Genetically encoded FRET-based MMP-9 activity biosensor and use thereof

09914955 · 2018-03-13

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a genetically encoded FRET-based biosensor to monitor the activity of matrix metalloproteinase 9 (MMP-9). MMP-9 is an extracellular acting endopeptidase implicated in both physiological and pathological processes. A genetically encoded FRET biosensor anchored in the cellular membrane allows studying the proteolytic activity of MMP-9 with high spatiotemporal resolution at the exact region of MMP-9 action on the cell. Applicability of the biosensor, both in vitro and in vivo in living cells, has been demonstrated by ratiometric analysis of cleavage of the biosensor by a purified auto-activating mutant of MMP-9.

Claims

1. A genetically encoded matrix metalloproteinase 9 (MMP-9) activity biosensor that is anchored in the plasma membrane comprising the teal fluorescent protein mTFP1 as a Frster Resonance Energy Transfer (FRET) donor fluorescent protein and two Venus Fluorescent Proteins as FRET acceptor fluorescent proteins all separated by flexible linkers, wherein the two Venus Fluorescent Proteins are separated by a flexible linker comprising seven repeats of GGSGSR (residues 18-23 of SEQ ID NO:14) hexapeptide, and one of the Venus Fluorescent Proteins is separated from the teal fluorescent protein mTFP1 by an -helical linker comprising a synthetic MMP-9 cleavage site or a linker comprising a synthetic MMP-9 cleavage site and only one GGTGGT (residues 13-18 of SEQ ID NO:13) hexapeptide.

2. The biosensor of claim 1, wherein one of the Venus Fluorescent Proteins is separated from the teal fluorescent protein mTFP1 by -helical linker comprising sequence EEEIREAFRVFPRSLSLRHVMTNL (SEQ ID NO:10).

3. The biosensor of claim 2, wherein the synthetic MMP-9 cleavage site corresponds to PRSLS sequence.

4. The biosensor of claim 2, wherein said biosensor is anchored in the plasma membrane by a PDGFR transmembrane domain.

5. The biosensor of claim 1, wherein the synthetic MMP-9 cleavage site corresponds to PRSLS (residues 12-16 of SEQ ID NO:10) sequence.

6. The biosensor of claim 5, wherein said biosensor is anchored in the plasma membrane by a PDGFR transmembrane domain.

7. The biosensor of claim 1, wherein said biosensor is anchored in the plasma membrane by a platelet-derived growth factor receptor (PDGFR) transmembrane domain.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1A presents the general structures of the preferred biosensors of the invention; in one embodiment (labeled (i)) Venus Fluorescent Proteins are separated by 7 GGSGSR (residues 18-23 of SEQ ID NO:14) repeats and Venus FP and mTFP1 by an -helical linker comprising an MMP-9 cleavage site; in another embodiment (labeled (ii)) Venus Fluorescent Proteins are separated by 7 GGSGSR (residues 18-23 of SEQ ID NO:14) repeats and Venus FP and mTFP1 by MMP-9 cleavage site and 1 GGTGGT (residues 13-18 of SEQ ID NO:13) hexapeptide; variant sensors with lower number of hexapeptide repeats between fluorescent proteins were generated through partial cleavage of the genetic sequence of the sensor. FIG. 1B presents FRET efficiency values calculated from AP; light gray bars indicate sensors analyzed with FLIM. FIG. 1C presents live cell imaging of HEK293 expressing the biosensor of the invention. FIG. 1D presents fractionation results of HEK293 cell line expressing the biosensor of the invention; WB against biosensor was carried out using anti-cmyc antibody; control WBs are presented below.

(2) FIG. 2A presents images of HEK293 cells expressing the biosensor with a loop-like linker before and after AP; mTFP1 was excited with the 458 nm laser, Venus with 514 nm laser; right side of the panel presents emission spectra of the optimized biosensor before and after AP; the disappearance of the acceptor peak and the increased fluorescence intensity of the donor are visible. FIG. 2B presents AP results of the biosensor having an -helical linker.

(3) FIG. 3 presents in vitro cleavage of the sensor with an -helical linker and negative controlsbaseline cleavage, cleavage with the inactive MMP-9 and effects of GM6001 metalloproteinase inhibitor on the biosensor cleavage with the autoactivating MMP-9. Biosensor cleavage was analysed on WB with the anti-GFP antibody; on quantification plots intensity was normalized to full length biosensor in control lanes; intensity of the cleavage product in the control lane was subtracted from cleavage product intensities in the 30 min., 1 h, 4 h, o/n lanes prior to normalization.

(4) FIG. 4 presents spectra recorded for HEK293 cells expressing biosensor with an -helical linker before and after the treatment with autoactivating MMP-9 (aaMMP-9); the treatment causes a spectrum shift towards shorter wavelengths indicating cleavage of the sensor. Error bars represent SEM values. Insert presents a maximum projection of a representative lambda stack of a HEK293 cell expressing the biosensor. A rectangle indicates an approximate region of interest, from which the emission spectrum was acquired. For each cell 3 ROIs were used to calculate the average emission spectrum.

(5) FIG. 5 presents images taken during live imaging of a HEK293 cells expressing the biosensor with -helical linker. Linear unmixing was performed on cell images acquired on the Zeiss LSM780 to remove an influence of a spectral overlap between mTFP1 and Venus FP. The unmixed data was then used to calculate fluorescence intensity ratios for each pixel of the image in each timepoint of the experiment. FIG. 5A presents a map correlating the fluorescence intensity ratio values (OY axis) and fluorescence intensity in that pixel (OX axis). The map was generated for the cell presented in FIG. 5B. FIG. 5B presents images of a HEK293 cell taken at the indicated timepoints. Each pixel was assigned color and hue corresponding to the fluorescence intensity ratio of that pixel. Autoactivating MMP-9 was added to the culture at 5 min. A gradual decrease in the Venus/mTFP1 fluorescence intensity ratio was observed. FIG. 5C presents fluorescence intensity ratios of cells either mock treated, treated with inactive MMP-9 or autoactivating MMP-9. The values were normalized to an average fluorescence intensity ratio value calculated for timepoint before the start of the treatment. Each line represents an averaged ratio of 3 cells. The gradual decrease in the ratio values of cells treated with auto-activating MMP-9 was observed. No such decrease is observed in cells that were either mock treated or treated with inactive MMP-9. Error bars represent SEM values.

DETAILED DESCRIPTION

(6) The genetically encoded FRET-based MMP-9 activity biosensor of the invention fills an important niche in the field of MMP-9 detection. Until now the MMP-9 activity probes were created with clinical diagnosis in mind, which is understandable, given the role of MMP-9 in the development of cancer. However, as recent years have shown, MMP-9 plays a critical role in other processes, for example in the physiology of the brain. Although probes, such as DQ-gelatin, have been incredibly useful in studying that aspect of MMP-9 role, they quite simply do not offer the required spatiotemporal resolution needed to answer numerous questions that have arisen. A genetically encoded, membrane-anchored FRET-based MMP-9 activity biosensor of the invention is better suited to elucidate the role of proteolytic activity of MMP-9 in physiological and pathological processes.

(7) The biosensor of the invention utilizes a novel monomeric teal fluorescent protein (mTFP1) that possesses superior spectral properties to CFP [Day, et al., 2008]. It has previously been shown that mTFP1 forms a more efficient FRET pair with the Yellow Fluorescent Protein [Li and Elledge, 2007]. However, other fluorescent proteins, such as Clover FP [Lam et al., 2012], can also be used in the biosensor of the invention.

(8) mTFP1 serves as a donor of energy while dual Venus Fluorescent Proteins serve as energy acceptors. Venus Fluorescent Protein, an improved variant of the Yellow Fluorescent Protein, was selected for the FRET acceptor. Other FP can also be used as acceptor FP, for example mRuby2 disclosed by Lam et al., supra.

(9) Although the majority of FRET-based sensors contain one donor protein and one acceptor protein, two acceptor FP proteins were introduced into the sensor to increase its FRET efficiency. FRET efficiency of a single donor and single acceptor system is defined as:

(10) E 1 = k T k T + k R + k F ,
where k.sub.T is the energy transfer rate, k.sub.R is the rate constant of all other deactivation processes and k.sub.F is the fluorescence decay rate.

(11) FRET efficiency of a single donor and two acceptors system is given by the following equation:

(12) E 2 = 2 k T 2 k T + k R + k F .
Introduction of a second acceptor in a FRET biosensor increases its FRET efficiency, since

(13) E 2 = 2 E 1 1 + E 1 E 1 .

(14) The distance between fluorescent proteins in the biosensor of the invention was optimized to maximize the effective FRET efficiency. Since FRET efficiency is determined not only by the distance between the donor and acceptor proteins, but also by the orientation, flexible linkers formed from several GGSGGS (residues 18-23 of SEQ ID NO:14) or GGTGGT (residues 13-18 of SEQ ID NO:13) repeats were employed and proved to be efficient in improving the FRET efficiency. Two glycine residues give the linker its flexibility, while a larger amino acid determines linear distance between proteins.

(15) The other factor determining the functionality of the biosensor of the invention is the MMP-9 cleavage sequence. A screen of known MMP-9 substrates has yielded neither a consensus sequence nor a secondary structure assumed by the MMP-9 cleavage site. Kridel et al. [Kridel, et al., 2001] reported a family of short peptides cleavable by MMP-9 using the phage display technology in an ELISA format. Thus the Inventors have selected a consensus sequence N-PRSLS-C suggested therein, which has been cloned into the biosensor of the invention. This sequence has previously been shown [Fudala et al., 2011] as being indeed recognized by MMP-9. However, other amino acid sequences can also be used as MMP-9 cleavage site (as it has been discussed above).

(16) As the proteolytic cleavage efficiency strongly depends on the accessibility of the cleavage site, which in turn is influenced by its secondary and tertiary structures, the Inventors have decided to alter the structure of the linker positioned between mTFP1 and Venus Fluorescent Protein in the biosensor of the invention, by placing the MMP-9 cleavage site between two -helices.

(17) The Inventors have carried out the acceptor photobleaching (AP) experiments in order to rapidly screen generated biosensors and give a general indication of whether FRET occurs. These experiments were never intended to provide a reliable quantification of the FRET phenomenon. In-depth analysis of the FRET properties of biosensors with the highest FRET efficiency was performed with fluorescence lifetime imaging microscopy (FLIM). There is a slight discrepancy between FRET efficiency values calculated from AP and FLIM experiments. However, the FRET efficiency values based on AP are calculated for the entire cell (therefore they include the cytoplasm, where FRET is negligible due to the membranous localization of the biosensor), whereas FRET efficiency values based on FLIM measurements were calculated for much smaller regions, where FRET was most pronounced.

(18) As the result of this analysis, it was found that the biosensor with -helical linker has a higher FRET efficiency than the biosensor with a loop-like linker. This difference is likely due to different higher order structures assumed by loop-like and -helical linkers, with the latter one being more compact and thus bringing the donor and acceptors closer to each other.

(19) The MMP-9 proteolytic activity leads to the release of dual Venus proteins from the cell membrane and a decrease in the Venus to mTFP1 fluorescence ratio. The biosensor is present predominantly in the cell membrane. The presence of a small fraction of the biosensor in the cytoplasm may indicate some level of sensor degradation. The biosensor is cleaved by MMP-9 in an in vitro assay. The cleavage is not due to a spontaneous degradation of the protein and can be blocked by the addition of a broad spectrum MMP inhibitor. A baseline cleavage of the biosensor is observable in untreated lysate. Since cell lysis was performed without protease inhibitors of any kind, the observed cleavage may be caused by endogenous MMP-9 present in the HEK293 cell lysate. The baseline cleavage can be, at least partially, blocked by matrix metalloproteinase inhibitorsboth broad-spectrum (GM6001 that blocks MMP-1, MMP-2, MMP-3, MMP-8 and MMP-9) and specific (Inhibitor I that selectively blocks MMP-9 and MMP-13).

(20) The fluorescence emission spectra collected from cell membranes of fixed HEK293 cells expressing the biosensor and treated with the auto-activating MMP-9 differ from those recorded from untreated cells. The contribution of mTFP1 to the fluorescence signal increases, implying the cleavage of the biosensor. The effect of MMP-9 on the structure of biosensor has been followed with live cell imaging microscopy.

(21) This shows usefulness of the biosensor of the invention for investigation of the proteolytic activity of MMP-9 in vitro, as well as in vivo in living cells.

EXAMPLES

Materials Used in the Examples

(22) The genetically encoded FRET-based MMP-9 activity biosensor was assembled in the pDisplay plasmid (Clontech). The mTFP1 gene was amplified from the pmTFP1-N1 plasmid (Allele Biotech). The plasmid coding the Venus gene was provided by Jacek Jaworski (The International Institute of Cell Biology, Warsaw).

(23) Phusion Hot Start II Polymerase was purchased from Thermo Scientific (formerly Finnzymes). XmaI, SacII, Nhel, AflII, Agel, XbaI, Apal and BglII restriction enzymes were acquired in New England Biolabs and Thermo Scientific (formerly Fermentas). T4 DNA Polymerase required in the SLIC cloning was obtained from Thermo Scientific (formerly Fermentas). DMEM+GlutaMAX (High Glucose 4.5 g/L), Fetal Bovine Serum and penicillin/streptomycin mix were purchased from Sigma-Aldrich. Polyethylenoimine used for HEK293 cell line transfection was acquired from Fluka. Proteoextract Subcellular Proteome Kit was acquired from Calbiochem and EndoFree Plasmid DNA Maxi Kit from Qiagen. The -GFP antibody was purchased from MBL (#498), the -myc antibody from Santa Cruz Biotechnologies (#sc-40), the -N-cadherin antibody from BD Biosciences (#610920), the -hsp90 antibody from Stressgen (#SPS-771) and the -histone H3 antibody from Abcam (#ab10799).

(24) Poly-L-lysine used to coat glass cover slips was purchased from Sigma-Aldrich. The auto-activating MMP-9 was designed and purified as described previously [Michaluk, et al., 2007]. The oligonucleotides were ordered either at Sigma Aldrich or Genomed.

Example 1 Construction of MMP-9 Activity Biosensor (Loop-Type Linker)

(25) The biosensor was cloned using the SLIC cloning methodology described in [Li, and Elledge, 2007]. The fluorescent protein genes were amplified with the Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific) using the following primers:

(26) TABLE-US-00001 Venus1 forwardprimer: (SEQIDNO:1) CTGGGGCCCAGCCGGCCAGATCTCCCGGCATGGTGAG CAAGGGCGAGGA reverseprimer: (SEQIDNO:2) TCCTCGCCCTTGCTCACCATGCTAGCCTTGTACAGCT CGTCCATGC Venus2 forwardprimer: (SEQIDNO:3) GCATGGACGAGCTGTACAAGGCTAGCATGGTGAGCAA GGGCGAGGA reverseprimer: (SEQIDNO:4) TCCTCGCCCTTGCTCACCATCTTAAGCTTGTACAGCT CGTCCATGC mTFP1 forwardprimer: (SEQIDNO:5) GCATGGACGAGCTGTACAAGCTTAAGATGGTGAGCAA GGGCGAGGA reverseprimer: (SEQIDNO:6) AGATGAGTTTTTGTTCGTCGACCTGCAGCCGCACTTG TACAGCTCGTCCATGC.

(27) The pDisplay plasmid was cleaved with Xmal and Sacll enzymes to generate single stranded ends. Proper assembly of the Venus-Venus-mTFP1 tandem construct was confirmed using restriction enzyme analysis and sequencing.

(28) Two restriction enzyme sites were introduced into the tandem construct: Nhel site separated the Venus 1 and Venus2 fluorescent proteins, while AflII was cloned between the Venus2 and mTFP1 genes (sites marked in bold in primer sequences). Two oligonucleotides were cloned into these sites, each one coding a peptide linker designed to be flexible and provide spatial separation between the fluorescent proteins. Oligonucleotides were composed of repeated segments separated with restriction enzyme cleavage sites (Agel and Xbal) to enable a rapid and simple adjustment of their length. An oligonucleotide (coding linker LN1) with the following sequence was cloned into the AflII site:

(29) TABLE-US-00002 (SEQIDNO:7) CTTAAGGGATCCCCCCGCTCTCTCTCTAAGCTTAAA- (GGAGGAACCGGTGGAACT).sub.8-CTTAAG.
The Agel restriction site is in bold font, the sequence coding the MMP-9 cleavage site was underlined. The following oligonucleotide (coding linker LN2) was cloned into the NheI site:

(30) TABLE-US-00003 (SEQIDNO:8) GCTAGCGGTGGTAGCGGTGGTAGCGGtGCTAGT-(GG TGGTTCTGGTTCTAGA).sub.8-GCTAGC.

(31) The XbaI restriction site is in bold. The biosensor constructed in the above fashion carried the MMP-9 cleavage site within an unstructured loop, hence the name: biosensor with a loop-like linker.

Example 2 Construction of MMP-9 Activity Biosensor (-Helical Cleavage Site)

(32) To construct a variant MMP-9 activity biosensor with the MMP-9 cleavage site located within -helical structure, the linker between Venus and mTFP1 in biosensor with a loop-like linker was cut out with the AflII enzyme and replaced with the following oligonucleotide (SEQ NO ID: 9):

(33) TABLE-US-00004 CTTAAGGAGGAGGAGATCAGAGAGGCCTTCAGAGTGT TCCCCAGAAGCCTGAGCCTGAGACACGTGATGACCAA CCTGCTTAAG
It encodes the following peptide (+1 Open Reading Frame):
EEEIREAFRVFPRSLSLRHVMTNL (SEQ ID NO: 10), where sequences given in bold represent -helices.

Example 3 Construction of Membrane Anchored mTFP1 Required for FLIM

(34) The membrane anchored mTFP1 was constructed in the pDisplay plasmid. The mTFP1 gene was amplified with the following primers

(35) TABLE-US-00005 forwardprimer: (SEQIDNO:11) AAGAACGGGCCCATGGTGAGCAAGGGCGAGG reverseprimer: (SEQIDNO:12) AAGAACAGATCTCTTGTACAGCTCGTCCATGC.

(36) Given in bold are restriction sitesApal in forward primer and BglII in reverse primer, respectively. The PCR product was cloned between these sites into the pDisplay plasmid.

Example 4 Construction of MMP-9 Activity Biosensors with Varying Linker Lengths

(37) A series of variant biosensors with altered linker lengths were generated to perform FRET efficiency optimization for the biosensor. The plasmid coding the biosensor with full length linkers was subjected to partial cleavage with either Agel or Xbal enzymes, religation and transformation into E. coli. Restriction enzyme cleavage reactions were performed with increasing amounts of enzyme. The LN1 linker was cleaved for 2 h with an amount of Agel sufficient to cut from 1 to 4 of its restriction sites0.85 U, 1 U, 1.5 U, 2 U, 2.5 U, 3 U, 3.5 U of Agel were used. Similarly the LN2 linker was cleaved with 6 U, 8 U, 10 U, 12 U, 14 U, 16 U 18 U or 20 U for 2 h, to cleave the plasmid in 1 to 4 Xbal sites. Clones were analyzed using PCR to determine the linker length within the biosensors and sequenced.

(38) The following biosensors were received: 1-1, 2-1, 3-1, 4-1, 5-1, 6-1, 7-1, 8-1, 1-2, 2-2, 8-2, 1-3, 2-3, 3-3, 4-3, 5-3, 6-3, 7-3, 8-3, 1-4, 2-4, 8-4, 1-5, 2-5, 8-5, 1-6, 2-6, 8-6, 1-7, 8-7, 1-8, 2-8, 3-8, 4-8, 5-8, 6-8, 7-8, 8-8, wherein the first digit in the number pair designating the biosensor variant indicates a number of GGSGGR (residues 18-23 of SEQ ID NO:14) hexapeptide repeats in LN2 linker and the second digit in the number pairs indicates a number of GGTGGT (residues 13-18 of SEQ ID NO:13) hexapeptide repeats in LN1 linker.

Example 5 Transfection of MMP-9 Activity Biosensors into HEK293 Cells

(39) Routine FRET optimization and testing of the sensor were performed in the HEK293 cell line. Cells were cultured in DMEM (4.5 g/L glucose)+10% FBS+1% P/S in 37 C., 5% CO.sub.2. Plasmids coding the sensors (identified in the proceeding Examples) were purified with the Qiagen Endo Free Plasmid Maxi Kit. DNA to be transfected was mixed with pure DMEM and polyethylenoimine (PEI) (5 g/L), left for 10 minutes at room temperature, and then transferred to cell culture. Cells were incubated with DNA-PEI complexes for 4 h, then the medium was replaced with a fresh one. Cells intended to be imaged on confocal microscope were cultured on glass cover slips coated with poly-L-lysine.

Example 6 AP/FLIM Analysis of the Cells Expressing MMP-9 Activity Biosensors

(40) Two days post transfection the cells obtained in Example 5 were fixed with 4% PFA, 3% sucrose in PBS and microscope slides were prepared. Acceptor photobleaching (AP) experiments were performed on Leica SP5 microscope with 63NA (1.4) oil immersion objective. Images were acquired at 10241024 pixels. mTFP1 was imaged with the 458 nm line of an argon laser set to 20%. FRET efficiency of the sensors was determined by AP of the Venus with high power 514 nm laser and measuring the increase in the intensity of the fluorescence of mTFP1. Sensors determined to have highest FRET efficiency were further analyzed with the Fluorescence Lifetime Imaging Microscopy (FLIM) on Leica SP2 microscope.

(41) The apparent FRET efficiency value of variant sensors from AP data was calculated using the following equation:

(42) Ef D = 1 - ( F DA F D ) , ( 1 )
where f.sub.D is the fraction of donor participating in the FRET complex, F.sub.DA and F.sub.D are the background subtracted and acquisition bleaching corrected pre- and post-bleach mTFP1 fluorescence intensities, respectively. The acquisition bleaching corrected post-bleach mTFP1 intensities were calculated as

(43) F D = F D B .Math. post + ( F D R .Math. pre - F D R .Math. post F D R .Math. pre ) F D B .Math. pre , ( 2 )
where F.sub.D.sup.B and F.sub.D.sup.R refer to mTFP1 intensities of the bleach and reference region of interest, and pre and post refer to pre-bleach and post-bleach measurements.

(44) FRET efficiency values from FLIM data were calculated with the following equation

(45) Ef D = ( 1 - D DA ) A DA A DA + A D , ( 3 )
where .sub.D is the lifetime of the donor in the absence of the acceptor (in our case the membrane anchored mTFP1) and .sub.DA is the lifetime of the FRET-based MMP-9 activity biosensor and A.sub.DA and A.sub.D represent the amplitude of individual decay components [Zeug, et al., 2012]. Error values were estimated using the Gaussian noise propagation equation

(46) stdE = ( E D ) 2 D 2 + ( E DA ) 2 DA 2 . ( 4 )

Example 7 Fluorescence Emission Spectra Collection for Cells Transfected with MMP-9 Activity Biosensors

(47) Lambda stack acquisition was performed on Zeiss LSM780 microscope equipped with 63NA (1.4) oil-immersion objective at 10241024 pixels. The 458 nm line of an argon laser was used for excitation and 32 lambda channels were acquired, at 9 nm steps. Acquired lambda stacks were analysed with Fiji ImageJ software by measuring the average brightness of the plasma membrane in each channel. Recovered sensor spectra were normalized by having the area under the spectrum plot equaling 1.

Example 8 HEK293 Cell Fractioning

(48) Cell fractioning experiments were performed using the Calbiochem ProteoExtract Subcellular Proteome Extraction kit. Sensor was detected on Western Blot using the anti-myc antibody. Quality of the cell fractioning was tested on Western Blot with the following antibodies: anti-hsp90, anti-N-cadherin and anti-histone H3.

Example 9 In Vitro Cleavage of the MMP-9 Activity Biosensors

(49) Two days post-transfection HEK293 cells were washed one with PBS, scraped from the plate and lysed for 1 h at 4 C. with the following buffer: 50 mM Tris-Cl pH 7.5, 1% Triton X-100, 10 mM CaCl.sub.2, 0.02% NaN.sub.3, 1 M ZnCl.sub.2. The lysis was performed without protease inhibitors since it was feared that they might block the activity of our auto-activating MMP-9. The lysate was then centrifuged at 13400 rpm for 15 at 4 C. to remove cell debris. Equal amount of the cleared lysate were used in the subsequent reactions. Either 400 ng (final concentration 10 g/mL), 1.2 g (final concentration 30 g/mL) of auto-activating MMP-9 or 400 ng (final concentration 10 g/mL) of inactive MMP-9 were added to the reactions. GM6001 inhibitor was used in 25 M final concentration. Reactions were stopped at either 30, 1 h, 4 h or after overnight incubation at 37 C. with the addition of SDS-PAGE Sample Buffer and heating to 100 C. for 10 minutes. Sensor was detected on Western Blot with the anti-GFP antibody.

Example 10 Cleavage of the MMP-9 Activity Biosensors in the Cell Culture

(50) Two days post-transfection with the MMP-9 activity biosensors, the culture medium was replaced with pure DMEM. Cells were incubated for 30 min. with 400 ng of auto-activating MMP-9 (final concentration800 ng/mL) and fixed with 4% PFA, 3% sucrose in PBS. Lambda stacks were acquired as previously described.

Example 12 Live ImagingRatiometric Analysis of Cells Transfected with MMP-9 Activity Bio Sensors

(51) The HEK293 cell line was cultured on Glass Bottom Microwell Dishes (MatTek Corporation). The cells were transfected with a plasmid coding the biosensor with -helical liner. Two days post-transfection the cells were transferred to a Zeiss LSM780 microscope fitted with incubator and imaged using a water-immersion 40 objective. A single optical slice of the cells was captured at the 10241024 pixel resolution every 30 s with linear unmixing of the donor and acceptor fluorescence spectra performed in real time. Acquisition was performed for 30 min. 5 min after the start of image acquisition the cells were either mock treated with pure DMEM, auto-activating MMP-9 diluted in DMEM (final concentration460 ng/mL) or inactive MMP-9 similarly diluted in DMEM to the same final concentration. Data analysis was performed in the custom written software under Matlab suite. The Venus/mTFP1 ratio was calculated for each pixel and plotted against the time elapsed from the start of the experiment.

(52) Results

(53) I. FRET Efficiency of the Biosensor (AP and FLIM Study)

(54) The introduction of linkers with adjustable lengths allowed a rapid formation of 38 biosensor variants. Biosensors of the invention with the highest FRET efficiency were identified with the AP technique (FIG. 1B) and analyzed using FLIM to confirm AP-based FRET efficiency calculations.

(55) Table 1 presents FRET Efficiency values calculated from FLIM data for the biosensors variants with the highest FRET efficiencies in AP experiments. Error values were estimated using the Gaussian noise propagation equation. The naming scheme of the variants is as follows: X-Y, where Xa number of hexapeptide repeats between both Venus FP (linker LN2), Ya number of hexapeptide repeats between Venus FP and mTFP1 (linker LN1).

(56) TABLE-US-00006 TABLE 1 FRET Efficiency of variant FRET Efficiency of variant MMP-9 activity biosensors with a loop-like linker - FLIM Sensor variant 3-1 4-1 7-1 8-1 8-3 2-8 0.22 0.22 0.23 0.19 0.05 0.20 0.05 0.22 0.05 0.05 0.05 0.05
A biosensor (named 7-1 in Table 1) with a long linker between the two Venus FP (seven repeats of GGTGGTTCTGGTTCTAGA (nucleotides 34-51 of SEQ ID NO:8) in its DNA sequence) and a short linker between the second Venus and mTFP1 (one GGAGGAACCGGTGGAACT (nucleotides 37-54 of SEQ ID NO:7) repeat in its DNA sequence) has the highest FRET efficiency of all obtained biosensor loop-like linker variants and the FRET efficiency was found to be E=0.200.03 (standard deviation value)FIG. 2A. The biosensor with -helical linker has a higher acquisition-bleaching corrected effective FRET efficiency 0.260.02 in comparison to the biosensor with the loop-like linkerFIG. 2B. Given the higher FRET efficiency exhibited by the biosensor with -helical linker, it was used in further studies.
II. Cellular Membrane Localization

(57) The MMP-9 activity biosensor of the invention localizes at the cellular membrane. This was confirmed by direct visualization of the biosensor in living HEK293 cells (FIG. 1C) and through cell fractionation followed by western blot analysis of collected fractions (FIG. 1D). Fractionation confirms that the vast majority (87%6%) of the biosensor localizes in membranes with a small percentage in the cytoplasm. No biosensor was observed in the nucleus. Control western blots confirmed the purity of collected fractions.

(58) III. In Vitro Biosensor Cleavage

(59) The MMP-9 activity biosensor is cleaved in vitro by a human auto-activating MMP-9 (FIG. 3). Significantly more enzyme was used (standard concentration of auto-activating MMP-9 in experiments is 400 ng/mL [Michaluk et al., 2009]) in these reactions to make sure that the entire biosensor pool was cleaved.

(60) The biosensor is already partially cleaved (14.20.4%see FIG. 3B, control lanes; value normalized to full length biosensor intensity in control lanes) in transfected but otherwise untreated HEK293 cell line, which can be readily seen on the Western blot (FIG. 3). The in vitro cleavage of the biosensor with -helical linker is not due to spontaneous degradation of the protein, though a slight increase in the amount of a cleaved form of the biosensor is observed over time (FIG. 3). Inactive human MMP-9 does not cleave the biosensor (FIG. 3). The cleavage can be blocked by the addition of a broad spectrum GM6001 matrix metalloproteinase inhibitor to the final concentration of 25 M (FIG. 3).

(61) IV. Biosensor Cleavage in the HEK293 Cell CultureFluorescence Emission Spectra of Fixed Cells

(62) Analysis of the fluorescence emission spectra collected from HEK293 cells incubated with the auto-activating MMP-9 for 30 minutes confirms that the biosensor is being cleaved in the cellular membrane (FIG. 4). The biosensor cleavage can be observed as a change in the emission spectrum of the biosensor within the membrane. The treatment with auto-activating MMP-9 results in a shift of the spectrum towards shorter wavelengths, a decrease in the contribution of Venus to the fluorescence signal (acceptor peak) and a corresponding increase in mTFP1 contribution (donor peak).

(63) V. Biosensor Cleavage in the HEK293 Cell CultureLive Cell Imaging

(64) The cleavage of the biosensor can be observed in live imaging of HEK293 cells (FIG. 5) as a decrease of the Venus to mTFP1 fluorescence intensity ratio (FIG. 5). The addition of auto-activating MMP-9 to the culture medium results in a decrease in the ratio whereas mock treatment with pure medium or a treatment with inactive MMP-9 results in a slight, gradual increase (FIG. 5B).

REFERENCES

(65) Akers, W. J., et al., Detection of MMP-2 and MMP-9 Activity in Vivo with a Triple-Helical Peptide Optical Probe. Bioconjugate Chemistry, 2012. 23(3): p. 656-663. Burdette, S. C., et al., Fluorescent Sensors for Zn.sup.2+Based on a Fluorescein Platform: Synthesis, Properties and Intracellular Distribution. Journal of the American Chemical Society, 2001. 123(32): p. 7831-7841. Cavallo-Medved, D., et al., Live-cell imaging demonstrates extracellular matrix degradation in association with active cathepsin B in caveolae of endothelial cells during tube formation. Experimental Cell Research, 2009. 315(7): p. 1234-1246. Day, R. N., C. F. Booker, and A. Periasamy, Characterization of an improved donor fluorescent protein for Forster resonance energy transfer microscopy. Journal of Biomedical Optics, 2008. 13(3): p. 031203-031203. Deryugina, E. I. and J. P. Quigley, Matrix metalloproteinases and tumor metastasis. Cancer metastasis reviews, 2006. 25(1): p. 9-34. Esposito, A., et al., pHlameleons: A Family of FRET-Based Protein Sensors for Quantitative pH Imaging. Biochemistry, 2008. 47 (49): p. 13115-13126. Evers, T. H., et al., Quantitative Understanding of the Energy Transfer between Fluorescent Proteins Connected via Flexible Peptide Linkers. Biochemistry, 2006. 45(44): p. 13183-13192. Fudala, R., et al., Fluorescence detection of MMP-9. I. MMP-9 selectively cleaves Lys-Gly-Pro-Arg-Ser-Leu-Ser-Gly-Lys peptide. Current pharmaceutical biotechnology, 2011. 12(5): p. 834-838. Fudala R, R. R., Mukerjee A, Ranjan A P, Vishwanatha J K, Kurdowska A K, Gryczynski Z, Borejdo J, Gryczynski I, Fluorescence Detection of MMP-9.11. Ratiometric FRET-Based Sensing With Dually Labeled Specific Peptide. Current pharmaceutical biotechnology, 2012. Gruenwald, K., et al., Visualization of Glutamine Transporter Activities in Living Cells Using Genetically Encoded Glutamine Sensors. PLoS ONE, 2012. 7(6): p. e38591. Hanemaaijer, R., et al., Increased gelatinase-A and gelatinase-B activities in malignant vs. benign breast tumors. International Journal of Cancer, 2000. 86(2): p. 204-207. Hawkins, K. E., et al., Fluorometric immunocapture assay for the specific measurement of matrix metalloproteinase-9 activity in biological samples: application to brain and plasma from rats with ischemic stroke. Molecular brain, 2013. 6: p. 14. Kaijzel, E. L., et al., Multimodality Imaging Reveals a Gradual Increase in Matrix Metalloproteinase Activity at Aneurysmal Lesions in Live Fibulin-4 Mice. Circulation: Cardiovascular Imaging, 2010. 3(5): p. 567-577. Kalab, P. and J. Soderholm, The design of Forster (fluorescence) resonance energy transfer (FRET)-based molecular sensors for Ran GTPase. Methods, 2010. 51(2): p. 220-232. Kessenbrock, K., V. Plaks, and Z. Werb, Matrix metalloproteinases: regulators of the tumor microenvironment. Cell, 2010. 141(1): p. 5267. Klein, G, et al., The possible role of matrix metalloproteinase (MMP)-2 and MMP-9 in cancer, e.g. acute leukemia. Crit Rev Oncol Hematol, 2004. 50(2): p. 87-100. Klein, T. and R. Bischoff, Physiology and pathophysiology of matrix metalloproteases. Amino acids, 2011. 41(2): p. 271-90. Kridel, S. J., et al., Substrate Hydrolysis by Matrix Metalloproteinase-9*. Journal of Biological Chemistry, 2001. 276(23): p. 20572-20578. Lam A. J., St-Pierre F., Gong Y., Marshall J. D., Cranfill P. J., Baird M. A., McKeown M. R., Wiedenmann J, Davidson M. W., Schnitzer M. J., Tsien R. Y., Lin M. Z. Improving FRET dynamic range with bright green and red fluorescent proteins, Nat Methods. 2012. 9(10): p. 1005-1012. Lee, C.-M., et al., Optical imaging of MMP expression and cancer progression in an inflammation-induced colon cancer model. International Journal of Cancer, 2012. 131(8): p. 1846-1853. Leight, J. L., et al., Direct measurement of matrix metalloproteinase activity in 3D cellular micro environments using a fluorogenic peptide substrate. Biomaterials, 2013. 34(30): p. 7344-7352. Li, M. Z. and S. J. Elledge, Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Meth, 2007. 4(3): p. 251-256. Meng, F. and F. Sachs, Visualizing dynamic cytoplasmic forces with a compliance-matched FRET sensor. Journal of Cell Science, 2011. 124 (2): p. 261-269. Michaluk, P., et al., -Dystroglycan as a Target for MMP-9, in Response to Enhanced Neuronal Activity. Journal of Biological Chemistry, 2007. 282 (22): p. 16036-16041. Michaluk, P., et al., Matrix Metalloproteinase-9 Controls NMDA Receptor Surface Diffusion through Integrin 1 Signaling. The Journal of Neuroscience, 2009. 29(18): p. 6007-6012. Miranda, J. G, et al., New Alternately Colored FRET Sensors for Simultaneous Monitoring of Zn.sup.2+ in Multiple Cellular Locations. PLoS ONE, 2012. 7(11): p. e49371. Ning, C., Design Genetic Fluorescent Probes to Detect Protease Activity and Calcium-Dependent Protein-Protein Interactions in Living Cells. Chemistry Dissertations of Georgia State University, 2008. Roopali Roy, D. Z., Susan Pories, Marcia L. Moss and Marsha A. Moses, Potential of Fluorescent Metalloproteinase Substrates for Cancer Detection. Clinical Biochemistry, 2011. 44(17-18): p. 1434-1439. Sameni, M., et al., Imaging and quantifying the dynamics of tumor-associated proteolysis. Clin Exp Metastasis, 2009. 26(4): p. 299-309. Scherer, R., J. O. McIntyre, and L. Matrisian, Imaging matrix metalloproteinases in cancer. Cancer and Metastasis Reviews, 2008. 27 (4): p. 679-690. Schmalfeldt, B., et al., Increased Expression of Matrix Metalloproteinases (MMP)-2, MMP-9, and the Urokinase-Type Plasminogen Activator Is Associated with Progression from Benign to Advanced Ovarian Cancer. Clinical Cancer Research, 2001. 7(8): p. 2396-2404. Schonbeck, U., F. Mach, and P. Libby, Generation of Biologically Active IL-1 by Matrix Metalloproteinases: A Novel Caspase-1-Independent Pathway of IL-1 Processing. The Journal of Immunology, 1998. 161(7): p. 3340-3346. Tsien R. Y., Very long-term memories may be stored in the pattern of holes in the perineuronal net, PNAS Early Edition. 2013 www.pnas.org/cgi/doi/10.1073/pnas.1310158110. Violin, J. D., et al., A genetically encoded fluorescent reporter reveals oscillatory phosphorylation by protein kinase C. The Journal of Cell Biology, 2003. 161(5): p. 899-909. Wallis de Vries, B. M., et al., Multispectral Near-Infrared Fluorescence Molecular Imaging of Matrix Metalloproteinases in a Human Carotid Plaque Using a Matrix-Degrading Metalloproteinase-Sensitive Activatable Fluorescent Probe. Circulation, 2009. 119(20): p. e534-e536. Wang, W., et al., Targeting Gelatinases with a Near-Infrared Fluorescent Cyclic His-Try-Gly-Phe Peptide. Molecular Imaging and Biology, 2009. 11(6): p. 424-433. Yu, Q. and I. Stamenkovic, Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF- and promotes tumor invasion and angiogenesis. Genes & Development, 2000. 14 (2): p. 163-176. Zeug, A., et al., Quantitative Intensity-Based FRET Approaches A Comparative Snapshot. Biophysical journal, 2012. 103(9): p. 18211827.