.02 (m, 3H),1.65-1.54 (m, 2H), 1.24-1.16 (m, 3H), 0.93-0.75 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 510.
[0635] Example 47-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.54-7.53 (d, J=8.0 Hz, 2H), 7.36-7.33 (d, J=8.0 Hz, 2H), 6.90 (br. s., 2H), 4.97 (s, 2H), 4.21 (s, 1H), 3.46-3.41 (m, 4H), 3.06-3.02 (m, 3H), 1.65-1.54 (m, 2H), 1.20-1.16 (m, 3H), 0.93-0.75 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 510.
Example 48-A and Example 48-B
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-purine-7-carboxamide (Example 48), 6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-methyl-8-oxo-purine-7-carboxamide and 6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-methyl-8-oxo-purine-7-carboxamide (Example 48-A and Example 48-B)
[0636] ##STR00184##
[0637] Example 48 was prepared in analogy to Example 1, Method A, Step 6 by using 6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one (Compound 47e) and N-ethyl-N-methyl-carbamoyl chloride instead of 6-amino-9-benzyl-2-(propyl sulfonimidoyl)-7H-purin-8-one (Compound 1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). 6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-propyl-purine-7-carboxamide (469 mg, Example 48) was obtained as a white solid. H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.34 (d, J=8,0 Hz, 2H), 6.98 (br. s., 2H), 4.97 (s, 2H), 3.53-3.46 (m, 4H), 3.05-3.01 (m, 3H), 1.22-1.16 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 496.
[0638] Separation of compound of Example 48 by chiral HPLC afforded Example 48-A (faster eluting, 198 mg) and Example 48-B (slower eluting, 202 mg) as white solid with methanol 5%-40% (0.05%DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0639] Example 48-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.34 (d, J=8,0 Hz, 2H), 6.92 (br. s., 2H), 4.97 (s, 2H), 4.19-4.18 (m, 1H), 3.46-3.41 (m, 4H), 3.05-3.01 (m, 3H), 1.20-1.14 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 496.
[0640] Example 48-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.34 (d, J=8.0 Hz, 2H), 6.92 (br. s., 2H), 4.97 (s, 2H), 4.24 (br. s., 1H), 3.58-3.41 (m, 4H), 3.05-3.01 (m, 3H), 1.26-1.01 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 496.
Example 49
Activity of Compounds and Examples in HEK293-hTLR-7 Assay
HEK293-Blue-hTLR-7 Cells Assay:
[0641] A stable HEK293-Blue-hTLR-7 cell line was purchased from InvivoGen (Cat.#: hkb-htlr7, San Diego, Calif., USA). These cells were designed for studying the stimulation of human TLR7 by monitoring the activation of NF-B. A SEAP (secreted embryonic alkaline phosphatase) reporter gene was placed under the control of the IFN- minimal promoter fused to five NF-B and AP-1-binding sites. The SEAP was induced by activating NF-B and AP-1 via stimulating HEK-Blue hTLR7 cells with TLR7 ligands. Therefore the reporter expression was regulated by the NF-B promoter upon stimulation of human TLR7 for 20 hrs. The cell culture supernatant SEAP reporter activity was determined using QUANTI-Blue kit (Cat.#: rep-qbl, Invivogen, San Diego, Calif., USA) at a wavelength of 640 nm, a detection medium that turns purple or blue in the presence of alkaline phosphatase.
[0642] HEK293-Blue-hTLR7 cells were incubated at a density of 250,000450,000 cells/mL in a volume of 180 L in a 96-well plate in Dulbecco's Modified Eagle's medium (DMEM) containing 4.5 g/L glucose, 50 U/mL penicillin, 50 mg/mL streptomycin, 100 mg/mL Normocin, 2 mM L-glutamine, 10% (V/V) heat-inactivated fetal bovine serum for 24 hrs. Then the HEK293-Blue-hTLR-7 cells were incubated with addition of 20 L test compound in a serial dilution in the presence of final DMSO at 1% and perform incubation under 37 C. in a CO.sub.2 incubator for 20 hrs. Then 20 L of the supernatant from each well was incubated with 180 L Quanti-blue substrate solution at 37 C. for 2 hrs and the absorbance was read at 620655 nm using a spectrophotometer. The signalling pathway that TLR7 activation leads to downstream NF-B activation has been widely accepted, and therefore similar reporter assay was also widely used for evaluating TLR7 agonist (Tsuneyasu Kaisho and Takashi Tanaka, Trends in Immunology, Volume 29, Issue 7, July 2008, Pages 329.sci; Hiroaki Hemmi et al, Nature Immunology 3, 196-200 (2002)).
[0643] The Compounds and Examples of the present invention were tested in HEK293-hTLR-7 assay for their TLR7 agonism activity as described herein and results are listed in Table 1. The Examples of prodrugs were found to have EC.sub.50 of about 2.1 M to about 1000 M, the Compounds of active forms were found to have EC.sub.50 less than 0.2 M. The calculated ratio of EC.sub.50(prodrug)/EC.sub.50(active form) were within the range from 32 to about 7600.
TABLE-US-00001 TABLE 1 Activity of Examples and Compounds of present invention in HEK293-hTLR-7 assay HEK293- HEK293- hTLR-7 EC.sub.50 Ratio hTLR-7 EC.sub.50 Corresponding (Active form, (EC.sub.50(prodrug)/ Prodrug (Prodrug, M) Active Form M) EC.sub.50(active form)) Example 1 50.4 Compound 1e 0.065 775.4 Example 1-A 42.5 Compound 1e-A 0.067 634.3 Example 1-B 27 Compound 1e-B 0.086 314.0 Example 2 32 Compound 1e 0.065 372.1 Example 2-A 3.7 Compound 1e-B 0.086 43.0 Example 2-B 4.4 Compound 1e-A 0.067 65.7 Example 3 15.1 Compound 1e 0.065 232.3 Example 4 23 Compound 1e 0.065 353.8 Example 5 41 Compound 1e 0.065 630.8 Example 6 82.3 Compound 1e 0.065 1266.2 Example 7 19.9 Compound 1e 0.065 306.2 Example 8 2.1 Compound 1e 0.065 32.3 Example 9 19.2 Compound 1e 0.065 295.4 Example 10 68.5 Compound 1e 0.065 1053.8 Example 11 5.6 Compound 1e 0.065 86.2 Example 12 43.9 Compound 1e 0.065 675.4 Example 13 67 Compound 1e 0.065 1030.8 Example 14 2.4 Compound 1e 0.065 36.9 Example 15 494 Compound 1e 0.065 7600 Example 16 32.1 Compound 1e 0.065 493.8 Example 25 24.2 Compound 1e 0.065 372.3 Example 26 13.4 Compound 1e 0.065 206.2 Example 27 31.7 Compound 1e 0.065 487.7 Example 28 6.9 Compound 1e 0.065 106.2 Example 29 48.8 Compound 1e 0.065 750.8 Example 32 22.5 Compound 1e 0.065 346.2 Example 34-A 6.0 Compound 34e-A 0.014 428.6 Example 34-B 6.36 Compound 34e-B 0.011 578.2 Example 36-A 31.8 Compound 36g-A 0.019 1673.7 Example 37-A 26.6 Compound 36g-A 0.019 1400 Example 37-B 47.4 Compound 36g-B 0.022 2154.5 Example 38-A 26.2 Compound 36g-A 0.019 1378.9 Example 38-B 19.5 Compound 36g-B 0.022 886.4 Example 39 4.3 Compound 36g 0.027 159.3 Example 40 52.8 Compound 36g 0.027 1955.6 Example 41 36 Compound 41c 0.053 679.2 Example 41-A 44.1 Compound 41c-B 0.085 518.8 Example 41-B 32.1 Compound 41c-A 0.071 452.1 Example 42-A 40.5 Compound 41c-A 0.071 570.4 Example 42-B 49.2 Compound 41c-B 0.085 578.8 Example 43-A 110 Compound 43e-A 0.11 1000 Example 43-B 78.4 Compound 43e-B 0.035 2240 Example 44-A 65.4 Compound 43e-B 0.035 1868.6 Example 44-B 96.7 Compound 43e-A 0.11 879.1 Example 45-A 153 Compound 45e-B or 0.26 or 0.39 588 or 392 Compound 45e-A Example 45-B >1000 Compound 45e-B or 0.26 or 0.39 >3846 or >2564 Compound 45e-A Example 46-A 45.5 Compound 45e-A or 0.26 or 0.39 175 or 116.7 Compound 45e-B Example 46-B 45.7 Compound 45e-B or 0.26 or 0.39 175.7 or 117.2 Compound 45e-A Example 47-A 10.9 Compound 47e-A or 0.021 or 0.025 519.0 or 436 Compound 47e-B Example 47-B 13.1 Compound 47e-A or 0.021 or 0.025 623.8 or 524 Compound 47e-B Example 48-A 18.3 Compound 47e-A or 0.021 or 0.025 871.4 or 732 Compound 47e-B Example 48-B 20.8 Compound 47e-A or 0.021 or 0.025 990.5 or 832 Compound 47e-B
Example 50
Metabolism of Prodrugs of Compound of Formula (I)
[0644] A study was undertaken to evaluate the metabolic conversion of prodrugs, compound of formula (I), to its corresponding active form. The compounds of formula (I), if served as prodrugs, can be metabolized to the active compound or other compounds of the invention in the body. Human liver microsomes are often used to assess the degree of metabolic conversion of prodrugs in the body of animal or human.
Materials
[0645] NADPH cofactor system including -Nicotinamide adenine dinucleotide phosphate (NADP), isocitric acid and isocitric dehydrogenase were purchased from Sigma-Aldrich Co. (St. Louis, Mo., USA). Human liver microsomes (Cat No. 452117, Lot No. 38290) were obtained from Corning (Woburn, Mass., USA). Mouse liver microsomes (Cat No. M1000, Lot No. 1310028) were obtained from Xenotech.
Working Solution of the Compounds and Other Solution
[0646] Compounds were dissolved in DMSO to make 10 mM stock solutions. 10 L of the stock solution was diluted with acetonitrile (990 L) to get a 100 M working solution.
Incubation
[0647] Microsomes were preincubated with test compound for 10 min at 37 C. in 100 mM potassium phosphate buffer with pH 7.4. The reactions were initiated by adding NADPH regenerating system to give a final incubation volume of 200 L and shaken in a water bath at 37 C. Incubation mixtures consisted of liver microsomes (0.5 mg microsomal protein/mL), substrates (1.0 M), and NADP (1 mM), isocitric dehydrogenase (1 unit/mL), isocitric acid (6 mM).
Preparation of Samples for Analysis
[0648] At 30 min, reaction was quenched by adding 600 L cold acetonitrile (including 100 ng/mL tolbutamide and 100 ng/mL labetalol as internal standard). The samples were centrifuged at 4000 rpm for 20 minutes and the resultant supernatants were subjected to LC-MS/MS analysis.
[0649] The samples for calibration curve were prepared as followed. Dispense 100 L/well liver microsomes and 98 L/well NADPH regenerating system solution to 96-well plate. Add 600 L quenching solution first, and then followed by 2 L Standard curve and QC working solution.
Bioanalysis
[0650] The compounds were quantified on an API4000 LC-MC/MC instrument in the ESI-Positive MRM mode.
[0651] A study was undertaken to evaluate the metabolic conversion of prodrugs (1 M), Example 1, Example 1-A, Example 1-B, Example 2, Example 2-A, Example 2-B, Example 3, Example 4, Example 5, Example 6, Example 7, Example 8, Example 9, Example 10, Example 11, Example 12, Example 13, Example 14, Example 15, Example 16, Example 17, Example 21, Example 22, Example 23, Example 25, Example 26, Example 27, Example 28 Example 29, Example 30, Example 31, Example 32, Example 33, Example 34-A, Example 34-B, Example 36-A, Example 36-B, Example 37-A, Example 37-B, Example 38-A, Example 38-B, Example 39, Example 40, Example 41, Example 41-A, Example 41-B, Example 42, Example 42-A, Example 42-B, Example 43, Example 43-A, Example 43-B, Example 44, Example 44-A, Example 44-B and Example 45-A, Example 46-A, Example 46-B, Example 47-A, Example 47-B, Example 48-A, Example 48-B to the corresponding active forms, Compound 1e, Compound 1e-A, Compound 1e-B, Compound 34e-A, Compound 34e-B, Compound 36g-A, Compound 36g-B, Compound 36g, Compound 41c, Compound 41c-B, Compound 41c-A, Compound 43e, Compound 43e-A, Compound 43e-B, Compound 45e-A, Compound 45e-B, Compound 47e-A, and Compound 47e-B in the presence of human liver microsomes. Results were summarized and shown in Table 2.
TABLE-US-00002 TABLE 2 Metabolic conversion of prodrugs in human liver microsomes Metabolized product Corresponding concentration Metabolized Product in human liver Example No. (active form) microsomes (M) Example 1 Compound 1e 0.0214 Example 1-A Compound 1e-A 0.018 Example 1-B Compound 1e-B 0.022 Example 2 Compound 1e 0.028 Example 2-A Compound 1e-B 0.036 Example 2-B Compound 1e-A 0.029 Example 3 Compound 1e 0.12 Example 5 Compound 1e 0.078 Example 6 Compound 1e 0.074 Example 7 Compound 1e 0.15 Example 8 Compound 1e 0.043 Example 9 Compound 1e 0.002 Example 10 Compound 1e 0.005 Example 11 Compound 1e 0.001 Example 12 Compound 1e 0.018 Example 13 Compound 1e 0.04 Example 14 Compound 1e 0.026 Example 15 Compound 1e 0.002 Example 16 Compound 1e 0.024 Example 17 Compound 1e 0.075 Example 21 Compound 1e 0.48 Example 22 Compound 1e 0.42 Example 23 Compound 1e 0.42 Example 25 Compound 1e 0.018 Example 26 Compound 1e 0.042 Example 27 Compound 1e 0.11 Example 28 Compound 1e 0.084 Example 29 Compound 1e 0.009 Example 31 Compound 1e 0.005 Example 32 Compound 1e 0.013 Example 33 Compound 1e 0.59 Example 34-A Compound 34e-A 0.2 Example 34-B Compound 34e-B 0.088 Example 36-A Compound 36g-A 0.02 Example 36-B Compound 36g-B 0.019 Example 37-A Compound 36g-A 0.004 Example 37-B Compound 36g-B 0.002 Example 38-A Compound 36g-A 0.026 Example 38-B Compound 36g-B 0.034 Example 40 Compound 36g 0.032 Example 41-A Compound 41c-B 0.38 Example 41-B Compound 41c-A 0.36 Example 42-A Compound 41c-A 0.14 Example 42-B Compound 41c-B 0.004 Example 43-A Compound 43e-A 0.014 Example 43-B Compound 43e-B 0.016 Example 44-A Compound 43e-B 0.002 Example 44-B Compound 43e-A 0.002 Example 45-A Compound 45e-B or 0.41 Compound 45e-A Example 46-A Compound 45e-A or 0.039 Compound 45e-B Example 46-B Compound 45e-B or 0.18 Compound 45e-A Example 47-A Compound 47e-A or 0.36 Compound 47e-B Example 47-B Compound 47e-B or 0.41 Compound 47e-A Example 48-A Compound 47e-A or 0.11 Compound 47e-B Example 48-B Compound 47e-B or 0.053 Compound 47e-A
Example 51
In Vivo Antiviral Efficacy of Example 43-A in AAV-HBV Mouse Model
Animal Model
[0652] 4-6 week old male C57BL/6 mice, specific pathogen free, were purchased from Shanghai Laboratory Animal Center of Chinese Academy of Sciences (SLAC) and housed in an animal care facility in individually ventilated cages under controlled temperature and light conditions following the Institutional Animal Care guidelines. AAV-HBV virus was purchased from Beijing FivePlus Molecular Medicine Institute (Beijing, China). The recombinant virus carries 1.3 copies of the HBV genome packaged into AAV serotype 8 (AAV8) capsids. C57BL/6 mice were injected with 200 L of the recombinant virus diluted in saline buffer through tail vein. On day 14, the mice were bled to measure HBV surface antigen (HBsAg) and HBV genomic DNA in the serum, and animals were then randomized into groups according to these HBV biomarkers.
Measurement of HBV Biomarkers
[0653] Serum HBsAg and HBeAg were measured using CLIA kits (Autobio Diagnostics Co., Ltd., Zhengzhou, China) according to the manufacturer's instructions. The lower limit of detection for HBsAg was 0.05 IU/mL. Serum dilution of 500-fold was used to obtain values within the linear range of the standard curve.
[0654] Serum HBV DNA was extracted using a MagNA Pure 96 DNA and Viral NA Small Volume Kit (Roche) following the manufacturer's instructions. The DNA samples were analyzed by real-time quantitative PCR (qPCR) using a HBV-specific primer and probe set for specific amplification and detection of a 128 bp HBV genome region from the nucleotide 2969 to 3096. The sequences of the primers and probe are:
TABLE-US-00003 Forwardprimer: AAGAAAAACCCCGCCTGTAA; Reverseprimer: CCTGTTCTGACTACTGCCTCTCC; HBV-Probe: 5TAMRA-CCTGATGTGATGTTCTCCATGTTCAGC-BHQ2-3.
[0655] Anti-HBs in the serum was tested using Anti-HBs CLIA kits (Autobio Diagnostics Co., Ltd., Zhengzhou, China) and mouse anti-IgG conjugated with Biotin (0.5 mg/mL) from a Mabtech B Elispot kit. The anti-IgG Biotin was diluted in PBS with a final concentration of 1 g/mL. 25 L of mouse anti-IgG were mixed with serum samples in wells of the plate in the Anti-HBs CLIA kit for 1-hour incubation. Then wash the plate and add Streptavidin-HRP for 1-hour incubation at room temperature. After repeating the washing step, mix substrate A and B from the CLIA kit and add 50 L of the mixture in each well. After 5-min incubation at room temperature, the plate was read on an Envision Plate Reader (PerkinElmer) to measure luminecence.
Study Design and Results
[0656] The mouse model with high level expression of both HBV DNA and HBsAg was generated by injecting C57BL/6 mice with a recombinant adeno-associated virus (AAV) carrying a replicable HBV genome (AAV-HBV). With long-lasting HBV viremia and fully competent immune system, the AAV-HBV mouse model was utilized to evaluate the antiviral efficacy of the TLR7 agonists following the study design as shown in Table 3.
TABLE-US-00004 TABLE 3 In vivo efficacy test of Example 43-A in AAV-HBV mouse model Animal Test Dose group article (mg/kg) Route Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 10 PO QOD 42 days 3 43-A 10 PO QW 42 days
[0657] Specifically, groups 2 and 3 were orally dosed with Example 43-A at 10 mg/kg every other day (QOD) and once weekly (QW), respectively, and the control group 1 received only Vehicle. At the dosing volume of 10 mL/kg, Example 43-A (1 mg/mL) was formulated as an inclusion complex with 2% Klucel LF, 0.5% TPGS, 0.09% Methylparabens, 0.01% Propylparabens in water. The animals were treated for a total of 42 days, and were submandibularly bled twice per week for serum collection throughout the study. The serum samples were subjected to analysis of HBV biomarkers.
[0658] As shown in
Example 52
In Vivo Antiviral Efficacy of Example 41-A in AAV-HBV Mouse Model
[0659] The antiviral efficacy of Example 41-A was evaluated in the same AAV-HBV model following the study design in Table 4 with the same methods to measure HBV biomarkers as described in Example 51.
TABLE-US-00005 TABLE 4 In vivo efficacy test of Example 41-A in AAV-HBV mouse model Animal Test Dose group article (mg/kg) Route Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 1 PO QOD 42 days 3 41-A 3 PO QOD 42 days 4 10 PO QOD 42 days 5 10 PO QW 42 days
[0660] Specifically, groups 2, 3 and 4 were orally dosed with Example 41-A at 1, 3 and 10 mg/kg QOD respectively. Group 5 was treated with 10 mg/kg QW, while group 1 with only Vehicle. At the dosing volume of 10 mL/kg, Example 41-A (0.1, 0.3, and 1 mg/mL) was formulated as an inclusion complex with 2% Klucel LF, 0.5% TPGS, 0.09% Methylparabens, 0.01% Propylparabens in water. The animals were treated for a total of 42 days, and were submandibularly bled twice per week for serum collection throughout the study. The serum samples were subjected to analysis of HBV biomarkers.
[0661] As shown in
Example 53
In Vivo Antiviral of Example 42-A Efficacy in AAV-HBV Mouse Model
[0662] The antiviral efficacy of Example 42-A was evaluated in the same AAV-HBV model following the study design in Table 5 with the same methods to measure HBV biomarkers as described in Example 51.
TABLE-US-00006 TABLE 5 In vivo efficacy test of Example 42-A in AAV-HBV mouse model Animal Test Dose group article (mg/kg) Route Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 1 PO QOD 42 days 3 42-A 3 PO QOD 42 days 4 10 PO QOD 42 days
[0663] Specifically, groups 2, 3, and 4 were orally dosed with Example 42-A at 1, 3, and 10 mg/kg QOD respectively, while group 1 with only Vehicle. At the dosing volume of 10 mL/kg, Example 42-A (0.1, 0.3, and 1 mg/mL) was formulated as an inclusion complex with 2% Klucel LF, 0.5% TPGS, 0.09% Methylparabens, 0.01% Propylparabens in water. The animals were treated for a total of 42 days, and were submandibularly bled twice per week for serum collection throughout the study. The serum samples were subjected to analysis of HBV biomarkers.
[0664] As shown in
Example 54
In Vivo Antiviral Efficacy of Example 41-B in AAV-HBV Mouse Model
[0665] The antiviral efficacy of Example 41-B was evaluated in the same AAV-HBV model following the study design in Table 6 with the same methods to measure HBV biomarkers as described in Example 51.
TABLE-US-00007 TABLE 6 In vivo efficacy test of Example 41-B in AAV-HBV mouse model Animal Dose group Test article (mg/kg) Route Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 1 PO QOD 42 days 3 41-B 3 PO QOD 42 days 4 10 PO QOD 42 days
[0666] Specifically, groups 2, 3, and 4 were orally dosed with Example 41-B at 1, 3, and 10 mg/kg QOD, respectively, while group 1 with only Vehicle. At the dosing volume of 10 mL/kg, Example 41-B (0.1, 0.3, and 1 mg/mL) was formulated as an inclusion complex with 2% Klucel LF, 0.5% TPGS, 0.09% Methylparabens, 0.01% Propylparabens in water. The animals were treated for a total of 42 days, and were submandibularly bled twice per week for serum collection throughout the study. The serum samples were subjected to analysis of HBV biomarkers.
[0667] As shown in
Example 55
Single Dose PK Study in Male Wister-Han Rats
[0668] The single dose PK in Male Wister-Han Rats was performed to assess pharmacokinetic properties of tested compounds. Two groups of animals were dosed via Gavage (POE) of the respective compound. Blood samples (approximately 20 L) were collected via Jugular vein or an alternate site at 15 min, 30 min, 1 H, 2 h, 4 h, 7 h and 24 h post-dose groups. Blood samples were placed into tubes containing EDTA-K2 anticoagulant and centrifuged at 5000 rpm for 6 min at 4 C. to separate plasma from the samples. After centrifugation, the resulting plasma was transferred to clean tubes for bioanalysis of both prodrug and active form on LC/MS/MS. In the groups that prodrug were dosed, the concentration of prodrugs in the plasma samples was under the detection limit. The tested compound in Table 8 was used as the internal standard for testing the metabolite (active form) of dose compound in vivo. The pharmacokinetic parameters were calculated using non-compartmental module of WinNonlin Professional 6.2. The peak concentration (C.sub.max) was recorded directly from experimental observations. The area under the plasma concentration-time curve (AUC.sub.0-t) was calculated using the linear trapezoidal rule up to the last detectable concentration.
[0669] C.sub.max and AUC.sub.0-last are two critical PK parameters related to the in vivo efficacy of the tested compound. Compounds with higher C.sub.max and AUC.sub.0-last will lead to the better in vivo efficacy. Results of PK parameters following oral administration of active forms and competitor compounds are given in Table 7. The PK parameters of prodrugs are tabulated in Table 8.
[0670] Following oral administration of prodrugs, the active forms were observed in plasma and therefore tested. The exemplified prodrugs of present invention (Example 41-B, 42-A, 42-B, 43-A, 45-A and 45-B) surprisingly showed much improved C.sub.max (5-175 folds increase) and AUC.sub.0-last (2.5-56 folds increase) comparing with reference compounds (GS9620, S-2 and S-3) and compounds mentioned in present invention (Compound 41c-A, 41c-B and 43e-A) which are all active forms. The results clearly demonstrated the unexpected superiority of prodrugs over active forms on PK parameters which led to better in vivo efficacy.
TABLE-US-00008 TABLE 7 The mean plasma concentration and PK parameters of active forms after 5 mg/kg oral dosing Dose compound Compound GS9620 S-2 S-3 41c-A Time (h) Mean plasma concentration (nM) 0.25 56.3 9.49 8.89 16.75 0.5 33.2 16.74 9.99 27.48 1 83.4 19.33 10.16 32.33 2 136 24.89 8.40 27.34 4 16.7 47.55 11.54 27.38 8* 9.49 52.72 8.17 18.02 24 ND 4.90 ND 5.60 C.sub.max (nM) 164 52.72 11.54 32.33 AUC.sub.0-last 316 748 95 242.5 (nM .Math. h) Dose compound Compound Compound Compound Compound 41c-B 43e-A 45e-A 45e-B Time (h) Mean plasma concentration (nM) 0.25 3.41 12.60 64.6 42.8 0.5 0.75 15.22 80.0 52.2 1 2.04 13.01 58.1 37.6 2 5.46 11.98 42.5 24.2 4 2.52 8.20 77.8 53.9 8* 1.21 6.31 34.6 29 24 ND ND 8.6 5.7 C.sub.max (nM) 5.46 15.22 80.0 53.9 AUC.sub.0-last 55.8 77 767 568 (nM .Math. h) *7 hrs for Compound 41-cA, Compound 41c-B and Compound 43e-A
TABLE-US-00009 TABLE 8 PK Parameters of prodrugs after 5 mg/kg oral dosing Dose Tested C.sub.max AUC.sub.0-last compound compound (nM) (nM .Math. h) Example 41-B Compound 41c-A 1315 3658 Example 42-A Compound 41c-A 1742 4867 Example 42-B Compound 41c-B 956 3148 Example 43-A Compound 43e-A 77 229 Example 45-A Compound 45e-B 922 1914 Example 45-B Compound 45e-A 1436 2619
Example 56
LYSA Solubility Study
[0671] LYSA study is used to determine the aqueous solubility of tested compounds. Samples were prepared in duplicate from 10 mM DMSO stock solution. After evaporation of DMSO with a centrifugal vacuum evaporator, the compounds were dissolved in 0.05 M phosphate buffer (pH 6.5), stirred for one hour and shaken for two hours. After one night, the solutions were filtered using a microtiter filter plate. Then the filtrate and its 1/10 dilution were analyzed by HPLC-UV. In addition, a four-point calibration curve was prepared from the 10 mM stock solutions and used for the solubility determination of the compounds. The results were in pg/mL. In case the percentage of sample measured in solution after evaporation divided by the calculated maximum of sample amount was bigger than 80%, the solubility was reported as bigger than this value.
[0672] Results of LYSA were shown in Table 9. It was clear that the solubility of active forms were surprisingly improved by 10 to over 200 folds when converted to various prodrugs.
TABLE-US-00010 TABLE 9 Solubility data of particular compounds LYSA of Corresponding LYSA of Active Prodrugs Active Forms Prodrugs (g/mL) Forms (g/mL) Example 1 290 Compound 1e 21 Example 1-A 315 Compound 1e-A 56 Example 1-B 200 Compound 1e-B 50 Example 2 615 Compound 1e 21 Example 2-A >600 Compound 1e-B 50 Example 2-B >590 Compound 1e-A 56 Example 3 240 Compound 1e 21 Example 4 695 Compound 1e 21 Example 5 >595 Compound 1e 21 Example 6 140 Compound 1e 21 Example 7 615 Compound 1e 21 Example 8 620 Compound 1e 21 Example 9 >520 Compound 1e 21 Example 10 120 Compound 1e 21 Example 11 >618 Compound 1e 21 Example 12 120 Compound 1e 21 Example 13 155 Compound 1e 21 Example 14 225 Compound 1e 21 Example 15 405 Compound 1e 21 Example 16 205 Compound 1e 21 Example 17 190 Compound 1e 21 Example 25 >670 Compound 1e 21 Example 26 >690 Compound 1e 21 Example 27 >380 Compound 1e 21 Example 28 695 Compound 1e 21 Example 29 395 Compound 1e 21 Example 32 125 Compound 1e 21 Example 36-A 168 Compound 36g-A 6 Example 36-B 209 Compound 36g-B 11 Example 41-A 260 Compound 41c-B 5 Example 41-B 250 Compound 41c-A 1 Example 42-A 225 Compound 41c-A 1 Example 42-B 335 Compound 41c-B 5 Example 43-A 203 Compound 43e-A 13 Example 43-B 170 Compound 43e-B 13 Example 45 172 Compound 45e 152 Example 45-A >560 Compound 45e-A or 90 or 115 Compound 45e-B Example 45-B 420 Compound 45e-B Or 115 or 90 Compound 45e-A Example 46-A 205 Compound 45e-A Or 90 or 115 Compound 45e-B Example 46-B >580 Compound 45e-B Or 115 or 90 Compound 45e-A Example 47-A 154 Compound 47e-A or <1.0 or <1.0 Compound 47e-B Example 47-B 128 Compound 47e-B or <1.0 or <1.0 Compound 47e-A Example 48-A 305 Compound 47e-A or <1.0 or <1.0 Compound 47e-B Example 48-B 275 Compound 47e-B or <1.0 or <1.0 Compound 47e-A
Example 57
Portal Vein Study
[0673] The objective of this study was to understand whether prodrug remains unchanged as it was absorbed through the intestine into the portal circulation and demonstrate the primary site of conversion.
Surgical procedure for Portal vein cannulation (PVC) and Carotid artery cannulation (CAC)
[0674] Surgery was performed under pentobarbital/isoflurane anesthesia. Briefly, after disinfecting the abdominal area with betadine and 70% isopropyl alcohol, a small abdominal mid-line incision was made. The cecum was pulled out and mesenteric vein was identified and isolated for about 5 mm vessel. A loose ligature was placed proximally and distal end of the vein was ligated. Make a small incision (just enough to allow the insertion of the catheter) on isolated vein and insert the PU catheter towards liver for appropriate length. The catheter was secured in place by tying the loose ligature around the cannulated vessel. The cecum was replaced into abdominal cavity. A hole was made in the right abdominal wall to make the end of catheter pass freely. The catheter was secured by suture on the abdominal wall. The abdominal muscle incision was closed with suture. A small incision was made in the scapular area to serve as the exit site of the catheter. The catheter was subcutaneously tunneled and exteriorized through the scapular incision. A fixed suture was placed in the scapular region. The patency of the catheter was checked and then exteriorized from the subcutaneous space to the dorsal neck region. After gently wiping the area, the abdominal cavity was sutured. The left carotid artery was then cannulated by inserting a PESO catheter. Both the exteriorized catheters were tied firmly on the dorsal neck region and fixed. The animals was then allowed to recover in its cage and used for study at least 3 days after surgery. All catheters were flushed once daily with heparinized saline to maintain patency.
Oral PK study in PVC/CAC Dual Cannulated Rat
[0675] Animals were fasted overnight (n=3) and administered vial oral gavage (10 mg/kg, 10 mL/kg). Blood samples (60 L) were collected simultaneously from the portal and carotid artery catheters at 0.083, 0.25, 0.5, 1, 2, 4, 7, 24 h. All blood samples will be transferred into microcentrifuge tubes containing 2 L of K.sub.2EDTA (0.5M) as anti-coagulant and placed on wet ice. Then blood samples will be processed for plasma by centrifugation at approximately 4 C., 3000 g within half an hour of collection. Plasma samples will be stored in polypropylene tubes, quick frozen over dry ice and kept at 7010 C. until LC/MS/MS analysis.
[0676] Pharmacokinetic parameters (meanSD, n=3) of prodrugs and active forms in portal and carotid samples following oral administration of prodrugs (10 mg/kg) in portal vein cannulated rat were detected and analyzed. The test results of Example 1-B, 41-A, 41-B, 42-A and 43-A were summarized below.
TABLE-US-00011 TABLE 10 Pharmacokinetic parameters of Example 41-A and its corresponding active form Compound 41c-B in portal and carotid samples following oral administration of Example 41-A (10 mg/kg) in portal vein cannulated rat Prodrug Example 41-A Corresponding Active Form Compound 41c-B Portal sampling Carotid sampling PK parameter prodrug active form prodrug active form T.sub.max (h) 0.14 0.4 0.19 0.42 C.sub.max (nM) 9703 2223 210 2185 AUC.sub.0-2 (nM .Math. h) 2188 2246 114 2108 AUC.sub.active/AUC.sub.total 51% 95%
TABLE-US-00012 TABLE 11 Pharmacokinetic parameters of Example 43-A and its corresponding active form Compound 43e-A in portal and carotid samples following oral administration of Example 43-A (10 mg/kg) in portal vein cannulated rat Prodrug Example 43-A Corresponding Active Form Compound 43e-A Portal sampling Carotid sampling PK parameter prodrug active form prodrug active form T.sub.max (h) 0.28 0.33 0.22 0.28 C.sub.max (nM) 4110 818 191 691 AUC.sub.0-2 (nM .Math. h) 2067 679 124 564 AUC.sub.active/AUC.sub.total 25% 82%
TABLE-US-00013 TABLE 12 Pharmacokinetic parameters of Example 1-B and its corresponding active form Compound 1e-A in portal and systemic samples following oral administration of Example 1-B (10 mg/kg) in portal vein cannulated rat Prodrug Example 1-B Corresponding Active Form Compound 1e-A Portal sampling Carotid sampling PK parameter prodrug active form prodrug active form T.sub.max (h) 0.083 0.25 0.083 0.5 C.sub.max (nM) 670 192 70 174 AUC.sub.0-2 (nM .Math. h) 266 164 40 184 AUC.sub.active/AUC.sub.total 38% 82%
TABLE-US-00014 TABLE 13 Pharmacokinetic parameters of Example 42-A and its corresponding active form Compound 41c-A in portal and carotid samples following oral administration of Example 42-A (10 mg/kg) in portal vein cannulated rat Prodrug Example 42-A Corresponding Active Form Compound 41c-A Portal sampling Carotid sampling PK parameter prodrug active form prodrug active form T.sub.max (h) 0.19 0.42 0.22 0.36 C.sub.max (nM) 8917 3162 286 3326 AUC.sub.0-2 (nM .Math. h) 3461 3199 286 3326 AUC.sub.active/AUC.sub.total 48% 96%
TABLE-US-00015 TABLE 14 Pharmacokinetic parameters of Example 41-B and its corresponding active form Compound 41c-A in portal and carotid samples following oral administration of Example 41-B (10 mg/kg) in portal vein cannulated rat Prodrug Example 41-B Corresponding Active Form Compound 41c-A Portal sampling Carotid sampling PK parameter prodrug active form prodrug active form T.sub.max (h) 0.19 0.5 0.25 0.5 C.sub.max (nM) 7068 3315 29.6 3432 AUC.sub.0-2 (nM .Math. h) 1444 3211 22.5 3301 AUC.sub.active/AUC.sub.total 69% 99%
[0677] Based on the above results, it was concluded that the primary site of conversion of prodrug was liver rather than intestine, because AUC.sub.active/AUC.sub.total was higher in sampling from carotid artery compared to AUC.sub.active/AUC.sub.total in sampling from portal vein.