Oligomeric compounds comprising bicyclic nucleotides and uses thereof
09914922 ยท 2018-03-13
Assignee
Inventors
Cpc classification
C12Y301/03067
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12Y301/03016
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/51
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention provides oligomeric compounds. Certain such oligomeric compounds are useful for hybridizing to a complementary nucleic acid, including but not limited, to nucleic acids in a cell. In certain embodiments, hybridization results in modulation of the amount activity or expression of the target nucleic acid in a cell.
Claims
1. A compound comprising: a modified oligonucleotide consisting of 17 to 20 linked nucleosides, wherein the modified oligonucleotide has a motif selected from e-e-e-k-(D).sub.9-k-e-e-e, e-e-e-k-k-(D).sub.8-e-e-e-e, e-k-e-k-(D).sub.9-e-e-e-e, e-k-e-k-d-k-(D).sub.7-e-e-e-e, k-d-k-d-k-(D).sub.10-e-e-e-e-e, k-d-k-d-k-(D).sub.8-e-e-e-e-e, and k-d-k-d-k-(D).sub.8-e-e-e-e; and wherein each k is a bicyclic nucleoside, each e is a 2-substituted nucleoside, each d is a 2-deoxynucleoside, and each D is a 2-deoxynucleoside; and wherein each 2 -substitutent is selected from 2-OMe, 2-O-methoxyethyl, and 2-F; and wherein the nucleobase sequence of the modified oligonucleotide is complementary to the nucleobase sequence of a target nucleic acid.
2. The compound of claim 1, wherein each 2-substituent is a 2-O-methoxyethyl group.
3. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: e-e-e-k-(D).sub.9-k-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, and each D is a 2-deoxynucleoside.
4. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: e-e-e-k-k-(D).sub.8-e-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, and each D is a 2-deoxynucleoside.
5. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: e-k-e-k-(D)9-e-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, and each D is a 2-deoxynucleoside.
6. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: e-k-e-k-d-k-(D)7-e-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, each d is a 2-deoxynucleoside, and each D is comprises a 2-deoxynucleoside.
7. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: k-d-k-d-k-(D).sub.10-e-e-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, each d is a 2-deoxynucleoside, and each D is a 2-deoxynucleoside.
8. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: k-d-k-d-k-(D).sub.8-e-e-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, each d is a 2-deoxynucleoside, and each D is a 2-deoxynucleoside.
9. The compound of claim 1, wherein the compound comprises a modified oligonucleotide having the motif: k-d-k-d-k-(D).sub.8-e-e-e-e, wherein each k is a constrained ethyl nucleoside, each e is a 2-MOE substituted nucleoside, each d is a 2-deoxynucleoside, and each D is a 2-deoxynucleoside.
10. A pharmaceutical composition comprising the compound according to claim 1 and a pharmaceutically acceptable diluent.
11. A method of modulating expression of a target nucleic acid in a cell comprising contacting the cell with the compound of claim 1.
12. The method of claim 11, wherein the cell is in an animal.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in Carbohydrate Modifications in Antisense Research Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 21.sup.st edition, 2005; and Antisense Drug Technology, Principles, Strategies, and Applications Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al., Molecular Cloning, A laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, 1989, which are hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
(2) Unless otherwise indicated, the following terms have the following meanings:
(3) As used herein, nucleoside means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
(4) As used herein, chemical modification means a chemical difference in a compound when compared to a naturally occurring counterpart. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications.
(5) As used herein, furanosyl means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
(6) As used herein, naturally occurring sugar moiety means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
(7) As used herein, sugar moiety means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
(8) As used herein, modified sugar moiety means a substituted sugar moiety or a sugar surrogate.
(9) As used herein, substituted sugar moiety means a furanosyl that is not a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2-position, the 3-position, the 5-position and/or the 4-position. Certain substituted sugar moieties are bicyclic sugar moieties.
(10) As used herein, 2-substituted sugar moiety means a furanosyl comprising a substituent at the 2-position other than H or OH. Unless otherwise indicated, a 2-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2-substituent of a 2-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.
(11) As used herein, MOE means OCH.sub.2CH.sub.2OCH.sub.3.
(12) As used herein the term sugar surrogate means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside is capable of (1) incorporation into an oligonucleotide and (2) hybridization to a complementary nucleoside. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.
(13) As used herein, bicyclic sugar moiety means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2-carbon and the 4-carbon of the furanosyl.
(14) As used herein, nucleotide means a nucleoside further comprising a phosphate linking group. As used herein, linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to linked nucleotides. As used herein, linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
(15) As used herein, nucleobase means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
(16) As used herein, heterocyclic base or heterocyclic nucleobase means a nucleobase comprising a heterocyclic structure.
(17) As used herein the terms, unmodified nucleobase or naturally occurring nucleobase means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
(18) As used herein, modified nucleobase means any nucleobase that is not a naturally occurring nucleobase.
(19) As used herein, modified nucleoside means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
(20) As used herein, bicyclic nucleoside or BNA means a nucleoside comprising a bicyclic sugar moiety.
(21) As used herein, constrained ethyl nucleoside or cEt means a nucleoside comprising a bicyclic sugar moiety comprising a 4-CH(CH.sub.3)O-2-bridge.
(22) As used herein, locked nucleic acid nucleoside or LNA means a nucleoside comprising a bicyclic sugar moiety comprising a 4-CH.sub.2O-2-bridge.
(23) As used herein, 2-substituted nucleoside means a nucleoside comprising a substituent at the 2-position other than H or OH. Unless otherwise indicated, a 2-substituted nucleoside is not a bicyclic nucleoside.
(24) As used herein, 2-deoxynucleoside means a nucleoside comprising 2-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
(25) As used herein, oligonucleotide means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
(26) As used herein oligonucleoside means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.
(27) As used herein, modified oligonucleotide means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.
(28) As used herein internucleoside linkage means a covalent linkage between adjacent nucleosides in an oligonucleotide.
(29) As used herein naturally occurring internucleoside linkage means a 3 to 5 phosphodiester linkage.
(30) As used herein, modified internucleoside linkage means any internucleoside linkage other than a naturally occurring internucleoside linkage.
(31) As used herein, oligomeric compound means a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide.
(32) As used herein, terminal group means one or more atom attached to either, or both, the 3 end or the 5 end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
(33) As used herein, conjugate means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
(34) As used herein, conjugate linking group means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
(35) As used herein, antisense compound means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
(36) As used herein, antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
(37) As used herein, detecting or measuring means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
(38) As used herein, detectable and/or measureable activity means a measurable activity that is not zero.
(39) As used herein, essentially unchanged means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.
(40) As used herein, expression means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5-cap), and translation.
(41) As used herein, target nucleic acid means a nucleic acid molecule to which an antisense compound hybridizes.
(42) As used herein, single nucleotide polymorphism or SNP means a single nucleotide variation between the genomes of individuals of the same species. In some cases, a SNP may be a single nucleotide deletion or insertion.
(43) As used herein, mRNA means an RNA molecule that encodes a protein.
(44) As used herein, pre-mRNA means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.
(45) As used herein, object RNA means an RNA molecule other than a target RNA, the amount, activity, splicing, and/or function of which is modulated, either directly or indirectly, by a target nucleic acid. In certain embodiments, a target nucleic acid modulates splicing of an object RNA. In certain such embodiments, an antisense compound modulates the amount or activity of the target nucleic acid, resulting in a change in the splicing of an object RNA and ultimately resulting in a change in the activity or function of the object RNA.
(46) As used herein, microRNA means a naturally occurring, small, non-coding RNA that represses gene expression of at least one mRNA. In certain embodiments, a microRNA represses gene expression by binding to a target site within a 3 untranslated region of an mRNA. In certain embodiments, a microRNA has a nucleobase sequence as set forth in miRBase, a database of published microRNA sequences found at http://microrna.sanger.ac.uk/sequences/. In certain embodiments, a microRNA has a nucleobase sequence as set forth in miRBase version 12.0 released September 2008, which is herein incorporated by reference in its entirety.
(47) As used herein, microRNA mimic means an oligomeric compound having a sequence that is at least partially identical to that of a microRNA. In certain embodiments, a microRNA mimic comprises the microRNA seed region of a microRNA. In certain embodiments, a microRNA mimic modulates translation of more than one target nucleic acids. In certain embodiments, a microRNA mimic is double-stranded.
(48) As used herein, targeting or targeted to means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
(49) As used herein, nucleobase complementarity or complementarity when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
(50) As used herein, non-complementary in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
(51) As used herein, complementary in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.
(52) As used herein, hybridization means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
(53) As used herein, specifically hybridizes means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.
(54) As used herein, fully complementary in reference to an oligonucleotide or portion thereof means that each nucleobase of the oligonucleotide or portion thereof is capable of pairing with a nucleobase of a complementary nucleic acid or contiguous portion thereof. Thus, a fully complementary region comprises no mismatches or unhybridized nucleobases in either strand.
(55) As used herein, percent complementarity means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
(56) As used herein, percent identity means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
(57) As used herein, modulation means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.
(58) As used herein, motif means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
(59) As used herein, nucleoside motif means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
(60) As used herein, sugar motif means a pattern of sugar modifications in an oligomeric compound or a region thereof
(61) As used herein, linkage motif means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
(62) As used herein, nucleobase modification motif means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
(63) As used herein, sequence motif means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
(64) As used herein, type of modification in reference to a nucleoside or a nucleoside of a type means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a nucleoside having a modification of a first type may be an unmodified nucleoside.
(65) As used herein, differently modified mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are differently modified, even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are differently modified, even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
(66) As used herein, the same type of modifications refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have the same type of modification, even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.
(67) As used herein, separate regions means portions of an oligonucleotide wherein the chemical modifications or the motif of chemical modifications of any neighboring portions include at least one difference to allow the separate regions to be distinguished from one another.
(68) As used herein, pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.
(69) As used herein, substituent and substituent group, means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2-substuent is any atom or group at the 2-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
(70) Likewise, as used herein, substituent in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (C(O)R.sub.aa), carboxyl (C(O)OR.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (OR.sub.aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (N(R.sub.bb)(R.sub.cc)), imino(NR.sub.bb), amido (C(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)R.sub.aa), azido (N.sub.3), nitro (NO.sub.2), cyano (CN), carbamido (OC(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)OR.sub.aa), ureido (N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido (N(R.sub.bb)C(S)N(R.sub.bb)(R.sub.cc)), guanidinyl (N(R.sub.bb)C(NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl (C(NR.sub.bb)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(NR.sub.bb)(R.sub.aa)), thiol (SR.sub.bb), sulfinyl (S(O)R.sub.bb), sulfonyl (S(O).sub.2R.sub.bb) and sulfonamidyl (S(O).sub.2N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)S(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
(71) As used herein, alkyl, as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon atoms being more preferred.
(72) As used herein, alkenyl, means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
(73) As used herein, alkynyl, means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.
(74) As used herein, acyl, means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula C(O)X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
(75) As used herein, alicyclic means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.
(76) As used herein, aliphatic means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines Aliphatic groups as used herein may optionally include further substituent groups.
(77) As used herein, alkoxy means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
(78) As used herein, aminoalkyl means an amino substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.
(79) As used herein, aralkyl and arylalkyl mean an aromatic group that is covalently linked to a C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
(80) As used herein, aryl and aromatic mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.
(81) As used herein, halo and halogen, mean an atom selected from fluorine, chlorine, bromine and iodine.
(82) As used herein, heteroaryl, and heteroaromatic, mean a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.
(83) Oligomeric Compounds
(84) In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.
(85) Certain Sugar Moieties
(86) In certain embodiments, oligomeric compounds of the invention comprise one or more modified nucleosides comprising a modified sugar moiety. Such oligomeric compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligomeric compounds comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substituted sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
(87) In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more non-bridging sugar substituent, including but not limited to substituents at the 2 and/or 5 positions. Examples of sugar substituents suitable for the 2-position, include, but are not limited to: 2-F, 2-OCH.sub.3 (OMe or O-methyl), and 2-O(CH.sub.2).sub.2OCH.sub.3 (MOE). In certain embodiments, sugar substituents at the 2 position is selected from allyl, amino, azido, thio, O-allyl, OC.sub.1-C.sub.10 alkyl, OC.sub.1-C.sub.10 substituted alkyl; OCF.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(Rm)(Rn), and OCH.sub.2C(O)N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. Examples of sugar substituents at the 5-position, include, but are not limited to: 5-methyl (R or S); 5-vinyl, and 5-methoxy. In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2-F-5-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5,2-bis substituted sugar moieties and nucleosides).
(88) Nucleosides comprising 2-substituted sugar moieties are referred to as 2-substituted nucleosides. In certain embodiments, a 2-substituted nucleoside comprises a 2-substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O, S, or N(R.sub.m)-alkyl; O, S, or N(R.sub.m)-alkenyl; O, S or N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(O)N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These 2-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
(89) In certain embodiments, a 2-substituted nucleoside comprises a 2-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CHCH.sub.2, OCH.sub.2CHCH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(O)N(R.sub.m)(R.sub.n) where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
(90) In certain embodiments, a 2-substituted nucleoside comprises a sugar moiety comprising a 2-substituent group selected from F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(O)N(H)CH.sub.3.
(91) In certain embodiments, a 2-substituted nucleoside comprises a sugar moiety comprising a 2-substituent group selected from F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
(92) Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4 and the 2 furanose ring atoms. Examples of such 4 to 2 sugar substituents, include, but are not limited to: [C(R.sub.a)(R.sub.b)].sub.n, [C(R.sub.a)(R.sub.b)].sub.nO, C(R.sub.aR.sub.b)N(R)O or, C(R.sub.aR.sub.b)ON(R); 4- CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-(CH.sub.2).sub.3-2, 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2)S-2; 4-(CH.sub.2).sub.2O-2 (ENA); 4-CH(CH.sub.3)O-2 (cEt) and 4-CH(CH.sub.2OCH.sub.3)O-2,and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4-C(CH.sub.3)(CH.sub.3)O-2 and analogs thereof, (see, e.g., WO2009/006478, published Jan. 8, 2009); 4-CH.sub.2N(OCH.sub.3)-2 and analogs thereof (see, e.g., WO2008/150729, published Dec. 11, 2008); 4-CH.sub.2ON(CH.sub.3)-2 (see, e.g., US2004/0171570, published Sep. 2, 2004); 4-CH.sub.2ON(R)-2, and 4-CH.sub.2N(R)O-2-, wherein each R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl; 4-CH.sub.2N(R)O-2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4-CH.sub.2C(H)(CH.sub.3)-2 (see, e.g., Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH.sub.2C(CH.sub.2)-2 and analogs thereof (see, published PCT International Application WO 2008/154401, published on Dec. 8, 2008).
(93) In certain embodiments, such 4 to 2 bridges independently comprise from 1 to 4 linked groups independently selected from [C(R.sub.a)(R.sub.b)].sub.n, C(R.sub.a)C(R.sub.b), C(R.sub.a)N, C(NR.sub.a), C(O), C(S), O, Si(R.sub.a).sub.2, S(O).sub.x, and N(R.sub.a);
(94) wherein:
(95) x is 0, 1, or 2;
(96) n is 1, 2, 3, or 4;
(97) each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(O)H), substituted acyl, CN, sulfonyl (S(O).sub.2-J.sub.1), or sulfoxyl (S(O)-J.sub.1); and
(98) each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(O)H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
(99) Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) -L-Methyleneoxy (4-CH.sub.2O-2) BNA, (B) -D-Methyleneoxy (4-CH.sub.2O-2) BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4-(CH.sub.2).sub.2O-2) BNA, (D) Aminooxy (4-CH.sub.2ON(R)-2) BNA, (E) Oxyamino (4-CH.sub.2N(R)O-2) BNA, (F) Methyl(methyleneoxy) (4-CH(CH.sub.3)O-2) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4-CH.sub.2S-2) BNA, (H) methylene-amino (4-CH2-N(R)-2) BNA, (I) methyl carbocyclic (4-CH.sub.2CH(CH.sub.3)-2) BNA, and (J) propylene carbocyclic (4-(CH.sub.2).sub.3-2) BNA as depicted below.
(100) ##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl.
(101) Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
(102) In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4-2-methylene-oxy bridge, may be in the -L configuration or in the -D configuration. Previously, -L-methyleneoxy (4-CH.sub.2O-2) bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
(103) In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5-substituted and 4-2 bridged sugars). (see, PCT International Application WO 2007/134181, published on Nov. 22, 2007, wherein LNA is substituted with, for example, a 5-methyl or a 5-vinyl group).
(104) In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4-sulfer atom and a substitution at the 2-position (see, e.g., published U.S. Patent Application US2005/0130923, published on Jun. 16, 2005) and/or the 5 position. By way of additional example, carbocyclic bicyclic nucleosides having a 4-2 bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
(105) In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula VII:
(106) ##STR00003##
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
(107) Bx is a nucleobase moiety;
(108) T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5 or 3-terminal group;
(109) q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and
(110) one of R.sub.1 and R.sub.2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(X)J.sub.1, OC(X)NJ.sub.1J.sub.2, NJ.sub.3C(X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
(111) In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.
(112) Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).
(113) Combinations of modifications are also provided without limitation, such as 2-F-5-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5,2-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4-CH.sub.2O-2 bicyclic nucleoside is further substituted at the 5 position with a 5-methyl or a 5-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
(114) Certain Nucleobases
(115) In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.
(116) In certain embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (CCCH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3,2:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
(117) Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
(118) Certain Internucleoside Linkages
(119) In certain embodiments, the present invention provides oligomeric compounds comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (PO), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (PS). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (CH.sub.2N(CH.sub.3)OCH.sub.2), thiodiester (OC(O)S), thionocarbamate (OC(O)(NH)S); siloxane (OSi(H).sub.2O); and N,N-dimethylhydrazine (CH.sub.2N(CH.sub.3)N(CH.sub.3)). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
(120) The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), or such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
(121) Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3-CH.sub.2N(CH.sub.3)O-5), amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5), formacetal (3-OCH.sub.2O-5), and thioformacetal (3-SCH.sub.2O-5). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.
(122) Certain Motifs
(123) In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).
(124) Certain Sugar Motifs
(125) In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
(126) In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or wings and an internal region or gap. The three regions of a gapmer motif (the 5-wing, the gap, and the 3-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3-most nucleoside of the 5-wing and the 5-most nucleoside of the 3-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5-wing differs from the sugar modification motif of the 3-wing (asymmetric gapmer).
(127) Certain 5-Wings
(128) In certain embodiments, the 5-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 5-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 5-wing of a gapmer consists of 5 linked nucleosides.
(129) In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least two bicyclic nucleosides. In certain embodiments, the 5-wing of a gapmer comprises at least three bicyclic nucleosides. In certain embodiments, the 5-wing of a gapmer comprises at least four bicyclic nucleosides. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a LNA nucleoside.
(130) In certain embodiments, the 5-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one 2-substituted nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one 2-MOE nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one 2-OMe nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a 2-substituted nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a 2-MOE nucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a 2-OMe nucleoside.
(131) In certain embodiments, the 5-wing of a gapmer comprises at least one 2-deoxynucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a 2-deoxynucleoside. In a certain embodiments, the 5-wing of a gapmer comprises at least one ribonucleoside. In certain embodiments, each nucleoside of the 5-wing of a gapmer is a ribonucleoside.
(132) In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-substituted nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-MOE nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-OMe nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-deoxynucleoside.
(133) In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-substituted nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-MOE nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-OMe nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-deoxynucleoside.
(134) In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-substituted nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-MOE nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-OMe nucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-deoxynucleoside.
(135) In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2-deoxynucleoside.
(136) In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2-substituted nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2-substituted nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside, at least one 2-substituted nucleoside, and at least one 2-deoxynucleoside.
(137) In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2-MOE nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2-MOE nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside, at least one 2-MOE nucleoside, and at least one 2-deoxynucleoside.
(138) In certain embodiments, the 5-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2-OMe nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2-OMe nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 5-wing of a gapmer comprises at least one LNA nucleoside, at least one 2-OMe nucleoside, and at least one 2-deoxynucleoside.
(139) In certain embodiments, the 5-wing of a gapmer has a sugar motif selected from among those listed in the following non-limiting table:
(140) TABLE-US-00002 TABLE 1 Certain 5-Wing Sugar Motifs 5-wing 5-wing 5-wing sugar sugar sugar motif # motif motif # motif motif # motif 1a A-B-B 1d A-L-L 1g A-K-K 2a A-A-B 2d A-A-L 2g A-A-K 3a A-D-B 3d A-D-L 3g A-D-K 4a B-D-A 4d L-D-A 4g K-D-A 5a B-A-A 5d L-A-A 5g K-A-A 6a B-B-B 6d L-L-L 6g K-K-K 7a A-A-A 7d A-A-A 7g A-A-A 8a A-D-D-B 8d A-D-D-L 8g A-D-D-K 9a B-D-D-A 9d L-D-D-A 9g K-D-D-A 10a A-A-A-B 10d A-A-A-L 10g A-A-A-K 11a B-A-A-A 11d L-A-A-A 11g K-A-A-A 12a A-A-A-A 12d A-A-A-A 12g A-A-A-A 13a B-D-D-B 13d L-D-D-L 13g K-D-D-K 14a A-A-A-A 14d A-A-A-A 14g A-A-A-A 15a B-B-B-B 15d L-L-L-L 15g K-K-K-K 16a A-A-A-A-A 16d A-A-A-A-A 16g A-A-A-A-A 17a A-D-A-D-B 17d A-D-A-D-L 17g A-D-A-D-K 18a A-D-B-D-A 18d A-D-L-D-A 18g A-D-K-D-A 19a B-D-A-D-A 19d L-D-A-D-A 19g K-D-A-D-A 20a A-A-A-A-B 20d A-A-A-A-L 20g A-A-A-A-K 21a A-A-B-A-A 21d A-A-L-A-A 21g A-A-K-A-A 22a B-A-A-A-A 22d L-A-A-A-A 22g K-A-A-A-A 1b E-B-B 1e E-L-L 1h E-K-K 2b E-E-B 2e E-E-L 2h E-E-K 3b E-D-B 3e E-D-L 3h E-D-K 4b B-D-E 4e L-D-E 4h K-D-E 5b B-E-E 5e L-E-E 5h K-E-E 6b B-B-B 6e L-L-L 6h K-K-K 7b E-E-E 7e E-E-E 7h E-E-E 8b E-D-D-B 8e E-D-D-L 8h E-D-D-K 9b B-D-D-E 9e L-D-D-E 9h K-D-D-E 10b E-E-E-B 10e E-E-E-L 10h E-E-E-K 11b B-E-E-E 11e L-E-E-E 11h K-E-E-E 12b E-E-E-E 12e E-E-E-E 12h E-E-E-E 13b B-D-D-B 13e L-D-D-L 13h K-D-D-K 14b E-E-E-E 14e E-E-E-E 14h E-E-E-E 15b B-B-B-B 15e L-L-L-L 15h K-K-K-K 16b E-E-E-E-E 16e E-E-E-E-E 16h E-E-E-E-E 17b E-D-E-D-B 17e E-D-E-D-L 17h E-D-E-D-K 18b E-D-B-D-E 18e E-D-L-D-E 18h E-D-K-D-E 19b B-D-E-D-E 19e L-D-E-D-E 19h K-D-E-D-E 20b E-E-E-E-B 20e E-E-E-E-L 20h E-E-E-E-K 21b E-E-B-E-E 21e E-E-L-E-E 21h E-E-K-E-E 22b B-E-E-E-E 22e L-E-E-E-E 22h K-E-E-E-E 1c M-B-B 1f M-L-L 1i M-K-K 2c M-M-B 2f M-M-L 2i M-M-K 3c M-D-B 3f M-D-L 3i M-D-K 4c B-D-M 4f L-D-M 4i K-D-M 5c B-M-M 5f L-M-M 5i K-M-M 6c B-B-B 6f L-L-L 6i K-K-K 7c M-M-M 7f M-M-M 7i M-M-M 8c M-D-D-B 8f M-D-D-L 8i M-D-D-K 9c B-D-D-M 9f L-D-D-M 9i K-D-D-M 10c M-M-M-B 10f M-M-M-L 10i M-M-M-K 11c B-M-M-M 11f L-M-M-M 11i K-M-M-M 12c M-M-M-M 12f M-M-M-M 12i M-M-M-M 13c B-D-D-B 13f L-D-D-L 13i K-D-D-K 14c M-M-M-M 14f M-M-M-M 14i M-M-M-M 15c B-B-B-B 15f L-L-L-L 15i K-K-K-K 16c M-M-M- 16f M-M-M-M-M 16i M-M-M- M-M M-M 17c M-D-M-D-B 17f M-D-M-D-L 17i M-D-M-D-K 18c M-D-B-D-M 18f M-D-L-D-M 18i M-D-K-D-M 19c B-D-M-D-M 19f L-D-M-D-M 19i K-D-M-D-M 20c M-M-M- 20f M-M-M-M-L 20i M-M-M- M-B M-K 21c M-M-B- 21f M-M-L-M-M 21i M-M-K- M-M M-M 22c B-M-M- 22f L-M-M-M-M 22i K-M-M- M-M M-M 1j A-L-K 1k A-K-L 1l E-L-K 2j M-E-K 2k M-E-L 2l E-M-K 3j L-D-K 3k K-D-L 3l B-D-K 4j K-D-A 4k L-D-K 4l K-B-L 5j B-M-E 5k L-M-E 5l K-M-E 6j K-L-L 6k L-K-L 6l L-K-K 7j E-M-E 7k M-E-M 7l M-E-E 8j E-D-D-M 8k K-D-D-L 8l L-D-D-K 9j M-D-D-E 9k L-D-K-E 9l K-D-L-E 10j E-M-E-B 10k E-M-E-L 10l E-M-E-K 11j B-E-E-M 11k L-E-E-M 11l K-E-E-M 12j E-E-E-M 12k M-E-E-E 12l E-M-E-E 13j K-L-D-K 13k L-K-D-L 13l K-D-L-K 14j E-M-E-M 14k M-EM-E 14l E-E-M-E 15j K-L-L-K 15k L-K-L-K 15l K-L-K-K 16j E-E-M-E-E 16k M-E-E-E-M 16l E-E-M-M-E 17j E-D-M-D-K 17k E-D-M-D-L 17l M-D-E-D-K 18j E-D-K-D-M 18k E-D-L-D-M 18l M-D-K-D-E 19j B-D-A-D-A 19k L-D-A-D-A 19l K-D-A-D-A 20j E-M-E-E-L 20k E-M-M-E-L 20l M-E-E-E-K 21j E-E-K-M-M 21k E-E-L-M-M 21l E-M-K-E-E 22j B-E-M-E-A 22k L-E-A-M-A 22l K-E-A-A-A 23j K-D-K-D-K 23k E-K-E-K-D-K
(141) In the above table, A represents a nucleoside comprising a 2-substituted sugar moiety; B represents a bicyclic nucleoside; D represents a 2-deoxynucleoside; K represents a constrained ethyl nucleoside; L represents an LNA nucleoside; E represents a 2-MOE nucleoside; and M represents a 2-OMe nucleoside.
(142) In certain embodiments, an oligonucleotide comprises any 5-wing motif provided herein. In certain such embodiments, the oligonucleotide is a 5-hemimer (does not comprise a 3-wing). In certain embodiments, such an oligonucleotide is a gapmer. In certain such embodiments, the 3-wing of the gapmer may comprise any sugar modification motif.
(143) In certain embodiments, the 5-wing of a gapmer has a sugar motif selected from among those listed in the following non-limiting tables:
(144) TABLE-US-00003 TABLE 2 Certain 5-Wing Sugar Motifs Certain 5-Wing Sugar Motifs AAAAA ABCBB BABCC BCBBA CBACC AAAAB ABCBC BACAA BCBBB CBBAA AAAAC ABCCA BACAB BCBBC CBBAB AAABA ABCCB BACAC BCBCA CBBAC AAABB ABCCC BACBA BCBCB CBBBA AAABC ACAAA BACBB BCBCC CBBBB AAACA ACAAB BACBC BCCAA CBBBC AAACB ACAAC BACCA BCCAB CBBCA AAACC ACABA BACCB BCCAC CBBCB AABAA ACABB BACCC BCCBA CBBCC AABAB ACABC BBAAA BCCBB CBCAA AABAC ACACA BBAAB BCCBC CBCAB AABBA ACACB BBAAC BCCCA CBCAC AABBB ACACC BBABA BCCCB CBCBA AABBC ACBAA BBABB BCCCC CBCBB AABCA ACBAB BBABC CAAAA CBCBC AABCB ACBAC BBACA CAAAB CBCCA AABCC ACBBA BBACB CAAAC CBCCB AACAA ACBBB BBACC CAABA CBCCC AACAB ACBBC BBBAA CAABB CCAAA AACAC ACBCA BBBAB CAABC CCAAB AACBA ACBCB BBBAC CAACA CCAAC AACBB ACBCC BBBBA CAACB CCABA AACBC ACCAA BBBBB CAACC CCABB AACCA ACCAB BBBBC CABAA CCABC AACCB ACCAC BBBCA CABAB CCACA AACCC ACCBA BBBCB CABAC CCACB ABAAA ACCBB BBBCC CABBA CCACC ABAAB ACCBC BBCAA CABBB CCBAA ABAAC ACCCA BBCAB CABBC CCBAB ABABA ACCCB BBCAC CABCA CCBAC ABABB ACCCC BBCBA CABCB CCBBA ABABC BAAAA BBCBB CABCC CCBBB ABACA BAAAB BBCBC CACAA CCBBC ABACB BAAAC BBCCA CACAB CCBCA ABACC BAABA BBCCB CACAC CCBCB ABBAA BAABB BBCCC CACBA CCBCC ABBAB BAABC BCAAA CACBB CCCAA ABBAC BAACA BCAAB CACBC CCCAB ABBBA BAACB BCAAC CACCA CCCAC ABBBB BAACC BCABA CACCB CCCBA ABBBC BABAA BCABB CACCC CCCBB ABBCA BABAB BCABC CBAAA CCCBC ABBCB BABAC BCACA CBAAB CCCCA ABBCC BABBA BCACB CBAAC CCCCB ABCAA BABBB BCACC CBABA CCCCC ABCAB BABBC BCBAA CBABB ABCAC BABCA BCBAB CBABC ABCBA BABCB BCBAC CBACA
(145) TABLE-US-00004 TABLE 3 Certain 5-Wing Sugar Motifs Certain 5-Wing Sugar Motifs AAAAA BABC CBAB ABBB BAA AAAAB BACA CBAC BAAA BAB AAABA BACB CBBA BAAB BBA AAABB BACC CBBB BABA BBB AABAA BBAA CBBC BABB AA AABAB BBAB CBCA BBAA AB AABBA BBAC CBCB BBAB AC AABBB BBBA CBCC BBBA BA ABAAA BBBB CCAA BBBB BB ABAAB BBBC CCAB AAA BC ABABA BBCA CCAC AAB CA ABABB BBCB CCBA AAC CB ABBAA BBCC CCBB ABA CC ABBAB BCAA CCBC ABB AA ABBBA BCAB CCCA ABC AB ABBBB BCAC CCCB ACA BA BAAAA ABCB BCBA ACB BAAAB ABCC BCBB ACC BAABA ACAA BCBC BAA BAABB ACAB BCCA BAB BABAA ACAC BCCB BAC BABAB AC BA BCCC BBA BABBA ACBB CAAA BBB BABBB ACBC CAAB BBC BBAAA ACCA CAAC BCA BBAAB ACCB CABA BCB BBABA ACCC CABB BCC BBABB BAAA CABC CAA BBBAA BAAB CACA CAB BBBAB BAAC CACB CAC BBBBA BABA CACC CBA BBBBB BABB CBAA CBB AAAA AACC CCCC CBC AAAB ABAA AAAA CCA AAAC ABAB AAAB CCB AABA ABAC AABA CCC AABB ABBA AABB AAA AABC ABBB ABAA AAB AACA ABBC ABAB ABA AACB ABCA ABBA ABB
(146) In certain embodiments, each A, each B, and each C located at the 3-most 5-wing nucleoside is a modified nucleoside. For example, in certain embodiments the 5-wing motif is selected from among ABB, BBB, and CBB, wherein the underlined nucleoside represents the 3-most 5-wing nucleoside and wherein the underlined nucleoside is a modified nucleoside.
(147) In certain embodiments, each A comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, each A comprises a modified sugar moiety. In certain embodiments, each A comprises a 2-substituted sugar moiety. In certain embodiments, each A comprises a 2-substituted sugar moiety selected from among F, ara-F, OCH.sub.3 and O(CH.sub.2).sub.2OCH.sub.3. In certain embodiments, each A comprises a bicyclic sugar moiety. In certain embodiments, each A comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, -L-LNA, ENA and 2-thio LNA. In certain embodiments, each A comprises a modified nucleobase. In certain embodiments, each A comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside. In certain embodiments, each A comprises an HNA. In certain embodiments, each A comprises an F-HNA.
(148) In certain embodiments, each B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, each B comprises a modified sugar moiety. In certain embodiments, each B comprises a 2-substituted sugar moiety. In certain embodiments, each B comprises a 2-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2OCH.sub.3. In certain embodiments, each B comprises a bicyclic sugar moiety. In certain embodiments, each B comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, -L-LNA, ENA and 2-thio LNA. In certain embodiments, each B comprises a modified nucleobase. In certain embodiments, each B comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne urindine nucleoside. In certain embodiments, each B comprises an HNA. In certain embodiments, each B comprises an F-HNA.
(149) In certain embodiments, each C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, each C comprises a modified sugar moiety. In certain embodiments, each C comprises a 2-substituted sugar moiety. In certain embodiments, each C comprises a 2-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2OCH.sub.3. In certain embodiments, each C comprises a 5-substituted sugar moiety. In certain embodiments, each C comprises a 5-substituted sugar moiety selected from among 5-Me, and 5-(R)-Me. In certain embodiments, each C comprises a bicyclic sugar moiety. In certain embodiments, each C comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, -L-LNA, ENA and 2-thio LNA. In certain embodiments, each C comprises a modified nucleobase. In certain embodiments, each C comprises a modified nucleobase selected from among 2-thio-thymidine and 5-propyne uridine. In certain embodiments, each C comprises a 2-thio-thymidine nucleoside. In certain embodiments, each C comprises an HNA. In certain embodiments, each C comprises an F-HNA.
(150) In certain embodiments, at least one of A or B comprises an unmodified 2-deoxyfuranose sugar moiety, and the other comprises a 2-substituted sugar moiety. In certain embodiments, at least one of A or B comprises an unmodified 2-deoxyfuranose sugar moiety, and the other comprises a bicyclic sugar moiety.
(151) In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-(ara)-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-(ara)-F sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-(ara)-F sugar moiety.
(152) In certain embodiments, at least one of A or B comprises an unmodified 2-deoxyfuranose sugar moiety, and the other comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-(ara)-F sugar moiety. In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety.
(153) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-substituted sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-substituted sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-substituted sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-substituted sugar moiety.
(154) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-MOE sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-MOE sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-MOE sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-MOE sugar moiety.
(155) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-F sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-F sugar moiety.
(156) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-(ara)-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-(ara)-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-(ara)-F sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-(ara)-F sugar moiety.
(157) In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2-MOE sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2-MOE sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2-MOE sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-MOE sugar moiety.
(158) In certain embodiments, B comprises a bicyclic sugar moiety, A comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, B is an LNA nucleoside, A comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, B is a cEt nucleoside, A comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-MOE sugar moiety.
(159) In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2-F sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-F sugar moiety.
(160) In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2-(ara)-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2-(ara)-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2-(ara)-F sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-(ara)-F sugar moiety.
(161) In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-substituted sugar moiety and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and comprises a modified nucleobase.
(162) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase.
(163) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase.
(164) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase.
(165) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
(166) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
(167) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
(168) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises 2-thio-thymidine nucleobase.
(169) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(170) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(171) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(172) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(173) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate.
(174) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate.
(175) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises sugar surrogate.
(176) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate.
(177) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar HNA surrogate.
(178) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate.
(179) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate.
(180) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate.
(181) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate.
(182) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety.
(183) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety.
(184) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety.
(185) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety.
(186) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety.
(187) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety.
(188) In certain embodiments, at least two of A, B or C comprises a 2-substituted sugar moiety, and the other comprises a bicyclic sugar moiety. In certain embodiments, at least two of A, B or C comprises a bicyclic sugar moiety, and the other comprises a 2-substituted sugar moiety.
(189) In certain embodiments, at least two of A, B or C comprises a 2-substituted sugar moiety, and the other comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, at least two of A, B or C comprises a bicyclic sugar moiety, and the other comprises an unmodified 2-deoxyfuranose sugar moiety.
(190) Certain 3-Wings
(191) In certain embodiments, the 3-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 3-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 3-wing of a gapmer consists of 5 linked nucleosides.
(192) In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a LNA nucleoside.
(193) In certain embodiments, the 3-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least two non-bicyclic modified nucleosides. In certain embodiments, the 3-wing of a gapmer comprises at least three non-bicyclic modified nucleosides. In certain embodiments, the 3-wing of a gapmer comprises at least four non-bicyclic modified nucleosides. In certain embodiments, the 3-wing of a gapmer comprises at least one 2-substituted nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one 2-MOE nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one 2-OMe nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a 2-substituted nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a 2-MOE nucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a 2-OMe nucleoside.
(194) In certain embodiments, the 3-wing of a gapmer comprises at least one 2-deoxynucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a 2-deoxynucleoside. In a certain embodiments, the 3-wing of a gapmer comprises at least one ribonucleoside. In certain embodiments, each nucleoside of the 3-wing of a gapmer is a ribonucleoside.
(195) In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-substituted nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-MOE nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-OMe nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2-deoxynucleoside.
(196) In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-substituted nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-MOE nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-OMe nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2-deoxynucleoside.
(197) In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-substituted nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-MOE nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-OMe nucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside and at least one 2-deoxynucleoside.
(198) In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2-deoxynucleoside.
(199) In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2-substituted nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2-substituted nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside, at least one 2-substituted nucleoside, and at least one 2-deoxynucleoside.
(200) In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2-MOE nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2-MOE nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside, at least one 2-MOE nucleoside, and at least one 2-deoxynucleoside.
(201) In certain embodiments, the 3-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2-OMe nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2-OMe nucleoside, and at least one 2-deoxynucleoside. In certain embodiments, the 3-wing of a gapmer comprises at least one LNA nucleoside, at least one 2-OMe nucleoside, and at least one 2-deoxynucleoside.
(202) In certain embodiments, the 3-wing of a gapmer has a sugar motif selected from among those listed in the following non-limiting table:
(203) TABLE-US-00005 TABLE 4 Certain 3-Wing Sugar Motifs 3-wing 3-wing 3-wing sugar sugar sugar motif # motif motif # motif motif # motif 1a B-B-A 1d L-L-A 1g K-K-A 2a B-B-B 2d L-L-L 2g K-K-K 3a A-A-B 3d A-A-L 3g A-A-K 4a B-A-B 4d L-A-L 4g K-A-K 5a B-A-B-A 5d L-A-L-A 5g K-A-K-A 6a B-B-B-A 6d L-L-L-A 6g K-K-K-A 7a B-D-B-A 7d L-D-L-A 7g K-D-K-A 8a B-B-B-B 8d L-L-L-L 8g K-K-K-K 9a B-D-D-B 9d L-D-D-L 9g K-D-D-K 10a A-B-B-A 10d A-L-L-A 10g A-K-K-A 1b B-B-E 1e L-L-E 1h K-K-E 2b B-B-B 2e L-L-L 2h K-K-K 3b E-E-B 3e E-E-L 3h E-E-K 4b B-E-B 4e L-E-L 4h K-E-K 5b B-E-B-E 5e L-E-L-E 5h K-E-K-E 6b B-B-B-E 6e L-L-L-E 6h K-K-K-E 7b B-D-B-E 7e L-D-L-E 7h K-D-K-E 8b B-B-B-B 8e L-L-L-L 8h K-K-K-K 9b B-D-D-B 9e L-D-D-L 9h K-D-D-K 10b E-B-B-E 10e E-L-L-E 10h E-K-K-E 1c B-B-M 1f L-L-M 1i K-K-M 2c B-B-B 2f L-L-L 2i K-K-K 3c M-M-B 3f M-M-L 3i M-M-K 4c B-M-B 4f L-M-L 4i K-M-K 5c B-M-B-M 5f L-M-L-M 5i K-M-K-M 6c B-B-B-M 6f L-L-L-M 6i K-K-K-M 7c B-D-B-M 7f L-D-L-M 7i K-D-K-M 8c B-B-B-B 8f L-L-L-L 8i K-K-K-K 9c B-D-D-B 9f L-D-D-L 9i K-D-D-K 10c M-B-B-M 10f M-L-L-M 10i M-K-K-M 1j K-K-A 1k L-K-A 1l K-L-E 2j K-L-L 2k K-K-L 2l K-L-K 3j E-M-B 3k E-M-L 3l E-K-K 4j K-A-L 4k L-A-K 4l L-E-K 5j K-A-L-A 5k L-A-K-A 5l K-E-L-E 6j K-L-K-A 6k K-K-L-A 6l K-L-K-A 7j L-D-K-A 7k K-D-L-A 7l K-D-L-E 8j B-K-L-B 8k K-L-L-L 8l K-K-L-K 9j K-D-D-B 9k K-D-D-L 9l L-D-D-K 10j A-K-B-A 10k A-K-L-A 10l A-B-K-A 1m E-E
(204) In the above table, A represents a nucleoside comprising a 2-substituted sugar moiety; B represents a bicyclic nucleoside; D represents a 2-deoxynucleoside; K represents a constrained ethyl nucleoside; L represents an LNA nucleoside; E represents a 2-MOE nucleoside; and M represents a 2-OMe nucleoside.
(205) In certain embodiments, an oligonucleotide comprises any 3-wing motif provided herein. In certain such embodiments, the oligonucleotide is a 3-hemimer (does not comprise a 5-wing). In certain embodiments, such an oligonucleotide is a gapmer. In certain such embodiments, the 5-wing of the gapmer may comprise any sugar modification motif.
(206) In certain embodiments, the 5-wing of a gapmer has a sugar motif selected from among those listed in the following non-limiting tables:
(207) TABLE-US-00006 TABLE 5 Certain 3-Wing Sugar Motifs Certain 3-Wing Sugar Motifs AAAAA ABCBB BABCC BCBBA CBACC AAAAB ABCBC BACAA BCBBB CBBAA AAAAC ABCCA BACAB BCBBC CBBAB AAABA ABCCB BACAC BCBCA CBBAC AAABB ABCCC BACBA BCBCB CBBBA AAABC ACAAA BACBB BCBCC CBBBB AAACA ACAAB BACBC BCCAA CBBBC AAACB ACAAC BACCA BCCAB CBBCA AAACC ACABA BACCB BCCAC CBBCB AABAA ACABB BACCC BCCBA CBBCC AABAB ACABC BBAAA BCCBB CBCAA AABAC ACACA BBAAB BCCBC CBCAB AABBA ACACB BBAAC BCCCA CBCAC AABBB ACACC BBABA BCCCB CBCBA AABBC ACBAA BBABB BCCCC CBCBB AABCA ACBAB BBABC CAAAA CBCBC AABCB ACBAC BBACA CAAAB CBCCA AABCC ACBBA BBACB CAAAC CBCCB AACAA ACBBB BBACC CAABA CBCCC AACAB ACBBC BBBAA CAABB CCAAA AACAC ACBCA BBBAB CAABC CCAAB AACBA ACBCB BBBAC CAACA CCAAC AACBB ACBCC BBBBA CAACB CCABA AACBC ACCAA BBBBB CAACC CCABB AACCA ACCAB BBBBC CABAA CCABC AACCB ACCAC BBBCA CABAB CCACA AACCC ACCBA BBBCB CABAC CCACB ABAAA ACCBB BBBCC CABBA CCACC ABAAB ACCBC BBCAA CABBB CCBAA ABAAC ACCCA BBCAB CABBC CCBAB ABABA ACCCB BBCAC CABCA CCBAC ABABB ACCCC BBCBA CABCB CCBBA ABABC BAAAA BBCBB CABCC CCBBB ABACA BAAAB BBCBC CACAA CCBBC ABACB BAAAC BBCCA CACAB CCBCA ABACC BAABA BBCCB CACAC CCBCB ABBAA BAABB BBCCC CACBA CCBCC ABBAB BAABC BCAAA CACBB CCCAA ABBAC BAACA BCAAB CACBC CCCAB ABBBA BAACB BCAAC CACCA CCCAC ABBBB BAACC BCABA CACCB CCCBA ABBBC BABAA BCABB CACCC CCCBB ABBCA BABAB BCABC CBAAA CCCBC ABBCB BABAC BCACA CBAAB CCCCA ABBCC BABBA BCACB CBAAC CCCCB ABCAA BABBB BCACC CBABA CCCCC ABCAB BABBC BCBAA CBABB ABCAC BABCA BCBAB CBABC ABCBA BABCB BCBAC CBACA
(208) TABLE-US-00007 TABLE 6 Certain 3-Wing Sugar Motifs Certain 3-Wing Sugar Motifs AAAAA BABC CBAB ABBB BAA AAAAB BACA CBAC BAAA BAB AAABA BACB CBBA BAAB BBA AAABB BACC CBBB BABA BBB AABAA BBAA CBBC BABB AA AABAB BBAB CBCA BBAA AB AABBA BBAC CBCB BBAB AC AABBB BBBA CBCC BBBA BA ABAAA BBBB CCAA BBBB BB ABAAB BBBC CCAB AAA BC ABABA BBCA CCAC AAB CA ABABB BBCB CCBA AAC CB ABBAA BBCC CCBB ABA CC ABBAB BCAA CCBC ABB AA ABBBA BCAB CCCA ABC AB ABBBB BCAC CCCB ACA BA BAAAA ABCB BCBA ACB BAAAB ABCC BCBB ACC BAABA ACAA BCBC BAA BAABB ACAB BCCA BAB BABAA ACAC BCCB BAC BABAB ACBA BCCC BBA BABBA ACBB CAAA BBB BABBB ACBC CAAB BBC BBAAA ACCA CAAC BCA BBAAB ACCB CABA BCB BBABA ACCC CABB BCC BBABB BAAA CABC CAA BBBAA BAAB CACA CAB BBBAB BAAC CACB CAC BBBBA BABA CACC CBA BBBBB BABB CBAA CBB AAAA AACC CCCC CBC AAAB ABAA AAAA CCA AAAC ABAB AAAB CCB AABA ABAC AABA CCC AABB ABBA AABB AAA AABC ABBB ABAA AAB AACA ABBC ABAB ABA AACB ABCA ABBA ABB
(209) In certain embodiments, each A, each B, and each C located at the 5-most 3-wing region nucleoside is a modified nucleoside. For example, in certain embodiments the 3-wing motif is selected from among ABB, BBB, and CBB, wherein the underlined nucleoside represents the the 5-most 3-wing region nucleoside and wherein the underlined nucleoside is a modified nucleoside.
(210) In certain embodiments, each A comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, each A comprises a modified sugar moiety. In certain embodiments, each A comprises a 2-substituted sugar moiety. In certain embodiments, each A comprises a 2-substituted sugar moiety selected from among F, ara-F, OCH.sub.3 and O(CH.sub.2).sub.2OCH.sub.3. In certain embodiments, each A comprises a bicyclic sugar moiety. In certain embodiments, each A comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, -L-LNA, ENA and 2-thio LNA. In certain embodiments, each A comprises a modified nucleobase. In certain embodiments, each A comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside.
(211) In certain embodiments, each B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, each B comprises a modified sugar moiety. In certain embodiments, each B comprises a 2-substituted sugar moiety. In certain embodiments, each B comprises a 2-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2OCH.sub.3. In certain embodiments, each B comprises a bicyclic sugar moiety. In certain embodiments, each B comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, -L-LNA, ENA and 2-thio LNA. In certain embodiments, each B comprises a modified nucleobase. In certain embodiments, each B comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne urindine nucleoside.
(212) In certain embodiments, each C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, each C comprises a modified sugar moiety. In certain embodiments, each C comprises a 2-substituted sugar moiety. In certain embodiments, each C comprises a 2-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2OCH.sub.3. In certain embodiments, each C comprises a 5-substituted sugar moiety. In certain embodiments, each C comprises a 5-substituted sugar moiety selected from among 5-Me, and 5-(R)-Me. In certain embodiments, each C comprises a bicyclic sugar moiety. In certain embodiments, each C comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, -L-LNA, ENA and 2-thio LNA. In certain embodiments, each C comprises a modified nucleobase. In certain embodiments, each C comprises a modified nucleobase selected from among 2-thio-thymidine and 5-propyne uridine. In certain embodiments, each C comprises a 2-thio-thymidine nucleoside.
(213) In certain embodiments, at least one of A or B comprises an unmodified 2-deoxyfuranose sugar moiety, and the other comprises a 2-substituted sugar moiety. In certain embodiments, at least one of A or B comprises an unmodified 2-deoxyfuranose sugar moiety, and the other comprises a bicyclic sugar moiety.
(214) In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2-(ara)-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2-(ara)-F sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises a 2-(ara)-F sugar moiety.
(215) In certain embodiments, at least one of A or B comprises an unmodified 2-deoxyfuranose sugar moiety, and the other comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-substituted sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-MOE sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-F sugar moiety. In certain embodiments, one of A or B is an unmodified 2-deoxyfuranose sugar moiety and the other of A or B comprises a 2-(ara)-F sugar moiety. In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside and the other of A or B comprises an unmodified 2-deoxyfuranose sugar moiety.
(216) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-substituted sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-substituted sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-substituted sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-substituted sugar moiety.
(217) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-MOE sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-MOE sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-MOE sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-MOE sugar moiety.
(218) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-F sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-F sugar moiety.
(219) In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2-(ara)-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2-(ara)-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2-(ara)-F sugar moiety. In certain embodiments, A is an -L-LNA nucleoside and B comprises a 2-(ara)-F sugar moiety.
(220) In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2-MOE sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2-MOE sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2-MOE sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-MOE sugar moiety.
(221) In certain embodiments, B comprises a bicyclic sugar moiety, A comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, B is an LNA nucleoside, A comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, B is a cEt nucleoside, A comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-MOE sugar moiety.
(222) In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2-F sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-F sugar moiety.
(223) In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2-(ara)-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2-(ara)-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2-(ara)-F sugar moiety. In certain embodiments, B is an -L-LNA nucleoside and A comprises a 2-(ara)-F sugar moiety.
(224) In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-substituted sugar moiety and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and comprises a modified nucleobase.
(225) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a modified nucleobase.
(226) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a modified nucleobase.
(227) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a modified nucleobase.
(228) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-substituted sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
(229) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
(230) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
(231) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises 2-thio-thymidine nucleobase.
(232) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(233) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(234) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(235) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-propyne uridine nucleobase.
(236) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a sugar surrogate.
(237) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar surrogate.
(238) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises sugar surrogate.
(239) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a HNA sugar surrogate.
(240) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a sugar HNA surrogate.
(241) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a HNA sugar surrogate.
(242) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a F-HNA sugar surrogate.
(243) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a F-HNA sugar surrogate.
(244) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a F-HNA sugar surrogate.
(245) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-Me DNA sugar moiety.
(246) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-Me DNA sugar moiety.
(247) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-Me DNA sugar moiety.
(248) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-MOE sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety.
(249) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety.
(250) In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an -L-LNA nucleoside, another of A or B comprises a 2-(ara)-F sugar moiety, and C comprises a 5-(R)-Me DNA sugar moiety.
(251) In certain embodiments, at least two of A, B or C comprises a 2-substituted sugar moiety, and the other comprises a bicyclic sugar moiety. In certain embodiments, at least two of A, B or C comprises a bicyclic sugar moiety, and the other comprises a 2-substituted sugar moiety.
(252) In certain embodiments, at least two of A, B or C comprises a 2-substituted sugar moiety, and the other comprises an unmodified 2-deoxyfuranose sugar moiety. In certain embodiments, at least two of A, B or C comprises a bicyclic sugar moiety, and the other comprises an unmodified 2-deoxyfuranose sugar moiety.
(253) Certain Gaps
(254) In certain embodiments, the gap of a gapmer consists of 6 to 20 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 15 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 12 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 or 7 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 to 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 or 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 or 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 11 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 12 linked nucleosides.
(255) In certain embodiments, each nucleotide of the gap of a gapmer is a 2-deoxynucleoside. In certain embodiments, the gap comprises one or more modified nucleosides. In certain embodiments, each nucleotide of the gap of a gapmer is a 2-deoxynucleoside or is a modified nucleoside that is DNA-like. In such embodiments, DNA-like means that the nucleoside has similar characteristics to DNA, such that a duplex comprising the gapmer and an RNA molecule is capable of activating RNase H. For example, under certain conditions, 2-fluoro (arabino) nucleosides (also referred to as FANA) have been shown to support RNase H activation, and thus is DNA-like. In certain embodiments, one or more nucleosides of the gap of a gapmer is not a 2-deoxynucleoside and is not DNA-like. In certain such embodiments, the gapmer nonetheless supports RNase H activation (e.g., by virtue of the number or placement of the non-DNA nucleosides).
(256) Certain Gapmer Motifs
(257) In certain embodiments, a gapmer comprises a 5-wing, a gap, and a 3 wing, wherein the 5-wing, gap, and 3 wing are independently selected from among those discussed above. For example, in certain embodiments, a gapmer has a 5-wing selected from any of the 5-wing motifs in Tables 1, 2, and 3 above and a 3-wing selected from any of the 3-wing motifs in Tables, 4, 5, and 6. For example, in certain embodiments, a gapmer has a 5-wing, a gap, and a 3-wing having features selected from among those listed in the following non-limiting table:
(258) TABLE-US-00008 TABLE 7 Certain Gapmer Sugar Motifs Gapmer motif # 5-wing Gap 3-wing 1 At least one non-bicyclic All 2-deoxynucleosides At least one bicyclic modified nucleoside nucleoside 2 At least one non-bicyclic All 2-deoxynucleosides At least one LNA nucleoside modified nucleoside 3 At least one non-bicyclic All 2-deoxynucleosides At least one cEt nucleoside modified nucleoside 4 At least one 2-substituted All 2-deoxynucleosides At least one bicyclic nucleoside nucleoside 5 At least one 2-substituted All 2-deoxynucleosides At least one LNA nucleoside nucleoside 6 At least one 2-substituted All 2-deoxynucleosides At least one cEt nucleoside nucleoside 7 At least one 2-MOE nucleoside All 2-deoxynucleosides At least one bicyclic nucleoside 8 At least one 2-MOE nucleoside All 2-deoxynucleosides At least one LNA nucleoside 9 At least one 2-MOE nucleoside All 2-deoxynucleosides At least one cEt nucleoside 10 At least one 2-OMe nucleoside All 2-deoxynucleosides At least one bicyclic nucleoside 11 At least one 2-OMe nucleoside All 2-deoxynucleosides At least one LNA nucleoside 12 At least one 2-OMe nucleoside All 2-deoxynucleosides At least one cEt nucleoside 13 At least one 2-deoxynucleoside All 2-deoxynucleosides At least one bicyclic nucleoside 14 At least one 2-deoxynucleoside All 2-deoxynucleosides At least one LNA nucleoside 15 At least one 2-deoxynucleoside All 2-deoxynucleosides At least one cEt nucleoside 16 At least one bicyclic nucleoside All 2-deoxynucleosides At least one non-bicyclic modified nucleoside 17 At least one LNA nucleoside All 2-deoxynucleosides At least one non-bicyclic modified nucleoside 18 At least one cEt nucleoside All 2-deoxynucleosides At least one non-bicyclic modified nucleoside 19 At least one bicyclic nucleoside All 2-deoxynucleosides At least one 2-substituted nucleoside 20 At least one LNA nucleoside All 2-deoxynucleosides At least one 2-substituted nucleoside 21 At least one cEt nucleoside All 2-deoxynucleosides At least one 2-substituted nucleoside 22 At least one bicyclic nucleoside All 2-deoxynucleosides At least one 2-MOE nucleoside 23 At least one LNA nucleoside All 2-deoxynucleosides At least one 2-MOE nucleoside 24 At least one cEt nucleoside All 2-deoxynucleosides At least one 2-MOE nucleoside 25 At least one bicyclic nucleoside All 2-deoxynucleosides At least one 2-OMe nucleoside 26 At least one LNA nucleoside All 2-deoxynucleosides At least one 2-OMe nucleoside 27 At least one cEt nucleoside All 2-deoxynucleosides At least one 2-OMe nucleoside 28 At least one bicyclic nucleoside All 2-deoxynucleosides At least one 2- deoxynucleoside 29 At least one LNA nucleoside All 2-deoxynucleosides At least one 2- deoxynucleoside 30 At least one cEt nucleoside All 2-deoxynucleosides At least one 2- deoxynucleoside 31 At least one bicyclic nucleoside All 2-deoxynucleosides At least one bicyclic and at least one 2-substituted nucleoside and at least one 2- nucleoside substituted nucleoside 32 At least one bicyclic nucleoside All 2-deoxynucleosides At least two bicyclic and at least one 2-substituted nucleosides nucleoside 33 At least one cEt nucleoside and All 2-deoxynucleosides At least one bicyclic at least one 2-substituted nucleoside and at least one 2- nucleoside substituted nucleoside 34 At least one cEt nucleoside and All 2-deoxynucleosides At least two bicyclic at least one 2-substituted nucleosides nucleoside 35 At least one LNA nucleoside and All 2-deoxynucleosides At least one bicyclic at least one 2-substituted nucleoside and at least one 2- nucleoside substituted nucleoside 36 At least one LNA nucleoside and All 2-deoxynucleosides At least two bicyclic at least one 2-substituted nucleosides nucleoside 37 At least one bicyclic nucleoside All 2-deoxynucleosides At least one LNA nucleoside and at least one 2-substituted and at least one 2-substituted nucleoside nucleoside 38 At least one bicyclic nucleoside All 2-deoxynucleosides At least two LNA nucleosides and at least one 2-substituted nucleoside 39 At least one cEt nucleoside and All 2-deoxynucleosides At least one LNA nucleoside at least one 2-substituted and at least one 2-substituted nucleoside nucleoside 40 At least one cEt nucleoside and All 2-deoxynucleosides At least two LNA nucleosides at least one 2-substituted nucleoside 41 At least one LNA nucleoside and All 2-deoxynucleosides At least one LNA nucleoside at least one 2-substituted and at least one 2-substituted nucleoside nucleoside 42 At least one LNA nucleoside and All 2-deoxynucleosides At least two LNA nucleosides at least one 2-substituted nucleoside 43 At least one bicyclic nucleoside All 2-deoxynucleosides At least one bicyclic and at least one 2- nucleoside and at least one 2- deoxynucleoside substituted nucleoside 44 At least one bicyclic nucleoside All 2-deoxynucleosides At least two bicyclic and at least one 2- nucleosides deoxynucleoside 45 At least one cEt nucleoside and All 2-deoxynucleosides At least one bicyclic at least one 2-deoxynucleoside nucleoside and at least one 2- substituted nucleoside 46 At least one cEt nucleoside and All 2-deoxynucleosides At least two bicyclic at least one 2-deoxynucleoside nucleosides 47 At least one LNA nucleoside and All 2-deoxynucleosides At least one bicyclic at least one 2-deoxynucleoside nucleoside and at least one 2- substituted nucleoside 48 At least one LNA nucleoside and All 2-deoxynucleosides At least two bicyclic at least one 2-deoxynucleoside nucleosides 49 At least one bicyclic nucleoside All 2-deoxynucleosides At least one LNA nucleoside and at least one 2- and at least one 2-substituted deoxynucleoside nucleoside 50 At least one bicyclic nucleoside All 2-deoxynucleosides At least two LNA nucleosides and at least one 2- deoxynucleoside 51 At least one cEt nucleoside and All 2-deoxynucleosides At least one LNA nucleoside at least one 2-deoxynucleoside and at least one 2-substituted nucleoside 52 At least one cEt nucleoside and All 2-deoxynucleosides At least two LNA nucleosides at least one 2-deoxynucleoside 53 At least one LNA nucleoside and All 2-deoxynucleosides At least one LNA nucleoside at least one 2-deoxynucleoside and at least one 2-substituted nucleoside 54 At least one LNA nucleoside and All 2-deoxynucleosides At least two LNA nucleosides at least one 2-deoxynucleoside 55 At least two 2-substituted All 2-deoxynucleosides At least one bicyclic nucleosides nucleoside and at least one 2- substituted nucleoside 56 At least two 2-substituted All 2-deoxynucleosides At least two bicyclic nucleosides nucleosides 57 At least two 2-substituted All 2-deoxynucleosides At least one LNA nucleoside nucleosides and at least one 2-substituted nucleoside 58 At least two 2-substituted All 2-deoxynucleosides At least two LNA nucleosides nucleosides
(259) In certain embodiments, a gapmer comprises a 5-wing, a gap, and a 3 wing, wherein the 5-wing, gap, and 3 wing are independently selected from among those discussed above. For example, in certain embodiments, a gapmer has a 5-wing, a gap, and a 3-wing wherein the 5-wing and the 3-wing have features selected from among those listed in the tables above. In certain embodiments, any 5-wing may be paired with any 3-wing. In certain embodiments the 5-wing may comprise ABBBB and the 3-wing may comprise BBA. In certain embodiments the 5-wing may comprise ACACA and the 3-wing may comprise BB. For example, in certain embodiments, a gapmer has a 5-wing, a gap, and a 3-wing having features selected from among those listed in the following non-limiting table, wherein each motif is represented as (5-wing)-(gap)-(3-wing), wherein each number represents the number of linked nucleosides in each portion of the motif, for example, a 5-10-5 motif would have a 5-wing comprising 5 nucleosides, a gap comprising 10 nucleosides, and a 3-wing comprising 5 nucleosides:
(260) TABLE-US-00009 TABLE 8 Certain Gapmer Sugar Motifs Certain Gapmer Sugar Motifs 2-10-2 3-10-2 4-10-2 5-10-2 2-10-3 3-10-3 4-10-3 5-10-3 2-10-4 3-10-4 4-10-4 5-10-4 2-10-5 3-10-5 4-10-5 5-10-5 2-9-2 3-9-2 4-9-2 5-9-2 2-9-3 3-9-3 4-9-3 5-9-3 2-9-4 3-9-4 4-9-4 5-9-4 2-9-5 3-9-5 4-9-5 5-9-5 2-11-2 3-11-2 4-11-2 5-11-2 2-11-3 3-11-3 4-11-3 5-11-3 2-11-4 3-11-4 4-11-4 5-11-4 2-11-5 3-11-5 4-11-5 5-11-5 2-8-2 3-8-2 4-8-2 5-8-2 2-8-3 3-8-3 4-8-3 5-8-3 2-8-4 3-8-4 4-8-4 5-8-4 2-8-5 3-8-5 4-8-5 5-8-5
(261) In certain embodiments, gapmers have a motif described by Formula I as follows:
(A).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(J).sub.t-(D).sub.g-h-(J).sub.v-(B).sub.w-(J).sub.x-(B).sub.y-(A).sub.z
(262) wherein:
(263) each A is independently a 2-substituted nucleoside;
(264) each B is independently a bicyclic nucleoside;
(265) each J is independently either a 2-substituted nucleoside or a 2-deoxynucleoside;
(266) each D is a 2-deoxynucleoside;
(267) m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6; and h is 14;
(268) provided that:
(269) at least one of m, n, and r is other than 0;
(270) at least one of w and y is other than 0;
(271) the sum of m, n, p, r, and t is from 2 to 5; and
(272) the sum of v, w, x, y, and z is from 2 to 5.
(273) In certain embodiments, one or more 2-substituted nucleoside is a 2-MOE nucleoside. In certain embodiments, one or more 2-substituted nucleoside is a 2-OMe nucleoside. In certain In certain embodiments, one or more bicyclic nucleoside is a cEt nucleoside. In certain embodiments, one or more bicyclic nucleoside is an LNA nucleoside.
(274) In certain embodiments, a gapmer of Formula I has a motif selected from among gapmer motifs 1-58.
(275) In certain embodiments, gapmers have a motif described by Formula II as follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.r-(D).sub.g-(A).sub.v-(B).sub.w-(J).sub.x-(B).sub.y-(J).sub.z
(276) wherein:
(277) each A is independently a 2-substituted nucleoside;
(278) each B is independently a bicyclic nucleoside;
(279) each J is independently either a 2-substituted nucleoside or a 2-deoxynucleoside;
(280) each D is a 2-deoxynucleoside;
(281) m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14;
(282) provided that:
(283) at least one of m, n, and r is other than 0;
(284) at least one of w and y is other than 0;
(285) the sum of m, n, p, r, and t is from 1 to 5; and
(286) the sum of v, w, x, y, and z is from 1 to 5.
(287) In certain embodiments, one or more 2-substituted nucleoside is a 2-MOE nucleoside. In certain embodiments, one or more 2-substituted nucleoside is a 2-OMe nucleoside. In certain embodiments, one or more bicyclic nucleoside is a cEt nucleoside. In certain embodiments, one or more bicyclic nucleoside is an LNA nucleoside.
(288) In certain embodiments, each 2-substituted nucleoside is a 2-MOE nucleoside. In certain embodiments, each 2-substituted nucleoside is a 2-OMe nucleoside. In certain embodiments, each bicyclic nucleoside is a cEt nucleoside. In certain embodiments, each bicyclic nucleoside is an LNA nucleoside.
(289) In certain embodiments, each A is the same 2-substituted nucleoside. In certain embodiments, each B is the same bicyclic nucleoside. In certain embodiments each A is the same 2-modified nucleoside and each B is the same bicyclic nucleoside. In certain embodiments, each J is a 2-modified nucleoside. In certain embodiments each J is the same 2-modified nucleoside. In certain embodiments, each J and each A is the same 2-modified nucleoside.
(290) In certain embodiments, a gapmer of Formula II has a motif selected from among gapmer motifs 1-58.
(291) In certain embodiments, a gapmer comprises a 5-wing, a gap, and a 3 wing, independently selected from among those proved in the above tables, for example as provided in the following table:
(292) TABLE-US-00010 TABLE 9 Certain Gapmer Sugar Motifs 5-wing 3-wing Gapmer sugar motif sugar motif motif # (from table 1) Gap (from table 2) 59 1(a-i) All 2-deoxynucleosides 1(a-i) 60 2(a-i) All 2-deoxynucleosides 1(a-i) 61 3(a-i) All 2-deoxynucleosides 1(a-i) 62 4(a-i) All 2-deoxynucleosides 1(a-i) 63 5(a-i) All 2-deoxynucleosides 1(a-i) 64 6(a-i) All 2-deoxynucleosides 1(a-i) 65 7(a-i) All 2-deoxynucleosides 1(a-i) 66 8(a-i) All 2-deoxynucleosides 1(a-i) 67 9(a-i) All 2-deoxynucleosides 1(a-i) 68 10(a-i) All 2-deoxynucleosides 1(a-i) 69 11(a-i) All 2-deoxynucleosides 1(a-i) 70 12(a-i) All 2-deoxynucleosides 1(a-i) 71 13(a-i) All 2-deoxynucleosides 1(a-i) 72 14(a-i) All 2-deoxynucleosides 1(a-i) 73 15(a-i) All 2-deoxynucleosides 1(a-i) 74 16(a-i) All 2-deoxynucleosides 1(a-i) 75 17(a-i) All 2-deoxynucleosides 1(a-i) 76 18(a-i) All 2-deoxynucleosides 1(a-i) 77 19(a-i) All 2-deoxynucleosides 1(a-i) 78 20(a-i) All 2-deoxynucleosides 1(a-i) 79 21(a-i) All 2-deoxynucleosides 1(a-i) 80 22(a-i) All 2-deoxynucleosides 1(a-i) 81 1(a-i) All 2-deoxynucleosides 2(a-i) 82 2(a-i) All 2-deoxynucleosides 2(a-i) 83 3(a-i) All 2-deoxynucleosides 2(a-i) 84 4(a-i) All 2-deoxynucleosides 2(a-i) 85 5(a-i) All 2-deoxynucleosides 2(a-i) 86 6(a-i) All 2-deoxynucleosides 2(a-i) 87 7(a-i) All 2-deoxynucleosides 2(a-i) 88 8(a-i) All 2-deoxynucleosides 2(a-i) 89 9(a-i) All 2-deoxynucleosides 2(a-i) 90 10(a-i) All 2-deoxynucleosides 2(a-i) 91 11(a-i) All 2-deoxynucleosides 2(a-i) 92 12(a-i) All 2-deoxynucleosides 2(a-i) 93 13(a-i) All 2-deoxynucleosides 2(a-i) 94 14(a-i) All 2-deoxynucleosides 2(a-i) 94 15(a-i) All 2-deoxynucleosides 2(a-i) 96 16(a-i) All 2-deoxynucleosides 2(a-i) 97 17(a-i) All 2-deoxynucleosides 2(a-i) 98 18(a-i) All 2-deoxynucleosides 2(a-i) 99 19(a-i) All 2-deoxynucleosides 2(a-i) 100 20(a-i) All 2-deoxynucleosides 2(a-i) 101 21(a-i) All 2-deoxynucleosides 2(a-i) 102 22(a-i) All 2-deoxynucleosides 2(a-i) 103 1(a-i) All 2-deoxynucleosides 3(a-i) 104 2(a-i) All 2-deoxynucleosides 3(a-i) 105 3(a-i) All 2-deoxynucleosides 3(a-i) 106 4(a-i) All 2-deoxynucleosides 3(a-i) 107 5(a-i) All 2-deoxynucleosides 3(a-i) 108 6(a-i) All 2-deoxynucleosides 3(a-i) 109 7(a-i) All 2-deoxynucleosides 3(a-i) 110 8(a-i) All 2-deoxynucleosides 3(a-i) 111 9(a-i) All 2-deoxynucleosides 3(a-i) 112 10(a-i) All 2-deoxynucleosides 3(a-i) 113 11(a-i) All 2-deoxynucleosides 3(a-i) 114 12(a-i) All 2-deoxynucleosides 3(a-i) 115 13(a-i) All 2-deoxynucleosides 3(a-i) 116 14(a-i) All 2-deoxynucleosides 3(a-i) 117 15(a-i) All 2-deoxynucleosides 3(a-i) 118 16(a-i) All 2-deoxynucleosides 3(a-i) 119 17(a-i) All 2-deoxynucleosides 3(a-i) 120 18(a-i) All 2-deoxynucleosides 3(a-i) 121 19(a-i) All 2-deoxynucleosides 3(a-i) 122 20(a-i) All 2-deoxynucleosides 3(a-i) 123 21(a-i) All 2-deoxynucleosides 3(a-i) 124 22(a-i) All 2-deoxynucleosides 3(a-i) 125 1(a-i) All 2-deoxynucleosides 4(a-i) 126 2(a-i) All 2-deoxynucleosides 4(a-i) 127 3(a-i) All 2-deoxynucleosides 4(a-i) 128 4(a-i) All 2-deoxynucleosides 4(a-i) 129 5(a-i) All 2-deoxynucleosides 4(a-i) 130 6(a-i) All 2-deoxynucleosides 4(a-i) 131 7(a-i) All 2-deoxynucleosides 4(a-i) 132 8(a-i) All 2-deoxynucleosides 4(a-i) 133 9(a-i) All 2-deoxynucleosides 4(a-i) 134 10(a-i) All 2-deoxynucleosides 4(a-i) 135 11(a-i) All 2-deoxynucleosides 4(a-i) 136 12(a-i) All 2-deoxynucleosides 4(a-i) 137 13(a-i) All 2-deoxynucleosides 4(a-i) 138 14(a-i) All 2-deoxynucleosides 4(a-i) 139 15(a-i) All 2-deoxynucleosides 4(a-i) 140 16(a-i) All 2-deoxynucleosides 4(a-i) 141 17(a-i) All 2-deoxynucleosides 4(a-i) 142 18(a-i) All 2-deoxynucleosides 4(a-i) 143 19(a-i) All 2-deoxynucleosides 4(a-i) 144 20(a-i) All 2-deoxynucleosides 4(a-i) 145 21(a-i) All 2-deoxynucleosides 4(a-i) 146 22(a-i) All 2-deoxynucleosides 4(a-i) 147 1(a-i) All 2-deoxynucleosides 5(a-i) 148 2(a-i) All 2-deoxynucleosides 5(a-i) 149 3(a-i) All 2-deoxynucleosides 5(a-i) 150 4(a-i) All 2-deoxynucleosides 5(a-i) 151 5(a-i) All 2-deoxynucleosides 5(a-i) 152 6(a-i) All 2-deoxynucleosides 5(a-i) 153 7(a-i) All 2-deoxynucleosides 5(a-i) 154 8(a-i) All 2-deoxynucleosides 5(a-i) 155 9(a-i) All 2-deoxynucleosides 5(a-i) 156 10(a-i) All 2-deoxynucleosides 5(a-i) 157 11(a-i) All 2-deoxynucleosides 5(a-i) 158 12(a-i) All 2-deoxynucleosides 5(a-i) 159 13(a-i) All 2-deoxynucleosides 5(a-i) 160 14(a-i) All 2-deoxynucleosides 5(a-i) 161 15(a-i) All 2-deoxynucleosides 5(a-i) 162 16(a-i) All 2-deoxynucleosides 5(a-i) 163 17(a-i) All 2-deoxynucleosides 5(a-i) 164 18(a-i) All 2-deoxynucleosides 5(a-i) 165 19(a-i) All 2-deoxynucleosides 5(a-i) 166 20(a-i) All 2-deoxynucleosides 5(a-i) 167 21(a-i) All 2-deoxynucleosides 5(a-i) 168 22(a-i) All 2-deoxynucleosides 5(a-i) 169 1(a-i) All 2-deoxynucleosides 6(a-i) 170 2(a-i) All 2-deoxynucleosides 6(a-i) 171 3(a-i) All 2-deoxynucleosides 6(a-i) 172 4(a-i) All 2-deoxynucleosides 6(a-i) 173 5(a-i) All 2-deoxynucleosides 6(a-i) 174 6(a-i) All 2-deoxynucleosides 6(a-i) 175 7(a-i) All 2-deoxynucleosides 6(a-i) 176 8(a-i) All 2-deoxynucleosides 6(a-i) 177 9(a-i) All 2-deoxynucleosides 6(a-i) 178 10(a-i) All 2-deoxynucleosides 6(a-i) 179 11(a-i) All 2-deoxynucleosides 6(a-i) 180 12(a-i) All 2-deoxynucleosides 6(a-i) 181 13(a-i) All 2-deoxynucleosides 6(a-i) 182 14(a-i) All 2-deoxynucleosides 6(a-i) 183 15(a-i) All 2-deoxynucleosides 6(a-i) 184 16(a-i) All 2-deoxynucleosides 6(a-i) 184 17(a-i) All 2-deoxynucleosides 6(a-i) 186 18(a-i) All 2-deoxynucleosides 6(a-i) 187 19(a-i) All 2-deoxynucleosides 6(a-i) 188 20(a-i) All 2-deoxynucleosides 6(a-i) 189 21(a-i) All 2-deoxynucleosides 6(a-i) 190 22(a-i) All 2-deoxynucleosides 6(a-i) 191 1(a-i) All 2-deoxynucleosides 7(a-i) 192 2(a-i) All 2-deoxynucleosides 7(a-i) 193 3(a-i) All 2-deoxynucleosides 7(a-i) 194 4(a-i) All 2-deoxynucleosides 7(a-i) 195 5(a-i) All 2-deoxynucleosides 7(a-i) 196 6(a-i) All 2-deoxynucleosides 7(a-i) 197 7(a-i) All 2-deoxynucleosides 7(a-i) 198 8(a-i) All 2-deoxynucleosides 7(a-i) 199 9(a-i) All 2-deoxynucleosides 7(a-i) 200 10(a-i) All 2-deoxynucleosides 7(a-i) 201 11(a-i) All 2-deoxynucleosides 7(a-i) 202 12(a-i) All 2-deoxynucleosides 7(a-i) 203 13(a-i) All 2-deoxynucleosides 7(a-i) 204 14(a-i) All 2-deoxynucleosides 7(a-i) 205 15(a-i) All 2-deoxynucleosides 7(a-i) 206 16(a-i) All 2-deoxynucleosides 7(a-i) 207 17(a-i) All 2-deoxynucleosides 7(a-i) 208 18(a-i) All 2-deoxynucleosides 7(a-i) 209 19(a-i) All 2-deoxynucleosides 7(a-i) 210 20(a-i) All 2-deoxynucleosides 7(a-i) 211 21(a-i) All 2-deoxynucleosides 7(a-i) 212 22(a-i) All 2-deoxynucleosides 7(a-i) 213 1(a-i) All 2-deoxynucleosides 8(a-i) 214 2(a-i) All 2-deoxynucleosides 8(a-i) 215 3(a-i) All 2-deoxynucleosides 8(a-i) 216 4(a-i) All 2-deoxynucleosides 8(a-i) 217 5(a-i) All 2-deoxynucleosides 8(a-i) 218 6(a-i) All 2-deoxynucleosides 8(a-i) 219 7(a-i) All 2-deoxynucleosides 8(a-i) 220 8(a-i) All 2-deoxynucleosides 8(a-i) 221 9(a-i) All 2-deoxynucleosides 8(a-i) 222 10(a-i) All 2-deoxynucleosides 8(a-i) 223 11(a-i) All 2-deoxynucleosides 8(a-i) 224 12(a-i) All 2-deoxynucleosides 8(a-i) 225 13(a-i) All 2-deoxynucleosides 8(a-i) 226 14(a-i) All 2-deoxynucleosides 8(a-i) 227 15(a-i) All 2-deoxynucleosides 8(a-i) 228 16(a-i) All 2-deoxynucleosides 8(a-i) 229 17(a-i) All 2-deoxynucleosides 8(a-i) 230 18(a-i) All 2-deoxynucleosides 8(a-i) 231 19(a-i) All 2-deoxynucleosides 8(a-i) 232 20(a-i) All 2-deoxynucleosides 8(a-i) 233 21(a-i) All 2-deoxynucleosides 8(a-i) 234 22(a-i) All 2-deoxynucleosides 8(a-i) 235 1(a-i) All 2-deoxynucleosides 9(a-i) 236 2(a-i) All 2-deoxynucleosides 9(a-i) 237 3(a-i) All 2-deoxynucleosides 9(a-i) 238 4(a-i) All 2-deoxynucleosides 9(a-i) 239 5(a-i) All 2-deoxynucleosides 9(a-i) 240 6(a-i) All 2-deoxynucleosides 9(a-i) 241 7(a-i) All 2-deoxynucleosides 9(a-i) 242 8(a-i) All 2-deoxynucleosides 9(a-i) 243 9(a-i) All 2-deoxynucleosides 9(a-i) 244 10(a-i) All 2-deoxynucleosides 9(a-i) 245 11(a-i) All 2-deoxynucleosides 9(a-i) 246 12(a-i) All 2-deoxynucleosides 9(a-i) 247 13(a-i) All 2-deoxynucleosides 9(a-i) 248 14(a-i) All 2-deoxynucleosides 9(a-i) 249 15(a-i) All 2-deoxynucleosides 9(a-i) 250 16(a-i) All 2-deoxynucleosides 9(a-i) 251 17(a-i) All 2-deoxynucleosides 9(a-i) 252 18(a-i) All 2-deoxynucleosides 9(a-i) 253 19(a-i) All 2-deoxynucleosides 9(a-i) 254 20(a-i) All 2-deoxynucleosides 9(a-i) 255 21(a-i) All 2-deoxynucleosides 9(a-i) 256 22(a-i) All 2-deoxynucleosides 9(a-i) 257 1(a-i) All 2-deoxynucleosides 10(a-i) 258 2(a-i) All 2-deoxynucleosides 10(a-i) 259 3(a-i) All 2-deoxynucleosides 10(a-i) 260 4(a-i) All 2-deoxynucleosides 10(a-i) 261 5(a-i) All 2-deoxynucleosides 10(a-i) 262 6(a-i) All 2-deoxynucleosides 10(a-i) 263 7(a-i) All 2-deoxynucleosides 10(a-i) 264 8(a-i) All 2-deoxynucleosides 10(a-i) 265 9(a-i) All 2-deoxynucleosides 10(a-i) 266 10(a-i) All 2-deoxynucleosides 10(a-i) 267 11(a-i) All 2-deoxynucleosides 10(a-i) 268 12(a-i) All 2-deoxynucleosides 10(a-i) 269 13(a-i) All 2-deoxynucleosides 10(a-i) 270 14(a-i) All 2-deoxynucleosides 10(a-i) 271 15(a-i) All 2-deoxynucleosides 10(a-i) 272 16(a-i) All 2-deoxynucleosides 10(a-i) 273 17(a-i) All 2-deoxynucleosides 10(a-i) 274 18(a-i) All 2-deoxynucleosides 10(a-i) 275 19(a-i) All 2-deoxynucleosides 10(a-i) 276 20(a-i) All 2-deoxynucleosides 10(a-i) 277 21(a-i) All 2-deoxynucleosides 10(a-i) 278 22(a-i) All 2-deoxynucleosides 10(a-i) 279 1(a)-22(a) All 2-deoxynucleosides 1(a)-10(a) 280 1(b)-22(b) All 2-deoxynucleosides 1(a)-10(a) 281 1(c)-22(c) All 2-deoxynucleosides 1(a)-10(a) 282 1(d)-22(d) All 2-deoxynucleosides 1(a)-10(a) 283 1(e)-22(e) All 2-deoxynucleosides 1(a)-10(a) 284 1(f)-22(f) All 2-deoxynucleosides 1(a)-10(a) 285 1(g)-22(g) All 2-deoxynucleosides 1(a)-10(a) 286 1(h)-22(h) All 2-deoxynucleosides 1(a)-10(a) 287 1(i)-22(i) All 2-deoxynucleosides 1(a)-10(a) 288 1(a)-22(a) All 2-deoxynucleosides 1(b)-10(b) 289 1(b)-22(b) All 2-deoxynucleosides 1(b)-10(b) 290 1(c)-22(c) All 2-deoxynucleosides 1(b)-10(b) 291 1(d)-22(d) All 2-deoxynucleosides 1(b)-10(b) 292 1(e)-22(e) All 2-deoxynucleosides 1(b)-10(b) 293 1(f)-22(f) All 2-deoxynucleosides 1(b)-10(b) 294 1(g)-22(g) All 2-deoxynucleosides 1(b)-10(b) 295 1(h)-22(h) All 2-deoxynucleosides 1(b)-10(b) 296 1(i)-22(i) All 2-deoxynucleosides 1(b)-10(b) 297 1(a)-22(a) All 2-deoxynucleosides 1(c)-10(c) 298 1(b)-22(b) All 2-deoxynucleosides 1(c)-10(c) 299 1(c)-22(c) All 2-deoxynucleosides 1(c)-10(c) 300 1(d)-22(d) All 2-deoxynucleosides 1(c)-10(c) 301 1(e)-22(e) All 2-deoxynucleosides 1(c)-10(c) 302 1(f)-22(f) All 2-deoxynucleosides 1(c)-10(c) 303 1(g)-22(g) All 2-deoxynucleosides 1(c)-10(c) 304 1(h)-22(h) All 2-deoxynucleosides 1(c)-10(c) 305 1(i)-22(i) All 2-deoxynucleosides 1(c)-10(c) 306 1(a)-22(a) All 2-deoxynucleosides 1(d)-10(d) 307 1(b)-22(b) All 2-deoxynucleosides 1(d)-10(d) 308 1(c)-22(c) All 2-deoxynucleosides 1(d)-10(d) 309 1(d)-22(d) All 2-deoxynucleosides 1(d)-10(d) 310 1(e)-22(e) All 2-deoxynucleosides 1(d)-10(d) 311 1(f)-22(f) All 2-deoxynucleosides 1(d)-10(d) 312 1(g)-22(g) All 2-deoxynucleosides 1(d)-10(d) 313 1(h)-22(h) All 2-deoxynucleosides 1(d)-10(d) 314 1(i)-22(i) All 2-deoxynucleosides 1(d)-10(d) 315 1(a)-22(a) All 2-deoxynucleosides 1(e)-10(e) 316 1(b)-22(b) All 2-deoxynucleosides 1(e)-10(e) 317 1(c)-22(c) All 2-deoxynucleosides 1(e)-10(e) 318 1(d)-22(d) All 2-deoxynucleosides 1(e)-10(e) 319 1(e)-22(e) All 2-deoxynucleosides 1(e)-10(e) 320 1(f)-22(f) All 2-deoxynucleosides 1(e)-10(e) 321 1(g)-22(g) All 2-deoxynucleosides 1(e)-10(e) 322 1(h)-22(h) All 2-deoxynucleosides 1(e)-10(e) 323 1(i)-22(i) All 2-deoxynucleosides 1(e)-10(e) 324 1(a)-22(a) All 2-deoxynucleosides 1(f)-10(f) 325 1(b)-22(b) All 2-deoxynucleosides 1(f)-10(f) 326 1(c)-22(c) All 2-deoxynucleosides 1(f)-10(f) 327 1(d)-22(d) All 2-deoxynucleosides 1(f)-10(f) 328 1(e)-22(e) All 2-deoxynucleosides 1(f)-10(f) 329 1(f)-22(f) All 2-deoxynucleosides 1(f)-10(f) 330 1(g)-22(g) All 2-deoxynucleosides 1(f)-10(f) 331 1(h)-22(h) All 2-deoxynucleosides 1(f)-10(f) 332 1(i)-22(i) All 2-deoxynucleosides 1(f)-10(f) 333 1(a)-22(a) All 2-deoxynucleosides 1(g)-10(g) 334 1(b)-22(b) All 2-deoxynucleosides 1(g)-10(g) 335 1(c)-22(c) All 2-deoxynucleosides 1(g)-10(g) 336 1(d)-22(d) All 2-deoxynucleosides 1(g)-10(g) 337 1(e)-22(e) All 2-deoxynucleosides 1(g)-10(g) 338 1(f)-22(f) All 2-deoxynucleosides 1(g)-10(g) 339 1(g)-22(g) All 2-deoxynucleosides 1(g)-10(g) 340 1(h)-22(h) All 2-deoxynucleosides 1(g)-10(g) 341 1(i)-22(i) All 2-deoxynucleosides 1(g)-10(g) 342 1(a)-22(a) All 2-deoxynucleosides 1(h)-10(h) 343 1(b)-22(b) All 2-deoxynucleosides 1(h)-10(h) 344 1(c)-22(c) All 2-deoxynucleosides 1(h)-10(h) 345 1(d)-22(d) All 2-deoxynucleosides 1(h)-10(h) 346 1(e)-22(e) All 2-deoxynucleosides 1(h)-10(h) 347 1(f)-22(f) All 2-deoxynucleosides 1(h)-10(h) 348 1(g)-22(g) All 2-deoxynucleosides 1(h)-10(h) 349 1(h)-22(h) All 2-deoxynucleosides 1(h)-10(h) 350 1(i)-22(i) All 2-deoxynucleosides 1(h)-10(h) 351 1(a)-22(a) All 2-deoxynucleosides 1(i)-10(i) 352 1(b)-22(b) All 2-deoxynucleosides 1(i)-10(i) 353 1(c)-22(c) All 2-deoxynucleosides 1(i)-10(i) 354 1(d)-22(d) All 2-deoxynucleosides 1(i)-10(i) 355 1(e)-22(e) All 2-deoxynucleosides 1(i)-10(i) 356 1(f)-22(f) All 2-deoxynucleosides 1(i)-10(i) 357 1(g)-22(g) All 2-deoxynucleosides 1(i)-10(i) 358 1(h)-22(h) All 2-deoxynucleosides 1(i)-10(i) 359 1(i)-22(i) All 2-deoxynucleosides 1(i)-10(i) 360 1(a-l) All 2-deoxynucleosides 1(a-l) 361 2(a-l) All 2-deoxynucleosides 1(a-l) 362 3(a-l) All 2-deoxynucleosides 1(a-l) 363 4(a-l) All 2-deoxynucleosides 1(a-l) 364 5(a-l) All 2-deoxynucleosides 1(a-l) 365 6(a-l) All 2-deoxynucleosides 1(a-l) 366 7(a-l) All 2-deoxynucleosides 1(a-l) 367 8(a-l) All 2-deoxynucleosides 1(a-l) 368 9(a-l) All 2-deoxynucleosides 1(a-l) 369 10(a-l) All 2-deoxynucleosides 1(a-l) 370 11(a-l) All 2-deoxynucleosides 1(a-l) 371 12(a-l) All 2-deoxynucleosides 1(a-l) 372 13(a-l) All 2-deoxynucleosides 1(a-l) 373 14(a-l) All 2-deoxynucleosides 1(a-l) 374 15(a-l) All 2-deoxynucleosides 1(a-l) 375 16(a-l) All 2-deoxynucleosides 1(a-l) 376 17(a-l) All 2-deoxynucleosides 1(a-l) 377 18(a-l) All 2-deoxynucleosides 1(a-l) 378 19(a-l) All 2-deoxynucleosides 1(a-l) 379 20(a-l) All 2-deoxynucleosides 1(a-l) 380 21(a-l) All 2-deoxynucleosides 1(a-l) 381 22(a-l) All 2-deoxynucleosides 1(a-l) 382 1(a-l) All 2-deoxynucleosides 2(a-l) 383 2(a-l) All 2-deoxynucleosides 2(a-l) 384 3(a-l) All 2-deoxynucleosides 2(a-l) 385 4(a-l) All 2-deoxynucleosides 2(a-l) 386 5(a-l) All 2-deoxynucleosides 2(a-l) 387 6(a-l) All 2-deoxynucleosides 2(a-l) 388 7(a-l) All 2-deoxynucleosides 2(a-l) 389 8(a-l) All 2-deoxynucleosides 2(a-l) 390 9(a-l) All 2-deoxynucleosides 2(a-l) 391 10(a-l) All 2-deoxynucleosides 2(a-l) 392 11(a-l) All 2-deoxynucleosides 2(a-l) 393 12(a-l) All 2-deoxynucleosides 2(a-l) 394 13(a-l) All 2-deoxynucleosides 2(a-l) 395 14(a-l) All 2-deoxynucleosides 2(a-l) 396 15(a-l) All 2-deoxynucleosides 2(a-l) 397 16(a-l) All 2-deoxynucleosides 2(a-l) 398 17(a-l) All 2-deoxynucleosides 2(a-l) 399 18(a-l) All 2-deoxynucleosides 2(a-l) 400 19(a-l) All 2-deoxynucleosides 2(a-l) 401 20(a-l) All 2-deoxynucleosides 2(a-l) 402 21(a-l) All 2-deoxynucleosides 2(a-l) 403 22(a-l) All 2-deoxynucleosides 2(a-l) 404 1(a-l) All 2-deoxynucleosides 3(a-l) 405 2(a-l) All 2-deoxynucleosides 3(a-l) 406 3(a-l) All 2-deoxynucleosides 3(a-l) 407 4(a-l) All 2-deoxynucleosides 3(a-l) 408 5(a-l) All 2-deoxynucleosides 3(a-l) 409 6(a-l) All 2-deoxynucleosides 3(a-l) 410 7(a-l) All 2-deoxynucleosides 3(a-l) 411 8(a-l) All 2-deoxynucleosides 3(a-l) 412 9(a-l) All 2-deoxynucleosides 3(a-l) 413 10(a-l) All 2-deoxynucleosides 3(a-l) 414 11(a-l) All 2-deoxynucleosides 3(a-l) 415 12(a-l) All 2-deoxynucleosides 3(a-l) 416 13(a-l) All 2-deoxynucleosides 3(a-l) 417 14(a-l) All 2-deoxynucleosides 3(a-l) 418 15(a-l) All 2-deoxynucleosides 3(a-l) 419 16(a-l) All 2-deoxynucleosides 3(a-l) 420 17(a-l) All 2-deoxynucleosides 3(a-l) 421 18(a-l) All 2-deoxynucleosides 3(a-l) 422 19(a-l) All 2-deoxynucleosides 3(a-l) 423 20(a-l) All 2-deoxynucleosides 3(a-l) 424 21(a-l) All 2-deoxynucleosides 3(a-l) 425 22(a-l) All 2-deoxynucleosides 3(a-l) 426 1(a-l) All 2-deoxynucleosides 4(a-l) 427 2(a-l) All 2-deoxynucleosides 4(a-l) 428 3(a-l) All 2-deoxynucleosides 4(a-l) 429 4(a-l) All 2-deoxynucleosides 4(a-l) 430 5(a-l) All 2-deoxynucleosides 4(a-l) 431 6(a-l) All 2-deoxynucleosides 4(a-l) 432 7(a-l) All 2-deoxynucleosides 4(a-l) 433 8(a-l) All 2-deoxynucleosides 4(a-l) 434 9(a-l) All 2-deoxynucleosides 4(a-l) 435 10(a-l) All 2-deoxynucleosides 4(a-l) 436 11(a-l) All 2-deoxynucleosides 4(a-l) 437 12(a-l) All 2-deoxynucleosides 4(a-l) 438 13(a-l) All 2-deoxynucleosides 4(a-l) 439 14(a-l) All 2-deoxynucleosides 4(a-l) 440 15(a-l) All 2-deoxynucleosides 4(a-l) 441 16(a-l) All 2-deoxynucleosides 4(a-l) 442 17(a-l) All 2-deoxynucleosides 4(a-l) 443 18(a-l) All 2-deoxynucleosides 4(a-l) 444 19(a-l) All 2-deoxynucleosides 4(a-l) 445 20(a-l) All 2-deoxynucleosides 4(a-l) 446 21(a-l) All 2-deoxynucleosides 4(a-l) 447 22(a-l) All 2-deoxynucleosides 4(a-l) 448 1(a-l) All 2-deoxynucleosides 5(a-l) 449 2(a-l) All 2-deoxynucleosides 5(a-l) 450 3(a-l) All 2-deoxynucleosides 5(a-l) 451 4(a-l) All 2-deoxynucleosides 5(a-l) 452 5(a-l) All 2-deoxynucleosides 5(a-l) 453 6(a-l) All 2-deoxynucleosides 5(a-l) 454 7(a-l) All 2-deoxynucleosides 5(a-l) 455 8(a-l) All 2-deoxynucleosides 5(a-l) 456 9(a-l) All 2-deoxynucleosides 5(a-l) 457 10(a-l) All 2-deoxynucleosides 5(a-l) 458 11(a-l) All 2-deoxynucleosides 5(a-l) 459 12(a-l) All 2-deoxynucleosides 5(a-l) 460 13(a-l) All 2-deoxynucleosides 5(a-l) 461 14(a-l) All 2-deoxynucleosides 5(a-l) 462 15(a-l) All 2-deoxynucleosides 5(a-l) 463 16(a-l) All 2-deoxynucleosides 5(a-l) 464 17(a-l) All 2-deoxynucleosides 5(a-l) 465 18(a-l) All 2-deoxynucleosides 5(a-l) 466 19(a-l) All 2-deoxynucleosides 5(a-l) 467 20(a-l) All 2-deoxynucleosides 5(a-l) 468 21(a-l) All 2-deoxynucleosides 5(a-l) 469 22(a-l) All 2-deoxynucleosides 5(a-l) 470 1(a-l) All 2-deoxynucleosides 6(a-l) 471 2(a-l) All 2-deoxynucleosides 6(a-l) 472 3(a-l) All 2-deoxynucleosides 6(a-l) 473 4(a-l) All 2-deoxynucleosides 6(a-l) 474 5(a-l) All 2-deoxynucleosides 6(a-l) 475 6(a-l) All 2-deoxynucleosides 6(a-l) 476 7(a-l) All 2-deoxynucleosides 6(a-l) 477 8(a-l) All 2-deoxynucleosides 6(a-l) 478 9(a-l) All 2-deoxynucleosides 6(a-l) 479 10(a-l) All 2-deoxynucleosides 6(a-l) 480 11(a-l) All 2-deoxynucleosides 6(a-l) 481 12(a-l) All 2-deoxynucleosides 6(a-l) 482 13(a-l) All 2-deoxynucleosides 6(a-l) 483 14(a-l) All 2-deoxynucleosides 6(a-l) 484 15(a-l) All 2-deoxynucleosides 6(a-l) 485 16(a-l) All 2-deoxynucleosides 6(a-l) 486 17(a-l) All 2-deoxynucleosides 6(a-l) 487 18(a-l) All 2-deoxynucleosides 6(a-l) 488 19(a-l) All 2-deoxynucleosides 6(a-l) 489 20(a-l) All 2-deoxynucleosides 6(a-l) 490 21(a-l) All 2-deoxynucleosides 6(a-l) 491 22(a-l) All 2-deoxynucleosides 6(a-l) 492 1(a-l) All 2-deoxynucleosides 7(a-l) 493 2(a-l) All 2-deoxynucleosides 7(a-l) 494 3(a-l) All 2-deoxynucleosides 7(a-l) 495 4(a-l) All 2-deoxynucleosides 7(a-l) 496 5(a-l) All 2-deoxynucleosides 7(a-l) 497 6(a-l) All 2-deoxynucleosides 7(a-l) 498 7(a-l) All 2-deoxynucleosides 7(a-l) 499 8(a-l) All 2-deoxynucleosides 7(a-l) 500 9(a-l) All 2-deoxynucleosides 7(a-l) 501 10(a-l) All 2-deoxynucleosides 7(a-l) 502 11(a-l) All 2-deoxynucleosides 7(a-l) 503 12(a-l) All 2-deoxynucleosides 7(a-l) 504 13(a-l) All 2-deoxynucleosides 7(a-l) 505 14(a-l) All 2-deoxynucleosides 7(a-l) 506 15(a-l) All 2-deoxynucleosides 7(a-l) 507 16(a-l) All 2-deoxynucleosides 7(a-l) 508 17(a-l) All 2-deoxynucleosides 7(a-l) 509 18(a-l) All 2-deoxynucleosides 7(a-l) 510 19(a-l) All 2-deoxynucleosides 7(a-l) 511 20(a-l) All 2-deoxynucleosides 7(a-l) 512 21(a-l) All 2-deoxynucleosides 7(a-l) 513 22(a-l) All 2-deoxynucleosides 7(a-l) 514 1(a-l) All 2-deoxynucleosides 8(a-l) 515 2(a-l) All 2-deoxynucleosides 8(a-l) 516 3(a-l) All 2-deoxynucleosides 8(a-l) 517 4(a-l) All 2-deoxynucleosides 8(a-l) 518 5(a-l) All 2-deoxynucleosides 8(a-l) 519 6(a-l) All 2-deoxynucleosides 8(a-l) 520 7(a-l) All 2-deoxynucleosides 8(a-l) 521 8(a-l) All 2-deoxynucleosides 8(a-l) 522 9(a-l) All 2-deoxynucleosides 8(a-l) 523 10(a-l) All 2-deoxynucleosides 8(a-l) 524 11(a-l) All 2-deoxynucleosides 8(a-l) 525 12(a-l) All 2-deoxynucleosides 8(a-l) 526 13(a-l) All 2-deoxynucleosides 8(a-l) 527 14(a-l) All 2-deoxynucleosides 8(a-l) 528 15(a-l) All 2-deoxynucleosides 8(a-l) 529 16(a-l) All 2-deoxynucleosides 8(a-l) 530 17(a-l) All 2-deoxynucleosides 8(a-l) 531 18(a-l) All 2-deoxynucleosides 8(a-l) 532 19(a-l) All 2-deoxynucleosides 8(a-l) 533 20(a-l) All 2-deoxynucleosides 8(a-l) 534 21(a-l) All 2-deoxynucleosides 8(a-l) 535 22(a-l) All 2-deoxynucleosides 8(a-l) 536 1(a-l) All 2-deoxynucleosides 9(a-l) 537 2(a-l) All 2-deoxynucleosides 9(a-l) 538 3(a-l) All 2-deoxynucleosides 9(a-l) 539 4(a-l) All 2-deoxynucleosides 9(a-l) 540 5(a-l) All 2-deoxynucleosides 9(a-l) 541 6(a-l) All 2-deoxynucleosides 9(a-l) 542 7(a-l) All 2-deoxynucleosides 9(a-l) 543 8(a-l) All 2-deoxynucleosides 9(a-l) 544 9(a-l) All 2-deoxynucleosides 9(a-l) 545 10(a-l) All 2-deoxynucleosides 9(a-l) 546 11(a-l) All 2-deoxynucleosides 9(a-l) 547 12(a-l) All 2-deoxynucleosides 9(a-l) 548 13(a-l) All 2-deoxynucleosides 9(a-l) 549 14(a-l) All 2-deoxynucleosides 9(a-l) 550 15(a-l) All 2-deoxynucleosides 9(a-l) 551 16(a-l) All 2-deoxynucleosides 9(a-l) 552 17(a-l) All 2-deoxynucleosides 9(a-l) 553 18(a-l) All 2-deoxynucleosides 9(a-l) 554 19(a-l) All 2-deoxynucleosides 9(a-l) 555 20(a-l) All 2-deoxynucleosides 9(a-l) 556 21(a-l) All 2-deoxynucleosides 9(a-l) 557 22(a-l) All 2-deoxynucleosides 9(a-l) 558 1(a-l) All 2-deoxynucleosides 10(a-l) 559 2(a-l) All 2-deoxynucleosides 10(a-l) 560 3(a-l) All 2-deoxynucleosides 10(a-l) 561 4(a-l) All 2-deoxynucleosides 10(a-l) 562 5(a-l) All 2-deoxynucleosides 10(a-l) 563 6(a-l) All 2-deoxynucleosides 10(a-l) 564 7(a-l) All 2-deoxynucleosides 10(a-l) 565 8(a-l) All 2-deoxynucleosides 10(a-l) 566 9(a-l) All 2-deoxynucleosides 10(a-l) 567 10(a-l) All 2-deoxynucleosides 10(a-l) 568 11(a-l) All 2-deoxynucleosides 10(a-l) 569 12(a-l) All 2-deoxynucleosides 10(a-l) 570 13(a-l) All 2-deoxynucleosides 10(a-l) 571 14(a-l) All 2-deoxynucleosides 10(a-l) 572 15(a-l) All 2-deoxynucleosides 10(a-l) 573 16(a-l) All 2-deoxynucleosides 10(a-l) 574 17(a-l) All 2-deoxynucleosides 10(a-l) 575 18(a-l) All 2-deoxynucleosides 10(a-l) 576 19(a-l) All 2-deoxynucleosides 10(a-l) 577 20(a-l) All 2-deoxynucleosides 10(a-l) 578 21(a-l) All 2-deoxynucleosides 10(a-l) 579 22(a-l) All 2-deoxynucleosides 10(a-l) 580 1(j)-22(j) All 2-deoxynucleosides 1(a)-10(a) 581 1(k)-22(k) All 2-deoxynucleosides 1(a)-10(a) 582 1(l)-22(l) All 2-deoxynucleosides 1(a)-10(a) 583 1(j)-22(j) All 2-deoxynucleosides 1(b)-10(b) 584 1(k)-22(k) All 2-deoxynucleosides 1(b)-10(b) 585 1(l)-22(l) All 2-deoxynucleosides 1(b)-10(b) 586 1(j)-22(j) All 2-deoxynucleosides 1(c)-10(c) 587 1(k)-22(k) All 2-deoxynucleosides 1(c)-10(c) 588 1(l)-22(l) All 2-deoxynucleosides 1(c)-10(c) 589 1(j)-22(j) All 2-deoxynucleosides 1(d)-10(d) 590 1(k)-22(k) All 2-deoxynucleosides 1(d)-10(d) 591 1(l)-22(l) All 2-deoxynucleosides 1(d)-10(d) 592 1(j)-22(j) All 2-deoxynucleosides 1(e)-10(e) 593 1(k)-22(k) All 2-deoxynucleosides 1(e)-10(e) 594 1(l)-22(l) All 2-deoxynucleosides 1(e)-10(e) 595 1(j)-22(j) All 2-deoxynucleosides 1(f)-10(f) 596 1(k)-22(k) All 2-deoxynucleosides 1(f)-10(f) 597 1(l)-22(l) All 2-deoxynucleosides 1(f)-10(f) 598 1(j)-22(j) All 2-deoxynucleosides 1(g)-10(g) 599 1(k)-22(k) All 2-deoxynucleosides 1(g)-10(g) 600 1(l)-22(l) All 2-deoxynucleosides 1(g)-10(g) 601 1(j)-22(j) All 2-deoxynucleosides 1(h)-10(h) 602 1(k)-22(k) All 2-deoxynucleosides 1(h)-10(h) 603 1(l)-22(l) All 2-deoxynucleosides 1(h)-10(h) 604 1(j)-22(j) All 2-deoxynucleosides 1(i)-10(i) 605 1(k)-22(k) All 2-deoxynucleosides 1(i)-10(i) 606 1(l)-22(l) All 2-deoxynucleosides 1(i)-10(i) 607 1(j)-22(j) All 2-deoxynucleosides 1(j)-10(j) 608 1(k)-22(k) All 2-deoxynucleosides 1(j)-10(j) 609 1(l)-22(l) All 2-deoxynucleosides 1(j)-10(j) 610 1(j)-22(j) All 2-deoxynucleosides 1(k)-10(k) 611 1(k)-22(k) All 2-deoxynucleosides 1(k)-10(k) 612 1(l)-22(l) All 2-deoxynucleosides 1(k)-10(k) 612 1(j)-22(j) All 2-deoxynucleosides 1(l)-10(l) 614 1(k)-22(k) All 2-deoxynucleosides 1(l)-10(l) 615 1(l)-22(l) All 2-deoxynucleosides 1(l)-10(l) 616 1k All 2-deoxynucleosides 1m
(293) In certain embodiments, a gapmer comprises a 5-wing selected from among the 5-wings provided herein and any 3-wing. In certain embodiments, a gapmer comprises a 5-wing selected from among 1(a-l) to 22(a-l). In certain embodiments, a gapmer comprises a 5-wing selected from among 1(a-l) to 22(a-l). In certain embodiments, a gapmer comprises a 3-wing selected from among the 3-wings provided herein and any 5-wing. In certain embodiments, a gapmer comprises a 3-wing selected from among 1(a-i) to 10(a-i). In certain embodiments, a gapmer comprises a 3-wing selected from among 1(a-l) to 10(a-l).
(294) In certain embodiments, a gapmer has a sugar motif other than: E-K-K-(D).sub.9-K-K-E; E-E-E-E-K-(D).sub.9-E-E-E-E-E; E-KK-K-(D).sub.9-KK-K-E; K-E-E-K-(D).sub.9-K-E-E-K; K-D-D-K-(D).sub.9-K-D-D-K; K-E-K-E-K-(D).sub.9-K-E-K-E-K; K-D-K-D-K-(D).sub.9-K-D-K-D-K; E-K-E-K-(D).sub.9-K-E-K-E; E-E-E-E-E-K-(D).sub.g-E-E-E-E-E; or E-K-E-K-E-(D).sub.9-E-K-E-K-E. In certain embodiments, a gapmer not having one of the above motifs has a sugar motif of Formula I. In certain embodiments, a gapmer not having one of the above motifs has a sugar motif selected from motifs 1-58. In certain embodiments, a gapmer not having one of the above motifs has a sugar motif of Formula I and selected from sugar motifs 1-58. In certain embodiments, a gapmer not having one of the above motifs has a sugar motif of Formula II. In certain embodiments, a gapmer not having one of the above motifs has a sugar motif selected from motifs 1-615. In certain embodiments, a gapmer not having one of the above motifs has a sugar motif of Formula II and selected from sugar motifs 1-615.
(295) In certain embodiments a gapmer comprises a A-(D).sub.4-A-(D).sub.4-A-(D).sub.4-AA motif. In certain embodiments a gapmer comprises a B-(D).sub.4-A-(D).sub.4-A-(D).sub.4-AA motif. In certain embodiments a gapmer comprises a A-(D).sub.4-B-(D).sub.4-A-(D).sub.4-AA motif. In certain embodiments a gapmer comprises a A-(D).sub.4-A-(D).sub.4-B-(D).sub.4-AA motif. In certain embodiments a gapmer comprises a A-(D).sub.4-A-(D).sub.4-A-(D).sub.4-BA motif. In certain embodiments a gapmer comprises a A-(D).sub.4-A-(D).sub.4-A-(D).sub.4-BB motif. In certain embodiments a gapmer comprises a K-(D).sub.4-K-(D).sub.4-K-(D).sub.4-K-E motif.
(296) Certain Internucleoside Linkage Motifs
(297) In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for sugar modification motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The sugar modification motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped sugar modification motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same.
(298) In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
(299) In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3 end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3 end of the oligonucleotide.
(300) Certain Nucleobase Modification Motifs
(301) In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain such embodiments, nucleobase modifications are arranged in a gapped motif. In certain embodiments, nucleobase modifications are arranged in an alternating motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.
(302) In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3-end of the oligonucleotide. In certain such embodiments, the block is at the 5-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5-end of the oligonucleotide.
(303) In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.
(304) In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5-methyl cytosine moieties. Herein, 5-methyl cytosine is not a modified nucleobase. Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified.
(305) Certain Overall Lengths
(306) In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that XY. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.
(307) In certain embodiments, any of the gapmer motifs provided above, including but not limited to gapmer motifs 1-278 provided in Tables 3 and 4, may have any of the above lengths. One of skill in the art will appreciate that certain lengths may not be possible for certain motifs. For example: a gapmer having a 5-wing region consisting of four nucleotides, a gap consisting of at least six nucleotides, and a 3-wing region consisting of three nucleotides cannot have an overall length less than 13 nucleotides. Thus, one would understand that the lower length limit is 13 and that the limit of 10 in 10-20 has no effect in that embodiment.
(308) Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range. For example, an oligonucleotide consisting of 20-25 linked nucleosides comprising a 5-wing consisting of 5 linked nucleosides; a 3-wing consisting of 5 linked nucleosides and a central gap consisting of 10 linked nucleosides (5+5+10=20) may have up to 5 nucleosides that are not part of the 5-wing, the 3-wing, or the gap (before reaching the overall length limitation of 25). Such additional nucleosides may be 5 of the 5-wing and/or 3 of the 3 wing.
(309) Certain Oligonucleotides
(310) In certain embodiments, oligonucleotides of the present invention are characterized by their sugar motif, internucleoside linkage motif, nucleobase modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Thus, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. One of skill in the art will appreciate that such motifs may be combined to create a variety of oligonucleotides, such as those provided in the non-limiting Table 5 below.
(311) TABLE-US-00011 TABLE 10 Certain Oligonucleotides Overall Internucleoside Nucleobase Mod. Length Sugar motif Linkage Motif Motif 12 Gapmer motif selected from 1-278 uniform PS uniform unmodified 14 Gapmer motif selected from 1-278 2-14-2 gapmer: PO in uniform unmodified wings and PS in gap 14 Gapmer motif selected from 1-278 uniform PS uniform unmodified; all C's are 5-meC 16 Gapmer of Formula I uniform PS uniform unmodified; no Cs are 5-meC) 16 Gapmer of Formula I uniform PS uniform unmodified; at least one nucleobase is a 5-meC 16 Gapmer of Formula I and having uniform PS uniform unmodified motif selected from 1-58 17 Gapmer of Formula I and having uniform PO uniform unmodified motif selected from 1-58 17 Gapmer motif selected from 1-278 uniform PS uniform unmodified 17 Gapmer of Formula I uniform PS uniform unmodified 18 Gapmer of Formula I and having uniform PS uniform unmodified motif selected from 1-58 18 Gapmer motif selected from 1-278 uniform PS uniform unmodified 20 Gapmer of Formula I uniform PS uniform unmodified 12 Gapmer motif selected from 1-359 uniform PS uniform unmodified 14 Gapmer motif selected from 1-359 2-14-2 gapmer: PO in uniform unmodified wings and PS in gap 14 Gapmer motif selected from 1-359 uniform PS uniform unmodified; all C's are 5-meC 16 Gapmer of Formula II uniform PS uniform unmodified; no Cs are 5-meC) 16 Gapmer of Formula II uniform PS uniform unmodified; at least one nucleobase is a 5-meC 16 Gapmer of Formula II and having uniform PS uniform unmodified motif selected from 1-359 17 Gapmer of Formula II and having uniform PO uniform unmodified motif selected from 1-359 17 Gapmer motif selected from 1-359 uniform PS uniform unmodified 17 Gapmer of Formula II uniform PS uniform unmodified 18 Gapmer of Formula I and having uniform PS uniform unmodified motif selected from 1-359 18 Gapmer motif selected from 1-359 uniform PS uniform unmodified 20 Gapmer of Formula II uniform PS uniform unmodified 12 Gapmer motif selected from 1-615 uniform PS uniform unmodified 14 Gapmer motif selected from 1-615 2-14-2 gapmer: PO in uniform unmodified wings and PS in gap 14 Gapmer motif selected from 1-615 uniform PS uniform unmodified; all C's are 5-meC 16 Gapmer of Formula I and having uniform PS uniform unmodified motif selected from 1-615 17 Gapmer of Formula I and having uniform PO uniform unmodified motif selected from 1-615 17 Gapmer motif selected from 1-615 uniform PS uniform unmodified 18 Gapmer of Formula I and having uniform PS uniform unmodified motif selected from 1-615 18 Gapmer motif selected from 1-615 uniform PS uniform unmodified
The above table is intended only to illustrate and not to limit the various combinations of the parameters of oligonucleotides of the present invention. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.
(312) Certain Conjugate Groups
(313) In certain embodiments, oligomeric compounds are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
(314) In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
(315) In certain embodiments, conjugate groups are directly attached to oligonucleotides in oligomeric compounds. In certain embodiments, conjugate groups are attached to oligonucleotides by a conjugate linking group. In certain such embodiments, conjugate linking groups, including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
(316) Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
(317) Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
(318) In certain embodiments, conjugate groups are at the 3-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3-end. In certain embodiments, conjugates are attached at the 3 end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group. In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or terminal groups may be added to oligonucleotides having any of the chemical motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.
(319) Antisense Compounds
(320) In certain embodiments, oligomeric compounds of the present invention are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).
(321) In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.
(322) In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.
(323) Certain Antisense Activities and Mechanisms
(324) In certain antisense activities, hybridization of an antisense compound results in recruitment of a protein that cleaves of the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex, need not be unmodified DNA. In certain embodiments, the invention provides antisense compounds that are sufficiently DNA-like to elicit RNase H activity. Such DNA-like antisense compounds include, but are not limited to gapmers having unmodified deoxyfuronose sugar moieties in the nucleosides of the gap and modified sugar moieties in the nucleosides of the wings.
(325) Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid; a change in the ratio of splice variants of a nucleic acid or protein; and/or a phenotypic change in a cell or animal
(326) In certain embodiments, compounds comprising oligonucleotides having a gapmer motif described herein have desirable properties compared to non-gapmer oligonucleotides or to gapmers having other motifs. In certain circumstances, it is desirable to identify motifs resulting in a favorable combination of potent antisense activity and relatively low toxicity. In certain embodiments, compounds of the present invention have a favorable therapeutic index (measure of potency divided by measure of toxicity).
(327) Certain Target Nucleic Acids
(328) In certain embodiments, antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long-non-coding RNA, a short non-coding RNA, an intronic RNA molecule, a snoRNA, a scaRNA, a microRNA (including pre-microRNA and mature microRNA), a ribosomal RNA, and promoter directed RNA. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, oligomeric compounds are at least partially complementary to more than one target nucleic acid. For example, antisense compounds of the present invention may mimic microRNAs, which typically bind to multiple targets.
(329) In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA. In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA or a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA or an intronic region of a pre-mRNA. In certain embodiments, the target nucleic acid is a long non-coding RNA. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is selected from among non-coding RNA, including exonic regions of pre-mRNA. In certain embodiments, the target nucleic acid is a ribosomal RNA (rRNA). In certain embodiments, the target nucleic acid is a non-coding RNA associated with splicing of other pre-mRNAs. In certain embodiments, the target nucleic acid is a nuclear-retained non-coding RNA.
(330) In certain embodiments, antisense compounds described herein are complementary to a target nucleic acid comprising a single-nucleotide polymorphism. In certain such embodiments, the antisense compound is capable of modulating expression of one allele of the single-nucleotide polymorphism-containing-target nucleic acid to a greater or lesser extent than it modulates another allele. In certain embodiments an antisense compound hybridizes to a single-nucleotide polymorphism-containing-target nucleic acid at the single-nucleotide polymorphism site. In certain embodiments an antisense compound hybridizes to a single-nucleotide polymorphism-containing-target nucleic acid near the single-nucleotide polymorphism site. In certain embodiments, the target nucleic acid is a Huntingtin gene transcript. In certain embodiments, the target nucleic acid is a single-nucleotide polymorphism-containing-target nucleic acid other than a Huntingtin gene transcript. In certain embodiments, the target nucleic acid is any nucleic acid other than a Huntingtin gene transcript.
(331) Certain Pharmaceutical Compositions
(332) In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.
(333) In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
(334) Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
(335) A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.
(336) Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono-or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
(337) In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
(338) In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
(339) In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
(340) In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80 and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
(341) In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
(342) In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
(343) In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
(344) In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
(345) In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.
(346) In certain embodiments, the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.
(347) In certain embodiments, the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures.
(348) Nonlimiting Disclosure and Incorporation by Reference
(349) While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
(350) Although the sequence listing accompanying this filing identifies each sequence as either RNA or DNA as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as RNA or DNA to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2-OH for the natural 2-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
(351) Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence ATCGATCG encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence AUCGAUCG and those having some DNA bases and some RNA bases such as AUCGATCG and oligomeric compounds having other modified or naturally occurring bases, such as AT.sup.meCGAUCG, wherein .sup.meC indicates a cytosine base comprising a methyl group at the 5-position.
EXAMPLES
(352) The following examples illustrate certain embodiments of the present invention and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
(353) Where nucleobase sequences are not provided, to allow assessment of the relative effects of nucleobase sequence and chemical modification, throughout the examples, oligomeric compounds are assigned a Sequence Code. Oligomeric compounds having the same Sequence Code have the same nucleobase sequence. Oligomeric compounds having different Sequence Codes have different nucleobase sequences.
Example 1
Dose-Dependent Inhibition of Chimeric Antisense Oligonucleotides Targeting PTEN
(354) A series of modified oligonucleotides were designed based on the parent gapmer, ISIS 482050, wherein the central gap region contains ten 2-deoxynucleosides. These modified oligonucleotides were designed by having the central gap region shortened to nine, eight or seven 2-deoxynucleosides and by introducing 2-O-methoxyethyl (MOE) modifications at one or both wing regions. The newly designed oligonucleotides were evaluated for their effects in reducing PTEN mRNA levels in vitro.
(355) The gapmers and their motifs are described in Table 60. The internucleoside linkages throughout each gapmer are phosphorothioate linkages (PS). Nucleosides followed by a subscript d indicate 2-deoxynucleosides. Nucleosides followed by a subscript e indicate 2-O-methoxyethyl (MOE) nucleosides. Nucleosides followed by a subscript k indicate constrained ethyl (cEt) nucleosides. N indicates modified or naturally occurring nucleobases (A, T, C, G, U, or 5-methyl C).
(356) The newly designed gapmers were tested in vitro. Mouse primary hepatocytes were plated at a density of 20,000 cells per well and transfected using electroporation with 0.6 M, 3.0 M and 15 M concentrations of antisense oligonucleotides. After a treatment period of approximately 24 hours, RNA was isolated from the cells and PTEN mRNA levels were measured by quantitative real-time PCR. Mouse PTEN primer probe set RTS 186 was used to measure mRNA levels. PTEN mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. The results in Table 12 are presented as PTEN mRNA expression relative to untreated control cells (% UTC).
(357) The parent gapmer, ISIS 482050 was included in the study as a bench mark oligonucleotide against which the activity of the newly designed gapmers targeting PTEN could be compared.
(358) TABLE-US-00012 TABLE11 ChimericantisenseoligonucleotidestargetingPTEN Gap Wingchemistry ISISNO. Sequence(5 to3) Motif chemistry 5 3 SEQIDNO 482050 A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-10-3 Fulldeoxy kkk kkk 23 .sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.k 508033 A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-10-3 Fulldeoxy kkk eee 23 .sub.dA.sub.dG.sub.d.sup.mC.sub.eT.sub.eT.sub.e 573351 A.sub.eT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-10-3 Fulldeoxy ekk kke 23 .sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.e 573352 A.sub.eT.sub.e.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 4-9-3 Fulldeoxy eekk kke 23 .sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.e 573353 A.sub.eT.sub.e.sup.mC.sub.eA.sub.kT.sub.kG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 5-8-3 Fulldeoxy eeekk kke 23 .sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.e 573355 A.sub.eT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-9-4 Fulldeoxy ekk kkee 23 .sub.dA.sub.dG.sub.k.sup.mC.sub.kT.sub.eT.sub.e 573356 A.sub.eT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-8-5 Fulldeoxy ekk kkeee 23 .sub.dA.sub.kG.sub.k.sup.mC.sub.eT.sub.eT.sub.e 573357 A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-7-6 Fulldeoxy ekk kkeeee 23 .sub.kA.sub.kG.sub.e.sup.mC.sub.eT.sub.eT.sub.e 573358 A.sub.eT.sub.e.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 4-8-4 Fulldeoxy eekk kkee 23 .sub.dA.sub.dG.sub.k.sup.mC.sub.kT.sub.eT.sub.e 573359 A.sub.eT.sub.e.sup.mC.sub.eA.sub.kT.sub.kG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 5-7-4 Fulldeoxy eeekk kkee 23 .sub.dA.sub.dG.sub.k.sup.mC.sub.kT.sub.eT.sub.e 573360 A.sub.eT.sub.e.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 4-7-5 Fulldeoxy eekk kkeee 23 .sub.dA.sub.kG.sub.k.sup.mC.sub.eT.sub.eT.sub.e e = 2-MOE, k = cEt, d = 2-deoxynucleoside
(359) TABLE-US-00013 TABLE 12 Dose-response effect of chimeric antisense oligonucleotides targeting PTEN % UTC Wing 0.6 3.0 Gap chemistry ISIS NO. M M 15 M Motif chemistry 5 3 482050 45.4 23.8 8.4 3-10-3 Full deoxy kkk kkk 508033 52.2 28.8 7.6 3-10-3 Full deoxy kkk eee 573351 66.0 24.0 12.4 3-10-3 Full deoxy ekk kke 573352 69.0 38.1 12.5 4-9-3 Full deoxy eekk kke 573353 59.8 36.5 13.8 5-8-3 Full deoxy eeekk kke 573355 52.1 37.4 11.4 3-9-4 Full deoxy ekk kkee 573356 52.9 46.4 15.4 3-8-5 Full deoxy ekk kkeee 573357 82.4 81.8 52.5 3-7-6 Full deoxy ekk kkeeee 573358 67.4 46.7 14.5 4-8-4 Full deoxy eekk kkee 573359 70.5 49.8 31.6 5-7-4 Full deoxy eeekk kkee 573360 62.2 50.8 17.6 4-7-5 Full deoxy eekk kkeee Saline = 100 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
Example 2
Dose-Dependent Inhibition of Chimeric Antisense Oligonucleotides Targeting PTEN
(360) Additional chimeric oligonucleotides were designed based on the parent gapmer, ISIS 482050, wherein the central gap region contains ten 2-deoxynucleosides. These modified oligonucleotides were designed by having the central gap region shortened to eight 2-deoxynucleosides and by introducing one or more 2-O-methoxyethyl (MOE) modification(s) at the 3 wing region. The modified oligonucleotides designed by microwalk were evaluated for their effects in reducing PTEN mRNA levels in vitro.
(361) The gapmers and their motifs are described in Table 13. The internucleoside linkages throughout each gapmer are phosphorothioate linkages (PS). Nucleosides followed by a subscript d indicate 2-deoxynucleoside. Nucleosides followed by a subscript e indicate 2-O-methoxyethyl (MOE) nucleosides. Nucleosides followed by a subscript k indicate constrained ethyl (cEt) nucleosides. mC indicates a 5-methyl nucleoside.
(362) The newly designed gapmers were tested in vitro. Mouse primary hepatocytes were plated at a density of 20,000 cells per well and transfected using electroporation with 0.6 M, 3.0 M and 15 M concentrations of antisense oligonucleotides. After a treatment period of approximately 24 hours, RNA was isolated from the cells and PTEN mRNA levels were measured by quantitative real-time PCR. Mouse PTEN primer probe set RTS 186 was used to measure mRNA levels. PTEN mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. The results in Table 14 are presented as PTEN mRNA expression relative to untreated control cells (% UTC).
(363) The parent gapmer, ISIS 482050 was included in the study as a bench mark oligonucleotide against which the activity of the newly designed gapmers targeting PTEN could be compared.
(364) TABLE-US-00014 TABLE13 ChimericantisenseoligonucleotidesdesignedbymicrowalktargetingPTEN Gap Wingchemistry ISISNO. Sequence(5 to3) Motif chemistry 5 3 SEQIDNO. 482050 A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-10-3 Fulldeoxy kkk kkk 24 .sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.k 573797 T.sub.kG.sub.kG.sub.k.sup.mC.sub.dT.sub.dG.sub.d.sup.mC.sub.dA.sub.dG.sub.d.sup.mC.sub.dT 3-8-5 Fulldeoxy kkk keeee 25 .sub.dT.sub.k.sup.mC.sub.e.sup.mC.sub.eG.sub.eA.sub.e 573798 A.sub.kT.sub.kG.sub.kG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC.sub.dA.sub.dG.sub.d.sup.mC 3-8-5 Fulldeoxy kkk keeee 26 .sub.dT.sub.kT.sub.e.sup.mC.sub.e.sup.mC.sub.eG.sub.e 573799 .sup.mC.sub.kA.sub.kT.sub.kG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC.sub.dA.sub.dG 3-8-5 Fulldeoxy kkk keeee 27 .sub.d.sup.mC.sub.kT.sub.eT.sub.e.sup.mC.sub.e.sup.mC.sub.e 573800 T.sub.k.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC.sub.dA 3-8-5 Fulldeoxy kkk keeee 28 .sub.dG.sub.k.sup.mC.sub.eT.sub.eT.sub.e.sup.mC.sub.e 573801 A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC 3-8-5 Fulldeoxy kkk keeee 24 .sub.dA.sub.kG.sub.e.sup.mC.sub.eT.sub.eT.sub.e 573802 .sup.mC.sub.kA.sub.kT.sub.k.sup.mC.sub.dA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG 3-8-5 Fulldeoxy kkk keeee 29 .sub.d.sup.mC.sub.kA.sub.eG.sub.e.sup.mC.sub.eT.sub.e 573803 .sup.mC.sub.k.sup.mC.sub.kA.sub.kT.sub.d.sup.mC.sub.dA.sub.dT.sub.aG.sub.dG.sub.d.sup.mC.sub.d 3-8-5 Fulldeoxy kkk keeee 30 T.sub.dG.sub.k.sup.mC.sub.eA.sub.eG.sub.e.sup.mC.sub.e 573804 T.sub.k.sup.mC.sub.k.sup.mC.sub.kA.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.dG.sub.dG.sub.d.sup.m 3-8-5 Fulldeoxy kkk keeee 31 C.sub.dT.sub.kG.sub.e.sup.mC.sub.eA.sub.eG.sub.e 573805 T.sub.kT.sub.k.sup.mC.sub.k.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.dG.sub.dG 3-8-5 Fulldeoxy kkk keeee 32 .sub.d.sup.mC.sub.kT.sub.eG.sub.e.sup.mC.sub.eA.sub.e e = 2-MOE, k = cEt, d = 2-deoxynucleoside
(365) TABLE-US-00015 TABLE 14 Dose-dependent inhibition of chimeric antisense oligonucleotides designed by microwalk targeting PTEN Wing ISIS % UTC Gap chemistry NO. 0.6 M 3.0 M 15 M Motif chemistry 5 3 482050 45.4 23.8 8.4 3-10-3 Full deoxy kkk kkk 573797 56.8 55.4 13.1 3-8-5 Full deoxy kkk keeee 573798 50.9 33.5 9.6 3-8-5 Full deoxy kkk keeee 573799 62.6 27.7 10.3 3-8-5 Full deoxy kkk keeee 573800 68.6 38.9 12.0 3-8-5 Full deoxy kkk keeee 573801 54.6 46.3 11.8 3-8-5 Full deoxy kkk keeee 573802 60.7 40.4 13.0 3-8-5 Full deoxy kkk keeee 573803 47.0 29.8 8.5 3-8-5 Full deoxy kkk keeee 573804 62.5 34.1 11.3 3-8-5 Full deoxy kkk keeee 573805 70.3 31.6 15.2 3-8-5 Full deoxy kkk keeee Saline = 100 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
Example 3
Antisense Inhibition of Target-Z mRNA in HepG2 Cells
(366) Antisense oligonucleotides were designed targeting a Target-Z nucleic acid and were tested for their effects on Target-Z mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. ISIS 146786, 509934, ISIS 509959, and ISIS 510100, were also included in these studies for comparison. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000 with 70 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and Target-Z mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 33; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 34; probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID NO: 35) was used to measure mRNA levels. Levels were also measured using primer probe set RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 36; reverse sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 37; probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO: 38). Target-Z mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of Target-Z, relative to untreated control cells.
(367) The newly designed chimeric antisense oligonucleotides and their motifs are described in Tables 15-20. The gapmers are 16 nucleotides in length, wherein the central gap region comprises ten 2-deoxynucleosides. Nucleosides followed by k indicate constrained ethyl (cEt) nucleosides. Nucleosides followed by e indicate 2-O-methoxyethyl (2-MOE) nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.
(368) Each gapmer listed in Tables 15-20 is targeted to the viral genomic sequence, designated herein as Target-Z. The activity of the newly designed oligonucleotides was compared with ISIS 146786, ISIS 509934, ISIS 509959, and ISIS 510100.
(369) TABLE-US-00016 TABLE 15 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 % ISIS No Motif inhibition 509934 eeeee-d(10)- 30 eeeee 552787 ekk-d(10)-kke 57 552788 ekk-d(10)-kke 60 552789 ekk-d(10)-kke 67 552790 ekk-d(10)-kke 67 552791 ekk-d(10)-kke 65 552792 ekk-d(10)-kke 44 552793 ekkd(10)kke 0 552794 ekk-d(10)-kke 54 552795 ekk-d(10)-kke 55 552796 ekk-d(10)-kke 62 552797 ekk-d(10)-kke 59 552798 ekk-d(10)-kke 59 552799 ekk-d(10)-kke 58 552800 ekk-d(10)-kke 62 552801 ekk-d(10)-kke 65 552802 ekk-d(10)-kke 53 552803 ekk-d(10)-kke 67 552804 ekk-d(10)-kke 75 552805 ekk-d(10)-kke 72 552806 ekk-d(10)-kke 64 552807 ekk-d(10)-kke 68 552808 ekk-d(10)-kke 65 552809 ekk-d(10)-kke 60 552810 ekk-d(10)-kke 59 552811 ekk-d(10)-kke 64 552812 ekk-d(10)-kke 69 552813 ekk-d(10)-kke 64 552814 ekk-d(10)-kke 62 552815 ekk-d(10)-kke 61 552816 ekk-d(10)-kke 63 552817 ekk-d(10)-kke 42 552818 ekk-d(10)-kke 44 552819 ekk-d(10)-kke 56 552820 ekk-d(10)-kke 59 552821 ekk-d(10)-kke 76 552822 ekk-d(10)-kke 77 552823 ekk-d(10)-kke 73 552824 ekk-d(10)-kke 73 552825 ekk-d(10)-kke 51 552826 ekk-d(10)-kke 55 552827 ekk-d(10)-kke 67 552828 ekk-d(10)-kke 78 552829 ekk-d(10)-kke 72 552830 ekk-d(10)-kke 71 552831 ekk-d(10)-kke 69 552832 ekk-d(10)-kke 67 552833 ekk-d(10)-kke 65 552834 ekk-d(10)-kke 78 552835 ekk-d(10)-kke 70 552836 ekk-d(10)-kke 64 552837 ekk-d(10)-kke 65 552838 ekk-d(10)-kke 64 552839 ekk-d(10)-kke 60 552840 ekk-d(10)-kke 35 552841 ekk-d(10)-kke 62 552842 ekk-d(10)-kke 67 552843 ekk-d(10)-kke 77 552844 ekk-d(10)-kke 81 552845 ekk-d(10)-kke 63 552846 ekk-d(10)-kke 79 552847 ekk-d(10)-kke 47 552848 ekk-d(10)-kke 69 552849 ekk-d(10)-kke 59 552850 ekk-d(10)-kke 83 552851 ekk-d(10)-kke 90 552852 ekk-d(10)-kke 89 552853 ekk-d(10)-kke 83 552854 ekk-d(10)-kke 80 552855 ekk-d(10)-kke 75 552856 ekk-d(10)-kke 69 552857 ekk-d(10)-kke 68 552858 ekk-d(10)-kke 79 552859 ekk-d(10)-kke 79 552860 ekk-d(10)-kke 71 552861 ekk-d(10)-kke 68 552862 ekk-d(10)-kke 65 552863 ekk-d(10)-kke 70 552864 ekk-d(10)-kke 71 e = 2-MOE, k = cEt, d = 2-deoxynucleosic
(370) TABLE-US-00017 TABLE 16 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 % ISIS No Motif inhibition 552787 ekk-d(10)-kke 53 552788 ekk-d(10)-kke 45 552789 ekk-d(10)-kke 75 552790 ekk-d(10)-kke 68 552791 ekk-d(10)-kke 51 552792 ekk-d(10)-kke 38 552793 ekk-d(10)-kke 0 552794 ekk-d(10)-kke 44 552795 ekk-d(10)-kke 56 552796 ekk-d(10)-kke 45 552797 ekk-d(10)-kke 46 552798 ekk-d(10)-kke 53 552799 ekk-d(10)-kke 48 552800 ekk-d(10)-kke 54 552801 ekk-d(10)-kke 63 552802 ekk-d(10)-kke 49 552803 ekk-d(10)-kke 71 552804 ekk-d(10)-kke 64 552805 ekk-d(10)-kke 70 552806 ekk-d(10)-kke 67 552807 ekk-d(10)-kke 61 552808 ekk-d(10)-kke 83 552809 ekk-d(10)-kke 59 552810 ekk-d(10)-kke 56 552811 ekk-d(10)-kke 62 552812 ekk-d(10)-kke 66 552813 ekk-d(10)-kke 63 552814 ekk-d(10)-kke 65 552815 ekk-d(10)-kke 63 552816 ekk-d(10)-kke 88 552817 ekk-d(10)-kke 94 552818 ekk-d(10)-kke 82 552819 ekk-d(10)-kke 80 552820 ekk-d(10)-kke 84 552821 ekk-d(10)-kke 71 552822 ekk-d(10)-kke 85 552823 ekk-d(10)-kke 71 552824 ekk-d(10)-kke 81 552825 ekk-d(10)-kke 51 552826 ekk-d(10)-kke 64 552827 ekk-d(10)-kke 61 552828 ekk-d(10)-kke 76 552829 ekk-d(10)-kke 61 552830 ekk-d(10)-kke 59 552831 ekk-d(10)-kke 58 552832 ekk-d(10)-kke 64 552833 ekk-d(10)-kke 75 552834 ekk-d(10)-kke 84 552835 ekk-d(10)-kke 57 552836 ekk-d(10)-kke 51 552837 ekk-d(10)-kke 53 552838 ekk-d(10)-kke 48 552839 ekk-d(10)-kke 50 552840 ekk-d(10)-kke 54 552841 ekk-d(10)-kke 61 552842 ekk-d(10)-kke 71 552843 ekk-d(10)-kke 75 552844 ekk-d(10)-kke 78 552845 ekk-d(10)-kke 52 552846 ekk-d(10)-kke 76 552847 ekk-d(10)-kke 61 552848 ekk-d(10)-kke 72 552849 ekk-d(10)-kke 87 552850 ekk-d(10)-kke 76 552851 ekk-d(10)-kke 76 552852 ekk-d(10)-kke 79 552853 ekk-d(10)-kke 82 552854 ekk-d(10)-kke 85 552855 ekk-d(10)-kke 78 552856 ekk-d(10)-kke 77 552857 ekk-d(10)-kke 75 552858 ekk-d(10)-kke 75 552859 ekk-d(10)-kke 79 552860 ekk-d(10)-kke 71 552861 ekk-d(10)-kke 74 552862 ekk-d(10)-kke 66 552863 ekk-d(10)-kke 70 552864 ekk-d(10)-kke 73 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
(371) TABLE-US-00018 TABLE 17 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3371 % ISIS No Motif inhibition 146786 eeeee-d(10)-eeeee 60 552889 ek-d(10)-keke 59 552890 ek-d(10)-keke 56 552891 ek-d(10)-keke 67 552892 ek-d(10)-keke 65 552893 ek-d(10)-keke 68 552894 ek-d(10)-keke 71 552895 ek-d(10)-keke 51 552896 ek-d(10)-keke 51 552897 ek-d(10)-keke 43 552898 ek-d(10)-keke 43 552899 ek-d(10)-keke 55 552900 ek-d(10)-keke 34 552901 ek-d(10)-keke 42 552902 ek-d(10)-keke 60 552903 ek-d(10)-keke 76 552904 ek-d(10)-keke 74 552905 ek-d(10)-keke 66 552907 ek-d(10)-keke 69 552908 ek-d(10)-keke 63 552909 ek-d(10)-keke 70 552910 ek-d(10)-keke 72 552911 ek-d(10)-keke 72 552912 ek-d(10)-keke 67 552913 ek-d(10)-keke 74 552914 ek-d(10)-keke 75 552915 ek-d(10)-keke 58 552916 ek-d(10)-keke 74 552917 ek-d(10)-keke 76 552918 ek-d(10)-keke 75 552919 ek-d(10)-keke 55 552920 ek-d(10)-keke 49 552921 ek-d(10)-keke 45 552922 ek-d(10)-keke 83 552923 ek-d(10)-keke 83 552924 ek-d(10)-keke 0 552925 ek-d(10)-keke 85 552926 ek-d(10)-keke 50 552927 ek-d(10)-keke 76 552928 ek-d(10)-keke 78 552929 ek-d(10)-keke 75 552930 ek-d(10)-keke 78 552931 ek-d(10)-keke 74 552932 ek-d(10)-keke 86 552933 ek-d(10)-keke 82 552934 ek-d(10)-keke 74 552935 ek-d(10)-keke 76 552936 ek-d(10)-keke 81 552937 ek-d(10)-keke 80 552938 ek-d(10)-keke 78 552939 ek-d(10)-keke 75 552940 ek-d(10)-keke 63 552941 ekk-d(10)-kke 78 552942 ek-d(10)-keke 80 552865 ekk-d(10)-kke 67 552866 ekk-d(10)-kke 68 552868 ekk-d(10)-kke 55 552869 ekk-d(10)-kke 48 552870 ekk-d(10)-kke 55 552871 ekk-d(10)-kke 57 552872 ekk-d(10)-kke 70 552873 ekk-d(10)-kke 49 552874 ekk-d(10)-kke 42 552875 ekk-d(10)-kke 41 552876 ekk-d(10)-kke 50 552877 ek-d(10)-keke 39 552878 ekk-d(10)-kke 31 552879 ekk-d(10)-kke 5 552880 ekk-d(10)-kke 5 552881 ekk-d(10)-kke 10 552882 ekk-d(10)-kke 11 552883 ekk-d(10)-kke 27 552884 ekk-d(10)-kke 36 552885 ekk-d(10)-kke 12 552886 ekk-d(10)-kke 32 552888 ekk-d(10)-kke 1 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
(372) TABLE-US-00019 TABLE 18 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 % ISIS No Motif inhibition 146786 eeeee-d(10)-eeeee 59 552955 eee-d(10)-kkk 60 552956 eee-d(10)-kkk 60 552957 eee-d(10)-kkk 64 552958 eee-d(10)-kkk 56 552959 eee-d(10)-kkk 59 552960 eee-d(10)-kkk 42 552961 eee-d(10)-kkk 41 552962 eee-d(10)-kkk 35 552963 eee-d(10)-kkk 19 552964 eee-d(10)-kkk 34 552965 eee-d(10)-kkk 42 552966 eee-d(10)-kkk 60 552967 eee-d(10)-kkk 38 552968 eee-d(10)-kkk 35 552969 eee-d(10)-kkk 67 552970 eee-d(10)-kkk 56 552971 eee-d(10)-kkk 69 552972 eee-d(10)-kkk 75 552973 eee-d(10)-kkk 59 552974 eee-d(10)-kkk 71 552975 eee-d(10)-kkk 56 552976 eee-d(10)-kkk 50 552977 eee-d(10)-kkk 56 552978 eee-d(10)-kkk 43 552979 eee-d(10)-kkk 71 552980 eee-d(10)-kkk 80 552981 eee-d(10)-kkk 64 552982 ek-d(10)-keke 61 552983 eee-d(10)-kkk 77 552984 eee-d(10)-kkk 65 552985 eee-d(10)-kkk 41 552986 eee-d(10)-kkk 30 552987 eee-d(10)-kkk 41 552988 eee-d(10)-kkk 74 552989 eee-d(10)-kkk 85 552990 eee-d(10)-kkk 72 552991 eee-d(10)-kkk 73 552992 eee-d(10)-kkk 60 552993 eee-d(10)-kkk 52 552994 eee-d(10)-kkk 58 552995 eee-d(10)-kkk 70 552996 eee-d(10)-kkk 74 552997 eee-d(10)-kkk 59 552998 eee-d(10)-kkk 82 552999 eee-d(10)-kkk 70 553000 eee-d(10)-kkk 67 553001 eee-d(10)-kkk 67 553002 eee-d(10)-kkk 74 553003 eee-d(10)-kkk 72 553004 eee-d(10)-kkk 73 553005 eee-d(10)-kkk 67 553006 eee-d(10)-kkk 69 553007 eee-d(10)-kkk 60 553008 eee-d(10)-kkk 71 552943 ek-d(10)-keke 77 553009 eee-d(10)-kkk 78 552944 ek-d(10)-keke 74 553010 eee-d(10)-kkk 78 552945 ek-d(10)-keke 76 553011 eee-d(10)-kkk 72 552946 ek-d(10)-keke 71 553012 eee-d(10)-kkk 74 552947 ek-d(10)-keke 54 553013 eee-d(10)-kkk 39 552948 ek-d(10)-keke 50 553014 eee-d(10)-kkk 37 552949 ek-d(10)-keke 8 553015 eee-d(10)-kkk 45 552950 ek-d(10)-keke 44 553016 eee-d(10)-kkk 47 552951 ek-d(10)-keke 60 553017 eee-d(10)-kkk 47 552952 ek-d(10)-keke 35 553018 eee-d(10)-kkk 30 552953 ek-d(10)-keke 37 553019 eee-d(10)-kkk 37 552954 ek-d(10)-keke 40 553020 eee-d(10)-kkk 24 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
(373) TABLE-US-00020 TABLE 19 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 % ISIS No Motif inhibition 552889 ek-d(10)-keke 42 552890 ek-d(10)-keke 56 552891 ek-d(10)-keke 55 552892 ek-d(10)-keke 53 552893 ek-d(10)-keke 56 552894 ek-d(10)-keke 53 552895 ek-d(10)-keke 38 552896 ek-d(10)-keke 43 552897 ek-d(10)-keke 40 552898 ek-d(10)-keke 50 552899 ek-d(10)-keke 37 552900 ek-d(10)-keke 43 552901 ek-d(10)-keke 56 552902 ek-d(10)-keke 43 552903 ek-d(10)-keke 78 552904 ek-d(10)-keke 75 552905 ek-d(10)-keke 52 552907 ek-d(10)-keke 75 552908 ek-d(10)-keke 57 552909 ek-d(10)-keke 66 552910 ek-d(10)-keke 60 552911 ek-d(10)-keke 65 552912 ek-d(10)-keke 37 552913 ek-d(10)-keke 76 552914 ek-d(10)-keke 79 552915 ek-d(10)-keke 71 552916 ek-d(10)-keke 82 552917 ek-d(10)-keke 78 552918 ek-d(10)-keke 64 552919 ek-d(10)-keke 38 552920 ek-d(10)-keke 43 552921 ek-d(10)-keke 49 552922 ek-d(10)-keke 90 552923 ek-d(10)-keke 92 552924 ek-d(10)-keke 30 552925 ek-d(10)-keke 81 552926 ek-d(10)-keke 39 552927 ek-d(10)-keke 53 552928 ek-d(10)-keke 48 552929 ek-d(10)-keke 68 552930 ek-d(10)-keke 87 552931 ek-d(10)-keke 87 552932 ek-d(10)-keke 88 552933 ek-d(10)-keke 75 552934 ek-d(10)-keke 76 552935 ek-d(10)-keke 71 552936 ek-d(10)-keke 80 552937 ek-d(10)-keke 81 552938 ek-d(10)-keke 85 552939 ek-d(10)-keke 82 552940 ek-d(10)-keke 76 552941 ekk-d(10)-kke 72 552942 ek-d(10)-keke 85 552865 ekk-d(10)-kke 70 552866 ekk-d(10)-kke 65 552868 ekk-d(10)-kke 36 552869 ekk-d(10)-kke 23 552870 ekk-d(10)-kke 49 552871 ekk-d(10)-kke 46 552872 ekk-d(10)-kke 73 552873 ekk-d(10)-kke 41 552874 ekk-d(10)-kke 18 552875 ekk-d(10)-kke 0 552876 ekk-d(10)-kke 49 552877 ek-d(10)-keke 37 552878 ekk-d(10)-kke 28 552879 ekk-d(10)-kke 0 552880 ekk-d(10)-kke 12 552881 ekk-d(10)-kke 0 552882 ekk-d(10)-kke 0 552883 ekk-d(10)-kke 12 552884 ekk-d(10)-kke 39 552885 ekk-d(10)-kke 37 552886 ekk-d(10)-kke 15 552888 ekk-d(10)-kke 0 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
(374) TABLE-US-00021 TABLE 20 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3370 % ISIS No Motif inhibition 552955 eee-d(10)-kkk 67 552956 eee-d(10)-kkk 60 552957 eee-d(10)-kkk 73 552958 eee-d(10)-kkk 63 552959 eee-d(10)-kkk 58 552960 eee-d(10)-kkk 67 552961 eee-d(10)-kkk 78 552962 eee-d(10)-kkk 29 552963 eee-d(10)-kkk 25 552964 eee-d(10)-kkk 33 552965 eee-d(10)-kkk 55 552966 eee-d(10)-kkk 71 552967 eee-d(10)-kkk 23 552968 eee-d(10)-kkk 41 552969 eee-d(10)-kkk 76 552970 eee-d(10)-kkk 44 552971 eee-d(10)-kkk 77 552972 eee-d(10)-kkk 74 552973 eee-d(10)-kkk 61 552974 eee-d(10)-kkk 73 552975 eee-d(10)-kkk 66 552976 eee-d(10)-kkk 70 552977 eee-d(10)-kkk 65 552978 eee-d(10)-kkk 40 552979 eee-d(10)-kkk 79 552980 eee-d(10)-kkk 81 552981 eee-d(10)-kkk 74 552982 ek-d(10)-keke 52 552983 eee-d(10)-kkk 78 552984 eee-d(10)-kkk 71 552985 eee-d(10)-kkk 38 552986 eee-d(10)-kkk 48 552987 eee-d(10)-kkk 54 552988 eee-d(10)-kkk 85 552989 eee-d(10)-kkk 84 552990 eee-d(10)-kkk 79 552991 eee-d(10)-kkk 53 552992 eee-d(10)-kkk 68 552993 eee-d(10)-kkk 67 552994 eee-d(10)-kkk 69 552995 eee-d(10)-kkk 62 552996 eee-d(10)-kkk 82 552997 eee-d(10)-kkk 58 552998 eee-d(10)-kkk 86 552999 eee-d(10)-kkk 63 553000 eee-d(10)-kkk 67 553001 eee-d(10)-kkk 70 553002 eee-d(10)-kkk 84 553003 eee-d(10)-kkk 83 553004 eee-d(10)-kkk 68 553005 eee-d(10)-kkk 57 553006 eee-d(10)-kkk 74 553007 eee-d(10)-kkk 62 553008 eee-d(10)-kkk 50 552943 ek-d(10)-keke 86 553009 eee-d(10)-kkk 79 552944 ek-d(10)-keke 83 553010 eee-d(10)-kkk 74 552945 ek-d(10)-keke 79 553011 eee-d(10)-kkk 60 552946 ek-d(10)-keke 68 553012 eee-d(10)-kkk 78 552947 ek-d(10)-keke 51 553013 eee-d(10)-kkk 45 552948 ek-d(10)-keke 56 553014 eee-d(10)-kkk 53 552949 ek-d(10)-keke 1 553015 eee-d(10)-kkk 55 552950 ek-d(10)-keke 52 553016 eee-d(10)-kkk 65 552951 ek-d(10)-keke 59 553017 eee-d(10)-kkk 36 552952 ek-d(10)-keke 34 553018 eee-d(10)-kkk 20 552953 ek-d(10)-keke 55 553019 eee-d(10)-kkk 34 552954 ek-d(10)-keke 51 553020 eee-d(10)-kkk 28 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
Example 4
Dose-Dependent Antisense Inhibition of Target-Z mRNA in HepG2 Cells
(375) Antisense oligonucleotides from the study described in Example 46 exhibiting in vitro inhibition of Target-Z mRNA were selected and tested at various doses in HepG2 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE2000 with 9.26 nM, 27.78 nM, 83.33 nM, and 250.00 nM concentrations of antisense oligonucleotide, as specified in Table 21. After a treatment period of approximately 16 hours, RNA was isolated from the cells and Target-Z mRNA levels were measured by quantitative real-time PCR. Target-Z primer probe set RTS3371 was used to measure mRNA levels. Target-Z mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of Target-Z, relative to untreated control cells.
(376) As illustrated in Table 21, Target-Z mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
(377) TABLE-US-00022 TABLE 21 Dose-dependent antisense inhibition of human Target-Z in HepG2 cells 9.2593 27.7778 83.3333 250.0 ISIS No Motif nM nM nM nM 146786 eeeee-d(10)-eeeee 10 43 74 89 552808 ekk-d(10)-kke 13 14 55 70 552816 ekk-d(10)-kke 38 73 87 92 552818 ekk-d(10)-kke 29 63 87 85 552820 ekk-d(10)-kke 58 83 90 90 552821 ekk-d(10)-kke 33 49 71 88 552822 ekk-d(10)-kke 24 55 74 88 552824 ekk-d(10)-kke 8 24 65 87 552834 ekk-d(10)-kke 11 28 68 89 552849 ekk-d(10)-kke 12 25 73 84 552851 ekk-d(10)-kke 13 42 74 89 552852 ekk-d(10)-kke 4 35 70 87 552853 ekk-d(10)-kke 19 52 86 93 552854 ekk-d(10)-kke 28 57 80 89 552916 ek-d(10)-keke 5 26 64 82 552922 ek-d(10)-keke 25 44 77 89 552923 ek-d(10)-keke 22 49 82 91 552925 ek-d(10)-keke 33 56 80 92 552930 ek-d(10)-keke 12 49 79 89 552931 ek-d(10)-keke 12 40 62 82 552932 ek-d(10)-keke 24 62 84 91 552933 ek-d(10)-keke 20 40 75 89 552936 ek-d(10)-keke 18 36 75 88 552937 ek-d(10)-keke 22 51 82 88 552938 ek-d(10)-keke 12 36 67 80 552939 ek-d(10)-keke 17 40 65 79 552942 ek-d(10)-keke 21 48 74 88 552943 ek-d(10)-keke 5 39 70 85 552944 ek-d(10)-keke 14 33 70 77 552980 eee-d(10)-kkk 15 40 69 86 552988 eee-d(10)-kkk 4 36 58 84 552989 eee-d(10)-kkk 0 50 74 81 552996 eee-d(10)-kkk 0 25 53 72 552998 eee-d(10)-kkk 17 49 79 90 553002 eee-d(10)-kkk 0 32 68 86 553003 eee-d(10)-kkk 15 42 67 88 e = 2-MOE, k = cEt, d = 2-deoxynucleoside
Example 5
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(378) Mice harboring a Target-Z gene fragment (Guidotti, L. G. et al., J. Virol. 1995, 69, 6158-6169) were used. The mice were treated with ISIS antisense oligonucleotides selected from studies described above as illustrated in Table 22 and evaluated for their efficacy in this model.
(379) Treatment
(380) Groups of 10 mice each were injected subcutaneously twice a week for the first with 50 mg/kg and, subsequently, twice a week for the next 3 weeks with 25 mg/kg of ISIS 146786 or ISIS 510100. Control groups of 10 mice each were treated in a similar manner with ISIS 141923 (5-10-5 MOE gapmer with no known murine target) or ISIS 459024 (3-10-4 MOE gapmer with no known murine target). Mice were euthanized 48 hours after the last dose, and organs and serum were harvested for further analysis.
(381) TABLE-US-00023 TABLE22 AntisenseoligonucleotidestargetingTarget-Zintransgenicmice ISISNO. Sequence(5 to3) Motif SEQIDNO. 146786 G.sub.esT.sub.esG.sub.esA.sub.esA.sub.esG.sub.dsC.sub.dsG.sub.dsA.sub.dsA.sub.ds e5-d(10)-e5 39 G.sub.dsT.sub.dsG.sub.dsC.sub.dsA.sub.dsC.sub.esA.sub.esC.sub.esG.sub.esG.sub.es 510100 G.sub.esG.sub.es.sup.mC.sub.esA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds eee-d(10)-eeee 40 G.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.esA.sub.esT.sub.esG.sub.e 141923 .sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds e5-d(10)-e5 41 A.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.e 459024 .sup.mC.sub.esG.sub.esG.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds eee-d(10)-eeee 42 A.sub.dsG.sub.dsG.sub.dsA.sub.esT.sub.esG.sub.es.sup.mC.sub.e e = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
DNA and RNA Analysis
(382) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe sets RTS3370, RTS3371, or RTS3372 (forward sequence ATCCTATCAACACTTCCGGAAACT, designated SEQ ID NO: 43; reverse sequence CGACGCGGCGATTGAG, designated SEQ ID NO: 44; probe sequence AAGAACTCCCTCGCCTCGCAGACG, designated SEQ ID NO: 45). The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe sets RTS3370 and RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. The data is presented in Table 23. Serum DNA samples were analyzed after the study period. The data is presented in Table 24, expressed relative to the levels measured in the control group. As shown in Tables 23 and 24, the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Treatment with either control oligonucleotide did not cause any changes in RNA or DNA levels, as expected.
(383) TABLE-US-00024 TABLE 23 Percent inhibition of Target-Z RNA and DNA in the liver of transgenic mice % % % % % % inhibition inhibition inhibition inhibition inhibition inhibition DNA DNA DNA RNA RNA RNA ISIS No Motif (RTS3370) (RTS3371) (RTS3372) (RTS3370) (RTS3371) (RTS3372) 146786 e5-d(10)-e5 97 97 95 86 85 89 510100 eee-d(10)-eeee 95 94 94 56 64 77 141923 e5-d(10)-e5 2 0 13 0 7 31 459024 eee-d(10)-eeee 19 0 8 0 0 0 e = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
(384) TABLE-US-00025 TABLE 24 Percent inhibition of Target-Z DNA in the serum of transgenic mice % inhibition % inhibition ISIS No Motif (RTS3370) (RTS3371) 146786 e5-d(10)-e5 98 98 510100 eee-d(10)-eeee 99 98 141923 e5-d(10)-e5 0 0 459024 eee-d(10)-eeee 0 0 e = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
Example 6
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(385) Transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(386) Treatment
(387) A group of 6 mice was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 10 mg/kg of ISIS 552803, ISIS 552903, ISIS 552817, ISIS 552822, and ISIS 552907. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
(388) DNA and RNA Analysis
(389) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. The data is presented in Table 25. Serum DNA samples were analyzed after the study period. The data is presented in Table 26, expressed relative to the levels measured in the control group. As shown in Tables 25 and 26, the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control.
(390) TABLE-US-00026 TABLE 25 Percent inhibition of Target-Z RNA and DNA in transgenic mice % Dose % inhibition inhibition ISIS No Motif (mg/kg/wk) of RNA of DNA 146786 e5-d(10)-e5 50 81 91 552803 ekk-d(10)-kke 20 71 95 552817 ekk-d(10)-kke 20 86 51 552822 ekk-d(10)-kke 20 90 89 552903 ek-d(10)-keke 20 56 82 552907 ek-d(10)-keke 20 41 45 e = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
(391) TABLE-US-00027 TABLE 26 Serum levels of Target-Z DNA in transgenic mice, relative to control levels Dose Post-dose ISIS No Motif (mg/kg/wk) DNA levels 146786 e5-d(10)-e5 50 0.1 552803 ekk-d(10)-kke 20 0.2 552817 ekk-d(10)-kke 20 1.3 552822 ekk-d(10)-kke 20 0.0 552903 ek-d(10)-keke 20 2.9 552907 ek-d(10)-keke 20 1.0 e = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
Liver Function
(392) To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of ALT were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz N W (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, Pa., 1995). The results are presented in Table 27 expressed in IU/L. All the ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.
(393) TABLE-US-00028 TABLE 27 ALT levels (IU/L) of transgenic mice Dose Motif (mg/kg/wk) ALT PBS 77 ISIS 146786 e5-d(10)-e5 50 21 ISIS 552803 ekk-d(10)-kke 20 74 ISIS 552817 ekk-d(10)-kke 20 38 ISIS 552822 ekk-d(10)-kke 20 47 ISIS 552903 ek-d(10)-keke 20 57 ISIS 552907 ek-d(10)-keke 20 28 e = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
Example 7
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(394) Transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(395) Treatment
(396) A group of 6 mice was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 10 mg/kg of ISIS 552853, ISIS 552854, ISIS 552932, and ISIS 552938. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
(397) DNA and RNA Analysis
(398) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. As shown in Table 28, the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Results are presented as percent inhibition of Target-Z mRNA or DNA, relative to control.
(399) TABLE-US-00029 TABLE 28 Percent inhibition of Target-Z DNA and RNA in transgenic mice Dose % inhibition % inhibition Motif (mg/kg/wk) (DNA) (RNA) PBS ISIS 146786 e5-d(10)-e5 50 90 60 ISIS 552853 ekk-d(10)-kke 20 94 60 ISIS 552854 ekk-d(10)-kke 20 61 23 ISIS 552932 ekk-d(10)-kke 20 75 70 ISIS 552938 ek-d(10)-keke 20 67 56 =2-MOE (e.g. e5 = eeeee), d = 2-deoxynucloside
Example 8
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(400) Transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(401) Treatment
(402) A group of 6 mice was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 10 mg/kg of ISIS 552922, ISIS 552923, ISIS 552942, ISIS 552872, ISIS 552925, ISIS 552937, and ISIS 552939. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
(403) DNA and RNA Analysis
(404) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. As shown in Table 29, the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Results are presented as percent inhibition of Target-Z mRNA or DNA, relative to control.
(405) TABLE-US-00030 TABLE 29 Percent inhibition of Target-Z DNA and RNA in transgenic mice % % Dose inhibition inhibition ISIS No Motif (mg/kg/wk) (DNA) (RNA) 146786 e5-d(10)-e5 50 52 57 552922 ek-d(10)-keke 20 61 50 552923 ek-d(10)-keke 20 89 76 552942 ek-d(10)-keke 20 58 52 552872 ekk-d(10)-kke 20 77 46 552925 ek-d(10)-keke 20 89 65 552937 ek-d(10)-keke 20 59 35 552939 ek-d(10)-keke 20 57 19 = 2-MOE (e.g. e5 = eeeee), d = 2-deoxynucleoside
Example 9
Antisense Inhibition of Target-Z mRNA in HepG2 Cells
(406) Antisense oligonucleotides were designed targeting a Target-Z nucleic acid and were tested for their effects on Target-Z mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables. ISIS 146786, 509934, ISIS 509959, and ISIS 510100, from the studies described above, were also included. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000 with 70 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and Target-Z mRNA levels were measured by quantitative real-time PCR. Primer probe set RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 33; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 34; probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID NO: 35) was used to measure mRNA levels. Levels were also measured using primer probe set RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 36; reverse sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 37; probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO: 38). Target-Z mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of Target-Z, relative to untreated control cells.
(407) The newly designed chimeric antisense oligonucleotides and their motifs are described in Tables 30-47. The modified oligonucleotides are 16, 17 or 20 nucleotides in length, wherein the central gap segment comprises of nine or ten 2-deoxynucleosides and is flanked by wing segments on the 5 direction and the 3 direction comprising 2-O-methoxyethyl (2-MOE) modifications. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.
(408) Each gapmer listed in the Tables is targeted to the viral genomic sequence, designated herein as Target-Z. The activity of the newly designed oligonucleotides was compared with ISIS 146786, 509934, ISIS 509959, and ISIS 510100, the information of which have been placed at the top of each table.
(409) TABLE-US-00031 TABLE 30 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 50 510100 3-10-4 2-MOE 62 552276 5-9-3 2-MOE 42 552277 5-9-3 2-MOE 46 552278 5-9-3 2-MOE 31 552279 5-9-3 2-MOE 41 552280 5-9-3 2-MOE 5 552281 5-9-3 2-MOE 11 552282 5-9-3 2-MOE 20 552283 5-9-3 2-MOE 28 552230 4-9-4 2-MOE 57 552284 5-9-3 2-MOE 0 552231 4-9-4 2-MOE 29 552285 5-9-3 2-MOE 61 552232 4-9-4 2-MOE 35 552286 5-9-3 2-MOE 47 552233 4-9-4 2-MOE 38 552287 5-9-3 2-MOE 45 552234 4-9-4 2-MOE 0 552288 5-9-3 2-MOE 50 552235 4-9-4 2-MOE 0 552289 5-9-3 2-MOE 46 552236 4-9-4 2-MOE 45 552290 5-9-3 2-MOE 41 552237 4-9-4 2-MOE 44 552291 5-9-3 2-MOE 26 552239 4-9-4 2-MOE 62 552293 5-9-3 2-MOE 67 552240 4-9-4 2-MOE 61 552294 5-9-3 2-MOE 71 552241 4-9-4 2-MOE 55 552295 5-9-3 2-MOE 58 552242 4-9-4 2-MOE 60 552296 5-9-3 2-MOE 59 552243 4-9-4 2-MOE 57 552297 5-9-3 2-MOE 55 552244 4-9-4 2-MOE 33 552298 5-9-3 2-MOE 48 552245 4-9-4 2-MOE 48 552299 5-9-3 2-MOE 34 552246 4-9-4 2-MOE 81 552300 5-9-3 2-MOE 56 552247 4-9-4 2-MOE 87 552301 5-9-3 2-MOE 86 552248 4-9-4 2-MOE 72 552302 5-9-3 2-MOE 77 552249 4-9-4 2-MOE 56 552303 5-9-3 2-MOE 65 552250 4-9-4 2-MOE 52 552304 5-9-3 2-MOE 57 552251 4-9-4 2-MOE 43 552305 5-9-3 2-MOE 56 552252 4-9-4 2-MOE 62 552306 5-9-3 2-MOE 75 552253 4-9-4 2-MOE 82 552307 5-9-3 2-MOE 90 552254 4-9-4 2-MOE 74 552255 4-9-4 2-MOE 78 552256 4-9-4 2-MOE 65 552257 4-9-4 2-MOE 62 552258 4-9-4 2-MOE 72 552259 4-9-4 2-MOE 63 552260 4-9-4 2-MOE 58 552261 4-9-4 2-MOE 63 552262 4-9-4 2-MOE 50 552263 4-9-4 2-MOE 60 552264 4-9-4 2-MOE 52 552265 4-9-4 2-MOE 68 552266 4-9-4 2-MOE 62 552267 4-9-4 2-MOE 58 552268 4-9-4 2-MOE 62 552269 4-9-4 2-MOE 52 552270 4-9-4 2-MOE 54 552271 4-9-4 2-MOE 58 552272 4-9-4 2-MOE 40 552273 4-9-4 2-MOE 34 552274 4-9-4 2-MOE 34 552275 4-9-4 2-MOE 39
(410) TABLE-US-00032 TABLE 31 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 49 509959 3-10-3 2-MOE 43 510100 3-10-4 2-MOE 54 552384 2-9-5 2-MOE 29 552440 3-9-4 2-MOE 58 552385 2-9-5 2-MOE 57 552441 3-9-4 2-MOE 42 552386 2-9-5 2-MOE 53 552442 3-9-4 2-MOE 53 552387 2-9-5 2-MOE 48 552443 3-9-4 2-MOE 59 552388 2-9-5 2-MOE 40 552444 3-9-4 2-MOE 51 552389 2-9-5 2-MOE 39 552445 3-9-4 2-MOE 60 552390 2-9-5 2-MOE 52 552446 3-9-4 2-MOE 54 552391 2-9-5 2-MOE 57 552447 3-9-4 2-MOE 54 552392 2-9-5 2-MOE 0 552448 3-9-4 2-MOE 58 552393 2-9-5 2-MOE 59 552449 3-9-4 2-MOE 60 552394 2-9-5 2-MOE 53 552450 3-9-4 2-MOE 53 552395 2-9-5 2-MOE 57 552451 3-9-4 2-MOE 39 552396 2-9-5 2-MOE 62 552452 3-9-4 2-MOE 57 552238 4-9-4 2-MOE 38 552292 5-9-3 2-MOE 48 552346 6-9-2 2-MOE 0 552397 2-9-5 2-MOE 63 552453 3-9-4 2-MOE 56 552398 2-9-5 2-MOE 61 552454 3-9-4 2-MOE 48 552399 2-9-5 2-MOE 52 552400 2-9-5 2-MOE 57 552401 2-9-5 2-MOE 52 552402 2-9-5 2-MOE 54 552403 2-9-5 2-MOE 74 552404 2-9-5 2-MOE 43 552405 2-9-5 2-MOE 15 552406 2-9-5 2-MOE 37 552407 2-9-5 2-MOE 37 552408 2-9-5 2-MOE 76 552409 2-9-5 2-MOE 76 552410 2-9-5 2-MOE 63 552411 2-9-5 2-MOE 70 552412 2-9-5 2-MOE 62 552413 2-9-5 2-MOE 56 552414 2-9-5 2-MOE 63 552415 2-9-5 2-MOE 52 552416 2-9-5 2-MOE 67 552417 2-9-5 2-MOE 50 552418 2-9-5 2-MOE 79 552419 2-9-5 2-MOE 70 552420 2-9-5 2-MOE 71 552421 2-9-5 2-MOE 69 552422 2-9-5 2-MOE 68 552423 2-9-5 2-MOE 65 552424 2-9-5 2-MOE 70 552425 2-9-5 2-MOE 51 552426 2-9-5 2-MOE 40 552427 2-9-5 2-MOE 35 552428 2-9-5 2-MOE 58 552429 2-9-5 2-MOE 46 552430 2-9-5 2-MOE 53 552431 2-9-5 2-MOE 51 552432 2-9-5 2-MOE 57 552433 2-9-5 2-MOE 54 552434 2-9-5 2-MOE 44 552435 2-9-5 2-MOE 46 552436 2-9-5 2-MOE 36 552437 2-9-5 2-MOE 27 552438 2-9-5 2-MOE 27 552439 2-9-5 2-MOE 13
(411) TABLE-US-00033 TABLE 32 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 35 509959 3-10-3 2-MOE 52 552496 4-9-3 2-MOE 47 552497 4-9-3 2-MOE 57 552498 4-9-3 2-MOE 45 552499 4-9-3 2-MOE 52 552500 4-9-3 2-MOE 46 552501 4-9-3 2-MOE 44 552502 4-9-3 2-MOE 57 552503 4-9-3 2-MOE 52 552504 4-9-3 2-MOE 45 552505 4-9-3 2-MOE 56 552506 4-9-3 2-MOE 54 552507 4-9-3 2-MOE 34 552508 4-9-3 2-MOE 34 552509 4-9-3 2-MOE 48 552510 4-9-3 2-MOE 50 552455 3-9-4 2-MOE 66 552511 4-9-3 2-MOE 66 552456 3-9-4 2-MOE 64 552512 4-9-3 2-MOE 62 552457 3-9-4 2-MOE 14 552513 4-9-3 2-MOE 56 552458 3-9-4 2-MOE 59 552514 4-9-3 2-MOE 52 552459 3-9-4 2-MOE 69 552515 4-9-3 2-MOE 57 552460 3-9-4 2-MOE 0 552516 4-9-3 2-MOE 54 552461 3-9-4 2-MOE 20 552517 4-9-3 2-MOE 52 552462 3-9-4 2-MOE 46 552518 4-9-3 2-MOE 34 552463 3-9-4 2-MOE 48 552519 4-9-3 2-MOE 44 552464 3-9-4 2-MOE 81 552520 4-9-3 2-MOE 69 552465 3-9-4 2-MOE 84 552521 4-9-3 2-MOE 80 552466 3-9-4 2-MOE 75 552522 4-9-3 2-MOE 76 552467 3-9-4 2-MOE 65 552523 4-9-3 2-MOE 71 552468 3-9-4 2-MOE 53 552524 4-9-3 2-MOE 43 552469 3-9-4 2-MOE 51 552525 4-9-3 2-MOE 57 552470 3-9-4 2-MOE 46 552526 4-9-3 2-MOE 60 552471 3-9-4 2-MOE 54 552527 4-9-3 2-MOE 72 552472 3-9-4 2-MOE 78 552528 4-9-3 2-MOE 78 552473 3-9-4 2-MOE 67 552529 4-9-3 2-MOE 77 552474 3-9-4 2-MOE 79 552530 4-9-3 2-MOE 78 552475 3-9-4 2-MOE 74 552531 4-9-3 2-MOE 68 552476 3-9-4 2-MOE 52 552477 3-9-4 2-MOE 76 552478 3-9-4 2-MOE 70 552479 3-9-4 2-MOE 67 552480 3-9-4 2-MOE 68 552481 3-9-4 2-MOE 57 552482 3-9-4 2-MOE 51 552483 3-9-4 2-MOE 48 552484 3-9-4 2-MOE 58 552485 3-9-4 2-MOE 51 552486 3-9-4 2-MOE 55 552487 3-9-4 2-MOE 62 552488 3-9-4 2-MOE 51 552489 3-9-4 2-MOE 49 552490 3-9-4 2-MOE 51 552491 3-9-4 2-MOE 51 552492 3-9-4 2-MOE 38 552493 3-9-4 2-MOE 52 552494 3-9-4 2-MOE 17 552495 3-9-4 2-MOE 49
(412) TABLE-US-00034 TABLE 33 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 47 509959 3-10-3 2-MOE 38 552552 5-9-2 2-MOE 33 552553 5-9-2 2-MOE 46 552554 5-9-2 2-MOE 54 552555 5-9-2 2-MOE 50 552556 5-9-2 2-MOE 46 552557 5-9-2 2-MOE 57 552558 5-9-2 2-MOE 55 552559 5-9-2 2-MOE 66 552560 5-9-2 2-MOE 44 552561 5-9-2 2-MOE 48 552562 5-9-2 2-MOE 52 552563 5-9-2 2-MOE 45 552564 5-9-2 2-MOE 41 552565 5-9-2 2-MOE 54 552566 5-9-2 2-MOE 56 552567 5-9-2 2-MOE 71 552568 5-9-2 2-MOE 64 552569 5-9-2 2-MOE 59 552570 5-9-2 2-MOE 60 552571 5-9-2 2-MOE 55 552572 5-9-2 2-MOE 60 552573 5-9-2 2-MOE 24 552574 5-9-2 2-MOE 34 552575 5-9-2 2-MOE 36 552576 5-9-2 2-MOE 67 552577 5-9-2 2-MOE 64 552578 5-9-2 2-MOE 75 552579 5-9-2 2-MOE 75 552580 5-9-2 2-MOE 59 552581 5-9-2 2-MOE 54 552582 5-9-2 2-MOE 61 552583 5-9-2 2-MOE 69 552584 5-9-2 2-MOE 74 552585 5-9-2 2-MOE 62 552586 5-9-2 2-MOE 79 552587 5-9-2 2-MOE 71 552532 4-9-3 2-MOE 48 552588 5-9-2 2-MOE 70 552533 4-9-3 2-MOE 43 552589 5-9-2 2-MOE 59 552534 4-9-3 2-MOE 62 552590 5-9-2 2-MOE 70 552535 4-9-3 2-MOE 55 552591 5-9-2 2-MOE 51 552536 4-9-3 2-MOE 3 552592 5-9-2 2-MOE 50 552537 4-9-3 2-MOE 14 552593 5-9-2 2-MOE 46 552538 4-9-3 2-MOE 52 552594 5-9-2 2-MOE 55 552539 4-9-3 2-MOE 47 552595 5-9-2 2-MOE 60 552540 4-9-3 2-MOE 60 552596 5-9-2 2-MOE 63 552541 4-9-3 2-MOE 60 552597 5-9-2 2-MOE 61 552542 4-9-3 2-MOE 64 552598 5-9-2 2-MOE 57 552543 4-9-3 2-MOE 46 552600 5-9-2 2-MOE 59 552544 4-9-3 2-MOE 53 552602 5-9-2 2-MOE 6 552545 4-9-3 2-MOE 33 552604 5-9-2 2-MOE 47 552546 4-9-3 2-MOE 42 552606 5-9-2 2-MOE 53 552547 4-9-3 2-MOE 51 552608 5-9-2 2-MOE 53 552548 4-9-3 2-MOE 52 552610 5-9-2 2-MOE 47 552549 4-9-3 2-MOE 38 552612 5-9-2 2-MOE 39 552550 4-9-3 2-MOE 19 552614 5-9-2 2-MOE 24 552551 4-9-3 2-MOE 24 552616 5-9-2 2-MOE 15
(413) TABLE-US-00035 TABLE 34 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 ISIS No Motif Wing chemistry % inhibition 146786 5-10-5 2-MOE 51 509934 5-10-5 2-MOE 76 552007 6-10-4 2-MOE 61 552039 7-10-3 2-MOE 84 552008 6-10-4 2-MOE 48 552040 7-10-3 2-MOE 48 552009 6-10-4 2-MOE 77 552041 7-10-3 2-MOE 73 552010 6-10-4 2-MOE 63 552042 7-10-3 2-MOE 66 552011 6-10-4 2-MOE 52 552043 7-10-3 2-MOE 54 552012 6-10-4 2-MOE 73 552044 7-10-3 2-MOE 86 552013 6-10-4 2-MOE 73 552045 7-10-3 2-MOE 65 552014 6-10-4 2-MOE 76 552046 7-10-3 2-MOE 93 552015 6-10-4 2-MOE 70 552047 7-10-3 2-MOE 77 552016 6-10-4 2-MOE 61 552048 7-10-3 2-MOE 66 552017 6-10-4 2-MOE 73 552049 7-10-3 2-MOE 73 552018 6-10-4 2-MOE 98 552050 7-10-3 2-MOE 98 552019 6-10-4 2-MOE 98 552051 7-10-3 2-MOE 99 551986 4-10-6 2-MOE 92 552020 6-10-4 2-MOE 97 552052 7-10-3 2-MOE 98 551987 4-10-6 2-MOE 95 552021 6-10-4 2-MOE 97 552053 7-10-3 2-MOE 98 551988 4-10-6 2-MOE 50 552005 5-10-5 2-MOE 99 552022 6-10-4 2-MOE 99 552054 7-10-3 2-MOE 99 551989 4-10-6 2-MOE 96 552023 6-10-4 2-MOE 99 552055 7-10-3 2-MOE 98 551990 4-10-6 2-MOE 86 552024 6-10-4 2-MOE 89 552056 7-10-3 2-MOE 88 551991 4-10-6 2-MOE 0 552025 6-10-4 2-MOE 90 552057 7-10-3 2-MOE 92 551992 4-10-6 2-MOE 72 552026 6-10-4 2-MOE 88 552058 7-10-3 2-MOE 86 551993 4-10-6 2-MOE 82 552027 6-10-4 2-MOE 87 552059 7-10-3 2-MOE 88 551994 4-10-6 2-MOE 85 552028 6-10-4 2-MOE 83 552060 7-10-3 2-MOE 82 551995 4-10-6 2-MOE 84 552029 6-10-4 2-MOE 88 552061 7-10-3 2-MOE 85 551996 4-10-6 2-MOE 87 552030 6-10-4 2-MOE 88 552062 7-10-3 2-MOE 85 551997 4-10-6 2-MOE 83 552031 6-10-4 2-MOE 82 551998 4-10-6 2-MOE 85 552032 6-10-4 2-MOE 87 551999 4-10-6 2-MOE 82 552033 6-10-4 2-MOE 87 552000 4-10-6 2-MOE 83 552006 5-10-5 2-MOE 88 552034 6-10-4 2-MOE 89 552001 4-10-6 2-MOE 65 552035 6-10-4 2-MOE 60 552002 4-10-6 2-MOE 63 552036 6-10-4 2-MOE 65 552003 4-10-6 2-MOE 65 552037 6-10-4 2-MOE 58 552004 4-10-6 2-MOE 58 552038 6-10-4 2-MOE 70
(414) TABLE-US-00036 TABLE 35 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 64 510100 3-10-4 2-MOE 62 552168 3-9-5 2-MOE 79 552222 4-9-4 2-MOE 79 552169 3-9-5 2-MOE 67 552223 4-9-4 2-MOE 40 552170 3-9-5 2-MOE 69 552224 4-9-4 2-MOE 64 552171 3-9-5 2-MOE 65 552225 4-9-4 2-MOE 69 552172 3-9-5 2-MOE 33 552226 4-9-4 2-MOE 48 552173 3-9-5 2-MOE 41 552227 4-9-4 2-MOE 32 552174 3-9-5 2-MOE 31 552228 4-9-4 2-MOE 42 552175 3-9-5 2-MOE 59 552176 3-9-5 2-MOE 68 552177 3-9-5 2-MOE 55 552178 3-9-5 2-MOE 66 552179 3-9-5 2-MOE 70 552180 3-9-5 2-MOE 66 552181 3-9-5 2-MOE 51 552182 3-9-5 2-MOE 69 552183 3-9-5 2-MOE 69 552184 3-9-5 2-MOE 43 552185 3-9-5 2-MOE 66 552186 3-9-5 2-MOE 54 552187 3-9-5 2-MOE 74 552188 3-9-5 2-MOE 78 552189 3-9-5 2-MOE 57 552190 3-9-5 2-MOE 39 552191 3-9-5 2-MOE 60 552192 3-9-5 2-MOE 85 552193 3-9-5 2-MOE 86 552194 3-9-5 2-MOE 68 552195 3-9-5 2-MOE 73 552196 3-9-5 2-MOE 60 552197 3-9-5 2-MOE 60 552198 3-9-5 2-MOE 61 552199 3-9-5 2-MOE 89 552200 3-9-5 2-MOE 85 552201 3-9-5 2-MOE 81 552202 3-9-5 2-MOE 76 552203 3-9-5 2-MOE 74 552204 3-9-5 2-MOE 71 552151 2-9-6 2-MOE 77 552205 3-9-5 2-MOE 78 552152 2-9-6 2-MOE 72 552206 3-9-5 2-MOE 77 552153 2-9-6 2-MOE 67 552207 3-9-5 2-MOE 81 552154 2-9-6 2-MOE 56 552208 3-9-5 2-MOE 70 552155 2-9-6 2-MOE 61 552209 3-9-5 2-MOE 63 552156 2-9-6 2-MOE 20 552210 3-9-5 2-MOE 75 552157 2-9-6 2-MOE 39 552211 3-9-5 2-MOE 75 552158 2-9-6 2-MOE 70 552212 3-9-5 2-MOE 67 552159 2-9-6 2-MOE 74 552213 3-9-5 2-MOE 70 552160 2-9-6 2-MOE 78 552214 3-9-5 2-MOE 79 552161 2-9-6 2-MOE 56 552215 3-9-5 2-MOE 61 552162 2-9-6 2-MOE 64 552216 3-9-5 2-MOE 62 552163 2-9-6 2-MOE 71 552217 3-9-5 2-MOE 58 552164 2-9-6 2-MOE 52 552218 3-9-5 2-MOE 56 552165 2-9-6 2-MOE 53 552219 3-9-5 2-MOE 33 552166 2-9-6 2-MOE 41 552220 3-9-5 2-MOE 53 552167 2-9-6 2-MOE 54 552221 3-9-5 2-MOE 31
(415) TABLE-US-00037 TABLE 36 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 73 509934 5-10-5 2-MOE 76 510100 3-10-4 2-MOE 73 552071 8-10-2 2-MOE 79 552114 2-9-6 2-MOE 66 552115 2-9-6 2-MOE 70 552116 2-9-6 2-MOE 68 552117 2-9-6 2-MOE 70 552072 8-10-2 2-MOE 50 552118 2-9-6 2-MOE 66 552119 2-9-6 2-MOE 62 552120 2-9-6 2-MOE 35 552121 2-9-6 2-MOE 39 552073 8-10-2 2-MOE 80 552122 2-9-6 2-MOE 55 552074 8-10-2 2-MOE 73 552123 2-9-6 2-MOE 75 552075 8-10-2 2-MOE 78 552124 2-9-6 2-MOE 64 552076 8-10-2 2-MOE 70 552125 2-9-6 2-MOE 73 552077 8-10-2 2-MOE 83 552126 2-9-6 2-MOE 64 552078 8-10-2 2-MOE 80 552127 2-9-6 2-MOE 72 552079 8-10-2 2-MOE 86 552128 2-9-6 2-MOE 76 552080 8-10-2 2-MOE 83 552129 2-9-6 2-MOE 72 552131 2-9-6 2-MOE 61 552132 2-9-6 2-MOE 73 552133 2-9-6 2-MOE 75 552081 8-10-2 2-MOE 76 552134 2-9-6 2-MOE 58 552135 2-9-6 2-MOE 67 552136 2-9-6 2-MOE 65 552137 2-9-6 2-MOE 55 552082 8-10-2 2-MOE 98 552138 2-9-6 2-MOE 82 552083 8-10-2 2-MOE 99 552139 2-9-6 2-MOE 86 552084 8-10-2 2-MOE 99 552140 2-9-6 2-MOE 74 552085 8-10-2 2-MOE 100 552141 2-9-6 2-MOE 67 552086 8-10-2 2-MOE 100 552142 2-9-6 2-MOE 45 552087 8-10-2 2-MOE 100 552143 2-9-6 2-MOE 68 552144 2-9-6 2-MOE 78 552145 2-9-6 2-MOE 88 552146 2-9-6 2-MOE 81 552088 8-10-2 2-MOE 95 552147 2-9-6 2-MOE 88 552089 8-10-2 2-MOE 93 552148 2-9-6 2-MOE 79 552090 8-10-2 2-MOE 87 552149 2-9-6 2-MOE 81 552091 8-10-2 2-MOE 88 552092 8-10-2 2-MOE 90 552093 8-10-2 2-MOE 91 552094 8-10-2 2-MOE 88 552063 7-10-3 2-MOE 81 552095 8-10-2 2-MOE 89 552064 7-10-3 2-MOE 85 552096 8-10-2 2-MOE 92 552065 7-10-3 2-MOE 86 552097 8-10-2 2-MOE 93 552066 7-10-3 2-MOE 33 552098 8-10-2 2-MOE 88 552067 7-10-3 2-MOE 50 552099 8-10-2 2-MOE 70 552068 7-10-3 2-MOE 73 552100 8-10-2 2-MOE 70 552069 7-10-3 2-MOE 73 552101 8-10-2 2-MOE 76 552070 7-10-3 2-MOE 71 552102 8-10-2 2-MOE 64
(416) TABLE-US-00038 TABLE 37 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 84 510100 3-1-4 2-MOE 76 552330 6-9-2 2-MOE 54 552331 6-9-2 2-MOE 66 552332 6-9-2 2-MOE 70 552333 6-9-2 2-MOE 55 552334 6-9-2 2-MOE 42 552335 6-9-2 2-MOE 39 552336 6-9-2 2-MOE 27 552337 6-9-2 2-MOE 74 552338 6-9-2 2-MOE 68 552339 6-9-2 2-MOE 71 552340 6-9-2 2-MOE 61 552341 6-9-2 2-MOE 58 552342 6-9-2 2-MOE 55 552343 6-9-2 2-MOE 63 552344 6-9-2 2-MOE 51 552345 6-9-2 2-MOE 65 552346 6-9-2 2-MOE 0 552347 6-9-2 2-MOE 84 552348 6-9-2 2-MOE 87 552349 6-9-2 2-MOE 74 552350 6-9-2 2-MOE 59 552351 6-9-2 2-MOE 60 552352 6-9-2 2-MOE 53 552353 6-9-2 2-MOE 0 552354 6-9-2 2-MOE 83 552355 6-9-2 2-MOE 90 552356 6-9-2 2-MOE 0 552357 6-9-2 2-MOE 45 552358 6-9-2 2-MOE 74 552359 6-9-2 2-MOE 72 552360 6-9-2 2-MOE 87 552361 6-9-2 2-MOE 96 552308 5-9-3 2-MOE 81 552362 6-9-2 2-MOE 92 552309 5-9-3 2-MOE 77 552363 6-9-2 2-MOE 92 552310 5-9-3 2-MOE 80 552364 6-9-2 2-MOE 87 552311 5-9-3 2-MOE 13 552365 6-9-2 2-MOE 84 552150 2-9-6 2-MOE 73 552312 5-9-3 2-MOE 77 552366 6-9-2 2-MOE 87 552313 5-9-3 2-MOE 64 552367 6-9-2 2-MOE 85 552314 5-9-3 2-MOE 73 552368 6-9-2 2-MOE 77 552315 5-9-3 2-MOE 75 552369 6-9-2 2-MOE 75 552316 5-9-3 2-MOE 64 552370 6-9-2 2-MOE 63 552317 5-9-3 2-MOE 99 552371 6-9-2 2-MOE 81 552318 5-9-3 2-MOE 76 552372 6-9-2 2-MOE 65 552319 5-9-3 2-MOE 55 552373 6-9-2 2-MOE 74 552320 5-9-3 2-MOE 68 552374 6-9-2 2-MOE 78 552321 5-9-3 2-MOE 74 552375 6-9-2 2-MOE 81 552322 5-9-3 2-MOE 73 552376 6-9-2 2-MOE 78 552323 5-9-3 2-MOE 75 552377 6-9-2 2-MOE 70 552324 5-9-3 2-MOE 0 552378 6-9-2 2-MOE 72 552325 5-9-3 2-MOE 70 552379 6-9-2 2-MOE 74 552326 5-9-3 2-MOE 63 552380 6-9-2 2-MOE 53 552327 5-9-3 2-MOE 30 552381 6-9-2 2-MOE 26 552328 5-9-3 2-MOE 25 552382 6-9-2 2-MOE 13 552329 5-9-3 2-MOE 33 552383 6-9-2 2-MOE 5
(417) TABLE-US-00039 TABLE 38 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3370 Wing % ISIS No Motif chemistry inhibition 509934 5-10-5 2-MOE 30 551909 2-10-8 2-MOE 62 551941 3-10-7 2-MOE 74 551973 4-10-6 2-MOE 64 551910 2-10-8 2-MOE 52 551942 3-10-7 2-MOE 54 551974 4-10-6 2-MOE 51 551911 2-10-8 2-MOE 58 551943 3-10-7 2-MOE 64 551975 4-10-6 2-MOE 57 551912 2-10-8 2-MOE 59 551944 3-10-7 2-MOE 66 551976 4-10-6 2-MOE 57 551913 2-10-8 2-MOE 58 551945 3-10-7 2-MOE 56 551977 4-10-6 2-MOE 56 551914 2-10-8 2-MOE 0 551946 3-10-7 2-MOE 48 551978 4-10-6 2-MOE 53 551915 2-10-8 2-MOE 44 551947 3-10-7 2-MOE 53 551979 4-10-6 2-MOE 64 551916 2-10-8 2-MOE 57 551948 3-10-7 2-MOE 68 551980 4-10-6 2-MOE 56 551917 2-10-8 2-MOE 58 551949 3-10-7 2-MOE 64 551981 4-10-6 2-MOE 63 551918 2-10-8 2-MOE 59 551950 3-10-7 2-MOE 71 551982 4-10-6 2-MOE 63 551919 2-10-8 2-MOE 76 551951 3-10-7 2-MOE 71 551983 4-10-6 2-MOE 73 551920 2-10-8 2-MOE 68 551952 3-10-7 2-MOE 76 551984 4-10-6 2-MOE 81 551921 2-10-8 2-MOE 83 551953 3-10-7 2-MOE 82 551985 4-10-6 2-MOE 76 551922 2-10-8 2-MOE 73 551954 3-10-7 2-MOE 68 551923 2-10-8 2-MOE 59 551955 3-10-7 2-MOE 71 551924 2-10-8 2-MOE 80 551956 3-10-7 2-MOE 80 551925 2-10-8 2-MOE 82 551957 3-10-7 2-MOE 88 551926 2-10-8 2-MOE 71 551958 3-10-7 2-MOE 74 551927 2-10-8 2-MOE 68 551959 3-10-7 2-MOE 69 551928 2-10-8 2-MOE 69 551960 3-10-7 2-MOE 62 551929 2-10-8 2-MOE 54 551961 3-10-7 2-MOE 20 551930 2-10-8 2-MOE 53 551962 3-10-7 2-MOE 60 551931 2-10-8 2-MOE 47 551963 3-10-7 2-MOE 63 551932 2-10-8 2-MOE 68 551964 3-10-7 2-MOE 56 551933 2-10-8 2-MOE 72 551965 3-10-7 2-MOE 67 551934 2-10-8 2-MOE 64 551966 3-10-7 2-MOE 73 551935 2-10-8 2-MOE 68 551967 3-10-7 2-MOE 60 551936 2-10-8 2-MOE 67 551968 3-10-7 2-MOE 63 551937 2-10-8 2-MOE 47 551969 3-10-7 2-MOE 36 551938 2-10-8 2-MOE 41 551970 3-10-7 2-MOE 43 551939 2-10-8 2-MOE 53 551971 3-10-7 2-MOE 55 551940 2-10-8 2-MOE 50 551972 3-10-7 2-MOE 58
(418) TABLE-US-00040 TABLE 39 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 Wing % ISIS No Motif chemistry inhibition 509934 5-10-5 2-MOE 21 551909 2-10-8 2-MOE 52 551941 3-10-7 2-MOE 62 551973 4-10-6 2-MOE 58 551910 2-10-8 2-MOE 48 551942 3-10-7 2-MOE 36 551974 4-10-6 2-MOE 45 551911 2-10-8 2-MOE 61 551943 3-10-7 2-MOE 56 551975 4-10-6 2-MOE 60 551912 2-10-8 2-MOE 53 551944 3-10-7 2-MOE 48 551976 4-10-6 2-MOE 48 551913 2-10-8 2-MOE 53 551945 3-10-7 2-MOE 54 551977 4-10-6 2-MOE 48 551914 2-10-8 2-MOE 0 551946 3-10-7 2-MOE 56 551978 4-10-6 2-MOE 36 551915 2-10-8 2-MOE 47 551947 3-10-7 2-MOE 45 551979 4-10-6 2-MOE 54 551916 2-10-8 2-MOE 44 551948 3-10-7 2-MOE 59 551980 4-10-6 2-MOE 49 551917 2-10-8 2-MOE 48 551949 3-10-7 2-MOE 60 551981 4-10-6 2-MOE 57 551918 2-10-8 2-MOE 53 551950 3-10-7 2-MOE 57 551982 4-10-6 2-MOE 57 551919 2-10-8 2-MOE 65 551951 3-10-7 2-MOE 57 551983 4-10-6 2-MOE 53 551920 2-10-8 2-MOE 57 551952 3-10-7 2-MOE 67 551984 4-10-6 2-MOE 62 551921 2-10-8 2-MOE 60 551953 3-10-7 2-MOE 57 551985 4-10-6 2-MOE 58 551922 2-10-8 2-MOE 63 551954 3-10-7 2-MOE 61 551923 2-10-8 2-MOE 50 551955 3-10-7 2-MOE 44 551924 2-10-8 2-MOE 52 551956 3-10-7 2-MOE 46 551925 2-10-8 2-MOE 54 551957 3-10-7 2-MOE 51 551926 2-10-8 2-MOE 70 551958 3-10-7 2-MOE 72 551927 2-10-8 2-MOE 60 551959 3-10-7 2-MOE 61 551928 2-10-8 2-MOE 57 551960 3-10-7 2-MOE 58 551929 2-10-8 2-MOE 49 551961 3-10-7 2-MOE 26 551930 2-10-8 2-MOE 54 551962 3-10-7 2-MOE 57 551931 2-10-8 2-MOE 46 551963 3-10-7 2-MOE 56 551932 2-10-8 2-MOE 57 551964 3-10-7 2-MOE 53 551933 2-10-8 2-MOE 65 551965 3-10-7 2-MOE 54 551934 2-10-8 2-MOE 58 551966 3-10-7 2-MOE 69 551935 2-10-8 2-MOE 63 551967 3-10-7 2-MOE 53 551936 2-10-8 2-MOE 67 551968 3-10-7 2-MOE 60 551937 2-10-8 2-MOE 51 551969 3-10-7 2-MOE 42 551938 2-10-8 2-MOE 40 551970 3-10-7 2-MOE 38 551939 2-10-8 2-MOE 32 551971 3-10-7 2-MOE 46 551940 2-10-8 2-MOE 39 551972 3-10-7 2-MOE 51
(419) TABLE-US-00041 TABLE 40 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 40 510100 3-10-4 2-MOE 60 552276 5-9-3 2-MOE 44 552277 5-9-3 2-MOE 39 552278 5-9-3 2-MOE 37 552279 5-9-3 2-MOE 50 552280 5-9-3 2-MOE 2 552281 5-9-3 2-MOE 0 552282 5-9-3 2-MOE 13 552229 4-9-4 2-MOE 17 552283 5-9-3 2-MOE 27 552230 4-9-4 2-MOE 53 552284 5-9-3 2-MOE 0 552231 4-9-4 2-MOE 31 552285 5-9-3 2-MOE 56 552232 4-9-4 2-MOE 35 552286 5-9-3 2-MOE 43 552233 4-9-4 2-MOE 40 552287 5-9-3 2-MOE 44 552234 4-9-4 2-MOE 0 552288 5-9-3 2-MOE 44 552235 4-9-4 2-MOE 13 552289 5-9-3 2-MOE 21 552236 4-9-4 2-MOE 40 552290 5-9-3 2-MOE 34 552237 4-9-4 2-MOE 37 552291 5-9-3 2-MOE 34 552239 4-9-4 2-MOE 58 552293 5-9-3 2-MOE 61 552240 4-9-4 2-MOE 54 552294 5-9-3 2-MOE 62 552241 4-9-4 2-MOE 47 552295 5-9-3 2-MOE 63 552242 4-9-4 2-MOE 61 552296 5-9-3 2-MOE 61 552243 4-9-4 2-MOE 55 552297 5-9-3 2-MOE 52 552244 4-9-4 2-MOE 45 552298 5-9-3 2-MOE 27 552245 4-9-4 2-MOE 41 552299 5-9-3 2-MOE 32 552246 4-9-4 2-MOE 67 552300 5-9-3 2-MOE 57 552247 4-9-4 2-MOE 74 552301 5-9-3 2-MOE 76 552248 4-9-4 2-MOE 65 552302 5-9-3 2-MOE 68 552249 4-9-4 2-MOE 38 552303 5-9-3 2-MOE 59 552250 4-9-4 2-MOE 43 552304 5-9-3 2-MOE 30 552251 4-9-4 2-MOE 52 552305 5-9-3 2-MOE 49 552252 4-9-4 2-MOE 51 552306 5-9-3 2-MOE 56 552253 4-9-4 2-MOE 47 552307 5-9-3 2-MOE 49 552254 4-9-4 2-MOE 50 552255 4-9-4 2-MOE 64 552256 4-9-4 2-MOE 57 552257 4-9-4 2-MOE 51 552258 4-9-4 2-MOE 62 552259 4-9-4 2-MOE 59 552260 4-9-4 2-MOE 56 552261 4-9-4 2-MOE 54 552262 4-9-4 2-MOE 47 552263 4-9-4 2-MOE 45 552264 4-9-4 2-MOE 52 552265 4-9-4 2-MOE 58 552266 4-9-4 2-MOE 54 552267 4-9-4 2-MOE 43 552268 4-9-4 2-MOE 57 552269 4-9-4 2-MOE 34 552270 4-9-4 2-MOE 37 552271 4-9-4 2-M0E 42 552272 4-9-4 2-M0E 36 552273 4-9-4 2-M0E 25 552274 4-9-4 2-M0E 11 552275 4-9-4 2-M0E 38
(420) TABLE-US-00042 TABLE 41 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 38 509959 3-10-3 2-MOE 49 510100 3-10-4 2-MOE 55 552384 2-9-5 2-MOE 41 552440 3-9-4 2-MOE 57 552385 2-9-5 2-MOE 53 552441 3-9-4 2-MOE 38 552386 2-9-5 2-MOE 42 552442 3-9-4 2-MOE 72 552387 2-9-5 2-MOE 43 552443 3-9-4 2-MOE 56 552388 2-9-5 2-MOE 18 552444 3-9-4 2-MOE 39 552389 2-9-5 2-MOE 24 552445 3-9-4 2-MOE 53 552390 2-9-5 2-MOE 40 552446 3-9-4 2-MOE 57 552391 2-9-5 2-MOE 51 552447 3-9-4 2-MOE 53 552392 2-9-5 2-MOE 0 552448 3-9-4 2-MOE 57 552393 2-9-5 2-MOE 52 552449 3-9-4 2-MOE 49 552394 2-9-5 2-MOE 32 552450 3-9-4 2-MOE 44 552395 2-9-5 2-MOE 33 552451 3-9-4 2-MOE 38 552396 2-9-5 2-MOE 46 552452 3-9-4 2-MOE 30 552130 2-9-6 2-MOE 46 552184 3-9-5 2-MOE 34 552238 4-9-4 2-MOE 41 552292 5-9-3 2-MOE 45 552346 6-9-2 2-MOE 0 552397 2-9-5 2-MOE 37 552453 3-9-4 2-MOE 45 552398 2-9-5 2-MOE 42 552454 3-9-4 2-MOE 39 552399 2-9-5 2-MOE 34 552400 2-9-5 2-MOE 47 552401 2-9-5 2-MOE 53 552402 2-9-5 2-MOE 47 552403 2-9-5 2-MOE 70 552404 2-9-5 2-MOE 44 552405 2-9-5 2-MOE 0 552406 2-9-5 2-MOE 25 552407 2-9-5 2-MOE 23 552408 2-9-5 2-MOE 73 552409 2-9-5 2-MOE 71 552410 2-9-5 2-MOE 52 552411 2-9-5 2-MOE 62 552412 2-9-5 2-MOE 50 552413 2-9-5 2-MOE 55 552414 2-9-5 2-MOE 64 552415 2-9-5 2-MOE 45 552416 2-9-5 2-MOE 45 552417 2-9-5 2-MOE 37 552418 2-9-5 2-MOE 73 552419 2-9-5 2-MOE 68 552420 2-9-5 2-MOE 64 552421 2-9-5 2-MOE 54 552422 2-9-5 2-MOE 60 552423 2-9-5 2-MOE 62 552424 2-9-5 2-MOE 60 552425 2-9-5 2-MOE 46 552426 2-9-5 2-MOE 48 552427 2-9-5 2-MOE 36 552428 2-9-5 2-MOE 57 552429 2-9-5 2-MOE 36 552430 2-9-5 2-MOE 42 552431 2-9-5 2-MOE 60 552432 2-9-5 2-MOE 44 552433 2-9-5 2-MOE 55 552434 2-9-5 2-MOE 46 552435 2-9-5 2-MOE 47 552436 2-9-5 2-MOE 25 552437 2-9-5 2-MOE 19 552438 2-9-5 2-MOE 25 552439 2-9-5 2-MOE 22
(421) TABLE-US-00043 TABLE 42 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 Wing % ISIS No Motif chemistry inhibition 509959 3-10-3 2-MOE 49 552496 4-9-3 2-MOE 35 552497 4-9-3 2-MOE 60 552498 4-9-3 2-MOE 20 552499 4-9-3 2-MOE 45 552500 4-9-3 2-MOE 53 552501 4-9-3 2-MOE 56 552502 4-9-3 2-MOE 50 552503 4-9-3 2-MOE 36 552504 4-9-3 2-MOE 50 552505 4-9-3 2-MOE 53 552506 4-9-3 2-MOE 49 552507 4-9-3 2-MOE 35 552508 4-9-3 2-MOE 62 552509 4-9-3 2-MOE 65 552510 4-9-3 2-MOE 54 552455 3-9-4 2-MOE 60 552511 4-9-3 2-MOE 65 552456 3-9-4 2-MOE 69 552512 4-9-3 2-MOE 63 552457 3-9-4 2-MOE 4 552513 4-9-3 2-MOE 50 552458 3-9-4 2-MOE 59 552514 4-9-3 2-MOE 53 552459 3-9-4 2-MOE 69 552515 4-9-3 2-MOE 68 552460 3-9-4 2-MOE 3 552516 4-9-3 2-MOE 65 552461 3-9-4 2-MOE 37 552517 4-9-3 2-MOE 54 552462 3-9-4 2-MOE 42 552518 4-9-3 2-MOE 23 552463 3-9-4 2-MOE 28 552519 4-9-3 2-MOE 32 552464 3-9-4 2-MOE 72 552520 4-9-3 2-MOE 61 552465 3-9-4 2-MOE 68 552521 4-9-3 2-MOE 68 552466 3-9-4 2-MOE 76 552522 4-9-3 2-MOE 71 552467 3-9-4 2-MOE 72 552523 4-9-3 2-MOE 73 552468 3-9-4 2-MOE 50 552524 4-9-3 2-MOE 49 552469 3-9-4 2-MOE 65 552525 4-9-3 2-MOE 45 552470 3-9-4 2-MOE 58 552526 4-9-3 2-MOE 39 552471 3-9-4 2-MOE 30 552527 4-9-3 2-MOE 39 552472 3-9-4 2-MOE 43 552528 4-9-3 2-MOE 43 552473 3-9-4 2-MOE 25 552529 4-9-3 2-MOE 50 552474 3-9-4 2-MOE 70 552530 4-9-3 2-MOE 73 552475 3-9-4 2-MOE 64 552531 4-9-3 2-MOE 62 552476 3-9-4 2-MOE 50 552477 3-9-4 2-MOE 66 552478 3-9-4 2-MOE 68 552479 3-9-4 2-MOE 60 552480 3-9-4 2-MOE 58 552481 3-9-4 2-MOE 54 552482 3-9-4 2-MOE 44 552483 3-9-4 2-MOE 17 552484 3-9-4 2-MOE 64 552485 3-9-4 2-MOE 56 552486 3-9-4 2-MOE 26 552487 3-9-4 2-MOE 42 552488 3-9-4 2-MOE 35 552489 3-9-4 2-MOE 46 552490 3-9-4 2-MOE 41 552491 3-9-4 2-MOE 38 552492 3-9-4 2-MOE 47 552493 3-9-4 2-MOE 49 552494 3-9-4 2-MOE 22 552495 3-9-4 2-MOE 0
(422) TABLE-US-00044 TABLE 43 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 56 509959 3-10-3 2-MOE 54 552552 5-9-2 2-MOE 32 552553 5-9-2 2-MOE 53 552554 5-9-2 2-MOE 48 552555 5-9-2 2-MOE 39 552556 5-9-2 2-MOE 39 552557 5-9-2 2-MOE 54 552558 5-9-2 2-MOE 41 552559 5-9-2 2-MOE 56 552560 5-9-2 2-MOE 39 552561 5-9-2 2-MOE 51 552562 5-9-2 2-MOE 56 552563 5-9-2 2-MOE 31 552564 5-9-2 2-MOE 31 552565 5-9-2 2-MOE 53 552566 5-9-2 2-MOE 46 552567 5-9-2 2-MOE 63 552568 5-9-2 2-MOE 66 552569 5-9-2 2-MOE 60 552570 5-9-2 2-MOE 60 552571 5-9-2 2-MOE 44 552572 5-9-2 2-MOE 52 552573 5-9-2 2-MOE 20 552574 5-9-2 2-MOE 36 552575 5-9-2 2-MOE 19 552576 5-9-2 2-MOE 61 552577 5-9-2 2-MOE 57 552578 5-9-2 2-MOE 71 552579 5-9-2 2-MOE 59 552580 5-9-2 2-MOE 58 552581 5-9-2 2-MOE 51 552582 5-9-2 2-MOE 40 552583 5-9-2 2-MOE 35 552584 5-9-2 2-MOE 50 552585 5-9-2 2-MOE 48 552586 5-9-2 2-MOE 74 552587 5-9-2 2-MOE 68 552532 4-9-3 2-MOE 59 552588 5-9-2 2-MOE 67 552533 4-9-3 2-MOE 52 552589 5-9-2 2-MOE 47 552534 4-9-3 2-MOE 71 552590 5-9-2 2-MOE 58 552535 4-9-3 2-MOE 59 552591 5-9-2 2-MOE 46 552536 4-9-3 2-MOE 19 552592 5-9-2 2-MOE 44 552537 4-9-3 2-MOE 26 552593 5-9-2 2-MOE 39 552538 4-9-3 2-MOE 54 552594 5-9-2 2-MOE 52 552539 4-9-3 2-MOE 50 552595 5-9-2 2-MOE 57 552540 4-9-3 2-MOE 60 552596 5-9-2 2-MOE 58 552541 4-9-3 2-MOE 68 552597 5-9-2 2-MOE 52 552542 4-9-3 2-MOE 63 552598 5-9-2 2-MOE 51 552543 4-9-3 2-MOE 44 552600 5-9-2 2-MOE 51 552544 4-9-3 2-MOE 45 552602 5-9-2 2-MOE 13 552545 4-9-3 2-MOE 42 552604 5-9-2 2-MOE 42 552546 4-9-3 2-MOE 46 552606 5-9-2 2-MOE 42 552547 4-9-3 2-MOE 38 552608 5-9-2 2-MOE 37 552548 4-9-3 2-MOE 49 552610 5-9-2 2-MOE 41 552549 4-9-3 2-MOE 34 552612 5-9-2 2-MOE 23 552550 4-9-3 2-MOE 13 552614 5-9-2 2-MOE 11 552551 4-9-3 2-MOE 8 552616 5-9-2 2-MOE 6
(423) TABLE-US-00045 TABLE 44 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 47 509934 5-10-5 2-MOE 67 552007 6-10-4 2-MOE 53 552039 7-10-3 2-MOE 74 552008 6-10-4 2-MOE 47 552040 7-10-3 2-MOE 57 552009 6-10-4 2-MOE 70 552041 7-10-3 2-MOE 65 552010 6-10-4 2-MOE 51 552042 7-10-3 2-MOE 59 552011 6-10-4 2-MOE 47 552043 7-10-3 2-MOE 36 552012 6-10-4 2-MOE 62 552044 7-10-3 2-MOE 82 552013 6-10-4 2-MOE 72 552045 7-10-3 2-MOE 62 552014 6-10-4 2-MOE 73 552046 7-10-3 2-MOE 74 552015 6-10-4 2-MOE 66 552047 7-10-3 2-MOE 60 552016 6-10-4 2-MOE 67 552048 7-10-3 2-MOE 60 552017 6-10-4 2-MOE 72 552049 7-10-3 2-MOE 68 552018 6-10-4 2-MOE 89 552050 7-10-3 2-MOE 86 552019 6-10-4 2-MOE 87 552051 7-10-3 2-MOE 86 551986 4-10-6 2-MOE 64 552020 6-10-4 2-MOE 86 552052 7-10-3 2-MOE 87 551987 4-10-6 2-MOE 76 552021 6-10-4 2-MOE 84 552053 7-10-3 2-MOE 75 551988 4-10-6 2-MOE 5 552005 5-10-5 2-MOE 72 552022 6-10-4 2-MOE 80 552054 7-10-3 2-MOE 83 551989 4-10-6 2-MOE 64 552023 6-10-4 2-MOE 78 552055 7-10-3 2-MOE 57 551990 4-10-6 2-MOE 83 552024 6-10-4 2-MOE 89 552056 7-10-3 2-MOE 82 551991 4-10-6 2-MOE 0 552025 6-10-4 2-MOE 89 552057 7-10-3 2-MOE 89 551992 4-10-6 2-MOE 67 552026 6-10-4 2-MOE 84 552058 7-10-3 2-MOE 82 551993 4-10-6 2-MOE 78 552027 6-10-4 2-MOE 85 552059 7-10-3 2-MOE 85 551994 4-10-6 2-MOE 82 552028 6-10-4 2-MOE 82 552060 7-10-3 2-MOE 74 551995 4-10-6 2-MOE 81 552029 6-10-4 2-MOE 81 552061 7-10-3 2-MOE 81 551996 4-10-6 2-MOE 79 552030 6-10-4 2-MOE 86 552062 7-10-3 2-MOE 85 551997 4-10-6 2-MOE 80 552031 6-10-4 2-MOE 86 551998 4-10-6 2-MOE 74 552032 6-10-4 2-MOE 78 551999 4-10-6 2-MOE 79 552033 6-10-4 2-MOE 80 552000 4-10-6 2-MOE 84 552006 5-10-5 2-MOE 86 552034 6-10-4 2-MOE 81 552001 4-10-6 2-MOE 66 552035 6-10-4 2-MOE 55 552002 4-10-6 2-MOE 54 552036 6-10-4 2-MOE 58 552003 4-10-6 2-MOE 50 552037 6-10-4 2-MOE 43 552004 4-10-6 2-MOE 56 552038 6-10-4 2-MOE 66
(424) TABLE-US-00046 TABLE 45 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 61 510100 3-10-4 2-MOE 66 552168 3-9-5 2-MOE 64 552222 4-9-4 2-MOE 76 552169 3-9-5 2-MOE 65 552223 4-9-4 2-MOE 41 552170 3-9-5 2-MOE 58 552224 4-9-4 2-MOE 58 552171 3-9-5 2-MOE 51 552225 4-9-4 2-MOE 49 552172 3-9-5 2-MOE 23 552226 4-9-4 2-MOE 36 552173 3-9-5 2-MOE 44 552227 4-9-4 2-MOE 20 552174 3-9-5 2-MOE 28 552228 4-9-4 2-MOE 29 552175 3-9-5 2-MOE 56 552176 3-9-5 2-MOE 66 552177 3-9-5 2-MOE 53 552178 3-9-5 2-MOE 57 552179 3-9-5 2-MOE 56 552180 3-9-5 2-MOE 51 552181 3-9-5 2-MOE 51 552182 3-9-5 2-MOE 63 552183 3-9-5 2-MOE 60 552185 3-9-5 2-MOE 67 552186 3-9-5 2-MOE 37 552187 3-9-5 2-MOE 68 552188 3-9-5 2-MOE 71 552189 3-9-5 2-MOE 51 552190 3-9-5 2-MOE 47 552191 3-9-5 2-MOE 50 552192 3-9-5 2-MOE 80 552193 3-9-5 2-MOE 73 552194 3-9-5 2-MOE 58 552195 3-9-5 2-MOE 60 552196 3-9-5 2-MOE 54 552197 3-9-5 2-MOE 64 552198 3-9-5 2-MOE 62 552199 3-9-5 2-MOE 57 552200 3-9-5 2-MOE 52 552201 3-9-5 2-MOE 73 552202 3-9-5 2-MOE 60 552203 3-9-5 2-MOE 60 552204 3-9-5 2-MOE 63 552151 2-9-6 2-MOE 71 552205 3-9-5 2-MOE 64 552152 2-9-6 2-MOE 69 552206 3-9-5 2-MOE 71 552153 2-9-6 2-MOE 63 552207 3-9-5 2-MOE 71 552154 2-9-6 2-MOE 56 552208 3-9-5 2-MOE 52 552155 2-9-6 2-MOE 61 552209 3-9-5 2-MOE 50 552156 2-9-6 2-MOE 40 552210 3-9-5 2-MOE 66 552157 2-9-6 2-MOE 45 552211 3-9-5 2-MOE 63 552158 2-9-6 2-MOE 66 552212 3-9-5 2-MOE 62 552159 2-9-6 2-MOE 68 552213 3-9-5 2-MOE 64 552160 2-9-6 2-MOE 78 552214 3-9-5 2-MOE 72 552161 2-9-6 2-MOE 57 552215 3-9-5 2-MOE 54 552162 2-9-6 2-MOE 54 552216 3-9-5 2-MOE 49 552163 2-9-6 2-MOE 65 552217 3-9-5 2-MOE 50 552164 2-9-6 2-MOE 48 552218 3-9-5 2-MOE 39 552165 2-9-6 2-MOE 46 552219 3-9-5 2-MOE 41 552166 2-9-6 2-MOE 42 552220 3-9-5 2-MOE 32 552167 2-9-6 2-MOE 47 552221 3-9-5 2-MOE 33
(425) TABLE-US-00047 TABLE 46 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 509934 5-10-5 2-MOE 56 510100 3-10-4 2-MOE 69 552071 8-10-2 2-MOE 73 552114 2-9-6 2-MOE 64 552115 2-9-6 2-MOE 61 552116 2-9-6 2-MOE 53 552117 2-9-6 2-MOE 69 552072 8-10-2 2-MOE 39 552118 2-9-6 2-MOE 49 552119 2-9-6 2-MOE 49 552120 2-9-6 2-MOE 21 552121 2-9-6 2-MOE 27 552073 8-10-2 2-MOE 73 552122 2-9-6 2-MOE 48 552074 8-10-2 2-MOE 69 552123 2-9-6 2-MOE 68 552075 8-10-2 2-MOE 78 552124 2-9-6 2-MOE 47 552076 8-10-2 2-MOE 63 552125 2-9-6 2-MOE 72 552077 8-10-2 2-MOE 62 552126 2-9-6 2-MOE 64 552078 8-10-2 2-MOE 59 552127 2-9-6 2-MOE 65 552079 8-10-2 2-MOE 80 552128 2-9-6 2-MOE 78 552080 8-10-2 2-MOE 74 552129 2-9-6 2-MOE 68 552130 2-9-6 2-MOE 46 552131 2-9-6 2-MOE 61 552132 2-9-6 2-MOE 66 552133 2-9-6 2-MOE 78 552081 8-10-2 2-MOE 69 552134 2-9-6 2-MOE 68 552135 2-9-6 2-MOE 59 552136 2-9-6 2-MOE 39 552137 2-9-6 2-MOE 36 552082 8-10-2 2-MOE 86 552138 2-9-6 2-MOE 80 552083 8-10-2 2-MOE 85 552139 2-9-6 2-MOE 80 552084 8-10-2 2-MOE 86 552140 2-9-6 2-MOE 70 552085 8-10-2 2-MOE 83 552141 2-9-6 2-MOE 72 552086 8-10-2 2-MOE 83 552142 2-9-6 2-MOE 58 552087 8-10-2 2-MOE 77 552143 2-9-6 2-MOE 70 552144 2-9-6 2-MOE 66 552145 2-9-6 2-MOE 78 552146 2-9-6 2-MOE 63 552088 8-10-2 2-MOE 90 552147 2-9-6 2-MOE 80 552089 8-10-2 2-MOE 87 552148 2-9-6 2-MOE 74 552090 8-10-2 2-MOE 85 552149 2-9-6 2-MOE 79 552091 8-10-2 2-MOE 84 552092 8-10-2 2-MOE 86 552093 8-10-2 2-MOE 82 552094 8-10-2 2-MOE 84 552063 7-10-3 2-MOE 79 552095 8-10-2 2-MOE 85 552064 7-10-3 2-MOE 83 552096 8-10-2 2-MOE 88 552065 7-10-3 2-MOE 86 552097 8-10-2 2-MOE 90 552066 7-10-3 2-MOE 35 552098 8-10-2 2-MOE 86 552067 7-10-3 2-MOE 53 552099 8-10-2 2-MOE 66 552068 7-10-3 2-MOE 70 552100 8-10-2 2-MOE 67 552069 7-10-3 2-MOE 68 552101 8-10-2 2-MOE 65 552070 7-10-3 2-MOE 64 552102 8-10-2 2-MOE 54
(426) TABLE-US-00048 TABLE 47 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotidesmeasured with RTS3371 Wing % ISIS No Motif chemistry inhibition 146786 5-10-5 2-MOE 63 510100 3-10-4 2-MOE 59 552330 6-9-2 2-MOE 50 552331 6-9-2 2-MOE 46 552332 6-9-2 2-MOE 50 552333 6-9-2 2-MOE 48 552334 6-9-2 2-MOE 42 552335 6-9-2 2-MOE 30 552336 6-9-2 2-MOE 23 552337 6-9-2 2-MOE 42 552338 6-9-2 2-MOE 40 552339 6-9-2 2-MOE 50 552340 6-9-2 2-MOE 45 552341 6-9-2 2-MOE 44 552342 6-9-2 2-MOE 51 552343 6-9-2 2-MOE 44 552344 6-9-2 2-MOE 24 552345 6-9-2 2-MOE 41 552346 6-9-2 2-MOE 0 552347 6-9-2 2-MOE 75 552348 6-9-2 2-MOE 72 552349 6-9-2 2-MOE 65 552350 6-9-2 2-MOE 42 552351 6-9-2 2-MOE 45 552352 6-9-2 2-MOE 43 552353 6-9-2 2-MOE 20 552354 6-9-2 2-MOE 70 552355 6-9-2 2-MOE 66 552356 6-9-2 2-MOE 62 552357 6-9-2 2-MOE 53 552358 6-9-2 2-MOE 57 552359 6-9-2 2-MOE 46 552360 6-9-2 2-MOE 45 552361 6-9-2 2-MOE 44 552308 5-9-3 2-MOE 38 552362 6-9-2 2-MOE 51 552309 5-9-3 2-MOE 76 552363 6-9-2 2-MOE 73 552310 5-9-3 2-MOE 58 552364 6-9-2 2-MOE 66 552311 5-9-3 2-MOE 38 552365 6-9-2 2-MOE 64 552150 2-9-6 2-MOE 68 552312 5-9-3 2-MOE 75 552366 6-9-2 2-MOE 55 552313 5-9-3 2-MOE 66 552367 6-9-2 2-MOE 67 552314 5-9-3 2-MOE 56 552368 6-9-2 2-MOE 41 552315 5-9-3 2-MOE 46 552369 6-9-2 2-MOE 52 552316 5-9-3 2-MOE 55 552370 6-9-2 2-MOE 35 552317 5-9-3 2-MOE 53 552371 6-9-2 2-MOE 58 552318 5-9-3 2-MOE 59 552372 6-9-2 2-MOE 68 552319 5-9-3 2-MOE 56 552373 6-9-2 2-MOE 63 552320 5-9-3 2-MOE 62 552374 6-9-2 2-MOE 70 552321 5-9-3 2-MOE 63 552375 6-9-2 2-MOE 64 552322 5-9-3 2-MOE 52 552376 6-9-2 2-MOE 58 552323 5-9-3 2-MOE 45 552377 6-9-2 2-MOE 42 552324 5-9-3 2-MOE 49 552378 6-9-2 2-MOE 37 552325 5-9-3 2-MOE 48 552379 6-9-2 2-MOE 57 552326 5-9-3 2-MOE 50 552380 6-9-2 2-MOE 48 552327 5-9-3 2-MOE 13 552381 6-9-2 2-MOE 22 552328 5-9-3 2-MOE 9 552382 6-9-2 2-MOE 20 552329 5-9-3 2-MOE 18 552383 6-9-2 2-MOE 18
Example 10
Dose-Dependent Antisense Inhibition of Target-Z mRNA in HepG2 Cells
(427) Antisense oligonucleotides from the study described in Example 52 exhibiting in vitro inhibition of Target-Z mRNA were selected and tested at various doses in HepG2 cells. Cells were plated at a density of 28,000 cells per well and transfected using LipofectAMINE2000 with 9.26 nM, 27.78 nM, 83.33 nM, and 250.00 nM concentrations of antisense oligonucleotide, as specified in Table 48. After a treatment period of approximately 16 hours, RNA was isolated from the cells and Target-Z mRNA levels were measured by quantitative real-time PCR. Target-Z primer probe set RTS3371 was used to measure mRNA levels. Target-Z mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of Target-Z, relative to untreated control cells.
(428) As illustrated in Table 48, Target-Z mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells. n/a indicates that the data for that dosage is not available.
(429) TABLE-US-00049 TABLE 48 Dose-dependent antisense inhibition of human Target-Z in HepG2 cells 9.2593 27.7778 83.3333 250.0 ISIS No nM nM nM nM 146786 10 43 74 89 509934 12 31 52 79 509959 4 24 49 67 510100 11 28 60 77 510124 3 11 13 41 551926 1 26 51 76 551958 15 17 56 82 551987 4 40 65 81 551990 7 55 78 91 551993 15 30 70 80 551994 0 30 39 58 551995 6 41 73 85 551996 13 47 71 85 551997 16 38 68 89 551998 4 36 69 85 551999 10 31 67 86 552000 0 17 61 78 552006 6 37 74 89 552009 1 5 39 60 552013 0 28 3 72 552014 0 26 32 77 552018 6 27 63 81 552019 15 34 65 90 552020 2 35 65 91 552021 4 11 53 82 552022 6 35 57 79 552023 11 33 59 81 552024 15 43 69 91 552025 17 35 69 87 552026 14 26 66 86 552027 3 46 62 88 552028 9 43 58 78 552029 8 40 72 89 552030 18 48 77 92 552031 0 38 66 89 552032 42 48 80 88 552033 2 40 64 84 552034 6 40 70 81 552039 2 33 56 83 552044 19 30 63 84 552046 4 21 47 77 552050 15 44 70 92 552051 8 33 69 90 552052 17 38 71 91 552053 0 40 59 86 552054 7 15 58 75 552056 19 62 86 92 552057 11 33 69 86 552058 30 55 79 90 552059 11 25 69 90 552060 9 32 61 86 552061 6 40 69 88 552062 22 48 75 89 552064 23 49 69 90 552065 10 8 69 86 552069 11 4 28 60 552073 9 31 62 78 552075 21 18 33 65 552077 0 17 40 72 552079 1 12 44 70 552080 3 12 34 69 552082 13 29 66 87 552083 24 54 69 88 552084 10 25 48 82 552085 28 35 64 85 552086 0 24 65 84 552088 33 53 77 93 552089 0 41 69 92 552090 17 35 70 87 552091 13 31 69 89 552092 6 23 66 89 552093 0 17 61 89 552094 12 38 65 88 552095 20 42 73 88 552096 n/a 39 66 91 552097 24 43 67 88 552098 0 24 56 85 552101 3 13 28 61 552147 11 27 58 80 552160 20 25 69 89 552163 0 21 22 53 552176 16 11 40 66 552192 7 38 78 89 552222 0 24 65 79 552247 0 38 69 86 552255 5 27 69 81 552301 5 38 65 86 552309 8 26 62 85 552312 0 4 32 62 552347 2 15 38 75 552348 12 40 42 65 552354 10 35 44 76 552361 2 25 55 74 552363 20 36 54 76 552374 7 4 38 76 552379 0 12 24 46 552403 8 27 54 76 552408 2 25 44 77 552409 6 31 56 80 552418 0 30 72 84 552420 9 34 53 81 552442 4 23 46 56 552466 0 23 56 79 552474 11 34 66 87 552477 11 22 44 64 552530 25 37 73 87 552559 9 13 29 51
Example 11
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(430) Target-Z transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(431) Treatment
(432) Groups of 12 mice each were injected subcutaneously twice a week for 4 weeks with 50 mg/kg of ISIS 510106, ISIS 510116, ISIS 505347, or ISIS 509934. A control group of 12 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and livers were harvested for further analysis.
(433) DNA and RNA Analysis
(434) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe sets RTS3370, RTS3371, and RTS3372. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe sets RTS3370 and RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. The data is presented in Table 49, expressed as percent inhibition compared to the control group. As shown in Table 49, most of the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Results are presented as percent inhibition of Target-Z mRNA or DNA, relative to control.
(435) TABLE-US-00050 TABLE 49 Percent inhibition of Target-Z RNA and DNA in the liver of transgenic mice % % % % % % inhibition inhibition inhibition inhibition inhibition inhibition DNA DNA DNA RNA RNA RNA ISIS No (RTS3370) (RTS3371) (RTS3372) (RTS3370) (RTS3371) (RTS3372) 510106 0 0 51 0 0 12 510116 68 79 68 49 54 66 505347 72 79 75 54 28 30 509934 93 95 94 72 75 92
Example 12
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(436) Target-Z transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(437) Treatment
(438) Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 50 mg/kg of ISIS 146779, ISIS 505358, ISIS 146786, ISIS 509974, ISIS 509958, or ISIS 509959. A control group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and livers were harvested for further analysis.
(439) DNA and RNA Analysis
(440) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe sets RTS3370. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe sets RTS3370 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. The data is presented in Table 50, expressed as percent inhibition compared to the control group. As shown in Table 50, most of the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Results are presented as percent inhibition of Target-Z mRNA or DNA, relative to control.
(441) TABLE-US-00051 TABLE 50 Percent inhibition of Target-Z RNA and DNA in the liver of transgenic mice % % inhibition inhibition ISIS No DNA RNA 146779 39 5 505358 84 77 146786 83 73 509974 56 28 509958 82 29 509959 54 30
Example 13
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(442) Transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(443) Treatment
(444) Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786, ISIS 552176, and ISIS 552073. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
(445) DNA and RNA Analysis
(446) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. The data is presented in Table 51. Serum DNA samples were analyzed after the study period. The data is presented in Table 52, expressed relative to the levels measured in the control group. As shown in Tables 51 and 52, the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Results are presented as percent inhibition of Target-Z mRNA or DNA, relative to control.
(447) TABLE-US-00052 TABLE 51 Percent inhibition of Target-Z RNA and DNA in transgenic mice Dose % inhibition of % inhibition of ISIS No (mg/kg/wk) RNA DNA 146786 50 81 91 552073 50 39 22 552176 50 55 56
(448) TABLE-US-00053 TABLE 52 Serum levels of Target-Z DNA in transgenic mice, relative to control levels Dose Post-dose ISIS No (mg/kg/wk) DNA levels 146786 50 0.1 552073 50 2.9 552176 50 2.1
Liver Function
(449) To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of ALT were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz N W (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, Pa., 1995). The results are presented in Table 53 expressed in IU/L. Both the ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.
(450) TABLE-US-00054 TABLE 53 ALT levels (IU/L) of transgenic mice Dose (mg/kg/wk) ALT PBS 77 ISIS 146786 50 21 ISIS 552073 50 19 ISIS 552176 50 27
Example 14
Efficacy of Antisense Oligonucleotides Targeting Target-Z in Transgenic Mice
(451) Transgenic mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for their efficacy in this model.
(452) Treatment
(453) Groups of 6 mice each were injected subcutaneously twice a week for 4 weeks with 25 mg/kg of ISIS 146786, ISIS 552056, ISIS 552088, and ISIS 552309. One group of 10 mice was injected subcutaneously twice a week for 4 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
(454) DNA and RNA Analysis
(455) RNA was extracted from liver tissue for real-time PCR analysis of Target-Z DNA, using primer probe set RTS3371. The DNA levels were normalized to picogreen. Target-Z RNA samples were also assayed with primer probe set RTS3371 after RT-PCR analysis. The mRNA levels were normalized to RIBOGREEN. As shown in Table 54, the antisense oligonucleotides achieved reduction of Target-Z DNA and RNA over the PBS control. Results are presented as percent inhibition of Target-Z mRNA or DNA, relative to control.
(456) TABLE-US-00055 TABLE 54 Percent inhibition of Target-Z DNA and RNA in transgenic mice % % Dose inhibition inhibition (mg/kg/wk) (RNA) (DNA) ISIS 146786 50 60 90 ISIS 552056 50 25 58 ISIS 552088 50 8 0 ISIS 552309 50 35 84
Example 15
Antisense Inhibition of Target-Z Viral mRNA in HepG2 Cells by Deoxy, MOE and (S)-cEt Gapmers
(457) Additional antisense oligonucleotides were designed targeting a Target-Z viral nucleic acid and were tested for their effects on Target-Z mRNA in vitro. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000 with 100 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and Target-Z mRNA levels were measured by quantitative real-time PCR. Viral primer probe sets RTS3370 and RTS3371 and were used to separately measure mRNA levels. Target-Z mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of Target-Z, relative to untreated control cells.
(458) The newly designed chimeric antisense oligonucleotides in Table below were designed as MOE gapmers or deoxy, MOE and (S)-cEt gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2-deoxynucleosides and is flanked on both sides (in the 5 and 3 directions) by wings comprising five nucleosides each. The deoxy, MOE and (S)-cEt gapmers are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The Chemistry column describes the sugar modifications of each oligonucleotide. k indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, d indicates a deoxynucleoside; and e indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.
(459) Each gapmer listed in Table 55 is targeted to the viral Target-Z genomic sequence.
(460) TABLE-US-00056 TABLE 55 Inhibition of viral Target-Z mRNA levels by chimeric antisense oligonucleotides measured with RTS3370 or RTS3371 % % inhibition inhibition ISIS No Motif (RTS3370) (RTS3371) 5808 Uniform deoxy 57 64 524518 eeeee-10-eeeee 62 72 146781 eeeee-10-eeeee 72 93 582665 eeeee-10-eeeee 57 59 582666 eeeee-10-eeeee 49 92 566831 kdkdk-9-ee 96 73 577123 eekk-9-ekee 84 96 577124 kdkdk-8-eeee 92 96 577126 kkk-8-eeeee 87 90 566830 kdkdk-9-ee 93 95 577130 eek-10-kke 87 94 577131 kdkdk-9-ee 83 93 566828 kdkdk-9-ee 97 90 146786 eeeee-10-eeeee 93 71 566829 kdkdk-9-ee 98 84 577120 kdkdk-10-eeeee 94 93 577127 kkk-8-eeeee 95 70 577134 kek-8-eeeee 94 89 577135 kek-10-kek 96 94 552859 ekk-10-kke 92 91 577121 kdkdk-10-eeeee 91 74 577128 kkk-8-eeeee 92 85 577132 kdkdk-9-ee 97 81 577136 kek-10-kek 95 95 566832 kdkdk-9-ee 95 78 552870 ekk-10-kke 71 93 577122 kdkdk-10-eeeee 70 96 577125 kdkdk-8-eeee 70 94 577129 kkk-8-eeeee 76 51 577133 kdkdk-9-ee 80 52 9591 Uniform deoxy 30 14
Example 16
Antisense Inhibition of Target-Z Viral mRNA in HepG2 Cells by Deoxy, MOE and (S)-cEt Gapmers
(461) Additional antisense oligonucleotides were designed targeting a Target-Z viral nucleic acid and were tested for their effects on Target-Z mRNA in vitro. ISIS 577121, ISIS 577122, ISIS 577123, ISIS 577132, ISIS 577133, and ISIS 577134, disclosed in the study described above, were also included in the assay. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using Cytofectin with 9.375 nM, 18.75 nM, 37.50 nM, 75.00 nM, 150.00 nM, or 300.00 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and Target-Z mRNA levels were measured by quantitative real-time PCR. Viral primer probe set RTS3371 was used to measure mRNA levels. Target-Z mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of Target-Z, relative to untreated control cells.
(462) The newly designed chimeric antisense oligonucleotides in Tables below were designed as deoxy, MOE and (S)-cEt gapmers. The deoxy, MOE and (S)-cEt gapmers are 16, 17, or 18 nucleosides in length wherein the nucleosides have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The Chemistry column describes the sugar modifications of each oligonucleotide. k indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise, d indicates a deoxynucleoside; and e indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each oligonucleotide are 5-methylcytosines.
(463) Each gapmer listed in Table 56 is targeted to the viral genomic sequence.
(464) TABLE-US-00057 TABLE 56 Chimeric antisense oligonucleotides targeting viral Target-Z genomic sequence ISIS No Motif 585163 eeekk-8-eeee 585164 eeekk-7-kkeee 585165 eeek-9-keee 585170 eeekk-7-kkeee 585171 eeek-9-keee 585172 eeeekk-7-eeee 585173 ekek-9-eeee 585174 ekekdk-7-eeee 585166 eeekk-7-kkeee 585167 eeek-9-keee 577119 kdkdk-8-eeeee 585168 eeekk-7-kkeee 585169 eeek-9-keee
(465) TABLE-US-00058 TABLE 57 Dose dependent inhibition of Target-Z mRNA levels by chimeric antisense oligonucleotides 9.375 18.75 37.5 75.0 150.0 300.0 ISIS No nM nM nM nM nM nM 146786 37 37 58 70 81 93 505358 30 26 28 57 74 85 510100 42 30 43 61 77 91 552859 21 30 39 61 79 91 577119 42 43 46 66 74 75 577121 10 15 42 64 82 89 577122 21 30 53 66 78 84 577123 27 29 45 56 78 84 577132 14 21 42 61 80 92 577133 12 14 32 47 62 77 577134 37 39 59 72 86 90 585174 31 28 48 61 80 90
(466) TABLE-US-00059 TABLE 58 Dose dependent inhibition of Target-Z mRNA levels by chimeric antisense oligonucleotides 9.375 18.75 37.5 75.0 150.0 300.0 ISIS No nM nM nM nM nM nM 146786 25 34 57 71 85 92 509932 9 28 59 62 70 74 585163 17 32 52 68 77 81 585164 23 4 29 31 36 56 585165 6 31 42 58 66 82 585166 19 27 35 48 50 63 585167 22 25 50 69 76 88 585168 4 30 44 52 67 76 585169 32 32 42 62 76 80 585170 23 19 39 49 66 75 585171 28 27 42 59 81 88 585172 26 29 30 64 80 91 585173 29 30 41 71 86 88