Biocompatible implants for use in tendon therapy

Abstract

The invention provides biocompatible implants (scaffolds) for use in the treatment of tendon injury and/or modulation of the biomechanical properties of tendon. More particularly, the invention provides biocompatible implants capable of delivering microRNA 29 and precursors and mimics thereof to the tendon. In some embodiments the implant comprises a bioresorbable substrate to avoid the need for surgical removal of the implant once healing or re-modelling is complete.

Claims

1. A biocompatible implant comprising (a) a biocompatible substrate capable of supporting growth of tendon cells; and (b) a modulator of tendon healing; wherein said modulator is (i) miR-29, a mimic thereof, or a precursor of either; or (ii) a nucleic acid encoding miR-29, a mimic thereof, or a precursor of either; and wherein said modulator is located extracellularly to any cells present on or in said substrate.

2. A biocompatible implant according to claim 1 wherein the substrate is bioresorbable.

3. A biocompatible implant according to claim 1 or claim 2 wherein the substrate comprises one or more cells.

4. A biocompatible implant according to claim 3 wherein said cells comprise tenocytes, tenoblasts or mesenchymal stem cells.

5. A biocompatible implant according to any one of the preceding claims wherein the substrate is porous.

6. A biocompatible implant according to claim 5 wherein the substrate comprises a fabric, matrix, foam or gel.

7. A biocompatible implant according to claim 5 or claim 6 wherein the mean pore diameter is in the range of 10-500 m, e.g. 50-500 m, e.g. 100-500 m or 200-500 m.

8. A biocompatible implant according to any one of the preceding claims wherein the substrate comprises or consists of extra-cellular matrix (ECM).

9. A biocompatible implant according to claim 8 wherein the ECM is derived from tendon, small intestinal submucosa (SIS), dermis or pericardium.

10. A biocompatible implant according to claim 8 or claim 9 wherein said ECM has been subjected to decellularisation, oxidation, freeze drying, or any combination thereof.

11. A biocompatible implant according to any one of claims 1 to 10 wherein said ECM has been subjected to chemical cross-linking.

12. A biocompatible implant according to any one of claims 1 to 7 wherein the substrate is a synthetic substrate.

13. A biocompatible implant according to claim 12 wherein the substrate comprises one or more proteins or polysaccharides.

14. A biocompatible implant according to claim 13 wherein said proteins comprise one or more of collagen, elastin, fibrin, albumin and gelatin, and/or wherein said polysaccharides comprise one of more of hyaluronan, alginate and chitosan.

15. A biocompatible implant according to any one of claims 12 to 14 wherein said substrate comprises one or more synthetic polymers.

16. A biocompatible implant according to claim 15 wherein said synthetic polymer comprises one or more of polyvinyl alcohol, oligo[poly(ethylene glycol) fumarate] (OPF), poly(glycolic acid) (PGA), poly(lactic acid) (PLA), and poly(lactic-co-glycolic acid) (PLGA).

17. A biocompatible implant according to any one of claims 1 to 7 wherein the substrate comprises or consist of a bioceramic material or a biodegradable metallic material.

18. A biocompatible implant according to any one of the preceding claims wherein the substrate further comprises one or more cell adhesion peptides and/or one of more extracellular growth factors.

19. A biocompatible implant according to any one of the preceding claims wherein the modulator is a miR-29 mimic or precursor which comprises one or more modified sugar residues.

20. A biocompatible implant according to any one of the preceding claims wherein the modulator is a miR-29 mimic or precursor which comprises one or more modified internucleoside linkages.

21. A biocompatible implant according to any one of the preceding claims wherein the modulator is a miR-29 mimic or precursor which comprises one or more modified bases.

22. A biocompatible implant according to any one of the preceding claims wherein the modulator is a miR-29 mimic or precursor which comprises a membrane transit moiety.

23. A biocompatible implant according to any one of the preceding claims wherein the modulator is a miR-29, mimic, precursor or nucleic acid which is in association with (e.g. complexed with or encapsulated by) a carrier.

24. A biocompatible implant according to claim 23 wherein the carrier comprises a pharmaceutically acceptable lipid or polymer.

25. A biocompatible implant according to claim 23 or claim 24 wherein the carrier molecule comprises a targeting agent capable of binding to the surface of a target cell.

26. A biocompatible implant according to any one of claims 1 to 18 wherein the modulator is a nucleic acid which is comprised within a viral vector.

27. A biocompatible implant according to claim 26 wherein the viral vector is an adenovirus, adeno-associated virus (AAV), retrovirus or herpesvirus vector.

28. A biocompatible implant according to claim 27 wherein the retroviral vector is a lentiviral vector.

29. A biocompatible implant according to any one of the preceding claims wherein the miR-29 is miR-29a, miR-29b1, miR29b2 or miR-29c or a combination thereof.

30. A biocompatible implant according to claim 29 wherein the combination comprises miR-29a.

31. A biocompatible implant according to any one of the preceding claims wherein the modulator is or encodes a miR-29 or mimic thereof which comprises a guide strand comprising the seed sequence AGCACCA.

32. A biocompatible implant according to claim 31 wherein the guide strand comprises the sequence: TABLE-US-00019 (hsa-miR-29a) UAGCACCAUCUGAAAUCGGUUA; (hsa-miR-29b1;ha-miR-29b2) UAGCACCAUUUGAAAUCAGUGUU; or (ha-miR-29c) UAGCACCAUUUGAAAUCGGUUA.

33. A biocompatible implant according to any one of the preceding claims wherein the modulator is or encodes a precursor which is pre-mir-29.

34. A biocompatible implant according to claim 33 wherein the pre-mir-29 comprises the sequence: TABLE-US-00020 (hsa-pre-mir-29a:alternative(i)) AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUC UGAAAUCGGUUAU; (hsa-pre-mir-29a:alternative(ii)) AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUC UGAAAUCGGUUAUAAUGAUUGGGG; (hsa-pre-mir-29b1) CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCU AGCACCAUUUGAAAUCAGUGUUCUUGGGGG; (hsa-pre-mir-29b2) CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUC UAGCACCAUUUGAAAUCAGUGUUUUAGGAG; or (ha-pre-mir-29c) AUCUCUUACACAGGCUGACCGAUUUGUCCUGGUGUUCAGAGUCUGUUUUUG UCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGA (wherein the mature guide strand sequences are underlined).

35. A biocompatible implant according to any one of claims 1 to 32 wherein the modulator is or encodes a miR-29 mimic which comprises a guide strand comprising the sequence: TABLE-US-00021 UAGCACCAUCUGAAAUCGGUUA(hsa-miR-29a); UAGCACCAUUUGAAAUCAGUGUU(hsa-miR-29b1and2); or UAGCACCAUUUGAAAUCGCUUA(hsa-miR-29c) (wherein the seed sequence is underlined in each case); or which differs from said sequence at: (i) no more than three positions within the seed sequence; and (ii) no more than five positions outside the seed sequence.

36. A biocompatible implant according to any one of the preceding claims for use in a method of tendon therapy, e.g. in a method of surgery performed on a subject in need thereof.

37. A method of tendon therapy comprising locating a biocompatible implant according to any one of claims 1 to 35 at a site of injury.

38. Use of a modulator of tendon healing in the preparation of a biocompatible implant according to any one of claims 1 to 35, for use in a method of tendon therapy.

39. Use according to claim 38 wherein the modulator is incorporated into the substrate before the implant is introduced to a target site.

40. Use according to claim 38 wherein the substrate is introduced to a target site and the modulator subsequently applied to the substrate in situ.

41. A modulator of tendon healing for use in a method of tendon therapy; wherein said method comprises applying said modulator to a biocompatible substrate capable of supporting growth of tendon cells; wherein said biocompatible substrate is located at a site of tendon injury; and wherein said modulator is: (i) miR-29, a mimic thereof, or a precursor of either; or (ii) a nucleic acid encoding miR-29, a mimic thereof, or a precursor of either.

42. Use of a modulator of tendon healing in the preparation of a pharmaceutically acceptable composition; wherein said composition is for use in a method of tendon therapy which comprises applying said composition to a biocompatible substrate capable of supporting growth of tendon cells; wherein said biocompatible substrate is located at a site of tendon injury; and wherein said modulator is (i) miR-29, a mimic thereof, or a precursor of either; or (ii) a nucleic acid encoding miR-29, a mimic thereof, or a precursor of either.

43. A method of tendon therapy comprising locating a biocompatible substrate capable of supporting growth of tendon cells at a site of tendon injury, and applying a modulator of tendon healing to the biocompatible substrate, wherein said modulator is (i) miR-29, a mimic thereof, or a precursor of either; or (ii) a nucleic acid encoding miR-29, a mimic thereof, or a precursor of either.

44. A kit comprising (a) a biocompatible substrate capable of supporting growth of tendon cells, and (b) a modulator of tendon healing, wherein said modulator is: (i) miR-29, a mimic thereof, or a precursor of either; or (ii) a nucleic acid encoding miR-29, a mimic thereof, or a precursor of either.

Description

DESCRIPTION OF THE DRAWINGS

[0258] FIG. 1: IL-33/ST2 expression in tendon.

[0259] (A) IL-33, (B) soluble ST2 (sST2) and (C) membrane ST2 (mST2) gene expression in tendon samples. Fold change in gene expression of IL-33, Soluble/Membrane ST2 in control (n=10), torn supraspinatus and matched subscapularis human tendon samples (n=17). Data points shown are relative expression compared to housekeeping gene 18S (mean of duplicate analysis). MeanSD reflects patient population comparisons by t-test. (D) Modified Bonar scoring for samples of tendon with mean and SEM shown. n=10 for control tendon (Ctl), n=17 for torn tendon and early tendinopathy. Modified Bonar scoring system depicts mean score per sample based on 10 high power field. 0=no staining, 1=<10%, 2=10-20%, 3=>20%+ve staining of cells per high power field. (E) Fold change in gene expression of IL-33, and ST2, 24 hours post incubation with respective doses of TNF alone, IL-1 alone and in combination. Data shown as the meanSD of triplicate samples and are in turn, representative of experiments performed on three individual patient samples. *p<0.05, **p<0.01 compared to control samples. (F) Fold change in gene expression of coil and col3 with 50 and 100 g/ml rhIL-33 24 hours post incubation. (G) Time course for coil and col3 gene expression following incubation with 100 g/ml IL-33. (H) Collagen 1 and 3 protein expression 24 hours post incubation with increasing concentrations of rhIL-33. For F, G and H, data are shown as the meanSD of triplicate samples and are in turn, representative of experiments performed on three individual patient samples. *p<0.05, **p<0.01 compared to control samples.

[0260] FIG. 2: IL-33/ST2 axis in tendon healing in vivo.

[0261] (A,B) IL-33 gene expression and soluble ST2 gene expression on Days 1,3,7 and 21 post injury. Data shown are the mean fold changeSD (pooled data from 4 mice per group performed on four sequential occasions therefore n=16 per condition) *p<0.05, **p<0.01 control versus injured mice. (C,D) coil mRNA and collagen 1 protein levels in WT and ST2/ post injury on Days 1 and 3 post injury. (E,F) col3 mRNA and collagen 3 protein levels in WT and ST2/ on days 1 and 3 post injury. Data shown are meanSD of duplicate samples and are representative of experiments using four mice per condition (n=16). *p<0.05, **p<0.01 control versus injured mice. +p<0.05, ++p<0.01 WT injured versus ST2/ injured mice. (G) percentage change in tendon strength for WT and ST2/ injured and uninjured tendons on days 1 and 3 post injury. Data are shown as the meanSD and are representative of experiments using four mice per condition (n=16). *p<0.05, **p<0.01 control versus injured mice. # p<0.05 ST2/ injured versus WT injured mice.

[0262] FIG. 3: IL-33 promotes collagen 3 production and reduced tendon strength while anti IL-33 attenuates these changes in tendon damage in vivo.

[0263] (A) coil mRNA, (B) Collagen 1 protein, (C) col3 mRNA and (D) Collagen 3 protein in WT and ST2/ mice treated with rhIL-33 on Day 1 post injury. Data are shown as the meanSD of duplicate samples and are representative of experiments using four mice per condition (n=16). *p<0.05,**p<0.01, injured versus uninjured mice. +p<0.05 WT versus ST2/ mice. (E) percentage change in tendon strength in WT uninjured mice on Days 1 and 3 post treatment with rhIL-33. Data are shown as the meanSD and are representative of experiments using four mice per group (n=16). **p<0.01, injured versus uninjured mice. (F) coil mRNA, (G) collagen 1 protein, (H) col3 mRNA and (I) collagen 3 protein levels post treatment with anti-IL-33 at days 1 and 3 post tendon injury in WT mice. (J) percentage change in tendon strength in anti IL-33 treatment WT mice on days 1 and 3 post injury. Data are shown as the meanSD and are representative of experiments using four mice per condition (n=16). *p<0.05,**p<0.01, injured versus uninjured mice. A-J, Data are shown as the meanSD of duplicate samples and are representative of experiments using four mice per condition (n=16)

[0264] FIG. 4: MicroRNA 29 directly targets soluble ST2-implications for collagen matrix changes in tendon disease.

[0265] (A) All members of the miR-29 family (miR-29a, miR-29b, and miR-29c) were expressed in tendinopathic tenocytes (n=6 patient samples). Lower Ct values indicate higher levels of expression. miR-29 family gene expression in Control, torn supraspinatus (Torn Tendon) and matched subscapularis tendon (Early Tendinopathy). Data shown as the meanSD of duplicate samples and represent experiments on ten patient samples. *p<0.05, **p<0.01. (B) Time course of miR-29a expression following the addition of 100 ng/ml of rhIL-33. (C&D) coil and col3 mRNA and Collagen 1 and 3 protein expression following transfection with scrambled mimic, miR-29a mimic or miR29a antagomir. (E) Collagen 3 protein levels following addition of miR-29a mimic/antagomir and 100 ng rhIL-33. For B-E data shown are the meanSD of duplicate samples and represent experiments on five tendon explant samples. (n=5) p<0.05, **p<0.01 (F) Luciferase activity in primary human tenocytes transfected with precursor miR-29a containing 3UTR of Col 1a1, Col1a2 or Col 3a1. Activity was determined relative to controls transfected with scrambled RNA, which was defined as 100%. This was repeated in 3 independent experiments. * p<0.05, **p<0.01 versus scrambled control. (G) miR-29a binding sites and MRE's on col3a1 and col1a1/col1a2 long/short forms highlighting alternative polyadenisation sites. (H) percentage of long/short collagen transcripts in tenocytes (T) following transfection with miR-29a. (I) col1a1, col1a2 and col3a1 mRNA following transfection with scrambled mimic and miR-29a antagomir. Data shown are the meanSD of duplicate samples and represent experiments on three tendon explant samples. (n=3) p<0.05, **p<0.01

[0266] FIG. 5: IL-33/ST2 regulates miR-29 in tendon healing in vivo

[0267] (A) Cotransfection of HEK 293 cells with pre-miR-29a containing 3UTR of soluble ST2 together with miRNA Regulatory Elements (MRE's) of 3UTR of soluble ST2 and resultant luciferase activity assay. *** p<0.001 versus scrambled control (n=3) (B) sST2 and membrane bound ST2 mRNA levels following addition of scrambled mimic miR-29a mimic or miR-29a antagomir (C) human sST2 protein production (ng/ml) following incubation with miR29a mimic/antagomir. (n=5) p<0.05, **p<0.01.

[0268] (D) Quantitative PCR showing mean fold changeSD in miR-29a in WT injured versus uninjured animals on days 1 and 3 post injury. (E) Quantitative PCR showing mean fold changeSD in miR-29a in WT and ST2/ mice in injured versus uninjured animals following treatment with rhIL-33 or PBS on Day 1 post injury. (F) miR-29a expression following the addition of anti IL-33 in post injured WT animals on days 1 and 3/Data are shown as the mean fold changeSD of duplicate samples and are representative of experiments using four mice per group (n=16) p<0.05, **p<0.01.

[0269] FIG. 6: IL-33/miR-29 axis in tendon pathology.

[0270] Schematic diagram illustrating the role of the IL-33/miR-29a in tendon pathology. An tendon injury or repetitive micro tears causing stress that a tendon cell experiences results in the release IL-33 and the downstream phosphorylation of NFkB which in turn represses miR-29a causing an increase in collagen type 3 and soluble ST2 production. An increase in collagen 3 reduces the tendons ultimate tensile strength lending it to early failure while soluble ST2 acts in an autocrine fashion which may ultimately be a protective mechanism whereby excess IL-33 is removed from the system.

[0271] FIG. 7

[0272] (A) Figure showing seed regions of the two Targetscan predicted miR-29a MRE sites: 29-1 and 29-2 (B) Luciferase activity in HEK 293 cells transfected with precursor miR-29 a/b/c (pre-miR-29) containing 3UTR of Col 1 or Col 3. Activity was determined relative to controls transfected with scrambled RNA, which was defined as 100%. This was repeated in 3 independent experiments. * p<0.05, **p<0.01 versus scrambled control. (C) Cotransfection of HEK 293 cells with pre-miR-29a,b.c containing 3UTR of soluble ST2 showing miR-29a significantly reducing the relative luciferase activity as compared with the scrambled RNA-transfected controls (n=3)

[0273] (D) The remaining miR-29 binding site present in the short col3a1 3UTR variant was tested in a luciferase assay for its sensitivity to miR-29a and found to be fully active.

[0274] (E) Sequences of 3RACE products of tenocyte collagen transcripts from human and horse. Polyadenylation signals are underlined. The miR29a MRE is shown in italics in the human Col3a1(short 3UTR) transcript and the horse Col3a1 transcript.

[0275] FIG. 8

[0276] (A) Col3 mRNA, (B) Collagen 3 protein, (C) Coil mRNA and (D) Collagen 1 protein levels post treatment with miR-29a mimic after tendon injury in WT mice. Data for mRNA are total copy number of gene vs 18S housekeeping gene in duplicate samples. Data are meanSD of duplicate samples, representative of 6 mice per group, *p<0.05, **p<0.01 vs control. (ANOVA)

DETAILED DESCRIPTION OF THE INVENTION

Materials and Methods

Human Model of Tendinopathy

[0277] All procedures and protocols were approved by the Ethics Committee under ACEC No. 99/101. Fifteen supraspinatus tendon samples were collected from patients with rotator cuff tears undergoing shoulder surgery (Table 1). The mean age of the rotator cuff ruptured patients was 54 years (range, 35-70 years)the mean tear size was 2.5 cm. Samples of the subscapularis tendon were also collected from the same patients. Patients were only included if there was no clinically detectable evidence of subscapularis tendinopathy on a preoperative MRI scan or macroscopic damage to the subscapularis tendon at the time of arthroscopyby these criteria they represented a truly pre-clinical cohort. An independent control group was obtained comprising 10 samples of subscapularis tendon collected from patients undergoing arthroscopic surgery for shoulder stabilization without rotator cuff tears. The absence of rotator cuff tears was confirmed by arthroscopic examination. The mean age of the control group was 35 years (range, 20-41 years).

Tissue Collection and Preparation

[0278] Arthroscopic repair of the rotator cuff was carried out using the standard three-portal technique as described previously described. The cross-sectional size of the rotator cuff tear was estimated and recorded as described previously.sup.39. The subscapularis tendon was harvested arthroscopically from the superior border of the tendon 1 cm lateral to the glenoid labrum. The supraspinatus tendon was harvested from within 1.5 cm of the edge of the tear prior to surgical repair. For immunohistochemical staining the tissue samples were immediately fixed in 10% (v/v) formalin for 4 to 6 hours and then embedded in paraffin. Sections were cut to 5 m thickness using a Leica-LM microtome (Leica Microsystems, Germany) and placed onto Superfrost Ultra Plus glass slides (Gerhard Menzel, Germany). The paraffin was removed from the tissue sections with xylene, rehydrated in graded alcohol and used for histological and immunohistochemical staining per previously established methodologies.sup.40.

[0279] Human tendon derived cells were explanted from hamstring tendon tissue of 5 patients (age 18-30 years) undergoing hamstring tendon ACL reconstruction. Cultures were maintained at 37 C. in a humidified atmosphere of 5% CO.sub.2 for 28 days. Cells were subcultured and trypinized at subconfluency, Cells from the 3.sup.rd and 4.sup.th passage were used in normoxic conditions.

Histology and Immunohistochemistry Techniques

[0280] Human sections were stained with haematoxylin and eosin and toluidine blue for determination of the degree of tendinopathy as assessed by a modified version of the Bonar score.sup.41 (Grade 4=marked tendinopathy, Grade 3=advanced tendinopathy, 2=moderate degeneration 1=mild degeneration 0=normal tendon). This included the presence or absence of oedema and degeneration together with the degree of fibroblast cellularity and chondroid metaplasia. Thereafter, sections were stained with antibodies directed against the following markers:IL-33 (Alexis, mouse monoclonal), ST2 (Sigma Aldrich, rabbit polyclonal), IL-1RaCP (ProSci, rabbit polyclonal) CD68 (pan macrophages), CD3 (T cells), CD4 (T Helper cells), CD206 (M.sub.2 macrophages), and mast cell tryptase (mast cells) (Vector Labs).

[0281] Endogenous peroxidase activity was quenched with 3% (v/v) H.sub.2O.sub.2, and nonspecific antibody binding blocked with 2.5% horse serum in TBST buffer for 30 minutes. Antigen retrieval was performed in 0.01M citrate buffer for 20 minutes in a microwave. Sections were incubated with primary antibody in 2.5% (w/v) horse serum/human serum/TBST at 4 C. overnight. After two washes, slides were incubated with Vector ImmPRESS Reagent kit as per manufactures instructions for 30 minutes. The slides were washed and incubated with Vector ImmPACT DAB chromagen solution for 2 minutes, followed by extensive washing. Finally the sections were counterstained with hematoxylin. Positive (human tonsil tissue) and negative control specimens were included, in addition to the surgical specimens for each individual antibody staining technique. Omission of primary antibody and use of negative control isotypes confirmed the specificity of staining.

[0282] We applied a scoring system based on previous methods.sup.42 to quantify the immunohistochemical staining. Ten random high power fields (400) were evaluated by three independent assessors (NLM, JHR, ALC). In each field the number of positive and negatively stained cells were counted and the percentage of positive cells calculated giving the following semi-quantitative grading; Grade 0=no staining, Grade 1=<10% cells stained positive, 2=10-20% cells stained positive, Grade 3=>20% cells positive.

[0283] Mouse sections were processed using the above protocol with antibodies directed against the following markers:IL-33 (R&D systems, mouse monoclonal), ST2 (Sigma Aldrich, rabbit polyclonal), F4/80 (Serotec, mouse monoclonal) and Anti-Histamine (Sigma Aldrich, rabbit polyclonal).

Matrix Regulation

[0284] Tenocytes were evaluated for immunocytochemical staining of collagen 1 and collagen 3 to assess tenocyte matrix production (Abcam). Total soluble collagen was measured from cell culture supernatants using the Sircol assay kit (Biocolor Ltd, Carrickfergus, Northern Ireland) according to the manufacturer's protocol. 1 ml of Sircol dye reagent was ded to 100 l test sample and mixed for 30 min at room temperature. The collagen-dye complex was precipitated by centrifugation at 10,000g for 10 min; and then washed twice with 500 l of ethanol. The pellet was dissolved in 500 l of alkali reagent. The absorbance was measured at 540 nm by microplate reader. The calibration curve was set up on the basis of collagen standard provided by the manufacturer. Additionally the concentration of human and mouse collagen 1 and 3 was assessed using ELISA with colour change measured at 450 nm by microplate reader along with standards supplier by the manufacturer (USCNK Life Science Inc).

Signalling Experiments

[0285] Phosphorylation status of mitogen-activated protein kinases (MAPKs), extracellular signal regulated kinases (ERK1/2), c-Jun N-terminal kinases (JNKs) and p38 isoforms were evaluated using the Human Phospho-MAPK Array (R & D Systems Europe, UK) as per the manufacturer's instructions. The ERK inhibitor (FR180204) was purchased from CalbioChem (Merck KGaA, Germany) and used at IC.sub.50=10 M, a concentration previously determined to offer optimal specific inhibition relative to off target effects which was used previously in our laboratory.sup.43.

[0286] Phosphorylation of NEK p65 was assessed using the InstantOne ELISA in cell lysates from treated and untreated tencocytes. The absorbance was measured at 450 nm by microplate reader with positive and negative controls supplied by the manufacturer. The relative absorbance of stimulated versus unstimulated cells was used to assess the total or phosphorylated NFK p65 in each sample.

RNA Extraction and Quantitative PCR

[0287] The cells isolated from the normoxic and hypoxic experiments Trizol prior to mRNA extraction. QIAgen mini columns (Qiagen Ltd, Crawley UK) were used for the RNA clean-up with an incorporated on column DNAse step as per manufactures instructions. cDNA was prepared from RNA samples according to AffinityScript (Agilent Technologies, CA, USA) multiple temperature cDNA synthesis kit as per manufactures instructions. Real time PCR was performed using SYBR green or Tagman FastMix (Applied Biosystems, CA, USA) according to whether a probe was used with the primers. The cDNA was diluted 1 in 5 using RNase-free water. Each sample was analysed in triplicate. Primers (Integrated DNA Technologies, Belgium) were as follows: GAPDH, 5-TCG ACA GTC AGC CGC ATC TTC TTT-3 (f) and 5-ACC AAA TCC GTT GAC TCC GAC CTT-3 (r); IL-33 human GGA AGA ACA CAG CAA GCA AAG CCT (f) TAA GGC CAG AGC GGA GCT TCA TAA (r); IL-33 murine GGA AGA ACA CAG CAA GCA AAG CCT (f) TAA GGC CAG AGC GGA GCT TCA TAA (r); Total ST2 human ACA ACT GGA CAG CAC CTC TTG AGT (f) ACC TGC GTC CTC AGT CAT CAC ATT (r); sST2 murine CCA ATG TCC CTT GTA GTC GG (f) CTT GTT CTC CCC GCA GTC (r) TCC CCA TCT CCT CAC CTC CCT TAA T (probe); ST2L murine TCT GCT ATT CTG GAT ACT GCT TTC, TCT GTG GAG TAC TTT GTT CAC C (r) AGA GAC CTG TTA CCT GGG CAA GAT G (probe); human ST2L ACA AAG TGC TCT ACA CGA CTG (f) TGT TCT GGA TTG AGG CCA C (r); CCC CAT CTG TAC TGG ATT TGT AGT TCC G (probe); human sST2 GAG ACC TOO CAC GAT TAC AC (f) TGTTAAACCCTGAGTTCCCAC (r), CCC CAC ACC CCT ATC CTT TCT CCT (probe); Col 3A Human TTG GCA GCA ACG ACA CAG AAA CTG (f) TTG AGT GCA GGG TCA GCA CTA CTT (r) Col 3A Mouse GCT TTG TGC AAA GTG GAA CCT GG (f) CAA GGT GGC TGC ATC CCA ATT CAT (r); COL 1A1 Human CCA TGC TGC CCT TTC TGC TCC TTT (f) CAC TTG GGT GTT TGA GCA TTG CCT (r) COL 1A1 Mouse TTC TCC TGG CAA AGA CGG ACT CAA (f) GGA AGC TGA AGT CAT AAC CGC CA (r)

RNA Isolation and Quantitative Real Time PCR Analysis of miRNA

[0288] Total RNA was isolated by miRNeasy kit (Qiagen). miScript Reverse Transcription Kit (Qiagen) was used for cDNA preparation. TaqMan mRNA assays (Applied Biosystems) or miScript primer assay (Qiagen) were used for semi-quantitative determination of the expression of human miR-29a (MS (MS00001701) 29b (MS00006566) and c (MS00009303) and mouse 29a (MS00003262), 29b (MS00005936) and c (MS00001379). The expressions of U6B small nuclear RNA or beta-actin were used as endogenous controls.

Quantification of Alternative Polyadenylated Collagen Transcripts

[0289] The absolute levels of long and short 3UTR forms of type 1 and 3 transcripts were determined by q-PCR relative to standards. cDNA was generated using AffinityScript (Agilent) with both random hexamer and oligo-dT primers. SYBR green Quantitative-PCR was performed using the following primers: Samples were normalised to GAPDH endogenous control.

TABLE-US-00014 Col1a2_SFW5 GCCTGCCCTTCCTTGATATT3 Col1a2_SREV5 TGAAACAGACTGGGCCAATG3 col1a2_LFW5 TCAGATACTTGAAGAATGTTGATGG3 col1a2_LREV5 CACCACACGATACAACTCAATAC3 Col1a1_SFW5 CTTCACCTACAGCGTCACT3 Col1a1_SREV5 TTGTATTCAATCACTGTCTTGCC3 col1a1_LFW5 CCACGACAAAGCAGAAACATC3 col1al_LREV5 GCAACACAGTTACACAAGGAAC3 COL3A1_SFW5 CTATGACATTGGTGGTCCTGAT3 COL3A1_SREV5 TGGGATTTCAGATAGAGTTTGGT3 COL3A1_LFW5 CCACCAAATACAATTCAAATGC3 COL3A1_LREV5 GATGGGCTAGGATTCAAAGA3
3 Rapid Extension of cDNA Ends (RACE)

[0290] To characterize human sequences, 3RACE was performed on cDNA that had been generated from total RNA isolated from human tenocytes using MiRscript II reverse transcriptase kit (Qiagen). cDNA ends were amplified by PCR using the following gene specific forward primers listed below along with the Universal reverse primer from the kit.

[0291] Human 3RACE gene specific forward primers:

TABLE-US-00015 RACE-Col1a1-LFW5 GACAACTTCCCAAAGCACAAAG3 RACE-Col1a1-SFW5 CTTCCTGTAAACTCCCTCCATC3 RACE-Col1a2-LFW5 TCTTCTTCCATGGTTCCACAG3 RACE-Col1a2-SFW5 CCTTCCTTGATATTGCACCTTTG3 RACE-Col3a1-LFW5 CTATGACATTGGTGGTCCTGAT3 RACE-Col3a1-SFW5 GTGTGACAAAAGCAGCCCCATA3

[0292] To characterise horse sequences, the 3UTRs of Col1a1, Col1a2 and Col3a1 transcripts expressed in equine tenocytes were amplified using 3 Rapid Extension of cDNA Ends (3RACE). The amplified cDNA fragments were sequenced and the polyA signal identified according to the location of AATAAA canonical polyA signal located 10 and 30 nucleotides 5 to the polyA tail.

[0293] Horse 3RACE primers:

TABLE-US-00016 Horsecol1a1GSP1CCCTGGAAACAGACAAACAAC Horsecol1a1GSP2CAGACAAACAACCCAAACTGAA Horsecol1a2GSP1GCTGACCAAGAATTCGGTTTG Horsecola2GSP2ACATTGGCCCAGTCTGTTT Horsecol3a1GSP1AGGCCGTGAGACTACCTATT Horsecol3a1GSP2CTATGATGTTGGTGGTCCTGAT Horsecol1a1q-PCRfwCAGACTGGCAACCTCAAGAA Horsecol1a1q-PCRrevTAGGTGACGCTGTAGGTGAA Horsecol1a2q-PCRfwGGCAACAGCAGGTTCACTTAT Horsecol1a2q-PCRRevGCAGGCGAGATGGCTTATTT Horsecol3a1q-PCRfwCTGGAGGATGGTTGCACTAAA Horsecol3a1q-PCRrevCACCAACATCATAGGGAGCAATA

[0294] The resulting PCR products were cloned into pCR2.1 TOPO (Invitrogen) and sequenced.

miRNA Transfection

[0295] Cells were transfected with synthetic mature miRNA for miR 29 a&b or with negative control (C. elegans miR-67 mimic labelled with Dy547, Thermo Scientific Inc) at a final concentration of 20 nM with the use of Dharmacon DharmaFECT 3 siRNA transfection reagents (Thermo Scientific Inc). At 48 hours after transfection cellular lysates were collected to analyse the expression of genes of interest.

[0296] Transfection efficiency was assessed by flow cytometry using the labelled Dy547 mimic and confirmed by quantitative PCR of control-scrambled mimic and the respective miR29 family mimic.

Luciferase Reporter Assay for Targeting Collagen 1 & 3 and Soluble ST2

[0297] The human 2 miRNA target site was generated by annealing the oligos: for COL 1 & 3 and soluble ST2 3UTR's which were cloned in both sense and anti-sense orientations downstream of the luciferase gene in pMIR-REPORT luciferase vector (Ambion). These constructs were sequenced to confirm inserts and named pMIR-COL I/COL III/sST2-miR29a/b/c and pMIR(A/S)-COL I/COL III/sST2-miR29a/b/c, and used for transfection of HEK293 cells. HEK293 cells were cultured in 96-well plates and transfected with 0.1 g of either pMIR-COL I/COL III/sST2-miR29a/b/c, pMIR(A/S)-COL I/COL III/sST2-miR29a/b/c or pMIR-REPORT, together with 0.01 g of pRL-TK vector (Promega) containing Renilla luciferase and 40 nM of miR-155 or scrambled miRNA (Thermo Scientific Dharmacon). Transfections were done using Effectene (Qiagen) according manufacturer's instructions. Twenty-four hours after transfection, luciferase activity was measured using the Dual-Luciferase Reporter Assay (Promega). The 3UTR of human sST2 was amplified from genomic DNA using the following primers sST2fw 5AGTTTAAACTGGCTTGAGAAGGCACACCGT3 and sST2rev 5AGTCGACGGGCCAAGAAAGGCTCCCTGG3 which created PmeI and SalI sites respectively. These sites where used to clone the PCR amplified product into the same sites of pmiRGLO (Promega). The seed regions of the two Targetscan predicted miR29a MRE sites: 29-1 and 29-2 were mutated using the QuickChange site-directed mutagenesis kit (Agilent). Each vector along with miR29a or scrambled control mimic were transfected into HEK293 cells using Attactene (Qiagen) according to manufactures instructions. After 24 hours luciferase activity was measured using Dual-Glo luciferase assay (Promega) with luciferase activity being normalized to Renilla. Normalized luciferase activity was expressed as a percentage of scrambled control for the same constructs.

Cytokine Production

[0298] A 25-Plex human cytokine assay evaluated the in vitro quantitative determination of 25 separate human cytokines using Luminex technology. Supernatants (n=3)

Patellar Tendon Injury Model

[0299] In preparation for the surgical procedure, mice were anesthetised with a mixture of isofluorane (3%) and oxygen (1%) and both hind limbs were shaved. During the surgical procedure, anaesthesia was delivered via a nose cone with the level of isofluorane reduced to 1% with the oxygen. Following a skin incision, two cuts parallel to the tendon were made in the retinaculum on each side, a set of flat faced scissors were then placed underneath the patellar tendon. With the scissor blades serving as a support, a 0.75 mm diameter biopsy punch (World Precision Instruments) was used to create a full thickness partial transection in the right patellar tendon. The left patellar tendon underwent a sham procedure, which consisted of only placing the plastic backing underneath the tendon without creating and injury. The skin wounds were closed with skin staples and the mice were sacrificed at 1 day, 3 days and 7 and 21 days post-surgery. Mice were sacrificed by CO.sub.2 inhalation and immediately weighted. Mice from two groups BALB/c control (CTL) and ST2/ BALB/c were used. Each group contained 16 mice (n=8 ST2/ BALB/c and 8 BALB/c) per time point. These experiments were repeated on 4 separate occasions.

[0300] To test if IL-33 induced tendon matrix dysregulation a cytokine injection model was established. IL-33 was tested in a previously reported model initially described for the application of IL-23 or IL-22.sup.44-45 ST2/ mice (n=4/group/treatment/experiment) were injected i.p. daily with IL-33 (0.2 g per mouse diluted in 100 L PBS) on days-3, -2, -1 and the day of injury. 24 hours following the final injection mice were culled as per protocol. Control mice similarly received an equal volume of PBS. We also tested neutralising antibodies to IL-33 (0.5 g/ml R&D systems) by injecting i.p immediately post injury in WT and ST2/ mice with IgG controls again with 4/group/treatment/experiment.

Biomechanical Analysis

[0301] For the biomechanical analysis, the patellar tendons of mice from each group were injured and eight mice sacrificed at one of three time points for mechanical testing as described previously by Lin et al.sup.10. Briefly, the patellar tendons were dissected and cleaned, leaving only the patella, patellar tendon and tibia as one unit. Tendon width and thickness were then quantified and cross sectional area was calculated as the product of the two. The tibia was the embedded in Isopon p38 (High Build Cellulose Filler) in a custom designed fixture and secured in place in a metal clamp. The patella was held in place by vice grips used with the BOSE ElectroForce 3200 test instrument. Each tendon specimen underwent the following protocol immersed in a 3700 saline bathreloaded to 0.02N, preconditioned for 10 cycles from 0.02 to 0.04 at a rate of 0.1%/s (0.003 mm/s), and held for 10 s. Immediately following, a stress relaxation experiment was performed by elongating the tendon to a strain of 5% (0.015 mm) at a rate of 25% (0.75 mm/s), followed by a relaxation for 600 s. Finally a ramp to failure was applied at a rate of 0.1%/s (0.003 mm/s). From these tests, maximum stress was determined and modulus was calculated using linear regression from the near linear region of the stress strain curve.

In Vivo Administration of miR29a Mimic

[0302] A transfection complex was prepared containing 150 ng/ml miR-29a mimic, 9 g/ml polyethylenimine (PEI) and 5% glucose. 50 l of this complex was injected into mouse patellar tendon immediately after surgery. Animals were sacrificed after 1 and 3 days and col1a1 and col3a1 mRNA and protein levels were measured. Fluorescently labelled miR-29a mimic was used to assess the in vivo distribution of miR-29a mimic in the tendon by immunofluorescence, using counterstains for phalloidin (to show cytoskeletal structure) and nuclei (DAPI).

[0303] The miR29a mimic was as follows:

[0304] Passenger strand:

TABLE-US-00017 mAmCrCmGrAmUrUmUrCmArGmArUmGrGmUrGmCrUmAdG

[0305] Guide strand:

TABLE-US-00018 /5Phos/rUrArGrCrArCrCrArUrCrUrGrArArArUrCrGrGmUm UmA
/5Phos/=5 phosphate
mA=2O-methyl adenosine ribonucleotide;
mC=2O-methyl cytosine ribonucleotide;
mG=2O-methyl guanine ribonucleotide;
mU=2O-methyl uracil ribonucleotide;
rA=adenosine ribonucleotide;
rC=cytosine ribonucleotide;
rG=guanine ribonucleotide;
rU=uracil ribonucleotide;

Statistical Analysis

[0306] All results are displayed as mean+/standard error mean (SEM) and all statistical analysis was done either by students T test, ANOVA test or Mann Whitney test, as indicated in figure legends, using the Graph Pad Prism 5 software. A p value of <0.05 was considered statistically significant.

Results

IL-33 and ST2 Expression in Human Tendinopathy

[0307] We first investigated IL-33 expression in human tendinopathy using our previously developed model.sup.22. IL-33, soluble and membrane bound ST2 transcripts were significantly upregulated in early tendinopathy compared to control or torn tendon biopsies (FIG. 1A-C). Early tendinopathy tissues exhibited significantly greater staining for IL-33 and ST2 compared to torn tendon or control biopsies (FIG. 1D). Staining was prominent in endothelial cells and particularly fibroblast-like cells, namely tenocytes that are considered pivotal to the regulation of early tendinopathy (data not shown). In parallel, in vitro cultured tenocytes expressed nuclear IL-33 that was up regulated at both mRNA and protein levels following stimulation by TNF and IL-1p (FIG. 1E and data not shown). In contrast ST2 was constitutively expressed in both resting and unstimulated tenocytes (data not shown).

IL-33 Regulates Tenocyte Collagen Matrix and Proinflammatory Cytokine Synthesis

[0308] Matrix dysregulation towards collagen 3 expression is a key early phenotypic change in tendinopathy thereby hastening repair; collagen 3 is however biomechanically inferior. IL-33 induced dose and time dependent upregulation of total collagen protein (data not shown), accounted for by increased expression of type 1 but particularly type 3 collagen mRNA and protein (FIG. 1F, G). Following array analysis (data not shown) and consistent with reported IL-33 downstream signalling.sup.12,16, this was abrogated by ERK inhibition (data not shown). rhIL-33 also significantly elevated production of IL-6, IL-8 and MCP-1 (data not shown), which was regulated by NF-kB inhibition suggesting that IL-33 operates in tenocytes via its canonical IL-1R signalling pathway (data not shown). In contrast we found no effect on production of other cytokines in keeping with previously reported IL-33 induced cytokine production profiles in fibroblasts.sup.20-23.

Modelling IL-33/ST2 Pathway In Vivo Following Tendon Injury

[0309] We extended these observations to a well-established in vivo model of tendon injury. IL-33 mRNA was elevated on days 1 and 3 post tendon injury in WT mice (FIG. 2A). This was significantly reduced in injured ST2/ mice suggesting autocrine regulation. Soluble ST2 was significantly up regulated at all time points post injury in WT mice compared to uninjured controls (FIG. 2B) whereas membrane ST2 mRNA was elevated only by Day 3 post injury (data not shown). No significant changes in IL-33 or ST2 transcript or protein expression were found in WT mice at days 7 or 21 post-injury, or for IL-33 expression in ST2/ mice, suggesting that the impact of IL-33 expression is manifest early, in keeping with alarmin type activity in tendon injury/repair.

[0310] Analysis of collagen synthesis revealed significantly greater expression of collagen 3 at all time points post injury in WT mice compared to uninjured controls or injured ST2/ mice (FIGS. 2E, F & data not shown). Collagen 1 was initially down regulated (days 1, 3) at mRNA levels (FIG. 2C) in WT injured mice but reverted towards pre-injury levels by days 7 and 21 (data not shown) with a similar trend in collagen 1 protein expression (FIG. 2D). In contrast, ST2/ injured mice showed prolonged reduction of collagen 1 synthesis (days 1, 3 & 7) returning to baseline only by day 21 (data not shown). Importantly injury of WT mice tendons resulted in a significant decrease in biomechanical strength at Day 1 post injury compared to ST2/ (FIG. 2G) that recovered by days 7 and 21 (data not shown). These data suggest altered collagen matrix synthesis in ST2/ mice implicating IL-33/ST2 as an early modulator of collagen changes in tendon injury that has biomechanical significance.

Manipulating IL-33 Modifies Collagen 3 In Vivo

[0311] To confirm this possibility we sought to directly modify IL-33 effector biology in vivo. Administration of rhIL-33 did not affect collagen 1 synthesis (FIG. 3A,B) but did significantly increase collagen 3 synthesis particularly in injured tendons (FIG. 3D,E and data not shown). Moreover, rhIL-33 administration significantly reduced ultimate tendon strength at all time points post injection in WT mice (FIG. 3E and data not shown) suggesting that such changes were of functional impact. IL-33 administration did not affect collagen matrix synthesis or ultimate tendon strength of the healing tendon in ST2/ mice confirming that IL-33 acted via an ST2-dependent pathway (data not shown).

[0312] We next directly targeted IL-33 in vivo. Neutralising antibodies to IL-33 attenuated the collagen 1 to 3 switch at days 1 and 3 post injury in WT injured mice (FIG. 3F-I) resulting in a significant increase in biomechanical strength at day 1 post injury WT mice tendons (FIG. 3J). This effect was not seen at later time points (data not shown). In control experiments we observed no effect on ST2/ mice (data not shown) further confirming the contribution of endogenous IL-33 to injury-induced tendinopathy.

IL-33 Promotes Differential Regulation of Collagen 1/3 Via miR-29 in Tenocytes

[0313] Having established that IL-33 drives differential regulation of collagen 1 and 3 in tenocytes we postulated a mechanistic role for the miRNA network in this process. Previous studies have shown that the miR-29 family directly targets numerous extracellular matrix genes, including type 1 and 3 collagens.sup.24-25 and is implicated in regulation of innate and adaptive immunity.sup.26. Computational algorithms predict that miR-29 may also target sST2. We found that all members of the miR-29 family were expressed in human tendon biopsies and explanted tenocytes (FIG. 4A) with miR-29a showing the most altered expression. In tenocyte culture IL-33 significantly reduced the expression of miR-29a at 6,12 and 24 hours (FIG. 4B) acting via NFB dependent signalling whereas we observed inconsistent effects on miR-29b and c (data not shown). Since IL-33 mediated collagen 3 matrix changes could be regulated by miR-29a we analysed the functional effects of miR-29a manipulation on collagen matrix synthesis in vitro. Firstly, using luciferase assays, we confirmed that miR-29a directly targets col 1a1 and 3a1 as previously demonstrated.sup.27 (FIG. 7B). We also observed a previously unrecognised interaction with col 1a2 subunit transcript (FIG. 7). To test whether miR-29a indeed regulates the levels of candidate target mRNAs in disease relevant cells, we transfected tenocytes with miR-29a mimic and antagomir. miR-29a manipulation selectively regulated collagen 3 but not collagen 1 mRNA and protein expression in primary tenocytes (FIG. 4C,D). Moreover, miR-29a over expression significantly abrogated IL-33 induced collagen 3 mRNA and protein synthesis (FIG. 4E). Additionally miR-29a inhibition resulted in a significant increase in col 3a1 expression indicating that miR-29a is not only actively regulating these transcripts in human tenocytes but whose loss is an important factor in the increase of type 3 collagen production observed in tendinopathy. In contrast col 1a1 transcript levels were unchanged (FIG. 4I).

[0314] Given that miR-29a was capable of repressing col 1a1 and 1a2 with equal or greater efficiency than collagen 3 in luciferase reporter assays, this was unlikely to be the result of miR-29a having greater affinity for its MREs in type 3 transcripts (FIG. 4F). One well-documented mechanistic explanation for transcripts to modulate their sensitivity to miRNA regulation is through the utilisation of alternative polyadenylation signals (FIG. 4G). To test this, we compared levels of full-length (miR-29a containing) transcripts to total levels by q-PCR (FIG. 4H) showing that in tenocytes, less than 5% of col 1a1 and 1a2 transcripts make use of the distal polyadenylation signal whereas the majority of col 3a1 transcripts do.

[0315] This was confirmed by 3 rapid amplification of cDNA ends (RACE) (FIG. 7E) confirming that both col 1a1 and 1a2, but not col 3a1, make use of previously unrecognized polyadenylation signals (FIG. 4G). The resulting truncated 3UTR lack miR29a MREs. (It will be appreciated that the sequences shown in FIG. 7E are cDNA sequences; the corresponding mRNA sequences would of course contain U rather than T.) These data suggest that in tenocytes, miR-29a specifically regulates col 3a1, while both col 1a1 and col 1a2 are rendered insensitive to miR-29a inhibition due to the utilisation of alternative polyadenylation signals. This utilisation of alternative polyadenylation signals was not influenced by the presence of IL-33 (data not shown). Loss of miR-29a upon IL-33 signalling results in depression of collagen 3 likely contributing to the increase of this collagen observed in injured tendons.

[0316] The 3RACE results from human tenocytes revealed two col 3a1 UTRs, the shorter of which [designated Col3a1(short 3UTR) in FIG. 7E] contains one miR-29a MRE, while the longer one contains two. Both are regulated by miR-29a as shown in FIG. 7D.

[0317] Characterisation of the 3UTRs of Col1a1, Cola2 and Col3a1 transcripts expressed in equine tenocytes showed that they utilise the same conserved polyA signals used in the orthologous collagen transcripts expressed in human tenocytes. In col1a1 and cola2, use of these proximal polyA signals results in transcripts with 3UTRs that are between 100 and 350 nucleotides in length and which do not contain miR-29 binding sites and therefore insensitive to regulation by this miRNA. In contrast both col3a1 3UTRs contain miR-29 binding sites rendering them sensitive to regulation by miR-29.

Soluble ST2 is a Direct Target of miR-29

[0318] Computational analysis revealed that soluble ST2 can be targeted by miR-29a suggesting a feasible regulatory role in IL-33 effector functions. A luciferase reporter gene was generated that contains the 3UTR of human sST2 predicted to possess two potential miR-29abc binding sites. Co-transfection of sST2-luciferase reporter plasmid with miR-29 mimics resulted in significant reduction in luciferase activity relative to scrambled control (FIG. 7B) Furthermore luciferase activity was fully restored when the seed regions of both miR-29 MREs in sST2 were mutated, demonstrating conclusively that sST2 is a direct target of miR-29a (FIG. 5A). To investigate whether miR-29a does indeed regulate the levels of the candidate target mRNA in tenocytes we again transfected miR-29a mimic and antagomir into human tenocytes. Soluble ST2 message was significantly (p<0.01) altered by transfection with miR-29a mimic/antagomir by approximately 5 fold (FIG. 5B) with a corresponding significant change in soluble ST2 protein confirming miR29a as a target for soluble ST2 (FIG. 5C).

IL-33/sST2 Regulates miR-29 Expression in In Vivo Models of Tendon Healing

[0319] Finally, we investigated miR-29a expression in our in vivo tendinopathy model. Tendon injury in WT mice resulted in a 22 fold decrease in miR29a on day 1 which reverted to a 6 fold decrease (versus baseline) by day 3 (FIG. 5D & data not shown) with no significant difference by day 7. This effect was significantly abrogated in ST2/ mice (data not shown). In addition, administration of exogenous rh-IL-33 reduced miR-29a expression in uninjured tendons at all-time points compared to PBS injected controls (data not shown). This effect was most profound in injured WT mice, with the addition of rhIL-33 mediating a further 10 fold reduction in miR-29a (FIG. 5E). Addition of rhIL-33 in ST2/ mice had no significant effect on miR-29a expression in injured or uninjured tendons again suggesting that miR-29a down regulation is in part directly mediated by IL-33/ST2 dependent signalling. The addition of neutralising antibody to IL-33 significantly reduced the effect of injury on miR-29a gene expression at days 1 and 3 post injury (FIG. 5F).

In Vivo Administration of miR29a Mimic in Patellar Tendon Injury Model

[0320] miR-29a mimic was delivered to tenocytes in WT mouse patellar tendons via direct injection of a miR-29a/PEI complex. Immunofluorescence staining for the mimic (red), counterstained with phalloidin (green, for cytoskeletal structure) and DAPI (to show nuclei) was used to visualise the localisation of mimic around tenocytes at 24 h post injection of miR-29a mimic (not shown). As shown in FIG. 8, collagen 3 mRNA and protein levels were significantly reduced in tendons injected with miR-29a mimic compared to controls. In contrast collagen 1 levels were unchanged.

Preparation of Tendon-Derived ECM Scaffolds

A. Preparation of Decellularized and Oxidized Tendon Scaffolds.

[0321] Freeze-dried human Achilles tendon allografts from multiple donors were provided and stored at 25 C. until use. Freeze-dried human Achilles tendon allografts were transferred under aseptic conditions to individual clean, autoclaved, 1000 ml glass flasks. 1000 ml of DNase-free/RNase-free, distilled water (Gibco) was added to each sample.

[0322] The flask was placed onto a rotating shaker (Barnstead MaxQ400, Dubuque, Iowa) at 200 rpm, 37 C., for 24 hours. After 24 hours, the water was discarded and the cycle was repeated. At the conclusion of the second cycle, the water was discarded and 500 ml of 0.05% trypsin-EDTA (Gibco) was added. The sample was placed onto the rotating shaker at 200 rpm, 37 C. for 1 hour. At the end of the cycle, the trypsin solution was discarded and 500 ml of Dulbecco's Modified Eagle's Medium (DMEM) high-glucose (Gibco) containing 10% fetal bovine serum (FBS) (Valley Labs, Winchester, Va.) and 100 I.U./ml Penicillin, 100 g/ml Streptomycin, 0.25 ng/ml Amphotercin B (Gibco) was added in order to halt trypsin digestion of the sample.

[0323] The sample was placed back onto the rotary shaker at 200 rpm, 37 C., for 24 hours. After 24 hours, the DMEM-FBS solution was discarded and 1000 ml of the DNase-free/RNase-free distilled water was added and the sample was placed onto the rotary shaker at 200 rpm, 37 C. for 24 hours.

[0324] The water wash was discarded and 1000 ml of 1.5% peracetic acid (Sigma) solution with 1.5% Triton X-100 (Sigma) in distilled, deionized water was added and the sample placed onto the rotary shaker at 200 rpm, 37 C. for 4 hours. The solution was discarded and three 1000 ml washes with diH.sub.2O were performed, each for 12 hours at 37 C. and 200 rpm on the rotary shaker. At the end of the third wash, the sample was removed and placed into a clean, sterile freezer bag and frozen for 24 hours at 80 C. The sample was then freeze-dried (Labconco, Freeze Dry System, Kansas City, Mo.) for 48 hours before being returned to the freezer and stored at 80 C. until further use.

B. Histologic Analysis of Decellularized and Oxidized Tendon Scaffolds.

[0325] Mid-substance portions of freeze-dried human Achilles tendon allograft and decellularized and oxidized freeze-dried human Achilles tendon allograft-derived scaffold were placed in 10% phosphate-buffered formalin at room temperature for 4 hours. The tendons then were processed for histology, embedded in paraffin, and microtomed to obtain 5.0 m thick, longitudinal sections. The sections were mounted on slides and stained using hematoxylin and eosin (H&E, Sigma) as well as 4,6-diamidino-2-phenylindole (DAPI) (Vector, Burlingame, Calif.) to identify cellular and nuclear components, respectively. Representative light (H&E) and fluorescence (DAPI) micrographs were taken at 100 magnification. Abundant cellular material, specifically nuclear material, was evident after H&E and 4,6-diamidino-2-phenylindole (DAPI) staining of longitudinal sections of freeze-dried human Achilles tendon allograft prior to decellularization and oxidation. Minimal porosity was observed in H&E stained sections of the freeze-dried human Achilles tendon allograft. After decellularization and oxidation, no nuclear material was evident via H&E staining. DAPI staining revealed the presence of DNA and RNA within the decellularized and oxidized tendon scaffolds. However, this material was neither organized, nor condensed in appearance as seen in the untreated tendons. An increase in intra-fascicular and inter-fascicular space after treatment was also observed via H&E staining.

C. Determination of DNA Content in Decellularized and Oxidized Tendon Scaffolds.

[0326] Freeze-dried human Achilles tendon allograft (n=10) stored at 80 C. for 24 hours were lyophilized for 24 hours. Samples then were weighed and placed into sterile 1.5 ml micro-centrifuge tubes. This process was repeated for the decellularized and oxidized tendon scaffolds which previously had been freeze dried as part of their preparation process (n=8). Total DNA was then isolated from this tissue using a commercially available kit (DNeasy, Qiagen, Valencia, Calif.). The DNA concentration in the resulting volume was used to calculate total DNA content at =280 nm using a spectrophotometer (Thermo Spectronic, Biomate 3, Rochester, N.Y.), which was then normalized using the initial dry weight of the sample.

[0327] DNA content of the decellularized and oxidized freeze-dried human Achilles tendon allograft-derived scaffolds was significantly decreased by 75% (0.110+/0.02 g DNA/mg tissue dry weight, n=10) after treatment when compared to untreated freeze-dried human Achilles tendon allografts (0.40+/0.14 g DNA/mg tissue dry weight, n=10), p<0.05.

D. Transmission Electron Microscopy of Decellularized and Oxidized Tendon Scaffolds.

[0328] Transmission electron microscopy revealed that the decellularised and oxidised tendon scaffolds displayed a considerable decrease in fibril density per unit area as compared to the freeze-dried human Achilles tendon allograft, thus providing a scaffold having considerably increased pore size and porosity compared to the original allograft.

E. In Vitro Biocompatibility of Decellularized and Oxidized Tendon Scaffolds: Direct Contact Method.

[0329] Representative specimens (approximately 0.04 cm.sup.3 portion/well) of the decellularized and oxidized freeze-dried human achilles tendon allograft-derived scaffolds (n=10) were placed in the center of sub-confluent murine NIH 3T3 cell monolayers in 96-well plates (Becton Dickinson), which covered one-tenth of the surface area, according to established standards (Pariente et al. (2001) J Biomed Mater Res 55:33-39). The same procedure was followed using latex (Ansell, Massillon, Ohio) as a negative control (n=10). Cells not exposed to any foreign material served as a positive control (n=10). The cell-material contact was maintained for 72 hours at 37 C. and 5% CO.sub.2.

[0330] At the end of the incubation, the test materials were removed and two separate assays were performed to measure metabolic activity (MTS solution) and cell viability (Neutral Red). Briefly, 40 L of MTS solution (Promega, Madison, Wis.) was added into each well. After a 3 hour incubation at 37 C., the absorbance of the solution was measured at 490 nm using a 96-well plate spectrophotometer (Biotek, ELX800, Winoski, Vt.). The absorbance obtained was directly proportional to the metabolic activity of the cell populations and inversely proportional to the toxicity of the material.

[0331] For the cell viability assay, the media was removed and the cell layers rinsed with 200 L, of cold PBS. 100 L of neutral red solution (Sigma, 0.005% weight/volume in culture medium) was then added into each well. After a 3 hour incubation period at 37 C., the neutral red solution was removed and dye extraction performed by adding 100 L of 1% (volume/volume) acetic acid in 50% (volume/volume) ethanol solution into each well. The plates were agitated on a platform shaker (Barnstead) for 5 minutes. Absorbance was measured at =540 nm using the 96-well plate spectrophotometer noted above. The absorbance obtained was directly proportional to the viability of the cell populations and inversely proportional to the toxicity of the material. The negative control (cells exposed to latex) for both assays was considered satisfactory if the observed absorbance for both assays was <10% of that observed for the positive control (cells exposed to media alone).

[0332] Mitochondrial activity determined using the MTS assay (absorbance at =490 nm) for NIH 3T3 cells exposed to the decellularized and oxidized freeze-dried human Achilles tendon allograft-derived scaffolds was 95% (1.36+/0.31, n=10) of that observed for cells exposed to media only (1.42+/0.31, n=10) a difference which was not statistically significant (p>0.05). Cell viability determined using the Neutral Red assay (absorbance at =540 nm) for NIH 3T3 cells exposed to the decellularized and oxidized freeze-dried human Achilles tendon allograft-derived scaffolds was 92% (0.24+/0.07, n=10) of that observed for NIH 3T3 cells exposed to media alone (0.22+/0.07, n=10, positive control), a difference which was not statistically significant. The decellularized and oxidized scaffold and positive control (cells only) differed significantly (p<0.001) from the values obtained for a known cytotoxic material (latex, negative control, n=10) in both assays. The absorbance observed for the negative control was also <10% of the absorbance observed for positive controls in each assay.

Preparation of Atelocollagen/Poly(Ethylene Glycol) Ether Tetrasuccinimidyl Glutarate Scaffold Impregnated with miR29a Mimic

[0333] Atelocollagen was isolated as described elsewhere.sup.50. Nine parts of collagen solution (3.5 mg/ml w/v) was gently and thoroughly mixed with one part 10PBS. The solution was neutralized by the drop-wise addition of 2 mol/l sodium hydroxide (NaOH) until a final pH of 7-7.5 was reached and kept in an ice bath to delay gel formation. 4S-StarPEG was then added at a final concentration of 0.125, 0.25, 0.5, and 1 mm in a volume of 200 l as a cross-linking agent. 0.625% glutaraldehyde was used as a positive control. The solutions were incubated for 1 hour at 37 C. in a humidified atmosphere to induce gelation.

[0334] ECM derived biomaterials as delivery platforms of nonviral therapeutics have been previously documented both in vitro and in vivo, with beneficial outcomes. Previously, the in vitro effects of 4S-StarPEG crosslinked collagen type I scaffolds have been investigated as a delivery platform for delivering mesenchymal stem cells.

[0335] 0.5 and 1 mmol concentrations of miR29a mimic will be added in a 5 ml volume to six well plates with 4S-StarPEG crosslinked collagen type I scaffolds and incubated for 2 hours. Functional PCR assays will be utilised to check saturation of the scaffold with miR29a mimic at this point.

[0336] Collagen scaffolds impregnated with miR29a mimic will be added to monolayer cultures of human and equine tenocytes and their effect on production of type I and III collagens (protein and mRNA) will be determined. Based on the results described above, a significant silencing of type III collagen in human and equine tenocytes is expected, with the balance of collagen synthesis being shifted in favour of type I collagen.

Discussion

[0337] microRNAs have emerged as powerful regulators of diverse cellular processes with important roles in disease and tissue remodeling. These studies utilising tendinopathy as a model system reveal for the first time the ability of a single microRNA (miR-29) to cross regulate inflammatory cytokine effector function and extracellular matrix regulation in the complex early biological processes leading to tissue repair.

[0338] We herein provide new evidence for a role of IL-33 in the initial steps that lead to the important clinical entity of tendinopathy. IL-33 has recently become increasingly associated with musculoskeletal pathologies.sup.16. Our data show IL-33 to be present in human tendon biopsies at the early stage of disease while end stage biopsies have significantly less IL-33 expression at the message and protein level promoting the concept of IL-33 as an early tissue mediator in tendon injury and subsequent tissue remodelling. Upon cell injury endogenous danger signals, so called damage associated molecular patterns, are released by necrotic cells including heat shock proteins.sup.28, HMGB1.sup.29, uric acid.sup.30 and IL-1 family members.sup.31-32 including IL-33.sup.33-34. These danger signals are subsequently recognised by various immune cells that initiate inflammatory and repair responses. Our data implicate IL-33 as an alarmin in early tendinopathy, and importantly, our biomechanical data suggest such expression has a pathogenically relevant role. The addition of rhIL-33 significantly reduced the load to failure of WT mice by approximately 30% at early time points, likely as a consequence of the concomitant collagen 3 matrix changes which result in mechanically inferior tendon.sup.35. Thus one plausible mechanism for the events mediating early tendon repair that is biomechanically inferior, may be that upon repeated micro injury IL-33 is up regulated with its subsequent release through mechanical stress/necrosis, which in turn drives the matrix degeneration and proinflammatory cytokine production propelling the tendon toward a pathological state such as that seen in early tendinopathy biopsies. Interestingly the addition of neutralising antibodies to injured mice did reverse the collagen 3 phenotype but this was only able to temporarily improve tendon strength on day 1 post injury. Whilst this may negate blocking IL-33 in longer term sports injuries the repetitive microtrauma associated with pathological tendon changes may conversely allow neutralising IL-33 to act as a check rein to further unwanted matrix dysregulation.

[0339] Emerging studies highlight miRNAs as key regulators of leukocyte function and the cytokine network while orchestrating proliferation and differentiation of stromal lineages that determine extracellular matrix composition.sup.36. The novel finding of a role for miR-29a in the regulation of IL-33 alarmin mediated effects provides mechanistic insight into miRNA cross-regulatory networks involving inflammation and matrix regulation in tissue repair. Our data provide convincing evidence for a functional role for miR-29 as a posttranscriptional regulator of collagen in murine and human tendon injury. The regulation of collagens by the miR-29 family has been highlighted in several prior studies.sup.37 27..sup.38. Our results now suggest that miR-29 acts as a critical repressor to regulate collagen expression in tendon healing. Moreover its reduced expression in human biopsies suggests that its functional diminution permissively permits development of tendinopathy. Despite tendon pathology being characterised by increased collagen 3 deposition resulting in biomechanical inferiority and degeneration the molecular premise for this collagen switch has hitherto been unknown. We describe for the first time that IL-33 induced deficiency in miR-29a results in an over-production of collagen 3 whilst simultaneously setting in motion, via sST2 inhibition of IL-33, the ultimate resolution of this early repair process. Contrary to expectations in human tenocytes, miR-29 was only capable of influencing the expression of col 3a1 and not type 1 collagens. Subsequent characterisation of the 3UTR of type 1 and 3 collagens revealed a previously unreported pattern of alternative polyadenylation in both type 1 subunits, resulting in transcripts lacking miR29a binding sites rendering them insensitive to repression by this miRNA. This was not the case for type 3 collagen transcripts, which retain both miR-29a binding sites. In human tenocytes, collagen 3 is actively repressed by miR-29a, as demonstrated by the ability of miR-29a inhibitors to significant increase collagen 3 levels while supplementing tenocytes with miR-29a in the presence of IL-33 was sufficient to inhibit the increase in collagen 3 production. Importantly in our model system miR-29a additionally targeted the IL-33 decoy receptor sST2. Thus IL-33 driven loss of miR-29a expression results in the simultaneous repression of collagen 3 and sST2, with a subsequent auto-regulatory inhibition of IL-33 promoting the resolution of the immediate alarmin response.

[0340] Based on this work we propose IL-33 as an influential alarmin in the unmet clinical area of early tendon injury and tendinopathy, which may be important in the balance between reparation and degeneration. A novel role for miR-29 as a posttranscriptional regulator of matrix/inflammatory genes in tendon healing and tendinopathy has been uncovered. One of the great promises of exploiting miRNAs for therapeutic purposes has been the potential of a single microRNA to regulate functionally convergent target genes. Our discovery of a single microRNA dependent regulatory pathway in early tissue healing, highlights miR-29 replacement therapy as a promising therapeutic option for tendinopathy with implications for many other human pathologies in which matrix dysregulation is implicated.

[0341] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention. All documents cited herein are expressly incorporated by reference.

REFERENCES

[0342] 1. Eming, S. A., Krieg, T. & Davidson, J. M. Inflammation in wound repair: molecular and cellular mechanisms. J Invest Dermatol 127, 514-525 (2007). [0343] 2. McCormick, A., Charlton, J. & Fleming, D. Assessing health needs in primary care. Morbidity study from general practice provides another source of information. BMJ 310, 1534 (1995). [0344] 3. Nakama, L. H., King, K. B., Abrahamsson, S. & Rempel, D. M. Evidence of tendon microtears due to cyclical loading in an in vivo tendinopathy model. J Orthop Res 23, 1199-1205 (2005). [0345] 4. Sharma, P. & Maffulli, N. Tendon injury and tendinopathy: healing and repair. J Bone Joint Surg Am 87, 187-202 (2005). [0346] 5. Millar, N. L., Wei, A. Q., Molloy, T. J., Bonar, F. & Murrell, G. A. Cytokines and apoptosis in supraspinatus tendinopathy. J Bone Joint Surg Br 91, 417-424 (2009). [0347] 6. Pufe, T., Petersen, W., Tillmann, B. & Mentlein, R. The angiogenic peptide vascular endothelial growth factor is expressed in foetal and ruptured tendons. Virchows Arch 439, 579-585 (2001). [0348] 7. Tsuzaki, M., et al. IL-1 beta induces COX2, MMP-1, -3 and -13, ADAMTS-4, IL-1 beta and IL-6 in human tendon cells. J Orthop Res 21, 256-264 (2003). [0349] 8. Tohyama, H., Yasuda, K., Uchida, H. & Nishihira, J. The responses of extrinsic fibroblasts infiltrating the devitalised patellar tendon to IL-1beta are different from those of normal tendon fibroblasts. J Bone Joint Surg Br 89, 1261-1267 (2007). [0350] 9. John, T., et al. Effect of pro-inflammatory and immunoregulatory cytokines on human tenocytes. J Orthop Res 28, 1071-1077 (2010). [0351] 10. Lin, T. W., Cardenas, L., Glaser, D. L. & Soslowsky, L. J. Tendon healing in interleukin-4 and interleukin-6 knockout mice. J Biomech 39, 61-69 (2006). [0352] 11. Zhang, N. & Oppenheim, J. J. Crosstalk between chemokines and neuronal receptors bridges immune and nervous systems. J Leukoc Biot 78, 1210-1214 (2005). [0353] 12. Schmitz, J., et al. IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity 23, 479-490 (2005). [0354] 13. Gao, P., Wange, R. L., Zhang, N., Oppenheim, J. J. & Howard, O. M. Negative regulation of CXCR4-mediated chemotaxis by the lipid phosphatase activity of tumor suppressor PTEN. Blood 106, 2619-2626 (2005). [0355] 14. Chen, X., Murakami, T., Oppenheim, J. J. & Howard, O. M. Triptolide, a constituent of immunosuppressive Chinese herbal medicine, is a potent suppressor of dendritic-cell maturation and trafficking. Blood 106, 2409-2416 (2005). [0356] 15. Lamkanfi, M. & Dixit, V. M. IL-33 raises alarm. Immunity 31, 5-7 (2009). [0357] 16. Liew, F. Y., Pitman, N. I. & McInnes, I. B. Disease-associated functions of IL-33: the new kid in the IL-1 family. Nat Rev Immunol 10, 103-110. [0358] 17. Asirvatham, A. J., Magner, W. J. & Tomasi, T. B. miRNA regulation of cytokine genes. Cytokine 45, 58-69 (2009). [0359] 18. Pritchard, C. C., Cheng, H. H. & Tewari, M. MicroRNA profiling: approaches and considerations. Nat Rev Genet 13, 358-369 (2012). [0360] 19. Matthews, T. J., Hand, G. C., Rees, J. L., Athanasou, N. A. & Carr, A. J. Pathology of the torn rotator cuff tendon. Reduction in potential for repair as tear size increases. J

[0361] Bone Joint Surg Br 88, 489-495 (2006). [0362] 20. Xu, D., et al. IL-33 exacerbates antigen-induced arthritis by activating mast cells. Proceedings of the National Academy of Sciences of the United States of America 105, 10913-10918 (2008). [0363] 21. Zaiss, M. M., et al. IL-33 shifts the balance from osteoclast to alternatively activated macrophage differentiation and protects from TNF-alpha-mediated bone loss. J Immunol 186, 6097-6105 (2011). [0364] 22. Rankin, A. L., et al. IL-33 induces IL-13-dependent cutaneous fibrosis. J Immunol 184, 1526-1535 (2010). [0365] 23. Palmer, G. & Gabay, C. Interleukin-33 biology with potential insights into human diseases. Nat Rev Rheumatol 7, 321-329. [0366] 24. Ogawa, T., et al. Suppression of type I collagen production by microRNA-29b in cultured human stellate cells. Biochem Biophys Res Commun 391, 316-321. [0367] 25. Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-233 (2009). [0368] 26. Ma, F., et al. The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-gamma. Nature immunology 12, 861-869 (2011). [0369] 27. Maurer, B., et al. MicroRNA-29, a key regulator of collagen expression in systemic sclerosis. Arthritis Rheum 62, 1733-1743 (2010). [0370] 28. Basu, S., Binder, R. J., Suto, R., Anderson, K. M. & Srivastava, P. K. Necrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the NF-kappa B pathway. Int Immunol 12, 1539-1546 (2000). [0371] 29. Scaffidi, P., Misteli, T. & Bianchi, M. E. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature 418, 191-195 (2002). [0372] 30. Shi, Y., Evans, J. E. & Rock, K. L. Molecular identification of a danger signal that alerts the immune system to dying cells. Nature 425, 516-521 (2003). [0373] 31. Chen, C. J., et al. Identification of a key pathway required for the sterile inflammatory response triggered by dying cells. Nat Med 13, 851-856 (2007). [0374] 32. Eigenbrod, T., Park, J. H., Harder, J., Iwakura, Y. & Nunez, G. Cutting edge: critical role for mesothelial cells in necrosis-induced inflammation through the recognition of IL-1 alpha released from dying cells. J Immunol 181, 8194-8198 (2008). [0375] 33. Moussion, C., Ortega, N. & Girard, J. P. The IL-1-like cytokine IL-33 is constitutively expressed in the nucleus of endothelial cells and epithelial cells in vivo: a novel alarmin? PLoS One 3, e3331 (2008). [0376] 34. Cayrol, C. & Girard, J. P. The IL-1-like cytokine IL-33 is inactivated after maturation by caspase-1. Proceedings of the National Academy of Sciences of the United States of America 106, 9021-9026 (2009). [0377] 35. James, R., Kesturu, G., Balian, G. & Chhabra, A. B. Tendon: biology, biomechanics, repair, growth factors, and evolving treatment options. J Hand Surg Am 33, 102-112 (2008). [0378] 36. Brown, B. D. & Naldini, L. Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev Genet 10, 578-585 (2009). [0379] 37. Roderburg, C., et al. Micro-RNA profiling reveals a role for miR-29 in human and murine liver fibrosis. Hepatology 53, 209-218 (2011). [0380] 38. Ogawa, T., et al. Suppression of type I collagen production by microRNA-29b in cultured human stellate cells. Biochem Biophys Res Commun 391, 316-321 (2010). [0381] 39. Millar, N. L., Wu, X., Tantau, R., Silverstone, E. & Murrell, G. A. Open versus two forms of arthroscopic rotator cuff repair. Clin Orthop Relat Res 467, 966-978 (2009). [0382] 40. McInnes, I. B., et al. Production of nitric oxide in the synovial membrane of rheumatoid and osteoarthritis patients. J Exp Med 184, 1519-1524 (1996). [0383] 41. Khan, K. M., Cook, J. L., Bonar, F., Harcourt, P. & Astrom, M. Histopathology of common tendinopathies. Update and implications for clinical management. Sports Med 27, 393-408 (1999). [0384] 42. Millar, N. L., Wei, A. Q., Molloy, T. J., Bonar, F. & Murrell, G. A. Heat shock protein and apoptosis in supraspinatus tendinopathy. Clin Orthop Relat Res 466, 1569-1576 (2008). [0385] 43. Kurowska-Stolarska, M., et al. IL-33 induces antigen-specific IL-5+ T cells and promotes allergic-induced airway inflammation independent of IL-4. J Immunol 181, 4780-4790 (2008). [0386] 44. Zheng, Y., et al. Interleukin-22, a T(H)17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature 445, 648-651 (2007). [0387] 45. Hedrick, M. N., et al. CCR6 is required for IL-23-induced psoriasis-like inflammation in mice. The Journal of clinical investigation 119, 2317-2329 (2009). [0388] 46. Longo, U. G., Lamberti, A., Petrillo, S., Maffulli, N. & Denaro, V. Scaffolds in tendon tissue engineering. Stem Cells Int 2012, 517165 (2012). [0389] 47. Cooper, J. O., Bumgardner, J. D., Cole, J. A., Smith, R. A. & Haggard, W. O. Co-cultured tissue-specific scaffolds for tendon/bone interface engineering. J Tissue Eng 5, 2041731414542294 (2014). [0390] 48. Kim, B. S., et al. Human collagen-based multilayer scaffolds for tendon-to-bone interface tissue engineering. J Biomed Mater Res A 102, 4044-4054 (2014). [0391] 49. Woo, S. L. Tissue engineering: use of scaffolds for ligament and tendon healing and regeneration. Knee Surg Sports Traumatol Arthrosc 17, 559-560 (2009). [0392] 50. Zeugolis, DI, Paul, R G and Attenburrow, G (2008). Factors influencing the properties of reconstituted collagen fibers prior to self-assembly: animal species and collagen extraction method. J Biomed Mater Res A 86: 892-904.