USE OF VITAMINS AND VITAMIN METABOLIC GENES AND PROTEINS FOR RECOMBINANT PROTEIN PRODUCTION IN MAMMALIAN CELLS
20180066268 ยท 2018-03-08
Inventors
- Nicolas Mermod (Plan-Les-Ouates, CH)
- Lucille Pourcel (Plan-les-Outes, CH)
- Pierre-Alain Girod (Plan-les-Outes, CH)
- Valerie Le Fourn (Plan-Les-Ouates, CH)
Cpc classification
C12N2830/00
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N2830/001
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed are eukaryotic expression systems and methods for the selection of mammalian cell lines that produce proteins of interest, such as therapeutic proteins. The systems and methods allow for a simple and fast selection of cells mediating high levels of recombinant protein production. The systems and methods decrease the efforts and time needed to bring a new therapeutic protein to the patients, and also lower the cost of the therapeutic protein by increasing the productivity of cells in a bioreactor.
Claims
1. An eukaryotic expression system comprising: at least one first polynucleotide encoding at least one vitamin metabolic protein under the control of at least one first regulatory sequence, and under the control of at least one second regulatory sequence, at least one restriction enzyme cleavage site and/or at least one second polynucleotide encoding at least one product of interest.
2. The eukaryotic expression system of claim 1, wherein the at least one vitamin metabolic protein is a vitamin transport protein.
3. The eukaryotic expression system of claim 1, wherein the at least one second polynucleotide is inserted into said at least one restriction enzyme cleavage site.
4. The eukaryotic expression system of claim 2, wherein said vitamin transport protein transports a soluble vitamin such as vitamin B1, B5 and/or H.
5. The eukaryotic expression system of claim 2, wherein said vitamin transport protein is THTR-1, THTR-2, TPK, TPC and/or SMVT (sodium dependent multi vitamin transporter).
6. The eukaryotic expression system of claim 5, wherein said vitamin transport protein is SMVT.
7. The eukaryotic expression system of claim 1, wherein the expression system is at least one expression vector.
8. The eukaryotic expression system of claim 7, wherein a singular vector comprises said at least one first and said at least one second polynucleotide.
9. The eukaryotic expression system of claim 1, wherein said first and/or second regulatory sequence are promoters, enhancers, locus control regions (LCRs), matrix attachment regions (MARs), scaffold attachment regions (SARs), insulator elements and/or nuclear matrix-associating DNAs.
10. A kit comprising in one container, said eukaryotic expression system of claim 1 and, in a second container, instructions of how to use said system.
11. The kit of claim 10 further comprising a cell culture medium, having a limiting and/or saturating concentration of at least one vitamin.
12. The kit of claim 11, wherein the cell culture medium has a limiting and/or saturating concentration of vitamin B1, B5 and/or H.
13. A recombinant eukaryotic cell comprising the expression system of claim 1; and/or having an up or down mutation in the vitamin metabolic protein, and comprising a second polynucleotide encoding a product of interest, wherein the vitamin metabolic protein is optionally intrinsic to the cell.
14. The recombinant eukaryotic cell of claim 13, wherein the cell is a Chinese Hamster Ovary (CHO) cell.
15. The recombinant eukaryotic cell of claim 13, wherein the at least one first polynucleotide or a sequence regulating the expression of the at least one first polynucleotide has an up or down mutation.
16. The recombinant eukaryotic cell of claim 13, wherein the vitamin metabolic protein interferes with vitamin metabolism and/or binds a vitamin within a cell.
17. The recombinant eukaryotic cell of claim 16, wherein the vitamin metabolic protein is pantothenate 1, 2 and/or 3 and/or is a thiamin pyrophosphate kinase, such as TPK1 (thiamin pyrophosphate kinase 1).
18. The recombinant eukaryotic cell of claim 13 comprising said expression system, wherein the vitamin metabolic protein is a selectable marker for said recombinant eukaryotic cell and said recombinant eukaryotic cell produces and, preferably secretes, said product of interest.
19. A eukaryotic cell culture medium comprising the recombinant eukaryotic cell according to claim 13 expressing (i) a vitamin transport protein as the selectable marker, and (ii) said protein of interest.
20. The cell culture medium of claim 19, wherein said medium is a limiting medium for B5, or a saturated medium for B5 but a limiting medium or not limiting medium for H or a saturated medium for H but a limiting medium or not a limiting medium for B5, preferably a limiting medium for B5, or a saturated medium for B5 but a limiting medium for H.
21. A method for culturing and, optionally selecting recombinant eukaryotic cells comprising: providing the expression system of claim 7, providing eukaryotic cells, wherein viability, growth and/or division of said eukaryotic cells is dependent on vitamin uptake, introducing said expression system into said eukaryotic cells to produce said recombinant eukaryotic cells expressing said vitamin metabolic protein and said protein of interest, subsequent to the introducing culturing said eukaryotic cells in a cell culture medium, and optionally, selecting via said vitamin metabolic protein, which is preferably expressed on the surface of said recombinant eukaryotic cells, said recombinant eukaryotic cells that stably express said product of interest.
22. The method of claim 21, wherein said medium is a limiting medium for B5, or a saturated medium for B5 but a limiting medium for H.
23. (canceled)
23. A culture medium comprising at least one vitamin: in a concentration of less than 10 nM, and/or in a concentration of 20 M or more, wherein said at least one vitamin is an essential vitamin.
24. The culture medium of claim 23, wherein said at least one vitamin is vitamin B1, B5 and/or H.
25. The culture medium of claim 23, wherein said culture medium comprises one or more recombinant eukaryotic cells expressing, secreting, a protein of interest.
26. The culture medium of claim 25, wherein said protein of interest is a therapeutic protein.
27. The culture medium of claim 25 or a method of providing said culture medium, wherein the growth and/or division of said cells is arrested, and said protein of interest is produced at a maximum arrested level (MAL in g/l) that exceeds a maximum level (ML in g/l) of protein expressed by said cells when grown in a medium, preferably a standard medium, in which growth is not arrested, wherein the MAL is more than 1.5the ML, more than 2the ML or even more than 2.5 or 3the ML.
28. A method of producing a protein of interest, comprising: (a) transforming eukaryotic cells with an expression system of claim 1 to produce recombinant eukaryotic cells; (b) culturing said recombinant eukaryotic cells in a culture medium in which viability, growth and/or division of the recombinant eukaryotic cells is dependent upon activity of one or more vitamin metabolic protein, (c) selecting for recombinant eukaryotic cells expressing one or more vitamin metabolic protein, wherein said vitamin metabolic protein is a selectable marker to obtain selected recombinant eukaryotic cells; and (d) purifying the protein of interest from said selected recombinant eukaryotic cells or from a culture medium thereof comprising said selected recombinant eukaryotic cells.
29. The method of claim 28, wherein the vitamin metabolic protein is a vitamin transport protein preferably transporting vitamins B5, B1 and/or H and said culture medium is limiting and/or saturating for one or more of said vitamins.
30. The method of claim 29, wherein the vitamin transport protein is SMVT and said culture medium is a limiting medium for B5, or a saturated medium for B5 but a limiting medium for H.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
SUMMARY OF THE INVENTION
[0029] The invention is directed at a eukaryotic expression system comprising: [0030] at least one first polynucleotide encoding at least one vitamin metabolic protein under the control of at least one first regulatory sequence, and [0031] under the control of at least one second regulatory sequence, at least one restriction enzyme cleavage site and/or at least one second polynucleotide encoding at least one product of interest.
[0032] The at least one vitamin metabolic protein may be a vitamin transport protein. The at least one second polynucleotide may be inserted into said at least one restriction enzyme cleavage site. The vitamin transport protein may transport a soluble vitamin such as vitamin B1, B5 and/or H. The vitamin transport protein may be THTR-1 (thiamine transporter-1), THTR-2 (thiamine transporter-1), TPC (thiamine pyrophosphate Carrier), TPK (thiamine pyrophosphokinase) and/or, in particular SMVT (sodium dependent multi vitamin transporter). An expression vector may comprise the expression system. In particular, a singular vector may comprise said at least one first and said at least one second polynucleotide.
[0033] The first and/or second regulatory sequence may be promoters, enhancers, locus control regions (LCRs), matrix attachment regions (MARs), scaffold attachment regions (SARs), insulator elements and/or nuclear matrix-associating DNAs.
[0034] The invention is also directed at a kit comprising in one container, the eukaryotic expression system disclosed herein (in particular on one or more vectors) and, in a second container, instructions of how to use said system. The kit may further comprise a cell culture medium, preferably having a limiting and/or saturating concentration of at least one vitamin, such as of vitamin B1, B5 and/or H.
[0035] The invention is also directed at a recombinant eukaryotic cell comprising the expression system described herein; and/or
having an up or down mutation in a vitamin metabolic protein, and a polynucleotide (second polynucleotide) encoding a product of interest, or a regulatory sequence regulating the expression of a polynucleotide encoding the vitamin metabolic protein, wherein the vitamin metabolic protein is optionally intrinsic to the cell. The cell may be a Chinese Hamster Ovary (CHO) cell. The at least one first polynucleotides may be mutated/contain an up or down mutation. The vitamin metabolic protein may interfere with vitamin metabolism and/or bind the vitamin within a cell. The vitamin metabolic protein may be pantothenate 1, 2 and/or 3 and/or a thiamin pyrophosphate kinase, such as TPK1 (thiamin pyrophosphate kinase 1).
[0036] The vitamin metabolic protein may be a selectable marker for said recombinant eukaryotic cell and said recombinant eukaryotic cell may produce and, preferably secret said product of interest.
[0037] The invention is also directed at a eukaryotic cell culture medium comprising the recombinant eukaryotic cells disclosed herein, preferably polyclonal, preferably expressing (i) a vitamin transport protein as the selectable marker and (ii) a protein of interest. The medium may be a limiting medium for B5, or a saturated medium for B5 but a limiting medium for H.
[0038] The invention is also directed at a method for culturing and, optionally selecting recombinant eukaryotic cells comprising: [0039] providing the expression system as disclosed herein, [0040] providing eukaryotic cells, wherein viability, growth and/or division of said eukaryotic cells is dependent on vitamin uptake, [0041] introducing said expression system into said eukaryotic cells to produce said recombinant eukaryotic cells expressing said vitamin metabolic protein and said protein of interest, [0042] culturing said eukaryotic cells in a cell culture medium, e.g., a limiting medium for B5, or a saturated medium for B5 but a limiting medium or not limiting medium for H, or a saturated medium for H but a limiting medium or not limiting medium for B5, and [0043] optionally, selecting via said vitamin metabolic protein, which is preferably expressed on the surface of said recombinant eukaryotic cells, said recombinant eukaryotic cells that stably express said product of interest.
[0044] A selection medium as disclosed herein might be a limiting medium for B5, or a saturated medium for B5 but a limiting or non-limiting medium for H.
[0045] The present invention is also directed at the use of a vitamin metabolic protein and it's DNA coding sequence as a selection marker for selection of recombinant eukaryotic cells stably expressing a product of interest, wherein viability, growth and/or division of said cell may be dependent on the uptake of a vitamin.
[0046] The present invention is also directed at a culture medium comprising at least one vitamin: [0047] in a concentration of less than 10 nM, and/or [0048] in a concentration of 20 M or more, wherein said at least one vitamin is an essential vitamin.
[0049] The at least one vitamin may be vitamin B1, B5 and/or H. The culture medium may comprise one or more recombinant eukaryotic cells expressing, preferably secreting, a protein of interest. The protein of interest may be a therapeutic protein. Growth and/or division of the cells may be arrested, and the protein of interest may be produced at a maximum arrested level (MAL in [g/l]) that exceeds a maximum level (ML in [g/l]) of protein expressed by the cells when grown in a medium, preferably a standard medium, in which growth is not arrested, wherein the MAL is more than 1.5the ML, more than 2the ML or even more than 2.5 or 3the ML.
[0050] The invention is also directed at a method of producing a protein of interest, comprising:
(a) transforming eukaryotic cells with an expression system disclosed herein to produce recombinant eukaryotic cells;
(b) culturing said recombinant eukaryotic cells in a culture medium in which viability and/or growth or division of the recombinant eukaryotic cells is dependent upon activity of one or more vitamin metabolic protein;
(c) selecting for recombinant eukaryotic cells expressing said one or more vitamin metabolic protein, wherein said vitamin metabolic protein is a selectable marker to obtain selected recombinant eukaryotic cells, preferably when said recombinant eukaryotic cells are part of a monoclonal cell population (originating from a single cell); and
(d) purifying the protein of interest from said selected recombinant eukaryotic cells or from a culture medium thereof comprising said selected recombinant eukaryotic cells.
[0051] The vitamin metabolic protein may be a vitamin transport protein preferably transporting vitamin B5, B1 and/or H and said culture medium may be limiting and/or saturating for one of more of said vitamins. The vitamin transport protein may be SMVT and the culture medium may be a limiting medium for B5, or a saturated medium for B5 but a limiting medium for H.
[0052] The invention is also directed at cells, methods, systems and expression vectors disclosed herein, wherein said SMVT protein is encoded by a Slc5a6 gene or a derivative thereof, and/or wherein said eukaryotic cells are part of a monoclonal cell population.
[0053] The present invention is also more generally directed at assessing whether the strict vitamin requirements of eukaryotic cells could be used as selection tool for transformed cells, in particular transformed cells that stably express high levels of a gene of interest, when co-expressed with a vitamin uptake gene. The present invention is also more generally directed at assessing whether vitamin-depleted or enriched culture media may be used to further improve protein production by such cells.
[0054] In one specific embodiment, the present invention is directed at decreasing the availability of vitamin B5 at the late phase of recombinant protein production to slow cell division, and thereby to increase the level of therapeutic proteins produced in a bioreactor.
[0055] In one other specific embodiment, the invention is also directed at cloning and expressing the multivitamin transporter Slc5a6 (SMVT), involved in the uptake of both vitamin B5 and H into the cell, in particular CHO-M cells. The invention is also directed at cells overexpressing this vitamin transporter to result in faster growth and higher viability in B5-limiting media when compared to non-transformed cells. The invention is also directed at co-expressing SLC5A6 as a selection marker to obtain cell lines having higher levels of recombinant protein production. The invention is furthermore directed at overexpressing SLC5A6 in cells to produce better cell viability even in a non-depleted culture media, preferably contributing to even more favorable expression levels of therapeutic proteins.
DISCUSSION OF VARIOUS AND PREFERRED EMBODIMENTS
Definitions
[0056] A eukaryotic expression system according to the present invention comprises elements that allow for expression of a gene of interest in a eukaryotic cells such as a CHO cell, preferably a CHO K1 cell, preferably a CHO-M cell. Generally, the eukaryotic expression system comprises at least one expression vector. However, the eukaryotic expression system might also be part of the genome of a eukaryotic cell. The system/expression vector comprises regulatory sequences such as promoters, enhancers, locus control regions (LCRs), matrix attachment regions (MARs), scaffold attachment regions (SARs), insulator elements and/or nuclear matrix-associating DNAs that lead to efficient transcription of a transgene integrated into the expression system. These regulatory sequences as any other sequences referred to herein are often heterologous (i.e., foreign to the host cell being utilized, e.g., derived from a different species as the host cell being utilized) or, while being homologous (i.e., endogenous to the host cell being utilized) are present at different genomic location(s) than any counterpart intrinsic to the cells (hereinafter referred to as heterolocal). An expression vector may also contain an origin of replication.
[0057] The first polynucleotide encoding at least one vitamin metabolic protein and the second polynucleotide encoding at least one product of interest according to the present invention are added to a eukaryotic cell to create a recombinant eukaryotic cell. Genes or proteins intrinsic to the eukaryotic cell are not added to the cell, but exist in the cell independent of any transformation. However, as the person skilled in the art will realize, the first and second polynucleotide might be copies of an intrinsic gene, such as heterolocal copies of the gene. In many instances it is preferred that some or all of the coding DNA sequences (CDSs) of a wild type gene make up the polynucleotides of the present invention, including the first polynucleotide encoding at least one vitamin metabolic protein.
[0058] As used herein, plasmid and vector are used interchangeably, as a plasmid is the most commonly used vector form. However, the invention is intended to include such other forms of expression vectors, including, but not limited to, viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), or transposable vectors, which serve equivalent functions. Herein, transformation refers to the introduction of vector DNA into any cell, irrespective the means or type of vector used.
[0059] The gene of interest or transgene, herein also referred to as polynucleotide encoding a product of interest encodes, e.g., a protein of interest (structural or regulatory protein). The protein of interest is often a therapeutic protein. As used herein protein refers generally to peptides and polypeptides having more than about ten amino acids. The proteins may be homologous to the host (i.e., endogenous to the host cell being utilized), or heterologous, (i.e., foreign to the host cell being utilized), such as a human protein produced by yeast. The protein may be produced as an insoluble aggregate or as a soluble protein in the periplasmic space or cytoplasm of the cell, or in the extracellular medium. Examples of therapeutic proteins include hormones such as growth hormone or erythropoietin (EPO), growth factors such as epidermal growth factor, analgesic substances like enkephalin, enzymes like chymotrypsin, receptors, or antibodies (e.g. Trastuzumab monoclonal immunoglobulin (IgG)). Genes usually used as a visualizing marker e.g. green fluorescent protein are also suitable transgenes. The transgene may also encode, e.g., a regulatory RNA, such as a siRNA. A homologous protein or RNA might be produced by a heterolocal polynucleotide. In many instances it is preferred that some or all of the coding DNA sequences (CDSs) of a wild type gene make up the polynucleotides of the present invention, including the second polynucleotide encoding at least one product of interest.
[0060] Eukaryotic cells used in the context of the present invention include, but are not limited to, the above mentioned CHO-M cells (available from SELEXIS SA), and other cells which are suitable for protein production at industrial manufacturing scale. Those cells are well known to the skilled person and have originated for example from Cricetulus griseus, Cercopithecus aethiops, Homo sapiens, Mesocricetus auratus, Mus musculus and Chlorocebus species. The respective cell lines are known as CHO-cells (Chinese Hamster Ovary), COS-cells (a cell line derived from monkey kidney (African green monkey), Vero-cells (kidney epithelial cells extracted from African green monkey), Hela-cells (The line was derived from cervical cancer cells taken from Henrietta Lacks), BHK-cells (baby hamster kidney cells, HEK-cells (Human Embryonic Kidney), NSO-cells (Murine myeloma cell line), C127-cells (nontumorigenic mouse cell line), PerC6-cells (human cell line, Crucell), CAP-cells (CEVEC's Amniocyte Production) and Sp-2/0-cells (Mouse myeloma cells). Eucaryotic cells used in the context of the present invention may also, e.g., be human primary cells including hematopoietic stem cells, such as cells from bone marrow or stem cells, such as embryonic stem (ES) cells, induced pluripotent stem (iPS) cells or differentiated cells derived from ES or iPS cells.
[0061] A vitamin metabolic protein according to the present invention is a protein which either lowers or increases vitamin availability or use in a cell.
[0062] One preferred vitamin metabolic protein is a vitamin transport protein which is generally a membrane-bound protein and transports vitamins available in a culture medium into a cell. Table 1 provides examples of those proteins under the heading Function. As can be seen from this table, two cytoplasmic and one mitochondrial transporters have been characterized for vitamin B1 (SLC19A2 [SEQ ID NO. 24], SLC19A3 [SEQ ID NO. 25] and SLC25A19 [SEQ ID NO. 27]), whereas a single cytoplasmic transporter has been characterized for both the B5 and H vitamins, called the sodium-multivitamin transporter SLC5A6 [SEQ ID NO. 21].
[0063] Other examples of vitamin metabolic proteins include pantothenate kinases 1, 2 or 3 encoded by the PANK1 [SEQ ID NO. 22], PANK2 [SEQ ID NO. 23], and PANK3 [SEQ ID NO. 35, 36] gene and the TPK1 (thiamin pyrophosphate kinase 1), encoded by the TPK1 gene [SEQ ID NO. 26]. Pantothenate kinases are key regulatory enzyme in the biosynthesis of coenzyme A (CoA), the homodimeric TPK1 protein catalyzes the conversion of thiamine to thiamine pyrophosphate. As the person skilled in the art will readily realize, other proteins that are involved in vitamin metabolism are also part of the present invention.
[0064] A cell growing in a complete culture medium will have all vitamins available at standard concentrations. Standard concentrations are referred to herein as 1. Standard concentrations for B1, B5 and H (1) were set at 7.5 M, 2.5 M and 0.5 M, respectively. B5 was determined to have for CHO cells a growth-limiting concentration range around 10.sup.4 to 10.sup.3 (0.25 to 2.5 nM), whereas 10.sup.2 and higher concentrations allowed normal culture growth. The limiting concentrations of B1 was determined to be for CHO cells between 10.sup.5 (15 M) and 10.sup.4 (150 M), whereas it was lower than 10.sup.5 (5 M) for H. In a medium having limiting concentration (limiting medium or depleted medium) of said vitamin the concentration is less than 1, e.g. 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, relative to said standard concentration of the respective vitamin present in a complete medium (1). The concentration of a vitamin is considered saturating if the concentration exceeds that in a standard reference medium (also referred to herein as a saturated medium) (e.g., 2, 3, 4, 5, or 10 the amount found in a complete medium).
[0065] Cell culture media having a limiting and/or a saturating concentration of a vitamin are part of the present invention. E.g., the medium may be depleted with respect to one vitamin, but saturated with respect to another vitamin.
[0066] In a limiting medium the growth and/or division of said cells may be arrested, and a protein of interest may be produced at a maximum arrested level (MAL in [g/l]). The MAL may exceed a maximum level (ML in [g/l]) of protein expressed by the same type of cells when grown in a medium such as a standard medium, in which their growth is not arrested. In certain embodiments of the present invention, the MAL is more than 1.5the ML, more than 2the ML or even more than 2.5 or 3the ML. For example, while a ML of protein of interest, such as an antibody that is expressed by recombinant cells, such as recombinant CHO cells in standard medium is about 1 g/l of IgG, the MAL of protein of interest, such as an antibody that is expressed by recombinant cells, such as recombinant CHO cells in standard medium is about 3 g/l of IgG or more.
[0067] The vitamin metabolic protein, including the vitamin transport protein, may be a full length wild type protein or may be mutated, including by point mutations, substitutions, insertions, additions and/or terminal or internal deletions or inversions. While a vitamin metabolic protein may, relative to a particular sequence, contain a mutation which has (i) activity corresponding to the wild type protein (neutral mutation), a vitamin metabolic/transport protein is referred to as mutated in the context of the present invention when the mutation causes an (ii) altered activity/stability compared to the wild type protein which includes increased activity (up mutation) (by e.g. more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90% or more than 100%) or decreased activity/stability (down mutation) (by e.g. less than 10%, less than 20%, less than 30%, less than 40%, less than 50%, less than 60%, less than 70%, less than 80%, less than 90%, less than or by 100%). Whether or not a particular mutation is an up or down mutation can be readily assessed be standard assays available in the art. The mutated vitamin metabolic protein results from a mutation in the least one first polynucleotide encoding the vitamin metabolic protein. Similarly, a mutation in the sequence regulating the expression of said first polypeptide is called an up-mutation when the polypeptide encoded by the polynucleotide is expressed more or more stably (e.g., 10%, 20%, 30%, 40%, 50%, or more) than when the in a sequence regulating the expression of said first polypeptide does not comprise the mutation. A mutation in a sequence regulating the expression of said first polypeptide is called a down mutation when the polypeptide encoded by the polynucleotide is expressed less or less stably than the first polynucleotide e.g., 10%, 20%, 30%, 40%, 50%, or less) than when the sequence regulating the expression of said first polypeptide does not comprise the mutation. Up-mutations in the sequences regulating the expression of the first polypeptide may also correspond to the addition of a MAR, SAR, LCR and./or an insulator element in addition to the enhancer and promoter sequences in order to increase the expression level or stability of the protein encoded by said polynucleotide.
[0068] The desired modifications or mutations in the polypeptide may be accomplished using any techniques known in the art. Recombinant DNA techniques for introducing such changes in a protein sequence are well known in the art. In certain embodiments, the modifications are made by site-directed mutagenesis of the polynucleotide encoding the protein or the sequence regulating (regulatory sequences as defined above) its expression. Other techniques for introducing mutations are discussed in Molecular Cloning: A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch, and Maniatis (Cold Spring Harbor Laboratory Press: 1989); the treatise, Methods in Enzymnology (Academic Press, Inc., N.Y.); Ausubel et al. Current Protocols in Molecular Biology (John Wiley & Sons, Inc., New York, 1999); each of which is incorporated herein by reference.
[0069] Well known are in particular down mutations in promoters and other regulatory sequences inherent in a cell. The mutation lowers the affinity of the transcription factors for the promoter region, lowering transcription rates. However, mutations in promoter regions may also be neutral or cause up mutations.
[0070] Polynucleotides and proteins having more than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the polynucleotides and proteins sequences disclosed herein, in particular those disclosed in
[0071] The term sequence identity refers to a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. Identity, per se, has recognized meaning in the art and can be calculated using published techniques. (See, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term identity is well known to skilled artisans (Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988)).
[0072] Whether any particular nucleic acid molecule is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the SMTV nucleic acid sequence [SEQ ID NO. 21], or a part thereof, can be determined conventionally using known computer programs such as DNAsis software (Hitachi Software, San Bruno, Calif.) for initial sequence alignment followed by ESEE version 3.0 DNA/protein sequence software (cabot@trog.mbb.sfu.ca) for multiple sequence alignments.
[0073] Whether the amino acid sequence is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance SEQ ID NO. 28, or a part thereof, can be determined conventionally using known computer programs such the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). BESTFIT uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences.
[0074] When using DNAsis, ESEE, BESTFIT or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleic acid or amino acid sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
[0075] A recombinant eukaryotic cell according to the present invention is a eukaryotic cell containing a transgene as defined above.
[0076] An essential vitamin according to the present invention is a vitamin required for cell growth, division and/or viability.
[0077] Expression systems generally contain a selectable marker gene which facilitates the selection of eukaryotic cells (host cells) transformed with vectors containing the polynucleotide encoding the protein of interest. The selectable marker (or selectable marker protein) expressed by the gene are often based on antibiotic resistance. E.g. a puromycin resistance selection expression cassette can be used to identify, via the addition of pyromycin, cells that has been successfully transformed with the cassette. However, selection without any resistance to antibiotics is also possible. Examples of selectable markers of this kind are dihydrofolate reductase (DHFR) and glutamine synthetase (GS). Selection occurs, e.g., in the absence of the metabolites e.g. glycine, hypoxanthine and thymidine for DHFR and glutamine for GS. Cells surviving selection comprise one or more copies of the transformed plasmid in the cell's genome. In the context of the present invention, the vitamin metabolic protein/vitamin transport protein may serve as selectable marker either alone or in combination with other selectable markers. Thus, in its simplest form, in a medium that is deficient in one vitamin, recombinant eukaryotic cells expressing the respective vitamin transport protein as a selectable marker can grow better than cells not expressing the respective vitamin transport protein. However, as discussed herein, even in standard medium, the vitamin transport proteins provide a growth advantage and thus can be used as selectable marker. The expression systems of the present invention may contain, as selectable markers, vitamin metabolic protein(s)/vitamin transport protein(s) in addition to selectable marker genes based, e.g., on antibiotic resistance.
[0078] Similarly, a mutation in the sequence regulating the expression of said first polypeptide is called an up-mutation when the polypeptide encoded by the polynucleotide is expressed more or is more stable (e.g., 10%, 20%, 30%, 40%, 50%, or more) than when the in a sequence regulating the expression of said first polypeptide does not comprise the mutation. A mutation in a sequence regulating the expression of said first polypeptide is called a down-mutation when the polypeptide encoded by the polynucleotide is expressed less than the first polynucleotide or is less stable (e.g., 10%, 20%, 30%, 40%, 50%, or less) than when the sequence regulating the expression of said first polypeptide does not comprise the mutation.
[0079] The desired modifications or mutations in the polypeptide may be accomplished using any techniques known in the art. Recombinant DNA techniques for introducing such changes in a protein sequence are well known in the art. In certain embodiments, the modifications are made by site-directed mutagenesis of the polynucleotide encoding the protein or the sequence regulating (regulatory sequences as defined above) its expression. Other techniques for introducing mutations are discussed in Molecular Cloning: A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch, and Maniatis (Cold Spring Harbor Laboratory Press: 1989); the treatise, Methods in Enzymnology (Academic Press, Inc., N.Y.); Ausubel et al. Current Protocols in Molecular Biology (John Wiley & Sons, Inc., New York, 1999); each of which is incorporated herein by reference.
[0080] Well known are in particular down mutations in promoters and other regulatory sequences inherent in a cell. The mutation lowers the affinity of the transcription factors for the promoter region, lowering transcription rates. Mutations in promoter regions may be neutral, cause down or up mutations. Similarly, mutations in, e.g., a gene for a vitamin metabolic protein such as a vitamin transport protein may be neutral, be down or up mutations.
1Effects of Limiting Vitamin Transport on CHO Cell Growth and Recombinant Protein Expression
[0081] A first step to the use of vitamins by cultured mammalian cells is their cellular uptake from the culture medium. Vitamins B1 (thiamin), B5 (panthotenate) and H (B8 or biotin) are soluble vitamins that are transported in the cytoplasm and then into the mitochondria, where they act as metabolic cofactors (
TABLE-US-00001 TABLE 1 Mice genes involved in vitamin uptake into the cell. Last column: transcript accumulation in CHO-M cells. CHO-M transcriptome (hit number in Vitamin Function Localization Accession RPKM) B1 (THTR)-1 (Thiamine Transporter) Plasma Slc19a2 3270/12 membrane (THTR)-2 (Thiamine Transporter) Plasma Slc19a3 0/0 membrane TPK (Thiamine Pyrophosphate Kinase) Cytosol Tpk1 4899/12 TPC (Thiamine Pyrophosphate Carrier) Mitochondria Slc25a19 6016/22 H + B5 SMTV (Sodium-dpdt MulTiVitamin Plasma Slc5a6 5267/13 transporter) membrane B5 PANK1 (Pantothenate Kinase 1) Mitochondria Pank1 3 PANK2 (Pantothenate Kinase 2) Mitochondria Pank2 38
1.1Determining the Growth-Limiting Vitamin Concentrations
[0082] To assess the effect of limiting vitamin concentration on cell growth, a cell culture medium specifically depleted of vitamins B1, B5 and H, called B-CDmin, was derived from a commercially available growth medium (BalanCD CHO growth medium, IRVINE SCIENTIFIC INC). CHO-M cells seeded in the B-CDmin medium were unable to maintain cell divisions, as expected (
TABLE-US-00002 TABLE 2 Vitamin B1, B5 and H composition in SLX and CDM4CHO media (done by mass spectrometry, cf. Selexis), and concentration added in the BalanCD minimum media. Culture media B1/Thiamin B5/Panthotenate H/Biotin SLX medium 8.84 M 14.26 M 90 nM CDM4CHO medium 6.75 M 2.99 M 3.06 M BalanCD minimum + 7.5 M 2.5 M 0.5 M vitamin B1, B5, H (1X)
[0083] The depleted B-CDmin medium was complemented with lower concentration of each vitamin separately, to determine the contrations range limiting CHO-M growth. B5 was essential for CHO-M growth, with a growth-limiting concentration range around 10.sup.4 to 10.sup.3 (0.25 to 2.5 nM), whereas 10.sup.2 and higher concentrations allowed normal culture growth (
1.2Effect of Growth-Limiting B5 Vitamin Concentration on Protein Expression and Modifications
[0084] It was next assessed whether the growth arrest observed upon the depletion of B5 may be used to interrupt or slow down cell division in protein production conditions, so as to possibly increase protein production, using fed-batch cultures maintained in spin-tube bioreactors. A CHO-M derived cell clone expressing a therapeutic protein displayed an increase of the cell number until day 8 when grown in the complete medium, after which the cell viability and viable cell number dropped, as usually observed from these culture conditions (
[0085] The titer of the antibody secreted in the cell culture supernatant increased up to 3 g/L until day 9 in the complete medium culture, after which it declined (
1.3Effect of Increasing B5 Vitamin Transport on Cell Growth
[0086] Based on the findings that cell growth can be inhibited either by the lack of B5, by high concentrations of H, which can compete with B5 for their common transporter, or by high concentrations of B5, which can compete with H for their common transporter, it was hypothesized that overexpressing the common Slc5a6 transporter might provide a growth advantage to the cells and/or may lead to higher viable cell densities. We thus cloned the CHO-M cDNA encoding the multivitamin Slc5a6 transporter, and other vitamin B1 transporters, as indicated in Table 1, and inserted them under the control of the strong GAPDH promoter and MAR 1-68 epigenetic activator element, next to a puromycin resistance selection expression cassette. CHO-M cells were co-transformed with this Slc5a6 construct, with a GFP expression vector and with a puromycin selection plasmid, after which stable polyclonal populations were obtained from the selection of puromycin-resistant cells. Up to 100-fold higher Slc5a6 transcript accumulation was observed in populations of CHO-M cells transformed with increasing amounts of the expression vector, when compared to the endogenous expression level (
[0087] Cell populations overexpressing SLC5A6 were then grown without puromycin selection in the B-CDmin medium supplemented with various concentrations of B5 and H. As before, cell division nearly arrested in the absence of B5 after 6 days of culture, irrespective of the overexpression of the transporter or of the presence of vitamin H (
[0088] Interestingly, when B5 was added in 10 excess in presence of the low H amount (10B5; 10.sup.4H), untransformed cell growth was strongly inhibited relative to the culture of these cells in the complete medium (1B5; 10.sup.4H). However, cells expressing the highest transporter level grew significantly more than those expressing the transporter at lower levels in the presence of the excess of B5 (10B5; 10.sup.4H). This further indicated the occurrence of a competition of the two vitamins for their common transporter, where saturating concentrations of B5 may inhibit the uptake of low amounts of H in the culture medium, thus limiting growth, unless the transporter is overexpressed. Overall, it was concluded that overexpression of the SLC5A6 transporter can confer a growth advantage in presence of either limiting concentrations of B5, or conversely in presence of saturating concentrations of B5 but with limiting amounts of H. It was hypothesized that this might therefore be used to discriminate cells that express elevated amounts of the transporter against those that express it at lower levels.
2Use of SLC5A6 (SMVT) Transporter Expression as a Selection Marker for Transformed Cells
[0089] The expression from the co-transformed GFP vector was quantified to determine if the co-transformation of the Slc5a6 transporter may have increased the overall transgene expression levels. Cells having integrated the plasmids in their genome and stably expressing the transgenes were selected either by culture in a B5-limiting medium or in the presence of puromycin. The percentage of GFP-expressing fluorescent cells as well as the cellular fluorescence intensities were first assessed following selection by B5 deprivation. Upon selection in presence of limiting amounts of B5 (10.sup.3), the highest proportion of both the GFP-positive cells and the average fluorescence levels were obtained when co-transforming the cells with 250 ng of the SLC5A6 expression plasmid (
TABLE-US-00003 TABLE 3 Vector mixes used for transfections with Slc5a6 + puro + GFP/IgG pGAPDH- MAR1-68- pGAPDH- pGAPDH- pGAPDH- Slc5a6 MAR1-68-GFP pSV-Puro 1.68-IgG.sub.Lc 1.68-IgG.sub.Hc Vectors (10148 bp) (8978 bp) (4118 bp) (12551 bp) (13274 bp) Mix1: GFP/puro (ng) 0 1884 23 0 0 Mix2: Slc5a6(50 ng)/GFP/puro 50 1834 23 0 0 (ng) Mix3: 100 1784 23 0 0 Slc5a6(100 ng)/GFP/puro (ng) Mix4: 250 1634 23 0 0 Slc5a6(250 ng)/GFP/puro (ng) Mix5: IgG.sub.Lc/IgG.sub.Hc/puro (ng) 0 0 17.9 1000 769.2 Mix6: 250 0 17.9 1000 769.2 Slc5a6(250 ng)/IgG.sub.Lc/IgG.sub.Hc/puro (ng)
[0090] When the cells were selected by puromycin in a medium containing a non-limiting B5 concentration, GFP fluorescent cells were obtained irrespective of Slc5a6 expression, as expected. Nevertheless, the most highly fluorescent cells were often obtained upon the co-transformation of 250 ng of the Slc5a6 expression vector (data not shown). This indicated that the vitamin transporter may confer a selective advantage to cells that express it at higher levels even in non-limiting culture media. When puromycin selection was followed by further culture in the vitamin B5-limiting medium, extremely high expression levels were observed in most of the cells overexpressing the SLC5a6 transporter (
[0091] This approach was pursued for the expression of a transgene encoding a therapeutic recombinant protein, namely the Trastuzumab monoclonal immunoglobulin (IgG). Cells were co-transformed with a plasmid encoding both Slc5a6 and the immunoglobulin light chain, and with another vector expressing the puromycin resistance marker and the immunoglobulin heavy chain. Cells were then selected under various regimen of B5 deprivation or puromycin treatment (
[0092] It was first assessed which of the selection conditions yielded polyclonal cell populations displaying the highest IgG secretion levels in the supernatants of fed batch cultures. Cells selected with puromycin only yielded the lowest levels of secreted IgG (A+ condition,
[0093] The highest proportion of IgG-expressing cells, in the 80 to 90% range, and the most elevated levels of cell surface fluorescence, were observed for the polyclonal cell pools selected using vitamin deprivation (
[0094] An example of a process of cell selection is depicted in
[0095] The GFP expressing polyclonal cell populations obtained in the process depicted in
[0096] In
[0097] Selected cell clones were further analyzed. In particular, two clones (C_a and C_b) obtained by the limiting dilution of a polyclonal cell pool expressing SLC5A6 and a therapeutic IgG, and selected using vitamin deprivation (Condition C in
[0098]
[0099] It will be apparent to someone skilled in the art that other vitamin metabolic genes can be overexpressed for similar purposes, as depicted for instance in
[0100] Similarly, host cells can be engineered to express lower levels of the transporter and other genes, to generate cell lines with even stronger selection properties. Finally, the use of cell culture media deprived of vitamins B1, B5 or H, or combinations thereof, as used in this study, is a general approach that can be used to increase the production levels of cells, whether they are engineered to overexpress one or more vitamin metabolic genes, as in
[0101] The above shows that polyclonal or monoclonal populations of cells producing recombinants proteins at homogeneous and very high levels can be obtained using coding sequences expressing vitamin metabolic proteins as selection markers. It was shown that vitamin deprivation during fed-batch bioreactor production conditions can be used to improve the viability of cell clones and their productivity in terms of the titer of secreted recombinant therapeutic proteins. Interestingly, these effects were obtained by lowering the levels of e.g. the B5 or H vitamins, but also when levels of one of the vitamins was raised above saturating levels. This later effect was noted when the elevation of B5 concentration above usual levels allowed the selection of cells that express high levels of the SLC5a6 selection gene, when grown in presence of low amounts of vitamin H. Thus, optimal selection regimen can also be designed by the increase of vitamin concentration, or by varying the relative levels of two vitamins that use the same membrane transporter. The approach described here is thus of high value for selecting and identifying cell clones that produce a protein of interest to more elevated and stable levels, and thus using reduced screening time and efforts, and also to increase protein production levels and cell viability independently of cell origin or vitamin gene engineering.
Material and Methods
Vitamin Gene Sequences and DNA Vector Constructs
[0102] Vitamin genomic and cDNA sequences were determined after alignment of the homologous genes in mice SCL5A6, SLC19A2, SLC19A3, TPK1, SLC25A19 using NCBI BLAST software. Transcript sequence and accumulation of the corresponding genes was determined using SELEXIS CHO-M gene expression database. CDSs (coding DNA sequences) and protein sequences are listed in
[0103] CHO-M (SURE CHO-M Cell Line (SELEXIS Inc., San Francisco, USA)), cDNA library was amplified by reverse transcription from 1 ug total RNA isolated from 10.sup.6 CHO-M cells (NucleoSpin RNA kit; Macherey-Nagel) using Superscript Reverse Transcription Enzyme II and random primers (Goscript Reverse Transcription System; PROMEGA).
[0104] Vitamin coding sequences (CDS) were cloned into the pGAPDH-MAR 1-68-GFP vector, by cutting out the green fluorescent protein (GFP) gene and replacing it with the vitamin CDS. Vectors were constructed as follow: The CDS were amplified from CHO-M cDNA library by PCR (PHUSION High-Fidelity DNA Polymerase; Finnzymes, THERMO FISHER SCIENTIFIC) from ATG to Stop using primers carrying restriction site HinIII/XbaI for SCL5A6, HinIII/FseI for SLC19A2, NcoI/XbaI for SLC19A3, HinIII/XbaI for TPK1, HinIII/XbaI for SLC25A19 (Table 4). Then, the cDNA products and pGAPDH vectors were double-digested by the corresponding restriction enzymes. Finally, the cDNAs were ligated into the pGAPDH-MAR 1-68 vector where the GFP sequence was cut out after digestions with the same restriction enzymes.
TABLE-US-00004 TABLE4 PrimerSequences SEQ.ID. PRIMERNAME PRIMERSEQUENCE5_3 PURPOSE NO. Slc5a6-ATG- AAAAAGCTTATGAGTGTGGAAGAGAGCA CloningoftheCDS SEQID1 HindIII_F Slc5a6-Stop- AAATCTAGATCACAGGGAGGTCTCCT CloningoftheCDS SEQID2 Xbal_R Pank2-ATG- AAAAAGCTTATGTCTGGTGGCTTCCCTAAGG CloningoftheCDS SEQID3 HindIII_F C Pak2-Stop- AAATCTAGATCACAACCGGTCAGC CloningoftheCDS SEQID4 Xbal_R Slc19a2-ATG- AAAAAGCTTATGCATGGATTATGCAGCC CloningoftheCDS SEQID5 HindIII_F Slc19a2-Stop- AAAGGCCGGCCTTAGGGAGTAGTTGCTTGA CloningoftheCDS SEQID6 FseI_R Slc19a3-ATG- AAACCATGGAAACCATAATGAAGATA CloningoftheCDS SEQID7 Ncol_F Slc19a3-Stop- AAATCTAGATCAGAACTTGGTTGACACAT CloningoftheCDS SEQID8 Xbal_R Tpkl-ATG- AAAAAGCTTATGGAGCATGCGTTTACC CloningoftheCDS SEQID9 HindIII_F Tpkl-Stop- AAATCTAGATTAGCTTTTGACGGCCATG CloningoftheCDS SEQID10 Xbal_R Slc25a19-ATG- AAAAAGCTTATGGTCGGCTATGACGC CloningoftheCDS SEQID11 HindIII_F Slc25a19-Stop- AAATCTAGACTATCTGTCTTCACTCCTTA CloningoftheCDS SEQID12 Xbal_R Slc5a6-qRT-F GTGCCTATGAGTACCTGGAGCTT QuantitativePCR SEQID13 Slc5a6-qRT-R AGCAACTCCCATGTAGATCACC QuantitativePCR SEQID14 IgG1-Lc-qRT-F AGGACAGCAAGGACTCCACCTA QuantitativePCR SEQID15 IgG1-Lc-qRT-R CGTACACCTTGTGCTTCTCGTAG QuantitativePCR SEQID16 IgG1-Hc-qRT-F GGACCCTGAGGTGAAGTTCAAT QuantitativePCR SEQID17 IgG1-Hc-qRT-R GGTAGGTGCTGTTGTACTGTTCC QuantitativePCR SEQID18 GFP-qRT-F ACATTATGCCGGACAAAGCC QuantitativePCR SEQID19 GFP-qRT-R TTGTTTGGTAATGATCAGCAAGTTG QuantitativePCR SEQID20 GAPDH-qRT-F QuantitativePCR GAPDH-qRT-R QuantitativePCR
[0105] The pGAPDH-MAR 1-68-GFP vector was described previously (Girod et al., 2007; Hart and Laemmli, 1998; Grandjean et al., 2011). The GFP protein was expressed using a eukaryotic expression cassette composed of a human cytomegalovirus (CMV) enhancer and human glyceraldehydes 3-phosphate dehydrogenase (GAPDH) promoter upstream of the coding sequence followed by a simian virus 40 (SV40) polyadenylation signal, the human gastrin terminator and a SV40 enhancer (Le Fourn et al., 2013).
[0106] The pSV-puro vector contains the puromycin resistance gene (puro) under the control of the SV40 promoter originated from pRc/RSVplasmid (INVITROGEN/LIFE TECHNOLOGIES).
[0107] The immunoglobulin expression vectors 1-68 filled-IgG1-Lc and 1-68 filled-IgG1-Hc were as previously described.
Cell Culture, Stable Transformation and Stable Polyclonal Line Analyses
[0108] Suspension Chinese hamster ovary cells (CHO-M) were maintained in suspension culture in SFM4CHO-M Hyclone serum-free medium (SFM, ThermoScientific) supplemented with L-glutamine (PAA, Austria) and HT supplement (GIBCO, INVITROGEN LIFE SCIENCES) at 37 C, 5% CO2 in humidified air. Other cell media used for these experiments are the BalanCD CHO-M Growth A (B-CDfull; Irvine Scientific), and the Deficient BalanCD CHO-M Growth A (B-CDmin; Irvine Scientific), supplemented with vitamin B1 (thiamine Hydrochloride; SIGMA ALDRICH), vitamin B5 (Calcium DL-Pantothenate; TCI) and vitamin H (Biotin, SIGMA ALDRICH)
[0109] CHO-M cells were transformed with PvuI-digested SLC5A6, GFP, puromycin, IgG1-Hc or IgG1-Lc expression vectors (see vector mixes in Table 3) by electroporation according to the manufacturer's recommendations (NEONDEVICES, INVITROGEN).
[0110] GFP and IgG1-producing cell polyclonal lines expressing the Slc5a6 and GFP or IgG were selected for further experiments as follow: One day before transformation, cells were grown at 300 000 cells/ml in B5 selective media which consisted in B-CDmin media supplemented with 7.5 M B1 (1), 250 nM B5 (10.sup.3) and 5 uM H (10.sup.4). After transformation, cells were directly incubated in a 24-well plate with B5 selective media for 24 h, then transferred to several wells depending on the experiments. For puromycin selection, cells were seeded in SFM media supplemented with 10 mg/ml puromycin for 2 weeks, then transferred into well with SFM media for 5 days, then into 50 ml spin tubes with SFM media. For B5 selection, cells were seeded in B5 selective media for 7-9 days, then transferred into SFM non selective media as for puromycin selection.
[0111] For double selection of the cells with puromycin then B5, polyclonal stable cell lines were first selected with puromycin, then cells were seeded at 20 000 cells/ml in 24-well plate in B5 selective media for 7 days (B-CDfull media was used as negative control), then transferred in SFM full media wells for 7 days, then seeded into pin tube with SFM media.
[0112] The percentage of fluorescent cells and the fluorescence intensity of GFP positive cells were determined by FACS analysis using a CyAn ADP flow cytometer (BECKMAN COULTER) Immunoglobulin concentrations in cell culture supernatants were measured by sandwich ELISA. Slc5a6, GFP, IgG1Lc and IgG1Hc transcript accumulation was confirmed by RT-quantitative PCR assays before analyses. Surface staining, IgG titer and limiting dilution where performed according to Le Fourn et al. (2014).
Quantitative PCR Analysis
[0113] For quantitative PCR (qPCR) analysis, total RNA was extracted from 10.sup.6 cells and reverse transcribed into cDNA. Transcripts accumulation was quantified by qPCR using the SYBR Green-Taq polymerase kit from Eurogentec Inc and ABI Prism 7700 PCR machine (Applied Biosystems) and using primers Slc5a6-qRT-F and Slc5a6-qRT-R listed in Table 4. Transcript levels were normalized to that of GAPDH housekeeping gene.
Statistical Analysis
[0114] The results are expressed as meansstandard error of the mean (SEM). Statistical analysis was performed using the two-tailed Student's t-test. Asterisks in the figure panels refer to statistical probabilities. Statistical probability values of less than 0.05 were considered significant.
[0115] It will be appreciated that the systems (vectors/cells etc.), methods and kits of the instant invention can be incorporated in the form of a variety of embodiments, only a few of which are disclosed herein. It will be apparent to the artisan that other embodiments exist and do not depart from the spirit of the invention. Thus, the described embodiments are illustrative and should not be construed as limiting.
LITERATURE
[0116] Birch, J. R. & Racher, A. J. (2006) Antibody production. Adv Drug Deliv Rev, 58, 671-85. [0117] Cacciatore, J. J., Chasin, L. A. & Leonard, E. F. (2010) Gene amplification and vector engineering to achieve rapid and high-level therapeutic protein production using the Dhfr-based CHO cell selection system. Biotechnol Adv, 28, 673-81. [0118] Brunetti D, Dusi S, Morbin M, Uggetti A, Moda F, D'Amato I, Giordano C, d'Amati G, Cozzi A, Levi S, Hayflick S, Tiranti V. (2012). Pantothenate kinase-associated neurodegeneration: altered mitochondria membrane potential and defective respiration in Pank2 knock-out mouse model. Hum Mol Genet. 21:5294-305 [0119] Chusainow, J., Yang, Y. S., Yeo, J. H., Toh, P. C., et al., (2009) A study of monoclonal antibody-producing CHO cell lines: what makes a stable high producer? Biotechnol. Bioeng. 102, 1182-1196. [0120] Dean, J. and P. Reddy (2013). Metabolic analysis of antibody producing CHO cells in fed-batch production. Biotechnology and bioengineering 110(6): 1735-1747. [0121] Du Z, Treiber D, McCarter J D, Fomina-Yadlin D, Saleem R A, McCoy R E, Zhang Y, Tharmalingam T, Leith M, Follstad B D, Dell B, Grisim B, Zupke C, Heath C, Morris A E, Reddy P. (2015). Use of a small molecule cell cycle inhibitor to control cell growth and improve specific productivity and product quality of recombinant proteins in CHO cell cultures. Biotechnol. Bioeng. 112: 141-155. [0122] Garcia M., Leonardi R, Zhang Y M, Rehg J E, Jackowski S. (2012). Germline deletion of pantothenate kinases 1 and 2 reveals the key roles for CoA in postnatal metabolism. PLoS One. 7:e40871. [0123] P. A. Girod, D. Q. Nguyen, D. Calabrese, S. Puttini, M. Grandjean, D. Martinet, A. Regamey, D. Saugy, J. S. Beckmann, P Bucher, N. Mermod (2007). Genome-wide prediction of matrix attachment regions that increase gene expression in mammalian cells. Nat. Methods, 4 (2007), pp. 747-753 [0124] Ghosal, A., N. Lambrecht, et al. (2013). Conditional knockout of the Slc5a6 gene in mouse intestine impairs biotin absorption. American journal of physiology. Gastrointestinal and liver physiology 304(1): G64-71. [0125] M. Grandjean, P. A. Girod, D. Calabrese, K. Kostyrko, M. Wicht, F. Yerly, C. Mazza, J. S. Beckmann, D. Martinet, N. Mermod (2011). High-level transgene expression by homologous recombination-mediated gene transfer. Nucleic Acids Res., 39, p. e104. [0126] C. M. Hart, U. K. Laemmli (1998). Facilitation of chromatin dynamics by SARs. Curr. Opin. Genet. Dev., 8, pp. 519-525. [0127] Jostock, T. (2011) Expression of Antibody in Mammalian Cells Cell Engineering, 7, 1-24. [0128] V. Le Fourn, P. A. Girod, M. Buceta, A. Regamey, N. Mermod (2014). CHO cell engineering to prevent polypeptide aggregation and improve therapeutic protein secretion. Metab. Eng., 21, pp. 91-102. [0129] Nam J H, Zhang F, Ermonval M, Linhardt R J, Sharfstein S T. (2008). The effects of culture conditions on the glycosylation of secreted human placental alkaline phosphatase produced in Chinese hamster ovary cells. Biotechnol Bioeng 100:1178-1192. [0130] Rothem, L., B. Berman, et al. (2005). The reduced folate carrier gene is a novel selectable marker for recombinant protein overexpression. Molecular pharmacology 68(3): 616-624. [0131] Sajan E, Matanguihan R, Heidemann R, Abu-Absi S, Asuncion W, Yamasaki G, Wu X, Chen J, Murphy J E, Zhang C. (2010). The effect of bioreactor pH and temperature on protein glycosylation in perfusion cultures of mammalian cells. ESACT Proc 4:785-788. [0132] Sampathkumar S G, Jones M B, Meledeo M A, Campbell C T, Choi S S, Hida K, Gomutputra P, Sheh A, Gilmartin T, Head S R., et al. (2006). Targeting glycosylation pathways and the cell cycle: Sugar-dependent activity of butyrate-carbohydrate cancer prodrugs. Chem Biol 13:1265-1275. [0133] Schlatter, S., Stansfield, S. H., Dinnis, D. M., Racher, A. J., et al., (2005) On the optimal ratio of heavy to light chain genes for efficient recombinant antibody production by CHO cells. Biotechnol. Prog. 21, 122-133. [0134] Trummer E, Fauland K, Seidinger S, Schriebl K, Lattenmayer C, Kunert R, Vorauer-Uhl K, Weik R, Borth N, Katinger H, et al. (2006). Process parameter shifting: Part II. Biphasic cultivation-A tool for enhancing the volumetric productivity of batch processes using Epo-Fc expressing CHO cells. Biotechnol Bioeng 94:1045-1052.