HYBRID PROTEIN FOR THE IDENTIFICATION OF NEDDYLATED SUBSTRATES

20180074072 ยท 2018-03-15

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a recombinant protein composed by the fusion of Glutathione S-transferase (GST), or an esa-histidine peptide (poly-His), or Maltose Binding Protein (MBP), to the Carboxyl-terminus end of the human KHNYN protein, containing residues 597-678 or a region including at least the amino acidic region 630-678. Also disclosed is a second recombinant protein where the Carboxyl-terminus end of the human KHNYN protein, containing residues 627-678 is genetically fused in a tandem construct to the Carboxyl-terminus end of KHNYN including residues 597-678. The tandem construct is N-terminally tagged with Glutathione S-transferase (GST), or an esa-histidine peptide (poly-His), or Maltose Binding Protein (MBP). The potential use of these Neddylation sensors also called Neddylation probes to isolate mono-, poly-neddylated targets as well as substrates modified by the addition of ubiquitin-NEDD8 mixed chains is considered.

    Claims

    1-8. (canceled)

    9. A protein characterized in that it shows a clear preference for the ubiquitin-like NEDD8, consisting of KH and NYN Domain Containing Protein (KHNYN) for the isolation and subsequent identification of ubiquitinated and neddylated substrates, such a protein consisting of the nucleotide sequence coding for the carboxyl-terminus end of the KHNYN human as shown in SEQ ID No.: 1, including aminoacids 597-678 as defined in SEQ ID No.: 2, and in any case including at least the region spanning amino acids 627-678.

    10. The protein according to claim 9 and showing at least 60% sequence identity with SEQ ID No.: 2.

    11. The protein according to claim 9, consisting of a tandem repeat of the carboxyl-terminus end of KHNYN for the isolation and subsequent identification of ubiquitinated and neddylated substrates, such a protein consisting of the nucleotide sequence coding for the carboxyl-terminus end of the KHNYN human spanning residues 627-678 as shown in SEQ ID No.: 3 (nucleotides) and in SEQ ID No.: 4 (amino acids) genetically fused with the amino acid region of KHNYN including residues 597-678.

    12. The protein according to claim 9, consisting of the carboxyl-terminus end of KHNYN fused to the GST (GST-KHNYN), such a recombinant protein herein called as a neddylation sensor or neddylation probe, for the isolation and subsequent identification of ubiquitinated and neddylated substrates, such a protein consisting of the nucleotide sequence coding for the carboxyl-terminus end of the KHNYN human spanning residues 597-678 as shown in SEQ ID No.: 6 and in SEQ ID No.: 7.

    13. The protein according to claim 11, consisting of a tandem repeat up to four carboxyl-terminus ends of KHNYN fused to the GST (GST-Tandem), for the isolation and subsequent identification of ubiquitinated and neddylated substrates, such a recombinant protein consisting of the nucleotide sequence coding for the carboxyl-terminus end of the KHNYN human spanning residues 627-678 genetically fused with the nucleotide sequence coding for the amino acid region of KHNYN including residues 597-678 as shown in SEQ ID No.: 8 and in SEQ ID No.: 9.

    14. A method for the isolation and the subsequent identification by mass spectrometry analysis of mono-neddylated, poly-neddylated substrates as well as substrates modified by the addition of ubiquitin-NEDD8 mixed chains by in vivo and in vitro assays, comprising providing the GST-KHNYN recombinant protein and the GST-Tandem, according to claim 12, and applying the GST-KHNYN recombinant protein and the GST-Tandem to perform the isolation and the subsequent identification.

    15. A method for studying NEDD8 regulated processes, comprising providing the GST-KHNYN recombinant protein and the GST-Tandem construct, according to claim 12, and applying the GST-KHNYN recombinant protein and the GST-Tandem construct to perform said study.

    16. A sensor or probe for the identification of biomarkers for disease prediction, comprising the GST-KHNYN recombinant protein and the GST-Tandem construct, according to claim 12.

    17. A method for the isolation and the subsequent identification by mass spectrometry analysis of mono-neddylated, poly-neddylated substrates as well as substrates modified by the addition of ubiquitin-NEDD8 mixed chains by in vivo and in vitro assays, comprising providing the GST-KHNYN recombinant protein and the GST-Tandem, according to claim 13, and applying the GST-KHNYN recombinant protein and the GST-Tandem to perform the isolation and the subsequent identification.

    18. A method for studying NEDD8 regulated processes, comprising providing the GST-KHNYN recombinant protein and the GST-Tandem construct, according to claim 13, and applying the GST-KHNYN recombinant protein and the GST-Tandem construct to perform said study.

    19. A sensor or probe for the identification of biomarkers for disease prediction, comprising the GST-KHNYN recombinant protein and the GST-Tandem construct, according to claim 13.

    Description

    DETAILED DESCRIPTION OF THE INVENTION

    [0009] In the following paragraph, the details for the development and use of the probes are described. Preferred embodiments can be performed following the three steps previously described or varying each step depending on the specific features of the expression system. Here is shown only one of the possible procedures. In the embodiment described in the present invention, the recombinant protein includes from the N-terminal to the C-terminal end: i) the glutathione S-transferase (GST) amino acid sequence; ii) a linker sequence localized downstream to the GST and iii) the Carboxyl-terminus end of human KHNYN. In the preferred embodiment, the GST fusion protein includes the nucleotide sequence coding for the C-terminal end of human KHNYN protein, spanning residues 597-678 and defined by the SEQ ID No.: 1, or an homologue having 60%, preferably at least 80%, most preferably at least 90% of sequence identity with SEQ ID No.: 1 and having the function of the native human KHNYN derived from SEQ ID: No.: 1; in the preferred embodiment, the GST fusion protein includes as a minimum the nucleotide sequence coding for the C-terminal end of human KHNYN protein, spanning residues 630627-678 and defined by the SEQ ID No.: 1, or an homologue having 60%, preferably at least 80%, most preferably at least 90% of sequence identity with SEQ ID No.: 1 and having the function of the native human KHNYN derived from SEQ ID: No.: 1. In an alternative embodiment, analogously to what has been described for ubiquitin sensors, the minimal NEDD8 binding region of KHNYN spanning residues 627-678 can be repeated in tandem up to four repeats, eventually separated by a linker, with the aim of increasing the binding affinity for ubiquitinated and neddylated substrates. If present, the linker is represented by an amino acidic chain of 1 to 20 aminoacids. The tandem repeat construct would allow the isolation of substrates that are modified by the addition of poly-neddylated chains as well as ubiquitin-NEDD8 mixed chains. In embodiments that are alternative to the one that is preferred and here described, the NEDD8 probe based on the KHNYN protein can be genetically fused to Maltose binding protein (MBP) or the esa-Histidine tag (6His). In an alternative embodiment, which is not described here in detail, the NEDD8 sensor based on the human C-terminal end of KHNYN can be achieved through the genetically fusion of the Flag epitope, Myc epitope or any other amino acid sequence aimed at facilitating the expression and purification of the recombinant protein, following transient or stable transfection of the expression vector in eukaryotic cells.

    [0010] Set out below is the description of the method used for the expression and purification of the recombinant proteins GST-KHNYN and GST-Tandem in prokaryotic cells. The amino acid region shows the features that guarantee the production of a highly soluble, abundant and stable protein. The recombinant construct comprehends the GST that is genetically fused to the NEDD8 binding region of KHNYN (GST-KHNYN) or the Tandem repeat (GST-Tandem). Probes construction follows the methods that are typically used in molecular biology, while the expression in bacterial cells and purification by affinity chromatography are used for the production of the recombinant protein.

    Step IPreparation of the Recombinant Proteins GST-KHNYN and GST-Tandem

    [0011] The cDNA coding for the Carboxyl-terminus end (aa 597-678) of human KHNYN (SEQ ID No.: 1) has been amplified by PCR using as template a phagemid vector in which the indicated region is genetically fused to the C-terminal end of the capsid protein of lambda bacteriophage (1). For the amplification by PCR, the following primers have been used: R2249 (5 CAAGGATCCACGCAGGGGTCTTCTAAG 3) adding a restriction site for the BamHI enzyme, and R2160 (5 GTTGAATTCTCAAAAGTTAAGACTGAG 3 that inserts a restriction site for the EcoRI enzyme and the stop codon. The destination plasmid vector is pGex2TK from Pharmacia. The fragment obtained by PCR amplification has been digested with BamHI and EcoRI and ligated in the pGex plasmid vector, following the procedures described in Sambrook, Fritsch ET Maniatis Molecular cloning, a laboratory manual (1989). For the generation of the tandem construct, the amino acid region spanning residues 627-678 of human KHNYN was amplified by PCR using the following primers: the forward primer R2251 (5 CAAGGATCCGGTGGCATTCGGAAGACC 3) that introduces a restriction site for BamHI and the reverse primer R2150 (5 ACAGATCTGCAAAGTTAAGACTGAGCAGGG 3) that inserts a restriction site for BglII and misses the stop codon. The purified DNA fragment was digested with BamHI and BglII and cloned in the GST-KHNYN plasmid previously linearized by BamHI digestion. The DNA extracted from isolated clones of GST-KHNYN and GST-Tandem was verified by nucleotide sequencing of the poly-linker.

    Step IIProduction and Purification of the Recombinant Proteins

    [0012] The protocol for the expression and purification is derived from the standard protocol used for the production of proteins fused to the GST in bacterial cells. The procedure here specified for descriptive purpose can be varied in one or more steps.

    [0013] Set out below is the description of the method used for the production of the recombinant protein GST-KHNYN and GST-Tandem. The plasmid coding for the Neddylation probes allows the expression in BL21 E. coli bacterial cells of the recombinant proteins under the control of IPTG (Isopropyl -D-1-thiogalactopyranoside) inducible lac promoter. The protocol consists of three steps: (i) expression of the recombinant protein in BL21 cells; (ii) resuspension and solubilisation of the bacterial pellet and (iii) purification of the recombinant protein by affinity chromatography.

    Step I: Induction of the Recombinant Protein in BL21 Bacterial Cells.

    [0014] 1. Transform the expression plasmid into BL21. Plate on antibiotic selection plates and incubate overnight at 37 C. [0015] 2. Resuspend a single colony in liquid culture with antibiotic (starter culture). Inoculate starter culture at a 1:100 dilution into expression media containing antibiotic. [0016] 3. Incubate at 37 C. with shaking until OD600 reaches 0.6-0.8. [0017] 4. Induce with 0.5 mM IPTG (Sigma, St. Louis, Mo.) and express protein for 5 hours at 30 C.

    Step II: Resuspension and Solubilisation of the Bacterial Pellet

    [0018] 1. Centrifuge your bacterial culture for 20 minutes at 5,000 RPM. [0019] 2. Resuspend the bacterial pellet in 2 ml of lysis buffer prepared as follow: [0020] 50 mM Tris pH 7.5, 100 mM NaCl, 2 mM EDTA, 2 mM DTT, 1 mM PMSF, 1% Triton, Protease inhibitor cocktail (CompleteSIGMA) [0021] 3. Freeze at 80 C.

    Step III: Purification of the Recombinant Proteins GST-KHNYN and GST-Tandem by Affinity Chromatography.

    [0022] 1. Thaw the resuspended pellet and add fresh inhibitors. [0023] 2. Sonicate the suspension 5 times for 10 seconds (with 15 seconds pause between each pulse) [0024] 3. Centrifuge at 14,000 RPM for 20 minutes at 4 C. [0025] 4. Incubate the supernatant with 100 l of glutathione-sepharose 4B (GE Healthcare) for 2 h at 4 C. Wash 5 times with 10 ml of lysis buffer. [0026] 5. Measure the protein concentration using the Bradford protein assay. [0027] 6. Check protein expression and purification by 10% SDS-PAGE followed by Coomassie blue staining (FIG. 1A,B).

    [0028] The recombinant protein has a molecular weight of approximately 36 kDa for GST-linker-KHNYN and 45 kDa for the GST-Tandem construct.

    Step IIIPull-Down Assay to Analyse the Binding Preference of KHNYN

    [0029] To analyse the binding preference of KHNYN toward purified Ubiquitin and NEDD8, 25 g of GST-KHNYN are incubated with 5 g of purified Ubiquitin or NEDD8 monomers in PBS1 (137 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4) for 90 min at 4 C. After three washes with cold PBS1, samples are analysed by Tricine-SDS-PAGE and immunoblotting with anti-Ubiquitin antibody from Santa Cruz (P4D1) that cross-reacts with NEDD8 and thus permits to recognize both monomers (FIG. 2). The result demonstrates that KHNYN shows a clear preference for NEDD8 monomers.

    Step IVPull-Down Assay for the Isolation of Neddylated Substrates from a Cellular Extract

    [0030] To isolate neddylated proteins from a cell culture, a pull-down assay was performed by using as cellular model the 293 T-Rex-flag-NEDD8 cell line obtained by stable integration of human NEDD8 fused to the Flag epitope. After induction with Doxycycline for 18 hours, a set of bands migrating at different molecular weights can be revealed by western-blotting of the cellular extract with anti-Flag antibody, indicating that the Flag-tagged NEDD8 has been conjugated to several cellular proteins (FIG. 3A). In detail, cells grown on dish for 24 hours are incubated with doxycycline for the indicated times, then harvested and lysed in lysis buffer (25 mM Tris pH 7.5, 125 mM NaCl, 1% glycerol, 1 mM MgCl2, 1 mM orthovanadate, 1 mM PMSF, 10 mM NaF, 20 mM NEM, eukaryotic inhibitor cocktail, 0.5% Triton, 0.5% NP-40). Cellular extracts are incubated on ice for 20 minutes and then centrifuged at 13000 rpm for 20 min at 4 C. The supernatant is recovered and quantified by Bradford protein assay. A total amount of 2 mg of cellular extract is incubated with 50 g of recombinant protein bound to glutathione-sepharose beads (GE Healthcare) for 2 hours in rotation at 4 C. Beads are washed three times with cold washing buffer (25 mM Tris pH 7.5, 125 mM NaCl, 1% glycerol, 1 mM MgCl2, 1 mM orthovanadate, 1 mM PMSF, 5 mM NaF, 5 mM NEM, eukaryotic inhibitor cocktail, 0.5% Triton, 0.5% NP-40) and resuspended in loading buffer (1% SDS, 10% glicerolo, 10 mM Tris-Cl, pH 6.8, 1 mM EDTA, 10 mM DTT, 0.05 mg/ml bromophenol blue). Samples are analysed by SDS-PAGE and immunoblotting with anti-Flag antibody (M2 monoclonal, SIGMA) and anti-ubiquitin (P4D1, Santa Cruz).

    [0031] As shown in FIG. 3B, the Carboxyl-terminus end of KHNYN, but not the GST alone, precipitated neddylated proteins as well as monomeric NEDD8. The recombinant protein is also able to associate with ubiquitinated substrates as shown by the immunoblotting with anti-ubiquitin antibody. The same samples have been analysed with antibodies specific for CUL1 (Zymed) and CUL2 (Zymed) demonstrating that both proteins have been recovered by GST-KHNYN (FIG. 2B). Particularly, while CUL2 is recovered only in its neddylated form, CUL1 bound GST-KHNYN both in the neddylated and non-neddylated forms. This difference can be explained by the observation that neddylated CUL1 interacts with the un-modified form, thus generating a stable homodimer that is recovered by GST-KHNYN. On the contrary, CUL2 only dimerizes in the neddylated form [16].

    Step VIn Vitro De-Ubiquitination and De-Neddylation Assays

    [0032] Samples obtained by incubating the recombinant GST-KHNYN with a T-Rex flag-NEDD8 cellular extract are resuspended in 50 ml of cold PBS1 pre-mixed with 5 mg of purified human USPS. The reaction is incubated for 30 minutes at 30 C. After washing three times with PBS, the reaction is resuspended in loading buffer and analysed by SDS-PAGE and immunoblotting with anti-Flag and anti-ubiquitin as previously described (FIG. 4A). As shown, the complete loss of ubiquitinated substrates is demonstrated by the absence of any anti-Ubiquitin signal in the lane corresponding to USP8 enzyme treatment. To further confirm that the recognition by KHNYN requires the NEDD8 modification on cullins, T-Rex-flag-NEDD8 cells plated on dishes were incubated with the NEDD8-activating enzyme inhibitor MLN4924. The pull-down assay performed as previously described confirms that, in the absence of neddylation, CUL2 cannot be precipitated by the NEDD8 binding domain of KHNYN (FIG. 4B). Finally, we compared the interaction of KHNYN with ubiquitinated and neddylated substrates after treatment with the de-neddylating enzyme NEDP1, the de-ubiquitinating enzyme USP8 or the NEDD8-activating enzyme inhibitor MLN4924 (FIG. 4C). As shown, the interaction with flag-tagged cellular proteins is similarly disrupted after MLN4924 or NEDP1 treatments (lanes 5 and 6). The interaction with ubiquitinated substrates is partly affected by the removal of neddylated proteins (lane 6), suggesting that part of the ubiquitinated substrates recovered by pull-down are proteins that are associated to Cullin-based complexes or to other neddylated substrates.

    Step VIIsolation of Neddylated Substrates from a Deneddylation Defective Cell Line

    [0033] The interaction of the C-terminal end of KHNYN with neddylated substrates were analysed in a cellular system where specific experimental conditions leading to an inhibition of the deneddylation process have been adopted (deneddylation defective cell line, called DD). Compared to the wild-type cell line, a global increase of neddylation can be observed in DD cells (FIG. 5). Equal amounts of cellular extract obtained from both cell lines were used to perform a pull-down experiment with GST-KHNYN and GST alone. The result clearly shows that a consistent number of bands in the input lane are recovered in the pull-down with GST-KHNYN, clearly indicating that KHNYN can be, in fact, efficiently used as a NEDD8 probe for the isolation of different neddylated substrates. Moreover, by comparing the post-translation modification profiles of CUL1 and CUL2 in the input lanes, is clearly evident that the neddylation probe allowed the isolation of post-translationally modified isoforms of both cullins whose identity would be easily identified by western-blotting analysis. Finally, the binding efficiencies of GST-KHNYN and GST-Tandem toward neddylated substrates were compared in the pull-down assay shown in FIG. 6, which demonstrates that the Tandem construct shows higher avidity towards neddylated substrates compared to the GST-KHNYN recombinant protein. Therefore, the use of the C-terminal end of KHNYN as a neddylation probe, alone expressed as a tandem repeat, allows the isolation and subsequent identification by mass spectrometry analysis of mono-neddylated and poly-neddylated substrates as well as substrates modified by the addition of mixed ubiquitin-NEDD8 chains.

    BRIEF DESCRIPTION OF FIGURES

    [0034] FIG. 1. Equivalent quantities of GST, GST-KHNYN and GST-Tandem were analysed on 10% SDS-PAGE and visualized by coomassie blue staining.

    [0035] FIG. 2. The recombinant construct GST-KHNYN shows a clear preference for NEDD8. Equal amounts of GST and GST-KHNYN were incubated with 5 mg of purified Ubiquitin or NEDD8 monomers in PBS1 (137 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4) for 90 min at 4 C. After three washes with cold PBS1, samples were analysed by SDS-PAGE and immunoblotting with anti-Ubiquitin antibody from Santa Cruz (P4D1).

    [0036] FIG. 3. (A,B) The recombinant protein GST-KHNYN bound neddylated proteins expressed at physiological levels in the inducible stable cell line T-Rex-flag-NEDD8. Equivalent quantities of GST and GST-KHNYN were incubated with 2 mg of cellular extract and the precipitated protein were analysed by SDS-PAGE together with 2% of the total cell lysate (20 mg) representing the input lane (total cell lysate, TCL). Immunoblotting with anti-Flag, anti-ubiquitin, anti-CUL1 and anti-CUL2 antibodies were performed as previously described. Filters were incubated with secondary antibodies conjugated to horseradish peroxidase (HRP). Chemiluminescence reaction derived from the incubation with the enzymatic substrate (Thermo Scientific Pierce) was acquired with the ImageQuant LAS 3000 Dark Box (GE Healthcare). The Ponceau staining confirmed that equal amounts of GST and GST-KHNYN were used.

    [0037] FIG. 4. (A) USP8 treatment removed the ubiquitinated substrates bound to GST-KHNYN without interfering in the interaction with neddylated substrates, thus excluding the involvement of ubiquitin in the recognition of neddylated substrates. The pull-down experiment previously described in FIG. 2 was sub-divided in three identical fractions that were incubated at 4 C., or at 37 C. with or without USP8 for 30 minutes. Samples were washed three times with PBS, resuspended in loading buffer and analysed by SDS-PAGE and immunoblotting with anti-Flag and anti-ubiquitin antibodies. (B) T-Rex-Flag-NEDD8 cells were incubated with MLN4924 uM for 3 h, the lysed and the cell extracts incubated with GST alone or GST-KHNYN. Bound proteins recovered after washing were analysed by western-blotting with anti-CUL2 and anti-Flag antibodies. (3) The pull-down was performed as previously shown in FIGS. 3A and 3B. Treatment with the de-ubiquitinating enzyme USP8 was performed by incubating washed beads, recovered after the pull-down assay, with 2 ug of purified enzyme for 30 min at 30 C.; treatment with the de-neddylating enzyme NEDP1 was performed by incubating the washed beads, recovered after the pull-down assay, with 2 ug of purified enzyme for 90 min at 30 C. Samples were analysed by SDS-PAGE and western-blotting with the indicated antibodies.

    [0038] FIG. 5. KHNYN binds neddylated substrates from a deneddylation defective (DD) cell line. Wild type and DD cells were lysed and the cell extracts used to perform a pull-down assay as previously shown. Bound proteins were analysed by SDS-PAGE and immunoblotting with anti-NEDD8 antibody (Abcam), anti-Ubiquitin (Santa Cruz, P4D1) anti-CUL1 (Zymed) and anti-CUL2 (Zymed).

    [0039] FIG. 6. The recombinant proteins GST-KHNYN and GST-Tandem were used to perform a pull-down assay aimed at comparing the binding efficiency towards neddylated substrates isolated from wild-type or deneddylation defective cells. Beads recovered after washing were analysed by SDS-PAGE and immunoblotting with anti-NEDD8 antibody (Abcam).

    BIBLIOGRAPHY

    [0040] 1. Hori, T., F. Osaka, et al. (1999). Covalent modification of all members of human cullin family proteins by NEDD8. Oncogene 18(48): 6829-6834. [0041] 2. Duncan K, Schafer G, Vava A, Parker M I, Zerbini L F. Targeting neddylation in cancer therapy. Future Oncol. 2012 November; 8(11):1461-70. doi: 10.2217/fon.12.131. Review. [0042] 3. Mori F, Nishie M, Piao Y S, Kito K, Kamitani T, Takahashi H, Wakabayashi K. Accumulation of NEDD8 in neuronal and glial inclusions of neurodegenerative disorders. Neuropathol Appl Neurobiol. 2005 February; 31(1):53-61. [0043] 4. Dil Kuazi A, Kito K, Abe Y, Shin R W, Kamitani T, Ueda N. NEDD8 protein is involved in ubiquitinated inclusion bodies. J Pathol 2003; 199(2):259-266. [0044] 5. Choo Y S, Vogler G, Wang D, Kalvakuri S, Iliuk A, Tao W A, Bodmer R, Zhang Z. Regulation of parkin and PINK by neddylation. Hum Mol Genet 2012; 21(11):2514-2523. [0045] 6. Soucy T A, Smith P G, Milhollen M A, Berger A J, Gavin J M, Adhikari S, Brownell J E, Burke K E, Cardin D P, Critchley S, Cullis C A, Doucette A, Garnsey J J, Gaulin J L, Gershman R E, Lublinsky A R, McDonald A, Mizutani H, Narayanan U, Olhava E J, Peluso S, Rezaei M, Sintchak M D, Talreja T, Thomas M P, Traore T, Vyskocil S, Weatherhead G S, Yu J, Zhang J, Dick L R, Claiborne C F, Rolfe M, Bolen J B, Langston S P. An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature. 2009 Apr. 9; 458(7239):732-6. doi: 10.1038/nature07884. [0046] 7. Inhibition of NEDD8-conjugation pathway by novel molecules: potential approaches to anticancer therapy. Tanaka T, Nakatani T, Kamitani T. Mol Oncol. 2012 June; 6(3):267-75. doi: 10.1016/j.molonc.2012.01.003. Epub 2012 Jan. 21. Review. [0047] 8. Hjerpe, R., Y. Thomas, et al. (2012). NEDD8 overexpression results in neddylation of ubiquitin substrates by the ubiquitin pathway. J Mol Biol 421(1): 27-29. [0048] 9. Hjerpe, R., Y. Thomas, et al. (2012). Changes in the ratio of free NEDD8 to ubiquitin triggers NEDDylation by ubiquitin enzymes. Biochem J 441(3): 927-936. [0049] 10. Xirodimas D P, Saville M K, Bourdon J C, Hay R T, Lane D P. Mdm2-mediated NEDD8 conjugation of p53 inhibits its transcriptional activity. Cell. 2004 Jul. 9; 118(1):83-97. [0050] 11. Watson I R, Blanch A, Lin D C, Ohh M, Irwin M S. Mdm2-mediated NEDD8 modification of TAp73 regulates its transactivation function. J Biol Chem. 2006 Nov. 10; 281(45):34096-103. Epub 2006 Sep. 14. [0051] 12. Oved S, Mosesson Y, Zwang Y, Santonico E, Shtiegman K, Marmor M D, Kochupurakkal B S, Katz M, Lavi S, Cesareni G, Yarden Y. Conjugation to Nedd8 instigates ubiquitylation and down-regulation of activated receptor tyrosine kinases. J Biol Chem. 2006 Aug. 4; 281(31):21640-51. Epub 2006 May 30. [0052] 13. Ikeda F, Crosetto N, Dikic I. (2010). What determines the specificity and outcomes of ubiquitin signaling? Cell. 143(5):677-81. doi: 10.1016/j.cell.2010.10.026. [0053] 14. Schmidtke, G., B. Kalveram, et al. (2006). The UBA domains of NUB1L are required for binding but not for accelerated degradation of the ubiquitin-like modifier FAT10. J Biol Chem 281(29): 20045-20054. [0054] 15. Whitby, F. G., G. Xia, et al. (1998). Crystal structure of the human ubiquitin-like protein NEDD8 and interactions with ubiquitin pathway enzymes. J Biol Chem 273(52): 34983-34991. [0055] 16. Chew, E. H., T. Poobalasingam, et al. (2007). Characterization of cullin-based E3 ubiquitin ligases in intact mammalian cellsevidence for cullin dimerization. Cell Signal 19(5): 1071-1080.