Modified oligonucleotides and compound that can be used for synthesizing same

11485752 · 2022-11-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure falls within the field of biomedical technology, and in particular relates to modified oligonucleotides and a compound that can be used for synthesizing same and a method for modifying oligonucleotides. The present disclosure also relates to the use of the modified oligonucleotides for preventing and/or treating diseases associated with the liver in a subject.

Claims

1. A compound comprising an oligonucleotide and a conjugate group, wherein the modified oligonucleotide has a general formula ##STR00080## wherein PN is the oligonucleotide, Y is 1, X is 2, M.sub.T is selected from the conjugate group as shown in formulas (4), ##STR00081## wherein in formulas (4), A.sub.x is A.sub.1′, and the structure of the linker is shown in formula (v): ##STR00082## ##STR00083## wherein n is selected from an integer between 1-10; X is 2, the structure of the two M are the same as shown in formula (1′), ##STR00084## wherein in formula (1′), A.sub.x is the A.sub.1′ and the structure of the linker is shown in formula (iv), ##STR00085## n is 1.

2. A kit comprising the compound as claimed in claim 1.

3. A pharmaceutical composition comprising the modified oligonucleotide as claimed in claim 1, and optionally a pharmaceutically acceptable carrier.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the GalNAc binding curves for each sample in Example 35.

SEQUENCE OF INFORMATION

(2) Information on the sequences to which the present disclosure relates is provided in the following table:

(3) TABLE-US-00001 Sequence number (SEQ ID NO:) Description 1 Artificial sequence 2 Artificial sequence 3 Artificial sequence 4 Artificial sequence

(4) TABLE-US-00002 Sequence 1 (SEQ ID NO: 1): 19nt CAGCAAGUGUGACAGUCAU Sequence 2 (SEQ ID NO: 2): 25nt AUGACUGUCACACUUGCUGGCCUGU Sequence 3 (SEQ ID NO: 3): 19nt CAGGCCAGCAAGUGUGACA Sequence 4 (SEQ ID NO: 4): 21nt UGUCACACUUGCTGGCCUGUC

DETAILED DESCRIPTION OF THE DISCLOSURE

(5) Embodiments of the present disclosure will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present disclosure and are not to be construed as limiting the scope of the present disclosure. Specific conditions which are not noted in the examples are carried out under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used of which the manufacturer are not noted are conventional products commercially available.

Example 1 Synthesis of Compound R′.SUB.1.-H

(6) ##STR00047##

(7) Using serinol as a raw material, compound 1 was prepared according to the reference (Choi J Y, Borch R F. Highly efficient synthesis of enantiomerically enriched 2-hydroxymethylaziridines by enzymatic desymmetrization. [J]. Organic letters, 2007, 9(2):215-218), and compound R′.sub.1-H was further prepared to obtain a white solid with a total yield of 49% over two steps. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.16 (s, 2H), 4.63-4.58 (m, 1H), 4.05-3.97 (m, 1H), 3.74 (s, 6H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H). MS(ESI), m/z:416.3 ([M+Na]+).

Example 2 Synthesis of Compound R′.SUB.2.-H

(8) ##STR00048##

(9) Referring to the method of Example 1, compound R′.sub.2-H was prepared as a white solid in 55% yield. .sup.1H NMR (400M Hz, DMSO-d6) δ:7.42-7.37 (d, J=7.2 Hz, 2H), 7.35-7.29 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.17 (s, 1H), 4.63-4.59 (m, 1H), 3.74 (s, 6H), 3.05-2.99 (m, 2H), 2.96-2.90 (m, 2H), 2.88-2.81 (m, 4H). MS(ESI), m/z:430.3 ([M+Na]+).

Example 3 Synthesis of Compound R′3-H

(10) ##STR00049##

(11) Using L-hydroxyproline methyl ester hydrochloride as a raw material, the compound R′.sub.3-H was prepared referring to the method of Example 1 to obtain a white solid with a yield of 45%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.42-7.37 (d, J=7.2 Hz, 2H), 7.35-7.29 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.17 (s, 1H), 4.63-4.59 (m, 1H), 3.74 (s, 6H), 3.05-2.99 (m, 3H), 2.90-2.86 (m, 2H), 2.77-2.71 (m, 1H), 1.88-1.81 (m, 2H). MS(ESI), m/z:442.5 ([M+Na]+).

Example 4 Synthesis of Compound A.SUB.1.-I.SUB.1

(12) ##STR00050##

(13) (1) Synthesis of Compound 3

(14) In a 1 L round bottom flask, δ-valerolactone (100 g, 1 mol), sodium hydroxide (40 g, 1 mol) and 400 mL of deionized water were added, mixed, reacted for 6 hours at 70° C., and monitored by TLC until the reaction was completed; the reaction solution was spin-dried, added with 200 mL of toluene, and spin-dried to obtain 140 g of a white solid.

(15) (2) Synthesis of Compound 4

(16) In a 1 L round bottom flask, compound 3 (140 g, 1 mol), 500 mL of anhydrous acetone, benzyl bromide (205.2 g, 1.2 mol), catalyst tetrabutylammonium bromide (16.2 g, 0.05 mol) were added, and refluxed under heating; the reaction was monitored by TLC; after 24 hours, the reaction was complete; the reaction liquid was cooled to room temperature, acetone was removed under reduced pressure, the residue was dissolved in 500 mL of ethyl acetate, and washed with 200 mL of saturated sodium bisulfate solution, 200 mL of saturated sodium bicarbonate solution, and 200 mL of saturated brine successively; and the organic phase was dried over anhydrous sodium sulfate, concentrated, and passed through a silica gel column (petroleum ether:ethyl acetate V:V=1:1) to isolate 175 g of a clear oily liquid with a yield of 84%.

(17) (3) Synthesis of Compound 5

(18) In a 1 L round bottom flask, D-galactose hydrochloride (100 g, 0.46 mol) and 450 mL of anhydrous pyridine were added, and 325 mL of acetic anhydride, triethylamine (64.5 mL, 0.46 mol) and DMAP (2 g, 0.016 mol) were slowly added under an ice bath. After overnight reaction at room temperature, a large amount of solid was precipitated, which was filtered by suction and the filter cake was rinsed with 200 mL of 0.5 N HCl solution to obtain 162.5 g of a white solid with a yield of 90%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.88 (d, J=9.2 Hz, 1H), 5.63 (d, J=8.8 Hz, 1H), 5.26 (d, J=3.1 Hz, 1H), 5.05 (d, J=11.3, 3.3 Hz, 1H), 4.36 (m, 4H), 2.11 (s, 3H), 2.03 (s, 3H), 1.98 (s, 3H), 1.90 (s, 3H), 1.78 (s, 3H).

(19) (4) Synthesis of Compound 6

(20) In a 250 mL round-bottomed flask, compound 5 (10 g, 25.7 mmol) and 100 mL of anhydrous dichloromethane were added, and stirred for 10 min, then added with trimethylsilyl trifluoromethanesulfonate (7 mL, 38.7 mmol), and allowed to react overnight at room temperature; the reaction solution was slowly poured into an aqueous solution (200 mL) of sodium bicarbonate (7 g, 79.5 mmol), and stirred for 0.5 hours; the organic phase was separated, dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain 7.78 g of a light yellow gum with a yield of 92%.

(21) (5) Synthesis of Compound 7

(22) In a 100 mL round bottom flask, compound 6 (5 g, 15.2 mmol) and compound 4 (3.8 g, 18.25 mmol) were dissolved in 50 mL of anhydrous 1,2-dichloroethane, stirred for 10 min, and trimethylsilyl trifluoromethanesulfonate (0.55 mL, 3 mmol) was added, reacted overnight at room temperature; the reaction solution was extracted with dichloromethane, and the organic phase was washed twice with 50 mL of saturated sodium bicarbonate Solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 6.94 g of a clear oily liquid with a yield of 85%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.69 (d, J=9.3 Hz, 1H), 7.33-7.16 (m, 5H), 5.28 (d, J=5.3 Hz, 1H), 4.95 (s, 2H), 4.93 (q, J=4.2 Hz, 1H), 4.40 (d, J=8.6 Hz, 1H), 4.00-3.86 (m, 3H), 3.73-3.56 (m, 2H), 3.36-3.21 (m, 1H), 2.53 (t, J=8.2 Hz, 2H), 2.11 (s, 3H), 1.89 (s, 3H), 1.83 (s, 3H), 1.65 (s, 3H), 1.59-1.36 (m, 4H). MS(ESI), m/z:560.2 ([M+Na]+).

(23) (6) Synthesis of Compound A.sub.1-I.sub.1

(24) In a 50 mL round bottom flask, compound 7 (3.3 g, 6.1 mmol), Pd/C (0.33 g, 10%) were dissolved in 5 mL of methanol and 20 mL of ethyl acetate, introduced with a hydrogen balloon and reacted overnight at room temperature. The reaction solution was filtered through diatomite, and rinsed with diatomite methanol; and the filtrate was concentrated under reduced pressure and spin-dried to obtain 2.8 g of a white solid with a yield of 95.5%. .sup.1H NMR (400 MHz, DMSO-d6) δ:11.98 (s, 1H), 7.79-7.75 (d, J=8.9 Hz, 1H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.46-4.51 (d, J=7.2 Hz, 1H), 4.15-4.07 (m, 3H), 3.89-3.79 (m, 1H), 3.80-3.69 (m, 1H), 3.46-3.36 (m, 1H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.59-1.42 (m, 4H). MS(ESI), m/z:470.5 ([M+Na].sup.+).

Example 5 Synthesis of Compounds A.SUB.1.-I.SUB.2

(25) ##STR00051##

(26) (1) Synthesis of Compound 8

(27) In a 100 mL round bottom flask, compound 6 (5 g, 15.2 mmol) and 10-undecenol (3.1 g, 18.24 mmol) were dissolved in 50 mL of anhydrous dichloromethane, stirred for 10 min, and trimethylsilyl trifluoromethanesulfonate (0.55 mL, 3.0 mmol was added), and reacted overnight at room temperature; the reaction solution was extracted with dichloromethane, and the organic phase was washed twice with 50 mL of saturated sodium bicarbonate solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 6.59 g of a white solid with a yield of 87%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.82 (d, J=3.3 Hz, 1H), 5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.02-4.9 (m, 3H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:522.4 ([M+Na]+).

(28) (2) Synthesis of compounds A.sub.1-I.sub.2

(29) In a 100 mL round bottom flask, compound 8 (4 g, 8.02 mmol), 50 mL of dichloromethane, 50 mL of acetonitrile, and 70 mL of deionized water were added; NaIO.sub.4 (6.86 g, 32.1 mmol) was added portionwise; the reaction was carried out at room temperature for 48 h, and the completion of the reaction was monitored by TLC. The reaction solution was added with deionized water (100 mL), and extracted three times with dichloromethane (50 mL×3); the organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure and spin-dried to obtain 4.1 g of a light brown gummy product with a yield of 99%. .sup.1HNMR (400 MHz, DMSO-d6) δ:11.99 (s, 1H), 7.82 (d, J=3.3 Hz, 1H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:540.26 ([M+Na].sup.+).

Example 6 Synthesis of Compounds A.SUB.2.-I.SUB.2

(30) ##STR00052##

(31) (1) Synthesis of Compound 9

(32) Compound 9 was synthesized with reference to [2] Hudson, C. S.; Johnson, J. J. Am. Chem. Soc. 1915, 37, 1270-1275.

(33) .sup.1HNMR (400 MHz, DMSO-d6) δ:5.20 (s, 2H), 4.95 (q, J=4.2 Hz, 2H), 4.51 (d, J=7.2 Hz, 1H), 4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 6H), 3.89-3.79 (m, 2H), 2.23 (s, 3H), 2.15 (s, 6H), 2.00 (s, 6H), 1.95 (s, 6H), 1.87 (s, 3H). MS(ESI), m/z:701.6 ([M+Na].sup.+).

(34) (2) Synthesis of Compound 10

(35) In a 500 mL round bottom flask, compound 9 (20 g, 29.5 mmol), and compound 4 (9.2 g, 44.3 mmol) were dissolved in 200 mL of anhydrous dichloromethane; BF.sub.3—OEt.sub.2 (14.8 mL) was added dropwise in an ice bath; the reaction was maintained in an ice bath for 24 h and the completion of the reaction was monitored by TLC. The reaction was filtered by diatomite; and the filtrate was dissolved in 500 mL of ethyl acetate and washed with 200 mL saturated sodium bicarbonate solution and 200 mL saturated brine successively. The organic phase was dried over anhydrous magnesium sulfate, concentrated under reduced pressure and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 17.06 g of a white solid with a yield of 70%. MS(ESI), m/z:849.26 ([M+Na]+).

(36) (3) Synthesis of Compound A.sub.2-I.sub.1

(37) In a 100 mL round bottom flask, compound 10 (10 g, 12.1 mmol), Pd/C (1 g, 10%) were dissolved in 10 mL of methanol and 50 mL of ethyl acetate, charged with nitrogen to replace air, introduced with a hydrogen balloon and reacted overnight at room temperature. The reaction solution was filtered through diatomite, and rinsed with diatomite methanol; and the filtrate was spin-dried under reduced pressure to obtain 8.5 g of a white solid with a yield of 95.5%. H NMR (400 MHz, DMSO-d6) δ:11.98 (s, 1H), 5.20 (s, 2H), 4.95 (q, J=4.2 Hz, 2H), 4.51 (d, J=7.2 Hz, 1H), 4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 6H), 3.89-3.79 (m, 2H), 3.80-3.69 (m, 1H), 3.46-3.36 (m, 1H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 6H), 2.00 (s, 6H), 1.95 (s, 6H), 1.87 (s, 3H), 1.59-1.42 (m, 4H). MS(ESI), m/z:759.26 ([M+Na].sup.+).

Example 7 Synthesis of Compounds A.SUB.2.-I.SUB.2

(38) ##STR00053##

(39) (1) Synthesis of Compound 11

(40) In a 500 mL round bottom flask, compound 9 (20 g, 29.5 mmol), and 10-undecenol (6 g, 35.4 mmol) were dissolved in 200 mL of anhydrous DCM; BF.sub.3—OEt.sub.2 (14.8 mL) was added dropwise in an ice bath; the reaction was maintained in an ice bath for 24 hours and the completion of the reaction was monitored by TLC. The reaction was filtered by diatomite; and the filtrate was dissolved in 500 mL of ethyl acetate and washed with 200 mL saturated sodium bicarbonate solution and 200 mL saturated brine successively. The organic phase was dried over anhydrous magnesium sulfate, concentrated under reduced pressure and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 19.5 g of a white solid with a yield of 83.9%, MS(ESI), m/z:811.25 ([M+Na].sup.+).

(41) (2) Synthesis of Compound A.sub.2-I.sub.2

(42) Using compound 11 as a raw material, synthesis was performed with reference to A.sub.1-I.sub.2. The yield was 87%. .sup.1HNMR (400 MHz, DMSO-d6) δ:11.82 (s, 1H), 5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.2-4.9 (m, 6H), 4.5-4.98 (s, J=3.5 Hz, 2H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 2H), 3.73-3.65 (m, 2H), 3.48-3.38 (m, 1H), 2.12 (s, 6H), 2.05-2.01 (m, 2H), 2.00 (s, 6H), 1.88 (s, 6H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 8H). MS(ESI), m/z:829.7 ([M+Na].sup.+).

Example 8 Synthesis of Compounds A.SUB.3.-I.SUB.1

(43) ##STR00054##

(44) (1) Synthesis of Compound 12

(45) Reference synthesis of compound 5, a white solid was obtained with a yield of 91%. .sup.1HNMR (400 MHz, DMSO-d6) δ:5.63 (d, J=8.8 Hz, 1H), 5.26 (d, J=3.1 Hz, 1H), 5.05 (d, J=11.3, 3.3 Hz, 1H), 4.36 (m, 4H), 2.11 (s, 3H), 2.03 (s, 3H), 1.98 (s, 3H), 1.90 (s, 3H), 1.78 (s, 3H). MS(ESI), m/z:391.21 ([M+1].sup.+).

(46) (2) Synthesis of Compound 13

(47) The synthesis of compound 13 was with reference to the synthesis of compound 10 using compound 12 as the raw material. A clear oily liquid was obtained with a yield of 86%.

(48) .sup.1HNMR (400 MHz, DMSO-d6) δ:7.33-7.16 (m, 5H), 5.28 (d, J=5.3 Hz, 1H), 4.95 (s, 2H), 4.93 (q, J=4.2 Hz, 1H), 4.40 (d, J=8.6 Hz, 1H), 4.00-3.86 (m, 3H), 3.73-3.56 (m, 1H), 3.36-3.21 (m, 2H), 2.53 (t, J=8.2 Hz, 2H), 2.11 (s, 3H), 1.89 (s, 3H), 1.83 (s, 3H), 1.65 (s, 3H), 1.59-1.36 (m, 4H). MS(ESI), m/z:561.2 ([M+Na].sup.+).

(49) (3) Synthesis of Compound A.sub.3-I.sub.1

(50) The synthesis of compound A.sub.3-I.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1 using compound 13 as the raw material. A white solid was obtained with a yield of 93.5%. .sup.1HNMR (400 MHz, DMSO-d6) δ: 11.98 (s, 1H), 5.20 (s, 1H), 4.95 (q, J=4.2 Hz, 1H), 4.51 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 3H), 3.89-3.79 (m, 1H), 3.80-3.69 (m, 1H), 3.46-3.36 (m, 1H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.59-1.42 (m, 4H). MS(ESI), m/z:471.5 ([M+Na].sup.+).

Example 9 Synthesis of Compounds A.SUB.3.-I.SUB.2

(51) ##STR00055##

(52) (1) Synthesis of Compound 14

(53) The synthesis of compound 14 was with reference to the synthesis of compound 11 using compound 12 as the raw material. A white solid was obtained with a yield of 88%.

(54) .sup.1HNMR (400 MHz, DMSO-d6) δ:5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.2-4.9 (m, 3H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:523.5 ([M+Na].sup.+).

(55) (2) Synthesis of Compounds A.sub.3-I.sub.2

(56) The synthesis of compound A.sub.3-I.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.2 using compound 14 as the raw material. A light brown gummy product was obtained with a yield of 97%.

(57) .sup.1HNMR (400 MHz, DMSO-d6) δ:11.99 (s, 1H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:541.3 ([M+Na].sup.+).

Example 10 Synthesis of Compounds A.SUB.1.-IV.SUB.1

(58) ##STR00056##

(59) (1) Synthesis of Compound 15

(60) The synthesis of compound 15 was with reference to the synthesis of compound 8 using compound 6 as the raw material. MS(ESI), m/z: 484.2 ([M+1].sup.+).

(61) (2) Synthesis of Compound A.sub.1-IV.sub.1

(62) The synthesis of compound A.sub.1-IV.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.2 using compound 15 as the raw material. .sup.1HNMR (400 MHz, DMSO-d6) δ:11.88 (s, 1H), 7.77-7.73 (d, J=8.9 Hz, 1H), 5.21 (s, 1H), 5.0-4.96 (q, J=4.2 Hz, 1H), 4.45-4.51 (d, J=7.2 Hz, 1H), 4.12-4.07 (m, 3H), 3.88-3.78 (m, 1H), 3.72-3.68 (m, 2H), 3.62-3.58 (m, 2H), 3.56-3.46 (m, 4H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H). MS(ESI), m/z:502.6 ([M+1].sup.+).

Example 11 Synthesis of Compound A.SUB.1.-I.SUB.1.-R.SUB.1

(63) ##STR00057##

(64) (1) Synthesis of Compound 16

(65) In a 250 mL round bottom flask, compound A.sub.1-I.sub.1 (10 g, 22.35 mmol), 1-ethyl-(3-dimethylaminopropyl) carbonyldiimine hydrochloride (EDC. HCL) (5.14 g, 26.82 mmol), N-hydroxysuccinimide (2.83 g, 24.59 mmol), and dichloromethane 100 mL were added. After stirring for the reaction at room temperature for 0.5 h, compound R.sub.1-H (8.79 g, 22.35 mmol) was added, and the reaction was monitored by TLC and was complete after 4 h. The reaction liquid was washed successively with 50 mL of saturated sodium bicarbonate solution and 50 mL of saturated brine, the organic phase was dried over anhydrous sodium sulfate, then concentrated, and passed through a silica gel column (dichloromethane:methanol V:V=20:1) to isolate 15.8 g of a white solid with a yield of 86%. MS (ESI), m/z:845.2 ([M+Na].sup.+).

(66) (2) Synthesis of Compound A.sub.1-I.sub.1-R.sub.1

(67) In a 250 mL two-necked flask, compound 16 (5 g, 6.08 mmol) under nitrogen protection, 100 mL anhydrous acetonitrile, and bis (diisopropylamino)(2-cyanoethoxy) phosphine (3.66 g, 12.16 mmol) were added, and a solution of ethylthiotetrazole in acetonitrile (2.5M) (1.22 mL, 3.04 mmol) was slowly added dropwise with stirring for a reaction for 0.5 h; the reaction was monitored by TLC and was complete after 0.5 h. The reaction was concentrated under reduced pressure to remove acetonitrile, added with 100 mL of dichloromethane to be dissolved and washed with 100 mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, concentrated and passed through a silica gel column (petroleum ether:ethyl acetate V:V=1:3) to isolate 5.16 g of a white solid with a yield of 83%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.84-7.79 (d, J=8.9 Hz, 1H), 7.65-7.60 (d, J=8.9 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-4.06 (m, 3H), 4.05-3.96 (m, 1H), 3.84-3.80 (m, 2H), 3.89-3.79 (m, 1H), 3.74 (s, 6H), 3.71-3.69 (m, 1H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.54 (m, 21-1), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1045.5 ([M+Na].sup.+).

Example 12 Synthesis of Compound A.SUB.1.-I.SUB.1.-R.SUB.2

(68) ##STR00058##

(69) (1) Synthesis of Compound 17

(70) The synthesis of compound 17 was with reference to the synthesis of compound 16 using compound A.sub.1-I.sub.1 as the raw material. A white solid was obtained with a yield of 82.5%. MS(ESI), m/z:859.2 ([M+Na].sup.+).

(71) (2) Synthesis of Compound A.sub.1-I.sub.1-R.sub.2

(72) The synthesis of compound A.sub.1-I.sub.1-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 17 as the raw material. A white solid was obtained with a yield of 84.2%. 1.sub.H NMR (400 MHz, DMSO-d6) δ:7.83-7.79 (d, J=8.8 Hz, 1H), 7.42-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 3H), 4.05-3.96 (m, 1H), 3.84-3.80 (m, 2H), 3.89-3.79 (m, 1H), 3.74 (s, 6H), 3.71-3.69 (m, 1H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.98-2.95 (m, 2H), 2.89-2.93 (m, 4H), 2.88-2.84 (m, 2H), 2.60-2.55 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1059.6 ([M+Na].sup.+).

Example 13 Synthesis of Compound A.SUB.1.-I.SUB.1.-R.SUB.3

(73) ##STR00059##

(74) (1) Synthesis of Compound 18

(75) The synthesis of compound 18 was with reference to the synthesis of compound 16 using compound A.sub.1-I.sub.1 as the raw material. A white solid was obtained with a yield of 86%. MS(ESI), m/z:871.2 ([M+Na].sup.+).

(76) (2) Synthesis of Compound A.sub.1-I.sub.1-R.sub.3

(77) The synthesis of compound A.sub.1-I.sub.1-R.sub.3 was with reference to the synthesis of compound A1-I.sub.1-R.sub.1 using compound 18 as the raw material. A white solid was obtained with a yield of 84.2%.

(78) .sup.1HNMR (400 MHz, DMSO-d6) δ:7.73-7.70 (d, J=7.9 Hz, 1H), 7.42-7.37 (d, J=7.2 Hz, 2H), 7.35-7.29 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 3H), 3.89-3.79 (m, 3H), 3.74 (s, 6H), 3.70-3.67 (m, 1H), 3.46-3.36 (m, 1H), 3.05-2.99 (m, 3H), 2.90-2.86 (m, 3H), 2.77-2.71 (m, 1H), 2.60-2.55 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.88-1.81 (m, 2H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1071.4 ([M+Na].sup.+).

Example 14 Synthesis of Compound A.SUB.1.-I.SUB.2.-R.SUB.1

(79) ##STR00060##

(80) (1) Synthesis of Compound 19

(81) The synthesis of Compound 19 was with reference to the synthesis of compound 16 using compound A.sub.1-I.sub.2 as the raw material. A white solid was obtained with a yield of 85.6%. MS(ESI), m/z:915.5 ([M+Na].sup.+).

(82) (2) Synthesis of Compound A.sub.1-I.sub.2-R.sub.1

(83) The synthesis of compound A.sub.1-I.sub.2-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 19 as the raw material. A white solid was obtained with a yield of 82.1%.

(84) .sup.1HNMR (400 MHz, DMSO-d6) δ:7.82-7.78 (d, J=7.3 Hz, 1H), 7.69-7.63 (d, J=7.3 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 4.05-3.97 (m, 1H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.74 (s, 6H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.61-2.55 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:1115.2 ([M+Na].sup.+).

Example 15 Synthesis of Compound A.SUB.1.-I.SUB.2.-R.SUB.2

(85) ##STR00061##

(86) (1) Synthesis of Compound 20

(87) The synthesis of compound 20 was with reference to the synthesis of compound 16 using compound A.sub.1-I.sub.2 as the raw material. A white solid was obtained with a yield of 84.2%. MS(ESI), m/z:929.3 ([M+Na].sup.+).

(88) (2) Synthesis of Compound A.sub.1-I.sub.2-R.sub.2

(89) The synthesis of compound A.sub.1-I.sub.2-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 20 as the raw material. A white solid was obtained with a yield of 81.1%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.83-7.77 (d, J=7.3 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.74 (s, 6H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.15-3.11 (m, 4H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.61-2.55 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:1129.4 ([M+Na].sup.+).

Example 16 Synthesis of Compound A.SUB.1.-I.SUB.2.-R.SUB.3

(90) ##STR00062##

(91) (1) Synthesis of Compound 21

(92) The synthesis of compound 21 was with reference to the synthesis of compound 16 using compound A.sub.1-I.sub.2 as the raw material. A white solid was obtained with a yield of 80.5%. MS(ESI), m/Z:941.1 ([M+Na].sup.+).

(93) (2) Synthesis of Compound A.sub.1-I.sub.2-R.sub.3

(94) The synthesis of compound A.sub.1-I.sub.2-R.sub.3 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 21 as the raw material. A white solid was obtained with a yield of 81.1% .sup.1HNMR (400 MHz, DMSO-d6) δ:7.82 (d, J=3.3 Hz, 1H), 7.42-7.37 (d, J=7.2 Hz, 2H), 7.35-7.29 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.76 (s, 6H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.05-2.99 (m, 3H), 2.90-2.84 (m, 4H), 2.77-2.71 (m, 1H), 2.62-2.56 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.87-1.81 (m, 2H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:1141.2 ([M+Na].sup.+).

Example 17 Synthesis of Compound A.SUB.2.-I.SUB.1.-R.SUB.1

(95) ##STR00063##

(96) (1) Synthesis of Compound 22

(97) The synthesis of compound 22 was with reference to the synthesis of compound 16 using compound A.sub.2-I.sub.1 as the raw material. A white solid was obtained with a yield of 80.4%. MS(ESI), m/z:1134.7 ([M+Na].sup.+).

(98) (2) Synthesis of Compound A.sub.2-I.sub.1-R.sub.1

(99) The synthesis of compound A.sub.2-I.sub.1-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 22 as the raw material. A white solid was obtained with a yield of 81.3%. H NMR (400 MHz, DMSO-d6) δ:7.61-7.57 (d, J=7.2 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 2H), 4.95 (q, J=4.2 Hz, 2H), 4.51 (d, J=7.2 Hz, 1H), 4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 6H), 4.05-3.97 (m, 1H), 3.89-3.79 (m, 4H), 3.75 (s, 6H), 3.80-3.69 (m, 1H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.61-2.55 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 6H), 2.00 (s, 6H), 1.95 (s, 6H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1334.2 ([M+Na].sup.+).

Example 18 Synthesis of Compound A.SUB.2.-I.SUB.1.-R.SUB.2

(100) ##STR00064##

(101) (1) Synthesis of Compound 23

(102) The synthesis of compound 23 was with reference to the synthesis of compound 16 using compound A.sub.2-I.sub.1 as the raw material. A white solid was obtained with a yield of 86.1%. MS(ESI), m/z:1148.3 ([M+Na].sup.+).

(103) (2) Synthesis of Compound A.sub.2-I.sub.1-R.sub.2

(104) The synthesis of compound A.sub.2-I.sub.1-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 23 as the raw material. A white solid was obtained with a yield of 82.3%. H NMR (400M Hz, DMSO-d6) δ:7.40-7.36 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 2H), 4.95 (q, J=4.2 Hz, 2H), 4.51 (d, J=7.2 Hz, 1H), 4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 6H), 3.89-3.79 (m, 4H), 3.75 (s, 6H), 3.80-3.69 (m, 1H), 3.46-3.41 (m, 4H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.61-2.55 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 6H), 2.00 (s, 6H), 1.95 (s, 6H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1348.2 ([M+Na].sup.+).

Example 19 Synthesis of Compound A.SUB.2.-I.SUB.1.-R.SUB.3

(105) ##STR00065##

(106) (1) Synthesis of Compound 24

(107) The synthesis of compound 24 was with reference to the synthesis of compound 16 using compound A.sub.2-I.sub.1 as the raw material. A white solid was obtained with a yield of 82.9%. MS(ESI), m/z:1160.5 ([M+Na].sup.+).

(108) (2) Synthesis of Compound A.sub.2-I.sub.1-R.sub.3

(109) The synthesis of compound A.sub.2-I.sub.1-R.sub.3 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 24 as the raw material. A white solid was obtained with a yield of 82.3%. H NMR (400 MHz, DMSO-d6) δ:7.44-7.39 (d, J=7.2 Hz, 2H), 7.36-7.30 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 2H), 4.95 (q, J=4.2 Hz, 2H), 4.51 (d, J=7.2 Hz, 1H), 4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 6H), 3.89-3.82 (m, 4H), 3.80-3.76 (m, 1H), 3.74 (s, 6H), 3.46-3.36 (m, 1H), 3.05-2.99 (m, 3H), 2.90-2.86 (m, 2H), 2.77-2.71 (m, 1H), 2.61-2.56 (m, 2H, 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 6H), 2.00 (s, 6H), 1.95 (s, 6H), 1.87 (s, 3H), 1.86-1.81 (m, 2H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1360.26 ([M+Na].sup.+).

Example 20 Synthesis of Compound A.SUB.2.-I.SUB.2.-R.SUB.1

(110) ##STR00066##

(111) (1) Synthesis of Compound 25

(112) The synthesis of compound 25 was with reference to the synthesis of compound 16 using compound A.sub.2-I.sub.2 as the raw material. A white solid was obtained with a yield of 86.3%. MS(ESI), m/z:1204.6 ([M+Na].sup.+).

(113) (2) Synthesis of Compound A.sub.2-I.sub.2-R.sub.1

(114) The synthesis of compound A.sub.2-I.sub.2-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 25 as the raw material. A white solid was obtained with a yield of 80.3%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.71-7.66 (d, J=7.2 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.2-4.9 (m, 6H), 4.5-4.98 (s, J=3.5 Hz, 2H), 4.08-3.99 (m, 4H), 3.9-3.88 (m, 2H), 3.84-3.80 (m, 2H), 3.75 (s, 6H), 3.73-3.65 (m, 2H), 3.48-3.38 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.55 (m, 2H), 2.12 (s, 6H), 2.05-2.01 (m, 2H), 2.00 (s, 6H), 1.88 (s, 6H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 8H). MS(ESI), m/z:1404.7 ([M+Na].sup.+).

Example 21 Synthesis of Compound A.SUB.2.-I.SUB.2.-R.SUB.2

(115) ##STR00067##

(116) (1) Synthesis of Compound 26

(117) The synthesis of compound 26 was with reference to the synthesis of compound 16 using compound A.sub.2-I.sub.2 as the raw material. A white solid was obtained with a yield of 87.3%. MS(ESI), m/z:1218.4 ([M+Na].sup.+).

(118) (2) Synthesis of Compound A.sub.2-I.sub.2-R.sub.2

(119) The synthesis of compound A.sub.2-I.sub.2-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 26 as the raw material. A white solid was obtained with a yield of 84.3%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.2-4.9 (m, 6H), 4.5-4.98 (s, J=3.5 Hz, 2H), 3.9-3.88 (m, 2H), 3.84-3.80 (m, 2H), 3.75 (s, 6H), 3.73-3.65 (m, 2H), 3.48-3.38 (m, 1H), 3.3.16-3.12 (m, 4H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.55 (m, 2H), 2.12 (s, 6H), 2.05-2.01 (m, 2H), 2.00 (s, 6H), 1.88 (s, 6H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 8H). MS(ESI), m/z:1418.7 ([M+Na].sup.+).

Example 22 Synthesis of Compound A.SUB.2.-I.SUB.2.-R.SUB.3

(120) ##STR00068##

(121) (1) Synthesis of Compound 27

(122) The synthesis of compound 27 was with reference to the synthesis of compound 16 using compound A.sub.2-I.sub.2 as the raw material. A white solid was obtained with a yield of 88.0%. MS(ESI), m/z:1230.2 ([M+Na].sup.+).

(123) (2) Synthesis of Compound A.sub.2-I.sub.2-R.sub.3

(124) The synthesis of compound A.sub.2-I.sub.2-R.sub.3 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 27 as the raw material. A white solid was obtained with a yield of 87.0%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.42-7.37 (d, J=7.2 Hz, 2H), 7.35-7.29 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.2-4.9 (m, 6H), 4.5-4.98 (s, J=3.5 Hz, 2H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 2H), 3.84-3.80 (m, 2H), 3.74 (s, 6H), 3.73-3.65 (m, 2H), 3.48-3.38 (m, 1H), 3.05-2.99 (m, 3H), 2.90-2.86 (m, 4H), 2.77-2.71 (m, 1H), 2.60-2.56 (m, 2H), 2.12 (s, 6H), 2.05-2.01 (m, 2H), 2.00 (s, 6H), 1.88 (s, 6H), 1.86-1.81 (m, 2H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 8H). MS(ESI), m/z:1430.2 ([M+Na].sup.+).

Example 23 Synthesis of Compound A.SUB.3.-I.SUB.1.-R.SUB.1

(125) ##STR00069##

(126) (1) Synthesis of Compound 28

(127) The synthesis of compound 28 was with reference to the synthesis of compound 16 using compound A.sub.3-I.sub.1 as the raw material. A white solid was obtained with a yield of 88.2%. MS(ESI), m/z:846.3 ([M+Na].sup.+).

(128) (2) Synthesis of Compound A.sub.3-I.sub.1-R.sub.1

(129) The synthesis of compound A.sub.3-I.sub.1-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 28 as the raw material. A white solid was obtained with a yield of 84.2%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.61-7.56 (d, J=7.2 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 4.95 (q, J=4.2 Hz, 1H), 4.51 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 4H), 3.89-3.79 (m, 3H), 3.75 (s, 6H), 3.73-3.69 (m, 1H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1046.5 ([M+Na].sup.+).

Example 24 Synthesis of Compound A.SUB.3.-I.SUB.1.-R.SUB.2

(130) ##STR00070##

(131) (1) Synthesis of Compound 29

(132) The synthesis of compound 29 was with reference to the synthesis of compound 16 using compound A.sub.3-I.sub.1 as the raw material. A white solid was obtained with a yield of 88.9%. MS(ESI), m/z:860.3 ([M+Na].sup.+).

(133) (2) Synthesis of Compound A.sub.3-I.sub.1-R.sub.2

(134) The synthesis of compound A.sub.3-I.sub.1-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 29 as the raw material. A white solid was obtained with a yield of 84.7%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 4.95 (q, J=4.2 Hz, 1H), 4.51 (d, J=7.2 Hz, 1H), 3.89-3.79 (m, 3H), 3.75 (s, 6H), 3.73-3.69 (m, 1H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.82-2.78 (m, 4H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1060.5 ([M+Na].sup.+).

Example 25 Synthesis of Compound A.SUB.3.-I.SUB.1.-R.SUB.3

(135) ##STR00071##

(136) (1) Synthesis of Compound 30

(137) The synthesis of compound 30 was with reference to the synthesis of compound 16 using compound A.sub.3-I.sub.1 as the raw material. A white solid was obtained with a yield of 84.3%. MS(ESI), m/z:872.7 ([M+Na].sup.+).

(138) (2) Synthesis of Compound A.sub.3-I.sub.1-R.sub.3

(139) The synthesis of compound A.sub.3-I.sub.1-R.sub.3 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 30 as the raw material. A white solid was obtained with a yield of 86.2%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.46-7.39 (d, J=7.2 Hz, 2H), 7.37-7.31 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 4.95 (q, J=4.2 Hz, 1H), 4.51 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 3H), 3.89-3.79 (m, 3H), 3.76 (s, 6H), 3.72-3.68 (m, 1H), 3.46-3.36 (m, 1H), 3.05-2.99 (m, 3H), 2.90-2.86 (m, 2H), 2.88-2.84 (m, 2H), 2.77-2.71 (m, 1H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.86-1.81 (m, 2H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z:1072.8 ([M+Na].sup.+).

Example 26 Synthesis of Compound A.SUB.3.-I.SUB.2.-R.SUB.1

(140) ##STR00072##

(141) (1) Synthesis of Compound 31

(142) The synthesis of compound 31 was with reference to the synthesis of compound 16 using compound A.sub.3-I.sub.2 as the raw material. A white solid was obtained with a yield of 86.2%. MS(ESI), m/z:916.4 ([M+Na].sup.+).

(143) (2) Synthesis of Compound A.sub.3-I.sub.2-R.sub.1

(144) The synthesis of compound A.sub.3-I.sub.2-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 31 as the raw material. A white solid was obtained with a yield of 85.1%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.75-7.71 (d, J=7.2 Hz, 1H), 7.42-7.39 (d, J=7.2 Hz, 2H), 7.32-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.05-3.99 (m, 4H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.76 (s, 6H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.87-2.84 (m, 2H), 2.58-2.54 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:1116.6 ([M+Na].sup.+).

Example 27 Synthesis of Compound A.SUB.3.-I.SUB.2.-R.SUB.2

(145) ##STR00073##

(146) (1) Synthesis of Compound 32

(147) The synthesis of compound 32 was with reference to the synthesis of compound 16 using compound A.sub.3-I.sub.2 as the raw material. A white solid was obtained with a yield of 82.9%. MS(ESI), m/z:930.7 ([M+Na].sup.+).

(148) (2) Synthesis of Compound A.sub.3-I.sub.2-R.sub.2

(149) The synthesis of compound A.sub.3-I.sub.2-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 32 as the raw material. A white solid was obtained with a yield of 84.3%. .sup.1H NMR (400M Hz, DMSO-d6) δ:7.44-7.39 (d, J=7.2 Hz, 2H), 7.32-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.76 (s, 6H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.04-2.99 (m, 2H), 2.97-2.94 (m, 2H), 2.93-2.88 (m, 4H), 2.87-2.84 (m, 2H), 2.58-2.54 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:1130.6 ([M+Na].sup.+).

Example 28 Synthesis of Compound A.SUB.3.-I.SUB.2.-R.SUB.3

(150) ##STR00074##

(151) (1) Synthesis of Compound 33

(152) The synthesis of compound 33 was with reference to the synthesis of compound 16 using compound A.sub.3-I.sub.2 as the raw material. A white solid was obtained with a yield of 83.8%. MS(ESI), m/z:942.4 ([M+Na].sup.+).

(153) (2) Synthesis of Compound A.sub.3-I.sub.2-R.sub.3

(154) The synthesis of compound A.sub.3-I.sub.2-R.sub.3 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 33 as the raw material. A white solid was obtained with a yield of 85.2%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.46-7.41 (d, J=7.2 Hz, 2H), 7.37-7.31 (t, J=6.9 Hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.75 (s, 6H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.05-3.00 (m, 3H), 2.91-2.86 (m, 2H), 2.88-2.84 (m, 2H), 2.77-2.71 (m, 1H), 2.59-2.54 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.86-1.81 (m, 2H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z:1142.5 ([M+Na].sup.+).

Example 29 Synthesis of Compound A.SUB.1.-II.SUB.1.-R.SUB.1

(155) ##STR00075##

(156) (1) Synthesis of Compound 34

(157) In a 250 mL round bottom flask, N-benzyloxycarbonyl-6-aminocaproic acid (10 g, 37.69 mmol), 1-ethyl-(3-dimethylaminopropyl) carbonyldiimine hydrochloride (EDC. HCL) (8.67 g, 45.23 mmol), N-hydroxysuccinimide (4.67 g, 41.46 mmol), and dichloromethane 100 mL were added. After stirring for the reaction at room temperature for 0.5 hours, compound R.sub.1-H (14.8 g, 37.69 mmol) was added, and the reaction was monitored by TLC and was complete after 4 h. The reaction liquid was washed with 50 mL of saturated sodium bicarbonate solution and 50 mL of saturated brine successively, the organic phase was dried over anhydrous sodium sulfate, then concentrated, and passed through a silica gel column (ethyl acetate:petroleum ether V:V=4:1) to isolate 19.8 g of a white solid with a yield of 82.1%. MS(ESI), m/z:663.1 ([M+Na].sup.+).

(158) (2) Synthesis of Compound 35

(159) In a 100 mL round bottom flask, compound 34 (5 g, 7.8 mmol), Pd/C (0.5 g, 10%) were dissolved in 10 mL of methanol and 4.0 mL of ethyl acetate, introduced with a hydrogen balloon for a reaction; the reaction was monitored by TLC and was complete after 6 h. The reaction solution was filtered through diatomite, and rinsed with diatomite methanol; and the filtrate was concentrated under reduced pressure and spin-dried to obtain 3.8 g of a white solid with a yield of 96.1%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.64-7.61 (d, J=7.2 Hz, 1H), 7.43-7.37 (d, J=8.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.92-6.87 (d, J=8.2 Hz, 4H), 5.12 (m, 2H), 4.63-4.58 (m, 1H), 4.05-3.97 (m, 1H), 3.73 (s, 6H), 3.5-3.42 (m, 2H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.12-2.06 (m, 2H), 1.52-1.45 (m, 2H), 1.42-1.35 (m, 2H), 1.28-1.20 (m, 2H). MS(ESI), m/z:529.3 ([M+Na].sup.+).

(160) (3) Synthesis of Compound 36

(161) In a 250 mL round bottom flask, compound A.sub.1-I.sub.1 (10 g, 22.37 mmol), 1-ethyl-(3-dimethylaminopropyl) carbonyldiimine hydrochloride (EDC. HCL) (5.15 g, 26.85 mmol), N-hydroxysuccinimide (2.83 g, 24.61 mmol) and dichloromethane 100 mL were added. After stirring for the reaction at room temperature for 0.5 hours, compound 35 (11.32 g, 22.37 mmol) was added, and the reaction was monitored by TLC and was complete after 6 h. The reaction liquid was washed successively with 50 mL of saturated sodium bicarbonate solution and 50 mL of saturated brine, the organic phase was dried over anhydrous sodium sulfate, then concentrated, and passed through a silica gel column (dichloromethane:methanol V:V=20:1) to isolate 17.3 g of a white solid with a yield of 82.7%. MS (ESI), m/z:958 ([M+Na].sup.+).

(162) (4) Synthesis of Compound A.sub.1-II.sub.1-R.sub.1

(163) The synthesis of compound A.sub.1-II.sub.1-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 36 as the raw material. A white solid was obtained with a yield of 84.7%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.84-7.80 (d, J=7.2 Hz, 1H), 7.72-7.66 (m, 1H), 7.64-7.61 (d, J=7.2 Hz, 1H), 7.43-7.37 (d, J=8.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.92-6.87 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-4.11 (m, 3H), 4.05-3.97 (m, 1H), 3.89-3.79 (m, 3H), 3.76 (s, 6H), 3.74-3.69 (m, 1H), 3.54-3.49 (m, 2H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.12-2.06 (m, 2H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 6H), 1.41-1.35 (m, 2H), 1.28-1.20 (m, 2H). MS(ESI), m/z:1158.5 ([M+Na].sup.+).

Example 30 Synthesis of Compound A.SUB.1.-II.SUB.1.-R.SUB.2

(164) ##STR00076##

(165) (1) Synthesis of Compound 37

(166) The synthesis of compound 37 was with reference to the synthesis of compound 34 using compound R′.sub.2-H as the raw material. A white solid was obtained with a yield of 84.3%. MS(ESI), m/z:677.5 ([M+Na].sup.+).

(167) (2) Synthesis of Compound 38

(168) The synthesis of compound 38 was with reference to the synthesis of compound 35 using compound 37 as the raw material. A white solid was obtained with a yield of 88.2%.

(169) .sup.1HNMR (400M Hz, DMSO-d6) δ:7.44-7.38 (d, J=8.2 Hz, 2H), 7.34-7.29 (t, J=6.9 Hz, 2H), 7.28-7.20 (m, 5H), 6.92-6.87 (d, J=8.2 Hz, 4H), 5.12 (m, 2H), 4.63-4.58 (m, 1H), 3.73 (s, 6H), 3.5-3.42 (m, 2H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.82 (m, 4H), 2.12-2.06 (m, 2H), 1.52-1.45 (m, 2H), 1.42-1.35 (m, 2H), 1.28-1.20 (m, 2H). MS(ESI), m/z:543.3 ([M+Na].sup.+).

(170) (3) Synthesis of Compound 39

(171) The synthesis of compound 39 was with reference to the synthesis of compound 36 using compound 38 as the raw material. A white solid was obtained with a yield of 80.7%. MS(ESI), m/z:972.6 ([M+Na].sup.+).

(172) (4) Synthesis of Compound A.sub.1-II.sub.1-R.sub.2

(173) The synthesis of compound A.sub.1-II.sub.1-R.sub.2 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 39 as the raw material. A white solid was obtained with a yield of 84.1%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.83-7.79 (d, J=7.2 Hz, 1H), 7.72-7.66 (m, 1H), 7.42-7.36 (d, J=8.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.92-6.87 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-4.10 (m, 3H), 3.89-3.79 (m, 3H), 3.76 (s, 6H), 3.74-3.69 (m, 1H), 3.54-3.49 (m, 2H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 6H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.12-2.06 (m, 2H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 6H) 1.41-1.35 (m, 2H), 1.28-1.20 (m, 2H). MS(ESI), m/z:1172.7 ([M+Na].sup.+).

Example 31 Synthesis of Compound A.SUB.1.-III.SUB.1.-R.SUB.1

(174) ##STR00077##

(175) (1) Synthesis of Compound 40

(176) The synthesis of compound 40 was with reference to the synthesis of compound 34 using compound 35 as the raw material. A white solid was obtained with a yield of 82.6%. MS(ESI), m/z:776.7 ([M+Na].sup.+).

(177) (2) Synthesis of Compound 41

(178) The synthesis of compound 41 was with reference to the synthesis of compound 35 using compound 40 as the raw material. A white solid was obtained with a yield of 96.7%.

(179) .sup.1HNMR (400 MHz, DMSO-d6) δ:7.71-7.67 (m, 1H), 7.65-7.62 (d, J=7.2 Hz, 1H), 7.45-7.39 (d, J=8.2 Hz, 2H), 7.34-7.29 (t, J=6.9 Hz, 2H), 7.26-7.19 (m, 5H), 6.93-6.88 (d, J=8.2 Hz, 4H), 5.14 (m, 2H), 4.64-4.58 (m, 1H), 4.05-3.98 (m, 1H), 3.72 (s, 6H), 3.5-3.43 (m, 4H), 3.05-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.12-2.06 (m, 4H), 1.52-1.45 (m, 4H), 1.41-1.35 (m, 4H), 1.29-1.20 (m, 4H). MS(ESI), m/z:642.3 ([M+Na].sup.+).

(180) (3) Synthesis of Compound 42

(181) The synthesis of compound 42 was with reference to the synthesis of compound 36 using compound 41 as the raw material. A white solid was obtained with a yield of 86.3%. MS(ESI), m/z: 1071.4 ([M+Na].sup.+).

(182) (4) Synthesis of Compound A.sub.1-III.sub.1-R.sub.1

(183) The synthesis of compound A.sub.1-III.sub.1-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 42 as the raw material. A white solid was obtained with a yield of 84.1%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.85-7.81 (d, J=7.2 Hz, 1H), 7.78-7.74 (m, 1H), 7.72-7.66 (m, 1H), 7.65-7.61 (d, J=7.2 Hz, 1H), 7.42-7.38 (d, J=8.2 Hz, 2H), 7.34-7.29 (t, J=6.9 Hz, 2H), 7.27-7.18 (m, 5H), 6.93-6.87 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.0-4.96 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-4.11 (m, 3H), 4.05-3.97 (m, 1H), 3.89-3.79 (m, 3H), 3.76 (s, 6H), 3.74-3.69 (m, 1H), 3.54-3.49 (m, 4H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.12-2.06 (m, 4H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 8H) 1.41-1.35 (m, 4H), 1.28-1.20 (m, 4H). MS(ESI), m/z:1271.2 ([M+Na].sup.+).

Example 32 Synthesis of Compound A.SUB.1.-IV.SUB.1.-R.SUB.1

(184) ##STR00078##

(185) (1) Synthesis of Compound 43

(186) The synthesis of compound 43 was with reference to the synthesis of compound 16 using compound A.sub.1-III.sub.1 as the raw material. A white solid was obtained with a yield of 82.8%. MS(ESI), m/z:877.4 ([M+Na].sup.+).

(187) (2) Synthesis of Compound A.sub.1-III.sub.1-R.sub.1

(188) The synthesis of compound A.sub.1-III.sub.1-R.sub.1 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 40 as the raw material. The yield is 82.9%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.76-7.72 (d, J=8.9 Hz, 1H), 7.70-7.66 (d, J=8.0 Hz, 1H), 7.40-7.36 (d, J=7.2 Hz, 2H), 7.32-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H, 5.21 (s, 1H), 5.0-4.96 (q, J=4.2 Hz, 1H), 4.45-4.51 (d, J=7.2 Hz, 1H), 4.12-4.07 (m, 3H), 4.05-3.97 (m, 1H), 3.88-3.78 (m, 3H), 3.74 (s, 6H), 3.72-3.68 (m, 2H), 3.62-3.58 (m, 2H), 3.56-3.46 (m, 4H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.89-2.85 (m, 2H), 2.58-2.53 (m, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.88 (s, 3H), 1.76 (s, 12H). MS(ESI), m/z:1077.3 ([M+Na].sup.+).

Example 33 Synthesis of Compound A.SUB.1.-V.SUB.1.-R.SUB.4

(189) ##STR00079##

(190) (1) Synthesis of Compound 44

(191) In a 250 mL round bottom flask, compound 6 (5 g, 15.2 mmol) and 1,6-hexanediol (9 g, 76 mmol) were dissolved in 100 mL of anhydrous 1,2-dichloroethane, stirred for 30 min, and added with trimethylsilyl trifluoromethanesulfonate (0.55 mL, 3 mmol); the reaction was reacted overnight at room temperature; the reaction solution was extracted with dichloromethane, and the organic phase was washed twice with 80 mL of saturated sodium bicarbonate solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 5.86 g of a clear oily liquid with a yield of 86.2%. MS(ESI), m/z:470.2 ([M+Na].sup.+).

(192) (2) Synthesis of Compound A.sub.1-V.sub.1-R.sub.4

(193) The synthesis of compound A.sub.1-V.sub.1-R.sub.4 was with reference to the synthesis of compound A.sub.1-I.sub.1-R.sub.1 using compound 41 as the raw material. The yield is 84.1%. .sup.1HNMR (400 MHz, DMSO-d6) δ:7.80-7.75 (d, J=8.9 Hz, 1H), 5.21 (s, 1H), 5.02-4.95 (q, J=4.2 Hz, 1H), 4.50-4.76 (d, J=7.2 Hz, 1H), 4.12-4.07 (m, 3H), 3.88-3.79 (m, 3H), 3.80-3.69 (m, 2H), 3.46-3.36 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.54 (m, 2H), 2.23-2.28 (m, 2H), 2.22-2.14 (m, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.79 (s, 12H), 1.58-1.42 (m, 4H). MS(ESI), m/z:870.5 ([M+Na].sup.+).

Example 34 Preparation of Modified Single Stranded Oligonucleotides

(194) In this embodiment, the modified oligonucleotide was synthesized according to the theoretical yield of 1 μmol. The process was as follows:

(195) (1) In anhydrous acetonitrile, the weighed 1 μmol of standard universal solid support CPG or 3′-cholesterol modified CPG (purchased from Chemgenes), 2′-O-TBDMS-protected RNA phosphoramidite monomer, DNA monomer, 2′-methoxy monomer and 2′-fluoro monomer (purchased from Sigma Aldrich) were dissolved to a concentration of 0.2 M. For phosphorothioate backbone modified oligonucleotides, a 0.2 M PADS solution was used as the thionating reagent. A solution of 5-ethylthio-1H-tetrazole (purchased from Chemgenes) in acetonitrile as the activator (0.25 M), a 0.02 M solution of iodine in pyridine/water as the oxidant, and a 3% solution of trichloroacetic acid in dichloromethane as the deprotecting reagent were placed at the designated position of the reagent corresponding to the ABI 394 DNA/RNA automatic synthesizer.

(196) (2) A synthesis procedure was set, a specified oligonucleotide base sequence was input and checked to make sure there was no errors, and cyclic oligonucleotide synthesis was started, wherein the coupling time of each step is 6 minutes, and the coupling time of the galactose ligand corresponding monomer (A.sub.x-linker-R.sub.x compound) is 10-20 minutes. After automatic circulation, oligonucleotide solid-phase synthesis was completed.

(197) (3) The CPG was blown dry with dry nitrogen, transferred to a 5 mL EP tube, added with 2 mL of ammonia/ethanol solution (3/1) and heated at 55° C. for 16-18 hours. Centrifugation was carried out at 10,000 rpm for 10 min, the supernatant was taken and concentrated aqueous ammonia/ethanol was pumped to dryness to obtain a white gummy solid. The solid was dissolved in 200 μl of 1 M TBAF in THF and shaken at room temperature for 20 hours. 0.5 mL of 1 M Tris-HCl buffer (pH 7.4) was added, shaken for 15 minutes at room temperature and placed on a centrifugal pump to a volume of ½ of the original volume to remove THF. The solution was extracted twice with 0.5 mL of chloroform, 0.1 mL of 0.1 M TEAA loading solution was added, the mixed solution was poured into a solid phase extraction column, and excess salt in the solution was removed.

(198) (4) The concentration of the obtained oligonucleotide was measured by micro-UV spectrophotometer (K05500). The mass spectrometric analysis was performed on an Oligo HTCS LC-MS system (Novatia) system. Nucleic acid molecular weight was calculated by normalization with Promass software after primary scanning.

Example 35 Preparation of Modified Single Stranded Oligonucleotides

(199) In this embodiment, the modified oligonucleotide was synthesized according to the theoretical yield of 1 μmol. The process was as follows:

(200) (1) In anhydrous acetonitrile, the weighed 1 μmol of standard universal solid support CPG or 3′-cholesterol modified CPG (purchased from Chemgenes), DNA monomer, 2′-methoxy monomer and 2′-fluoro monomer (purchased from Sigma Aldrich) were dissolved to a concentration of 0.2 M. For phosphorothioate backbone modified oligonucleotides, a 0.2 M PADS solution was used as the thionating reagent. A solution of 5-ethylthio-1H-tetrazole (purchased from Chemgenes) in acetonitrile as the activator (0.25 M), a 0.02 M solution of iodine in pyridine/water as the oxidant, and a 3% solution of trichloroacetic acid in dichloromethane as the deprotecting reagent were placed at the designated position of the reagent corresponding to the ABI 394 DNA/RNA automatic synthesizer.

(201) (2) A synthesis procedure was set, a specified oligonucleotide base sequence was input and checked to make sure there was no errors, and cyclic oligonucleotide synthesis was started, wherein the coupling time of each step is 6 minutes, and the coupling time of the galactose ligand corresponding monomer (A.sub.x-linker-R.sub.x compound) is 6-10 minutes. After automatic circulation, oligonucleotide solid-phase synthesis was completed.

(202) (3) The CPG was blown dry with dry nitrogen, transferred to a 5 mL EP tube, added with 2 ml of aqueous ammonia solution, and heated at 55° C. for 16-18 hours. Centrifugation was carried out at 10,000 rpm for 10 min, the supernatant was taken and concentrated aqueous ammonia/ethanol was pumped to dryness to obtain a white or yellow gummy solid. Followed by adding 1 mL of 0.1 M TEAA loading solution, the mixed solution was poured onto a solid phase extraction column to remove excess salt from the solution.

(203) (4) The concentration of the obtained oligonucleotide was measured by micro-UV spectrophotometer (K05500). The mass spectrometric analysis was performed on an Oligo HTCS LC-MS system (Novatia) system. Nucleic acid molecular weight were calculated by normalization with Promass software after primary scanning.

Example 36 Preparation of Modified Double Stranded Oligonucleotides

(204) The process was as follows: after the preparation of the modified single-stranded oligonucleotides were completed, the modified single-stranded oligonucleotides were mixed according to an ultraviolet absorption content of 1:1, heated to 95° C. for three minutes, and then cooled to room temperature to form double strands.

(205) In Examples 34-36, the modified oligonucleotides with a crude purity of less than 50% were purified in a linear gradient manner by a DNAPAc PA-100 ion exchange column with mobile phase A: 20 mM NaOH; and mobile phase B: 20 mM NaOH+2M NaCl mixture.

(206) Exemplary modified oligonucleotide sequences and corresponding molecular weight detection results are shown in Table 1.

(207) Abbreviations Description: N=RNA; dN=DNA; mN=2′ OMe modification; fN=2′F modification.

(208) TABLE-US-00003 TABLE 1 Theoretical Oberserved No. Structure (5′-3′) MW MW P8G8-A1 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.1-R.sub.1).sub.1  6585.1 6585.4 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7941.0 P8G8-A2 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.1-R.sub.1).sub.2  7041.2 7042.1 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7941.9 P8G8-A3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.1-R.sub.1).sub.3  7497.4 7496.4 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7941.2 P8G8-A4 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.1-R.sub.1).sub.4  7953.5 7954.6 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7942.3 A3-P8G8 (A.sub.1-I.sub.1-.sub.1R.sub.1).sub.3-mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU  7497.4 7497.8 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941 6 7942.7 P8G8-B1 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.2-R.sub.1).sub.1 6655.1 6653.2 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7940.3 P8G8-B2 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.2-R.sub.1).sub.2 7181.4 7182.0 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7942.5 P8G8-B3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.2-R.sub.1).sub.3 7707.6 7709.4 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7940.6 P8G8-B4 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.2-R.sub.1).sub.4 8233.8 8234.6 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7942.7 B3-P8G8 (A.sub.1-I.sub.2-R.sub.1).sub.3-mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU  7707.6 7709.3 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7942.2 P8G8-C3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-II.sub.1-R.sub.1).sub.2  7836.6 7835.1 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7942.5 P8G8-D3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-III.sub.1-R.sub.1).sub.3  8175.9 8177.3 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.3 7940.2 P8G8-E3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.1-I.sub.1-R.sub.2).sub.3  7539.4 7538.1 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7942.7 P8G8-F3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.2-I.sub.2-R.sub.1).sub.3  8070.7 8068.9 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7940.1 P8G8-G3 mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU-(A.sub.3-I.sub.2-R.sub.1).sub.3  7584.5 7583.7 AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7941.2 P8G8-H2I (A.sub.1-V.sub.1-R.sub.4)-(A.sub.1-IV.sub.1-R.sub.1.sup.).sub.2-mCmAdGfCdAmAdGfUdGfUdGm 7488.3 7386.5 AfCmAmGfUfCmAmU  AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU 7941.6 7939.7 P9G20-A3 CAGGCCAGCAAGUGUGACA-(A.sub.1-I.sub.1-R.sub.1).sub.3 7491.3 7492.0 fUmGfUfCfA(s)dC(s)dAmCmUfUfGfC(s)dT(s)dGmGmCfCfUfG(s)mU(s)mC 6766.4 6766.9

(209) The modified sequences (not including the compound of modifier, such as A.sub.1-I.sub.1-R.sub.1) of Table 1 are as followings:

(210) TABLE-US-00004 Sequence 5 (SEQ ID NO: 5): mCmAdGfCdAmAdGfUdGfUdGmAfCmAmGfUfCmAmU Sequence 6 (SEQ ID NO: 6): AfUGAfCfUGfUfCAfCAfCfUfUGfCfUGGfCfCfUGfU Sequence 7 (SEQ ID NO: 7): fUmGfUfCfA(s)dC(s)dAmCmUfUfGfC(s)dT(s)dGmGmCfCfUf G(s)mU(s)mC

Example 37 Cell Targeting Assay of Modified Oligonucleotides

(211) Modified oligonucleotides for animal experiments were filtered through a 0.22 μm membrane before injection.

(212) 1, Isolation of Primary Mouse Hepatocytes

(213) The mice were anesthetized, and the skin and muscle layers were dissected to expose the liver, the perfusion catheter was inserted into the portal vein, and the inferior vena cava was dissected to prepare for liver perfusion. Perfusion Solution I (Hank's, 0.5 mM EGTA, pH 8) and Perfusion Solution II (Low-glucose DMEM, 100 U/mL Type IV, pH 7.4) were pre-warmed at 40° C., and Perfusion Solution I of 37° C. was perfused through the portal vein at a flow rate of 7 mL/min for 5 min until the liver turned off-white. Perfusion Solution II of 37° C. was then perfused into the liver at a flow rate of 7 mL/min for 7 min. After perfusion was complete, the liver was removed and placed in Solution III (10% FBS low-glucose DMEM, 4° C.) to stop digestion, then the liver capsule was cut by the forceps, and the hepatocytes was released by gently shaking. The hepatocytes were filtered through a 70 μm cell filter, centrifuged at 50 g for 2 min with the supernatant discarded. The cells were resuspended in Solution IV (40% percoll low-glucose DMEM, 4° C.), centrifuged at 100 g for 2 min with the supernatant discarded. Cells were added with 2% FBS low-glucose DMEM and resuspended for use. Cell viability was identified by Trypan blue staining.

(214) 2, Determinations of GalNAc Binding Curves and Kd Values

(215) Freshly isolated mouse primary hepatocytes were plated in 96-well plates at 2×10.sup.4 cells/well, 100 μl/well. GalNAc-siRNA was added to each well, respectively. Each GalNAc-siRNA was set to a final concentration of 0.9 nM, 2.7 nM, 8.3 nM, 25 nM, 50 nM, or 100 nM. The suspensions were incubated at 4° C. for 2 h, and centrifuged at 50 g for 2 min with the supernatant discarded. The cells were resuspended in 10 μg/ml PI, stained for 10 min and centrifuged at 50 g for 2 min. Cells were washed with pre-cooled PBS and centrifuged at 50 g for 2 min with the supernatant discarded. The cells were resuspended in PBS. The mean fluorescence intensity (MFI) of living cells was measured by a flow cytometry, and nonlinear fitting and K.sub.d value calculation were performed with the GraphPad Prism 5 software. The results are shown in Table 2, Table 3 and FIG. 1. The data showed that GalNAc-siRNA could specifically target hepatocytes; the GalNAc ligand has a Kd value of 7.6-53.4 nM with the cell receptor, showing a higher affinity (Ki value 5.2-51.3 nM) compared with the galactose ligand preferred in the prior art (PCT/US2014/046425). GalNAc-siRNAs with different conjugate structures show a certain difference in binding ability to the receptor, and structures A3 and A4 show a relatively strong affinity for the receptor (the smaller the Kd value, the greater the affinity).

(216) TABLE-US-00005 TABLE 2 K.sub.d values (nM) and B.sub.max values for each experimental group Groups P8G8-A2 P8G8-A3 P8G8A4 A3-P8G8 P8G8-B2 P8G8-B3 P8G8-B4 B3-P8G8 B.sub.max 101482 159404 156210 159880 96906 157659 167084 182089 K.sub.d 53.69 7.58 7.22 9.82 30.07 14.45 9.02 14.27

(217) TABLE-US-00006 TABLE 3 K.sub.d values (nM) and B.sub.max values for each expermental group Groups P8G8-C3 P8G8-D3 P8G8-E3 P8G8-F3 P8G8-G3 P8G8-H2I P9G20-A3 B.sub.max 197556 163439 169699 164021 176761 138114 170152 K.sub.d 12.26 17.56 14.90 18.54 17.87 8.89 9.87

Example 38 In Vivo Liver Targeting Assay

(218) 13 Male, 6-7 week old SPF grade Balb/c-nu mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used for this study, and were randomly divided into 4 groups, blank control group, P8G8 control group (unconjugated ligand), P8G8-A3 group and P8G8-B3 group. The number of animals in each group was 2, 3, 4 and 4 respectively, and administered by tail vein injection at a dose of about 10 mg/kg (see Table 4 for experimental design). All animals were subjected to in vivo imaging, including white light and X-ray imaging, before administration and 5 min, 30 min, 1 hour, 2 hours, 4 hours, 6 hours after administration. After euthanasia 6 hours after the administration, the brain, salivary glands, heart, spleen, lung, liver, kidney, and intestinal tract were removed for imaging of isolated organs.

(219) TABLE-US-00007 TABLE 4 Liver targeting expermental design Sequence Samples Dosing Dosing Volume Number Groupings for test (mg/kg) (mL) 1 Blank control group Saline 0 0.2 2 NC1 P8G8 10 0.2 3 Positive group P8G8-A3 10 0.2 4 Positive group P8G8-B3 10 0.2

(220) The in vivo imaging analysis (Tables 5-6) showed that the fluorescence intensity of each liver in the P8G8-A3 and P8G8-B3 groups was higher than that in the negative control group 6 hours after administration. The results showed that P8G8-A3 and P8G8-B3 have a certain targeting to liver.

(221) TABLE-US-00008 TABLE 5 Statistical results of in vivo organ fluorescence intensity values after background subtraction (×10.sup.8 ps/mm.sup.2) Groups Salivary gland Liver Kidney Intestinal tract P8G8 Mean 8102 4627 35414 15620 SD 754 452 2685 1125 P8G8-A3 Mean 8520 16214 39654 18564 SD 962 1025 345 1265 P8G8-B3 Mean 8954 13326 32584 19854 SD 1203 1657 2147 2365

(222) TABLE-US-00009 TABLE 6 Fluorescence intensity ratio results Salivary gland Liver Kidney Intestinal tract P8G8-A3/P8G8 1.05 3.50 1.12 1.19 P8G8-B3/P8G8 1.10 2.88 0.92 1.30

(223) Although specific embodiments of the present disclosure have been described in detail, those skilled in the art will appreciate that various modifications and variations of the details are possible in light of the above teachings and are within the purview of this disclosure. The full scope of the present disclosure is indicated by the appended claims and any equivalents thereof.