BACTERIAL PREPARATIONS FOR ICE NUCLEATION
20220348614 · 2022-11-03
Assignee
Inventors
- Werner LUBITZ (Klosterneuburg - Kritzendorf, AT)
- Mascha RESCH (Wien, AT)
- Johannes KASSMANNHUBER (Dornbirn, AT)
Cpc classification
F25C3/04
MECHANICAL ENGINEERING; LIGHTING; HEATING; WEAPONS; BLASTING
International classification
Abstract
The present invention relates to bacterial preparations comprising ice nucleation proteins. Such bacterial preparations can in particular be used for the production of snow or rain, for hail suppression or for fog dispersal.
Claims
1-16. (canceled)
17. A bacterial preparation comprising inactivated bacteria, bacterial ghosts (BGs) or fragments thereof which carry an ice nucleation protein (INP) and which are fixed with a fixation agent.
18. The bacterial preparation of claim 17, wherein the fixation agent is glutaraldehyde.
19. The bacterial preparation of claim 17, wherein the ice nucleation protein (INP) is within the cytoplasm, anchored at the inner membrane (IM) or anchored at the outer membrane (OM).
20. The bacterial preparation of claim 17, comprising bacterial ghosts (BGs) which carry an ice nucleation protein (INP) anchored at the outer membrane (OM).
21. A bacterial preparation, comprising an ice nucleation protein (INP) lacking a transport sequence for localization in the outer membrane.
22. The bacterial preparation of claim 21, wherein the bacterial preparation comprises inactivated bacteria, bacterial ghosts (BGs), fragments of bacteria or fragments of bacterial ghosts.
23. The bacterial preparation of claim 21, wherein it comprises the ice nucleation protein (INP) in the cytoplasm or anchored at the inner membrane (IM).
24. A bacterial preparation of claim 17, comprising inactivated bacteria, bacterial ghosts (BGs) or fragments thereof which carry a heterologous ice nucleation protein (INP).
25. The bacterial preparation according to claim 24, comprising inactivated E. coli bacteria, E. coli bacterial ghosts (BGs) or fragments thereof which carry an ice nucleation protein (INP) of Pseudomonas syringae.
26. The bacterial preparation of claim 17, comprising bacterial ghosts (BGs) or fragments thereof which carry an ice nucleation protein (INP) anchored at the inner membrane (IM).
27. The bacterial preparation of claim 17, comprising inactivated bacteria or fragments thereof which carry an ice nucleation protein (INP) within the cytoplasm or anchored at the inner membrane (IM).
28. The bacterial preparation of claim 17, wherein the ice nucleation protein is an ice nucleation protein (INP) of Pseudomonas syringae, in particular a N-terminal truncated form of the ice nucleation protein (INP) of Pseudomonas syringae.
29. The bacterial preparation of claim 17, wherein the inactivated bacteria are E. coli bacteria and/or the bacterial ghosts are E. coli bacterial ghosts.
30. The bacterial preparation of claim 21, wherein the bacterial preparation is fixed with a fixation agent, in particular with glutaraldehyde.
31. The bacterial preparation of claim 17, wherein the ice nucleation protein (INP) is heterologous to the inactivated bacteria or bacterial ghosts (BGs).
32. A method for ice nucleation, for the production of snow, for the production of rain, for cloud seeding, weather modification, as cloud condensation nuclei (CNN), for artificial cloud creation, for ice nucleation in the atmosphere, for hail suppression or for fog dispersal including applying a bacterial preparation according to claim 17.
Description
[0069] The invention is further explained by the enclosed Figures and the following examples.
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
Example 1
[0081] Formation of Bacteria and Bacterial Ghosts
[0082] Bacterial ghosts (BGs) having a truncated form of InaZ localized to the inner membrane were produced. For the production of BGs exposing INPs to the luminal side of the inner membrane (IM), directional targeting of InaZ lacking 162aa of the 175aa-long N-terminal domain (—NINP) via N-terminal E′domain (E′-NINP), C-terminal L′domain (—NINP-L′) or by fusing —NINP with both anchor peptides (E′-NINP-L′) was used. —NINP is shown in SEQ ID NO: 2. In order to express different forms of IM anchored —NINP fusion proteins plasmids pBE-NINPH, pBH-NINPL and pBE-NINPHL were constructed.
[0083] Bacterial strains, plasmids and primers utilized are listed in Table 1.
TABLE-US-00001 Strains, plasmids Source or and primers Description Reference Bacterial Strain E. coli C41 (DE3) F-ompT hsdSB (rB- mB-) gal dem (DE3). Lucigen E. coli K-12 5-α F′ proA.sup.+B.sup.+ lacl.sup.q Δ(lacZ)M15 zzf::Tn10(Tet.sup.R)/fhuA2Δ(argF- NEB lacZ)U169 phoA glnV44 Φ80Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17. Plasmids pBAD24 Bacterial expression vector containing the arabinose P.sub.BAD BIRD-C promotor system; restriction enzyme cloning; AmpR; ColE1 ori. pGLMivb Laclq-P.sub.TAC-Eivb; Gent.sup.R. pEX-A2INP P.sub.LAC-inaZ, coding for InaZ, PUC Origin; Amp.sup.R. Eurofins Genomics pBELK P.sub.BAD-E′-L′-cassette for inner-membrane anchoring of proteins, BIRD-C Kan.sup.R. pBH-NINP P.sub.BAD-H-NINP; Amp.sup.R. Coding for InaZ lacking N-terminal domain sequence with N-terminal His-tagged fusion. pBE-NINPHSLK P.sub.BAD-E′-NINP-His; Kan.sup.R. Coding for E′-NINP-His fusion protein. pBE-NINPH P.sub.BAD-E′-NINP-His; Amp.sup.R. Coding for E′-NINP-His fusion protein. pBH-NINPLK P.sub.BAD-His-NINP-L′; Kan.sup.R. Coding for His-NINP-L′ fusion protein. pBH-NINPL P.sub.BAD-His-NINP-L′; Amp.sup.R. Coding for His-NINP-L′ fusion protein. pBE-NINPHLK P.sub.BAD-E′-NINPhis-L′; Kan.sup.R. Coding for E′-NINPHis-L′ fusion gene. pBE-NINPHLK P.sub.BAD-E′-NINPhis-L'; Amp.sup.R. Coding for E′-NINPHis-L′ fusion gene. Restriction Primers Sequence (5′.fwdarw.3′) site P1: -N_INP-fwd GTACGCTCTAGAAGTAAACACCCTGCCGGT XbaI P2: INP-His-rev AAAAAACTGCAGTTATTAATGGTGATGGTGATGGTGAGAGCCG PstI GATCCCTTTACCTCTATCCAGTCATC P3: E′-fwd GTACCGGAATTCTTTATGGTACGCTGGACT EcoRI P4: His-tag-rev GACCCAAGCTTGCAGTTATTAATGGTGATGG HindIII P5: His-NINP-fwd GTACCGGAATTCACTACTCATGCACCATCACCATCACCATGGA EcoRI TCCGGCTCTGTAAACACCCTGCCGGT P6: INP-rev AAAAAACTGCAGACTTTACCTCTATCCAGTCATC PstI P7: His-tag-fwd GTACCGGAATTCCATGCACCATCACCATC EcoRI P8: L′-rev GTACGCTCTAGACTTTGTGAGCAATTCGTC XbaI P9: INP-His1-rev AAAAAACTGCAGAATGGTGATGGTGATGGTGAGAGCCGGATC PstI CCTTTACCTCTATCCAGTCATC P10: L′1-rev AACATGCCATGGCTTTGTGAGCAATTCGTC NcoI The primer restriction sites are underlined and 6x His-tag sequence is highlighted in italic.
[0084] The E. coli strain K-12 5-α has been used for routine cloning and E. coli C41 (DE3) (Lucigen) for BG production. Plasmid pBAD24, E-lysis plasmid pGLMivb and plasmid pBELK were obtained from BIRD-C plasmid collection. Plasmid pBELK contains an E′-L′-anchoring cassette derived from pKSEL5-2 under control of the arabinose inducible P.sub.BAD promoter. Plasmid pEX-A2INP (Eurofins Genomics) harbors a chemically synthesized 3603 bp inaZ gene encoding INP of P. syringae S203. The sequence thereof is given as SEQ ID NO: 1. In lysis plasmid pGLMivb expression of the lysis gene E is under control of P.sub.TAC promoter and translational fused to an in vivo biotinylation sequence. Expression vector pBH-NINP, coding for a N-terminal His-tagged truncated INP lacking 486 bp of the 525 bp long N-terminal domain (H—NINP) has been described in J. Kassmannhuber et al., Functional Display of Ice Nucleation Protein InaZ on the surface of Bacterial Ghosts, Bioengineering 2017.
[0085] In order to construct a fusion between INP and the E′-anchor first a truncated INP lacking N-terminal domain (—NINP) (lacking first 485 nt) was generated. A 3171 bp fragment absent of INP N-domain sequence was produced by PCR amplification using plasmid pEX-A2INP as template and primers P1 and P2 to introduce Xbal- and Pstl-restriction sites at the termini and a 6x-His tag coding sequence at 3′-end with a terminal coding sequence. The amplified PCR-product coding for —NINP-His was cloned into the corresponding sites of pBELK resulting in plasmid pBE-NINPHSLK. The 3338 bp translational fused E-NINP-His PCR-fragment was amplified using pBE-NINPHSLK as template and primers P3 and P4 containing EcoRI and HindIII at terminal restriction sites. The fragment was cloned into the equivalent sites of pBAD24 to construct the E′-NINP-His anchor fusion protein expression-vector pBE-NINPH under transcriptional control of the arabinose-inducible expression system.
[0086] Using pEX-A2INP as template a 3171 bp PCR-fragment, encoding the His-NINP protein without termination codon, was obtained by PCR amplification. Primers P5 and P6 were used to introduce a 6x-His tag coding sequence at 5′-end and EcoRI-PstI-restriction sites at the terminal ends. In frame fusion of the L′-anchor and His-NINP sequence was generated by cloning the fragment into the equivalent sites of pBELK resulting in pBH-NINPLK. By PCR using pBH-NINPLK as template and primers P7 and P8 to introduce restriction sites EcoRI and Xbal at the termini a 3366 bp PCR— fragment was obtained encoding the anchor fusion protein His-NINP-L′. The fragment was cloned into the corresponding sites of pBAD24 resulting in pBH-NINPL.
[0087] A 3165 bp PCR-fragment was generated by using P1 and P9 primers and pEX-A2INP as template to obtain the —NINP-His gene without a terminal coding sequence and 5′Xbal and 3′Pstl restriction sites. The fragment was cloned into the Xbal/Pstl sites of pBELK resulting in pBE-NINPHLK carrying the E′-NINPH-L′ fusion gene, which translational fuses the —NINP-His sequence to the amino-terminal E′ sequence and the carboxy-terminal L′ sequence. The E′-NINP-L′ gene was amplified by using primers P3 and P10 to introduce EcoRI and Ncol restriction sites at the termini. The 3528 bp fragment was cloned into the corresponding sites of pBAD24 resulting in pBE-NINPHL.
[0088] Bacterial cultures were grown in animal protein-free, vegetable variant of Luria-Bertani (LBv: 10.0 g/l soy peptone (Car Roth) 5.0 g/l yeast extract (Carl Roth) and 5.0 g/l NaCl) and supplemented with appropriate antibiotics, ampicillin (100 μg/ml), gentamycin (20 μg/ml) and kanamycin (50 μg/ml) at 37° or 23° C. To induce expression of the anchor fusion gene which is under the control of P.sub.BAD promoter the E. coli C41 cells carrying plasmid (pBE-NINPH, pBH-NINPL, or pBE-NINPHL) were grown in LBv supplemented with 0.2% L-arabinose at 23° C. In plasmid pGLMivb the expression of lysis gene E is under the control of synthetic P.sub.TAC promotor. The bacterial lysis was induced with 0.5 mM isopropyl-D-1-thiogalactopyranoside (IPTG). Gene E-mediated lysis of bacteria was induced when cells reached an optical density at 600 nm (OD.sub.600) of 0.6, and was extended for duration of 120 min. At the end of the E-lysis procedure the BGs were harvested and washed four times with 1× Vol. of sterile de-ionized water (dH.sub.2O) by centrifugation and finally resuspended in 1× Vol. of sterile dH.sub.2O. For inactivation of any surviving E-lysis escape mutants from BG production representing a minor fraction of about 0.1%-0.3% the washed BGs harvest was treated with 0.17% (v/v) of the DNA-alkylating agent β-propiolactone (BPL, 98.5%, Ferak) and kept for 120 min at 23° C. with slow agitation. After inactivation process, the fully inactivated cell broth consisting of BGs and inactivated surviving cells were washed twice with 1× Vol. of sterile dH.sub.2O and once with ROTISOLV® water (Carl Roth) and resuspended in 1/10× Vol. ROTISOLV® water. The suspensions of E. coli C41 cells and BGs carrying cytoplasmic membrane anchored ice nucleation protein were adjusted to a concentration of 5×10.sup.8 cells ml.sup.−1 determined by flow cytometry (FCM) in ROTISOLV® water.
Example 2
[0089] Determination of Colony Forming Units (Cfu)
[0090] For cfu determination appropriate dilutions of samples (0.85% (w/v) NaCl Solution) were plated on Plate Count Agar (PCA) (Carl Roth) using a WASP spiral plater (Don Whitley Scientific). 50 μl samples were plated on PCA plates as triplicates. The plates were incubated at 35° C. over night and the next day the cfu was analyzed by a ProtoCOL SR 92000 colony counter (Synoptics Ltd);
[0091] Lysis efficiency (LE) is defined as ratio of BGs to total cell counts and can be calculated as following equation:
[0092] where t.sub.0 is the time point of lysis induction (LI) and t any time after LI.
[0093] Lysis efficiency (LE) for E. coli C41 carrying plasmids (pBE-NINPH and pGLMivb) amounts to 99.9%; for E. coli C41 carrying plasmid (pBH-NINPL and pGLMivb) a LE of 99.8% and for E. coli C41 harboring plasmids (pBE-NINPHL and pGLMivb) a LE of 99.7% was achieved.
[0094] E-Lysis Monitoring
[0095] The BG production was monitored by light-microscopy (Leica DM R microscope, Leica Microsystems), by measuring the optical density at 600 nm (OD.sub.600) and fluorescence-based flow cytometry (FCM). Briefly, flow cytometry was performed using a CyFlow® SL flow cytometer (Partec) and the membrane potential-sensitive dye DiBAC.sub.4(3) was well as the phospholipid membranes staining RH414 (both from AnaSpec) were used for fluorescent labeling, Dye RH414 was used for discriminating non-cellular background and DiBAC for the evaluation of cell-viability. Data were analyzed using FloMax V 2.52 (CyFlow SL; Quantum Analysis) illustrating forward scatter (FSC) against DiBAC fluorescence signal (FL1, DiBAC) and presented as 2D density dot plots as shown in
[0096] The fluorescent dye RH414 staining phospholipid membranes enables discrimination of non-cellular background and DiBAC.sub.4(3) penetrating depolarized cell membranes binding to intracellular proteins or membrane compartments signaling changes in the membrane potential were used. A complete switch of DiBAC-negative cells with high scatter signal (G1), to DiBAC-positive cells with a diminished scatter signal (G2) marks the completion of protein E-mediated lysis process (
[0097] In order to inactivate E-lysis escape mutants, the cultures were further incubated at 23° C. and treated with 0.17% (v/v) β-propiolactone for another 120 min. In the final preparation of E. coli BGs carrying either E′-NINP (E′-NINP-BG), —NINP-L′(—NINP-L′-BG) or E-NINP-L′ (E-NINP-L′-BG) no viable cells were detected.
[0098] Western Blot Analyses
[0099] Pellets of 5×10.sup.−8 cells or BGs, respectively per ml were boiled in SDS gel-loading buffer (1×) for 5 min and separated on Bolt™ 4-12% Bis-Tris Plus gel by using a XCell SureLock™ Mini-Cell electrophoresis system (Thermo Fisher Scientific). By using XCell II™ Blot Module (Thermo Fisher Scientific) the electrophoretically separated proteins were then transferred to nitrocellulose membrane (GE Healthcare) with transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol). The membrane was placed in TBST (20 mM Tris-HCl, pH7.5, 100 mM NaCl, 0.05% Tween-20) with 5% milk powder (Carl Roth) overnight at 4° C. Polyclonal α-H—NINP serum from rabbit was used to detect recombinant INP. Immunodetection was performed using α-H—NINP serum followed by α-rabbit IgG-HRP (GE Healthcare). Detection was performed using Amersham ECL Western blot detection kit (GE Healthcare) and developed with ChemiDoc™ XRS (Bio-Rad). The results are shown in
[0100] The predicted molecular mass (M.sub.r) of the fusion protein E′-NINP is 109.2 kDa, M.sub.r of —NINP-L is 110.3 kDa and of E′-NINP-L′ 116.9 kDa. The full length —NINP forms were detected around their specific M.sub.r. Apart from the unspecific binding of the used polyclonal antibodies with proteins derived from E. coli, the lower migrated bands around 75 kDa most probably represent degradation products of the above mentioned INPs.
Example 3
[0101] Measurement of Ice Nucleation Activity
[0102] Ice nucleation activities of E. coli C41 constructs and BG-derived versions carrying either E′-INP, —NINP-L′ or E′-NINP-L′ were determined by a droplet-freezing assay. Additionally, full E. coli C41 cells carrying pBH-NINP encoding a cytoplasmic N-terminal His-tagged truncated INP lacking 162 aa of N-terminal outer-membrane binding domain (C41-NINP) were tested for their ice-nucleating activity.
[0103] Out of each suspension to be tested, forty-five 10 μl droplets of each tenfold dilutions series (ranging from 5×10.sup.8 cells ml.sup.−1 to 5×10.sup.4 cells ml.sup.−1) were tested for active ice nuclei inside the droplet at a given temperature. The droplets were distributed on a sterile aluminum plate coated with a hydrophobic film and surrounded by styrofoam and covered by a plexiglas plate for isolation. The temperature of the working plate was decreased by two in series circuited two-stage Peltier elements of the type TEC2-127-63-04. The surface temperature of the plate was measured by a small precision temperature sensor TS-NTC-103A (B+B Thermo-Technik). Ice nucleation activity was tested from −2 to −13° C. at a constant rate of 1° C. decrements. After a 30 sec dwell time at each temperature the Plexiglas plate was removed and the number of frozen droplets was recorded. The results are shown in
Example 4
[0104] Determination of Ice Nucleation Activity
[0105] Forty-five (of 10 μl volume) drops containing a known number of BGs or bacterial cell suspension was allowed to cool to a fixed temperature as in Example 3 and the number of frozen droplets were counted. This measurement was repeated for each and every series of 10-fold dilutions to obtain statistically significant values The different samples were compared by their median freezing temperature (T.sub.50), which represents the temperature where 50% of all droplets are frozen. The T.sub.50 was calculated with the equation,
[0106] where, F1 and F2 are the number of frozen droplets at temperature T1 and adjacent temperature T2, and are just below and above 50% of the total number of tested drops (n).
[0107] The cumulative number N(T), of ice nuclei ml.sup.−1 active at a given temperature was calculated by
[0108] where, f=fraction of unfrozen droplets at temperature T, V=volume of each droplet used (10 μl), D=the number of 1:10 serial dilutions of the original suspension. N(T) was normalized for the number of cells present in each suspension to obtain the nucleation frequency (NF) per cell by dividing ice nuclei −ml through cell density (cell-ml)
[0109] The Results are Shown in
[0110] The first frozen droplets of E. coli C41 cells without INP (median freezing temperature, T.sub.50, of −20.1° C.) and E. coli C41 BGs without INP (T.sub.50 of −18.9° C.) were detected at −14° C.
[0111] BGs carrying E′-NINP fusion protein (E′-NINP-BG) showed a T.sub.50 value at −7.7° C., T.sub.50 for BGs carrying —NINP-L′ (—NINP-L′-BG) was determined at −8.7° C. and for BGs with E′-NINP-L′ anchored (E′-NINP-L′-BG) a T.sub.50 at −9° C. was recorded.
[0112] For C41-NINP a T.sub.50 of −7.1° C. was determined, for C41 E′-NINP, a T.sub.50 of −7.2° C., for C41-NINP-L′ a T.sub.50 of −7.2° C. and for C41 E′-NINP-L′ a T.sub.50 of −8.8° C.
[0113] C41-NINP carries cytoplasmic N-terminal truncated INP while in C41 E′-NINP, C41-NINP-L′ and C41 E′-NINP-L′ the ice nuclein proteins are anchored at the inner membrane.
Example 5
[0114] Sum Frequency Generation Spectroscopy
[0115] To test the impact of INPs in BG on the water structure sum frequency generation (SFG) vibrational spectroscopy was used. SFG uses frequency mixing of infrared and visible laser pulses to probe the molecular structure of interfaces.
[0116] The SFG setup is based on a Ti:sapphire fs-laser oscillator (MaiTai, Spectra-Physics). A regenerative amplifier (SpitFire Ace, Spectra-Physics) pumped by a Nd:YLF laser (EMPower, Spectra-Physics) is used to generate a 9,5 mJ pulse at 800 nm with a 40 fs duration at a repetition rate of 1 kHz. 1.5 mJ of the output energy is used to pump a commercial optical parametric amplifier (TOPAS-C, Spectra-Physics). The signal and idler pulses of the parametric amplifier are mixed in a silver gallium disulfide (AgGaS.sub.2) difference frequency generation crystal, resulting in 3 μJ IR pulses, centered at 2500 cm.sup.−1 with a full width at half maximum (FWHM) of ˜800 cm.sup.−1. The narrowband visible (VIS) up-conversion pulses (25 ρJ, FWHM˜15 cm.sup.−1) are obtained by passing 800 nm pulses (1 mJ pulse energy) through a Fabry-Perot etalon (SLS Optics Ltd). The visible and IR beams are spatially and temporally overlapped on the sample surface with incident angles of 45° and 50°, respectively, with respect to the surface normal. The desired ssp (s-polarized SFG, s-polarized VIS, p-polarized IR) polarization is obtained using polarizer and half wave plates in combination. The VIS and IR beams are focused on the sample with 20 cm and 5 cm focal length plano-convex lenses respectively. The sum-frequency signal is collected in reflection geometry and collimated by a 20 cm focal length lens before passing through a short wave pass filter to remove the residual visible light. The polarization of the SFG light is controlled by polarization optics before it is guided to a spectrograph (Acton Instruments) and detected with an electron-multiplied charge-coupled device (EMCCD) camera (Newton; Andor Technologies). All SFG spectra were recorded under ssp polarization conditions. The spectra where recorded over 5 minutes. The SFG sample area and the IR beam path were flushed with nitrogen to avoid spectral artifacts from water vapor. All the SFG spectra were normalized using reference spectra obtained from z-cut quartz.
[0117] The Results are Shown in
[0118] The interaction of E′-NINP-BG with water was probed with SFG for BGs assembled at the air-water interface. SFG spectra of the BG monolayers were collected in the ssp (s-polarized SFG, s-polarized visible, p-polarized infrared) polarization combination. The spectra show C—H resonances between 2900 cm.sup.−1 and 2800 cm.sup.−1. These resonances are related to methylene units within carbohydrates, lipids, protein side chains and other organic molecules present in the BGs. Strong modes in the O-D stretching range between 2200 and 2700 cm.sup.−1 show the presence of ordered water molecules at the bacterial membrane surfaces. Disordered water near the membrane is not detected with SFG. The room temperature spectrum (blue trace) shows a broad peak with components related to weakly and strongly hydrogen-bonded water molecules. Spectra collected at 15° C., 10° C., and 5° C. showed an increase of the SFG water signal, indicating that more ordered water is present at the surface. The data clearly indicate that INPs within the BGs orient water within their hydration shell when cooled to appropriate temperatures.
Example 6
[0119] Surface Tension Experimental Details
[0120] Surface tension has been measured using a Langmuir tensiometer (Kibron, Finland). E′-NINP-BG have been prepared in D.sub.2O. The temperature-controlled trough was thoroughly rinsed with acetone, ethanol and milli-Q water, and dried under nitrogen stream prior to measurements. The tensiometer was calibrated using pure D.sub.2O at room temperature (20° C.).
Example 7
[0121] Inactivation with Glutaraldehyde (GA)
[0122] E. coli POP2135 bacteria having the ice nucleation protein InaZ expressed into the cytoplasm (E. coli POP2135 InaZ-cyto) were prepared.
[0123] Further, bacterial ghosts from E. coli POP2135 carrying InaZ on the outer membrane (E. coli POP2135 InaZ-OM) were prepared.
[0124] Cell suspensions of E. coli POP2135 InaZ-cyto as well as of E. coli POP2135 InaZ-OM were washed with 0.3% sodium bicarbonate. Thereafter, glutaraldehyde (GA) was added to the suspensions and inactivation/fixation was performed at room temperature (20° C. to 23° C.) at GA concentrations of 0.02% (v/v), 0.05% (v/v), 0.1% (v/v), 0.2% (v/v), 0.5% (v/v), 1% (v/v) and 2% (v/v). Cell suspensions containing 1×10.sup.10 bacteria or ghosts, respectively, per ml were incubated for 15 minutes up to overnight. Cell suspensions containing 5×10.sup.10 bacteria or ghosts, respectively, per ml were inactivated for 15 minutes up to overnight.
[0125] A droplet-freezing assay (DFA) was carried out with the obtained inactivated and fixed bacterial preparations.
[0126] The results are shown in
[0127] The Present Application Further Discloses the Following Items:
[0128] Item 1. Bacterial preparation comprising [0129] inactivated bacteria, bacterial ghosts (BGs) or fragments thereof which carry an ice nucleation protein (INP) and which are fixed with a fixation agent.
[0130] Item 2. Bacterial preparation according to item 1, [0131] wherein the fixation agent is glutaraldehyde.
[0132] Item 3. Bacterial preparation according to any one of items 1 or 2, [0133] wherein the ice nucleation protein (INP) is within the cytoplasm, anchored at the inner membrane (IM) or anchored at the outer membrane (OM).
[0134] Item 4. Bacterial preparation according to any one of items 1 to 3, [0135] comprising bacterial ghosts (BGs) which carry an ice nucleation protein (INP) anchored at the outer membrane (OM).
[0136] Item 5. Bacterial preparation according to any one of items 1 to 4, [0137] comprising inactivated bacteria, bacterial ghosts (BGs) or fragments thereof which carry a heterologous ice nucleation protein (INP).
[0138] Item 6. Bacterial preparation according to any one of items 1 to 5, [0139] comprising inactivated E. coli bacteria, E. coli bacterial ghosts (BGs) or fragments thereof which carry an ice nucleation protein (INP) of Pseudomonas syringae.
[0140] Item 7. Use of a bacterial preparation according to any one of items 1 to 6 for [0141] ice nucleation, for the production of snow, for the production of rain, for could seeding, weather modification, as cloud condensation nuclei (CNN), for artificial cloud creation or for ice nucleation in the atmosphere.
[0142] In a further preferred embodiment, the present invention discloses the following items:
[0143] Item 1. Bacterial preparation, [0144] characterized in that [0145] it comprises an ice nucleation protein (INP) lacking a transport sequence for localization in the outer membrane.
[0146] Item 2. Bacterial preparation according to item 1, [0147] characterized in that [0148] the bacterial preparation comprises inactivated bacteria, bacterial ghosts (BGs), fragments of bacteria or fragments of bacterial ghosts.
[0149] Item 3. Bacterial preparation according to item 1 or 2, [0150] characterized in that [0151] it comprises the ice nucleation protein (INP) in the cytoplasm or anchored at the inner membrane (IM).
[0152] Item 4. Bacterial preparation according to any one of items 1 to 3, [0153] characterized in that [0154] the ice nucleation protein is an ice nucleation protein (INP) of Pseudomonas syringae.
[0155] Item 5. Bacterial preparation according to any one of items 1 to 4, [0156] characterized in that [0157] the ice nucleation protein is a N-terminal truncated form of the ice nucleation protein (INP) of Pseudomonas syringae.
[0158] Item 6. Bacterial preparation according to any one of items 1 to 5, [0159] characterized in that [0160] the ice nucleation protein is a truncated form of the nucleation protein InaZ which is devoid of a transport sequence for localization in the outer membrane.
[0161] Item 7. Bacterial preparation according to any one of items 1 to 6, [0162] characterized in that [0163] the ice nucleation protein (INP) contains or is fused to inner membrane anchors.
[0164] Item 8. Bacterial preparation according to any one of items 1 to 7, [0165] characterized in that [0166] the ice nucleation protein (INP) is a N-terminal truncated ice nucleation protein of Pseudomonas syringae having SEQ ID NO: 1.
[0167] Item 9. Bacterial preparation according to any one of items 1 to 8, [0168] characterized in that [0169] the bacterium is an E. coli bacterium and, in particular E. coli POP2135, E. coli C41 or E. coli K12 or that the bacterial ghost is an E. coli bacterial ghost and, in particular, an E. coli POP2135, E. coli C41 or an E. coli K12 bacterial ghost.
[0170] Item 10. Bacterial preparation according to any one of items 1 to 9, [0171] characterized in that the ice nucleation protein (INP) is heterologous to the inactivated bacteria or bacterial ghosts (BGs).
[0172] Item 11. Use of a bacterial preparation according to any one of items 1 to 10 for ice nucleation.
[0173] Item 12. Use of a bacterial preparation according to any one of items 1 to 10 for the production of snow.
[0174] Item 13. Use of a bacterial preparation according to any one of items 1 to 10 for the production of rain.
[0175] Item 14. Use of a bacterial preparation of any one of items 1 to 10 for cloud seeding, weather modification, as cloud condensation nuclei (CCN), for artificial cloud creation or for ice nucleation in the atmosphere.
[0176] In a further preferred embodiment, the present application discloses the following items:
[0177] Item 1. Bacterial preparation [0178] comprising bacterial ghosts (BGs) or fragments thereof which carry an ice nucleation protein (INP) anchored at the inner membrane (IM).
[0179] Item 2. Bacterial preparation [0180] comprising inactivated bacteria or fragments thereof which carry an ice nucleation protein (INP) within the cytoplasm or anchored at the inner membrane (IM).
[0181] Item 3. Bacterial preparation according to any one of items 1 or 2, [0182] wherein the ice nucleation protein is an ice nucleation protein (INP) of Pseudomonas syringae, in particular a N-terminal truncated form of the ice nucleation protein (INP) of Pseudomonas syringae.
[0183] Item 4. Bacterial preparation according to any one of items 1 to 3, [0184] wherein the inactivated bacteria are E. coli bacteria and/or the bacterial ghosts are E. coli bacterial ghosts.
[0185] Item 5. Bacterial preparation according to any one of items 1 to 4, [0186] wherein the bacterial preparation is fixed with a fixation agent, in particular with glutaraldehyde.
[0187] Item 6. Bacterial preparation according to any one of items 1 to 5, [0188] wherein the ice nucleation protein (INP) is heterologous to the inactivated bacteria or bacterial ghosts (BGs).
[0189] Item 7. Bacterial preparation according to any of items 1 to 6, [0190] wherein the ice nucleation protein (INP) contains or is fused to at least one inner membrane anchor.
[0191] Item 8. Bacterial preparation according to item 7, [0192] wherein the inner membrane anchor is based on the hydrophobic membrane spanning domains of the E and/or L and/or the truncated E′ and/or L′ proteins of the bacteriophages ϕX174 and MS2.
[0193] Item 9. Use of a bacterial preparation according to any one of items 1 to 8 for ice nucleation, for the production of snow, for the production of rain, for cloud seeding, weather modification, as cloud condensation nuclei (CNN), for artificial cloud creation or for ice nucleation in the atmosphere.