SMALL MOLECULE THERAPEUTIC COMPOUNDS THAT REDUCE THE INCIDENCE OF INTRACEREBRAL HEMORRHAGE AND BRAIN MICROHEMORRHAGES
20180064731 ยท 2018-03-08
Inventors
- R. Loch MacDonald (Scottsdale, AZ, US)
- Xiao-Yan Wen (Toronto, CA)
- Tom A. Schweizer (Oakville, CA)
- Andrew Baker (Toronto, CA)
Cpc classification
A61K31/4545
HUMAN NECESSITIES
A61K31/567
HUMAN NECESSITIES
A61P9/14
HUMAN NECESSITIES
A61K31/585
HUMAN NECESSITIES
A61K31/357
HUMAN NECESSITIES
A61K31/58
HUMAN NECESSITIES
International classification
A61K31/585
HUMAN NECESSITIES
A61K31/357
HUMAN NECESSITIES
A61K31/4545
HUMAN NECESSITIES
Abstract
The described invention relates to small molecule therapeutic compounds capable of reducing the incidence of intracerebral hemorrhage and brain microhemorrhages identified using zebrafish and mouse models of intracerebral hemorrhage and brain microhemorrhages.
Claims
1. A method for reducing incidence of vascular leakage comprising administering a pharmaceutical composition containing a small molecule therapeutic compound, a therapeutic amount of which is effective to reduce incidence of bleeding in the brain by at least 30% relative to a control.
2. The method according to claim 1, wherein the small molecule therapeutic compound is selected from the group consisting of artemether or a derivative of artemether.
3. The method according to claim 2, wherein the derivative of artemether is dihydroartemisinin, artemisinin, or artesunate.
4. The method according to claim 1, wherein the small molecule therapeutic compound is selected from the group consisting of benidipine, lacidipine, ethynylestradiol or triptolide.
5. The method according to claim 1, wherein the vascular leakage is induced by a statin, by a lipopolysaccharide, or both.
6. The method according to claim 5, wherein the statin is atorvastatin.
7. The method according to claim 1, wherein the vascular leakage is a spontaneous intracerebral hemorrhage.
8. The method according to claim 7, wherein the spontaneous intracerebral hemorrhage occurs in association with a mutation of one or more genes selected from beta-pix, Pak2a, cdh5, ccm1, ccm2, ccm3, Rap1b, Pggt1b, Hmgcrb, and integrin beta3.
9. The method according to claim 1, wherein the vascular leakage includes a brain microhemorrhage.
10. The method according to claim 9, wherein the brain microhemorrhage occurs in association with administration of a statin.
11. The method according to claim 1, wherein the vascular leakage comprises a brain vascular malformation.
12. The method according to claim 11, wherein the brain vascular malformation is a cerebral cavernous malformation.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0105] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
DETAILED DESCRIPTION OF THE INVENTION
Glossary
[0122] The term active as used herein refers to the ingredient, component or constituent of the compositions of the described invention responsible for the intended therapeutic effect. The term administer as used herein means to give or to apply. The term administering as used herein includes in vivo administration, as well as administration directly to cells or a tissue ex vivo.
[0123] The term agonist as used herein refers to a chemical substance capable of activating a receptor to induce a full or partial pharmacological response. Receptors can be activated or inactivated by either endogenous or exogenous agonists and antagonists, resulting in stimulating or inhibiting a biological response. A physiological agonist is a substance that creates the same bodily responses, but does not bind to the same receptor. An endogenous agonist for a particular receptor is a compound naturally produced by the body which binds to and activates that receptor. A superagonist is a compound that is capable of producing a greater maximal response than the endogenous agonist for the target receptor, and thus an efficiency greater than 100%. This does not necessarily mean that it is more potent than the endogenous agonist, but is rather a comparison of the maximum possible response that can be produced inside a cell following receptor binding. Full agonists bind and activate a receptor, displaying full efficacy at that receptor. Partial agonists also bind and activate a given receptor, but have only partial efficacy at the receptor relative to a full agonist. An inverse agonist is an agent which binds to the same receptor binding-site as an agonist for that receptor and reverses constitutive activity of receptors. Inverse agonists exert the opposite pharmacological effect of a receptor agonist. An irreversible agonist is a type of agonist that binds permanently to a receptor in such a manner that the receptor is permanently activated. It is distinct from a mere agonist in that the association of an agonist to a receptor is reversible, whereas the binding of an irreversible agonist to a receptor is believed to be irreversible. This causes the compound to produce a brief burst of agonist activity, followed by desensitization and internalization of the receptor, which with long-term treatment produces an effect more like an antagonist. A selective agonist is specific for one certain type of receptor.
[0124] The term amplification as used herein refers to a replication of genetic material that results in an increase in the number of copies of that genetic material.
[0125] Anatomical Terms:
[0126] When referring to animals, that typically have one end with a head and mouth, with the opposite end often having the anus and tail, the head end is referred to as the cranial end, while the tail end is referred to as the caudal end. Within the head itself, rostral refers to the direction toward the end of the nose, and caudal is used to refer to the tail direction. The surface or side of an animal's body that is normally oriented upwards, away from the pull of gravity, is the dorsal side; the opposite side, typically the one closest to the ground when walking on all legs, swimming or flying, is the ventral side. On the limbs or other appendages, a point closer to the main body is proximal; a point farther away is distal. Three basic reference planes are used in zoological anatomy. A sagittal plane divides the body into left and right portions. The midsagittal plane is in the midline, i.e. it would pass through midline structures such as the spine, and all other sagittal planes are parallel to it. A coronal plane divides the body into dorsal and ventral portions. A transverse plane divides the body into cranial and caudal portions.
[0127] When referring to humans, the body and its parts are always described using the assumption that the body is standing upright. Portions of the body which are closer to the head end are superior (corresponding to cranial in animals), while those farther away are inferior (corresponding to caudal in animals). Objects near the front of the body are referred to as anterior (corresponding to ventral in animals); those near the rear of the body are referred to as posterior (corresponding to dorsal in animals). A transverse, axial, or horizontal plane is an X-Y plane, parallel to the ground, which separates the superior/head from the inferior/feet. A coronal or frontal plane is a Y-Z plane, perpendicular to the ground, which separates the anterior from the posterior. A sagittal plane is an X-Z plane, perpendicular to the ground and to the coronal plane, which separates left from right. The midsagittal plane is the specific sagittal plane that is exactly in the middle of the body.
[0128] Structures near the midline are called medial and those near the sides of animals are called lateral. Therefore, medial structures are closer to the midsagittal plane, lateral structures are further from the midsagittal plane. Structures in the midline of the body are median. For example, the tip of a human subject's nose is in the median line.
[0129] Ipsilateral means on the same side, contralateral means on the other side and bilateral means on both sides. Structures that are close to the center of the body are proximal or central, while ones more distant are distal or peripheral. For example, the hands are at the distal end of the arms, while the shoulders are at the proximal ends.
[0130] The term antagonist as used herein refers to a substance that counteracts the effects of another substance.
[0131] The terms apoptosis or programmed cell death refer to a highly regulated and active process that contributes to biologic homeostasis comprised of a series of biochemical events that lead to a variety of morphological changes, including blebbing, changes to the cell membrane, such as loss of membrane asymmetry and attachment, cell shrinkage, nuclear fragmentation, chromatin condensation and chromosomal DNA fragmentation, without damaging the organism.
[0132] Apoptotic cell death is induced by many different factors and involves numerous signaling pathways, some dependent on caspase proteases (a class of cysteine proteases) and others that are caspase independent. It can be triggered by many different cellular stimuli, including cell surface receptors, mitochondrial response to stress, and cytotoxic T cells, resulting in activation of apoptotic signaling pathways.
[0133] The caspases involved in apoptosis convey the apoptotic signal in a proteolytic cascade, with caspases cleaving and activating other caspases that then degrade other cellular targets that lead to cell death. The caspases at the upper end of the cascade include caspase-8 and caspase-9. Caspase-8 is the initial caspase involved in response to receptors with a death domain (DD) like Fas.
[0134] Receptors in the tumor necrosis factor receptor family are associated with the induction of apoptosis, as well as inflammatory signaling. The Fas receptor (CD95) mediates apoptotic signaling by Fas-ligand expressed on the surface of other cells. The Fas-FasL interaction plays an important role in the immune system and lack of this system leads to autoimmunity, indicating that Fas-mediated apoptosis removes self-reactive lymphocytes. Fas signaling also is involved in immune surveillance to remove transformed cells and virus infected cells. Binding of Fas to oligimerized FasL on another cell activates apoptotic signaling through a cytoplasmic domain termed the death domain (DD) that interacts with signaling adaptors including FAF, FADD and DAX to activate the caspase proteolytic cascade. Caspase-8 and caspase-10 first are activated to then cleave and activate downstream caspases and a variety of cellular substrates that lead to cell death.
[0135] Mitochondria participate in apoptotic signaling pathways through the release of mitochondrial proteins into the cytoplasm. Cytochrome c, a key protein in electron transport, is released from mitochondria in response to apoptotic signals, and activates Apaf-1, a protease released from mitochondria. Activated Apaf-1 activates caspase-9 and the rest of the caspase pathway. Smac/DIABLO is released from mitochondria and inhibits IAP proteins that normally interact with caspase-9 to inhibit apoptosis. Apoptosis regulation by Bcl-2 family proteins occurs as family members form complexes that enter the mitochondrial membrane, regulating the release of cytochrome c and other proteins. Tumor necrosis factor family receptors that cause apoptosis directly activate the caspase cascade, but can also activate Bid, a Bcl-2 family member, which activates mitochondria-mediated apoptosis. Bax, another Bcl-2 family member, is activated by this pathway to localize to the mitochondrial membrane and increase its permeability, releasing cytochrome c and other mitochondrial proteins. Bcl-2 and Bcl-xL prevent pore formation, blocking apoptosis. Like cytochrome c, AIF (apoptosis-inducing factor) is a protein found in mitochondria that is released from mitochondria by apoptotic stimuli. While cytochrome C is linked to caspase-dependent apoptotic signaling, AIF release stimulates caspase-independent apoptosis, moving into the nucleus where it binds DNA. DNA binding by AIF stimulates chromatin condensation, and DNA fragmentation, perhaps through recruitment of nucleases.
[0136] The mitochondrial stress pathway begins with the release of cytochrome c from mitochondria, which then interacts with Apaf-1, causing self-cleavage and activation of caspase-9. Caspase-3, -6 and -7 are downstream caspases that are activated by the upstream proteases and act themselves to cleave cellular targets.
[0137] Granzyme B and perforin proteins released by cytotoxic T cells induce apoptosis in target cells, forming transmembrane pores, and triggering apoptosis, perhaps through cleavage of caspases, although caspase-independent mechanisms of granzyme B mediated apoptosis have been suggested.
[0138] Fragmentation of the nuclear genome by multiple nucleases activated by apoptotic signaling pathways to create a nucleosomal ladder is a cellular response characteristic of apoptosis. One nuclease involved in apoptosis is DNA fragmentation factor (DFF), a caspase-activated DNAse (CAD). DFF/CAD is activated through cleavage of its associated inhibitor ICAD by caspases proteases during apoptosis. DFF/CAD interacts with chromatin components such as topoisomerase II and histone H1 to condense chromatin structure and perhaps recruit CAD to chromatin. Another apoptosis activated protease is endonuclease G (EndoG). EndoG is encoded in the nuclear genome but is localized to mitochondria in normal cells. EndoG may play a role in the replication of the mitochondrial genome, as well as in apoptosis. Apoptotic signaling causes the release of EndoG from mitochondria. The EndoG and DFF/CAD pathways are independent since the EndoG pathway still occurs in cells lacking DFF.
[0139] Hypoxia, as well as hypoxia followed by reoxygenation can trigger cytochrome c release and apoptosis. Glycogen synthase kinase (GSK-3) a serine-threonine kinase ubiquitously expressed in most cell types, appears to mediate or potentiate apoptosis due to many stimuli that activate the mitochondrial cell death pathway (Loberg, R D, et al. (2002) J. Biol. Chem. 277 (44): 41667-673). It has been demonstrated to induce caspase 3 activation and to activate the proapoptotic tumor suppressor gene p53. It also has been suggested that GSK-3 promotes activation and translocation of the proapoptotic Bcl-2 family member, Bax, which, upon agregation and mitochondrial localization, induces cytochrome c release. Akt is a critical regulator of GSK-3, and phosphorylation and inactivation of GSK-3 may mediate some of the antiapoptotic effects of Akt.
[0140] The term appearance as used herein refers to an outward aspect or presentation of oneself.
[0141] The term apply as used herein refers to placing in contact with or to lay or spread on.
[0142] The term assay marker or reporter gene (or reporter) refers to a gene that can be detected, or easily identified and measured. The expression of the reporter gene may be measured at either the RNA level, or at the protein level. The gene product, which may be detected in an experimental assay protocol, includes, but is not limited to, marker enzymes, antigens, amino acid sequence markers, cellular phenotypic markers, nucleic acid sequence markers, and the like. Researchers may attach a reporter gene to another gene of interest in cell culture, bacteria, animals, or plants. For example, some reporters are selectable markers, or confer characteristics upon on organisms expressing them allowing the organism to be easily identified and assayed. To introduce a reporter gene into an organism, researchers may place the reporter gene and the gene of interest in the same DNA construct to be inserted into the cell or organism. For bacteria or eukaryotic cells in culture, this may be in the form of a plasmid. Commonly used reporter genes may include, but are not limited to, fluorescent proteins, luciferase, -galactosidase, and selectable markers, such as chloramphenicol and kanomycin.
[0143] The term associate and its various grammatical forms as used herein refers to joining, connecting, or combining to, either directly, indirectly, actively, inactively, inertly, non-inertly, completely or incompletely.
[0144] The term in association with as used herein refers to a relationship between two substances that connects, joins or links one substance with another
[0145] The term biomarkers (or biosignatures) as used herein refers to peptides, proteins, nucleic acids, antibodies, genes, metabolites, or any other substances used as indicators of a biologic state. It is a characteristic that is measured objectively and evaluated as a cellular or molecular indicator of normal biologic processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention. The term indicator as used herein refers to any substance, number or ratio derived from a series of observed facts that may reveal relative changes as a function of time; or a signal, sign, mark, note or symptom that is visible or evidence of the existence or presence thereof. Once a proposed biomarker has been validated, it may be used to diagnose disease risk, presence of disease in an individual, or to tailor treatments for the disease in an individual (choices of drug treatment or administration regimes). In evaluating potential drug therapies, a biomarker may be used as a surrogate for a natural endpoint, such as survival or irreversible morbidity. If a treatment alters the biomarker, and that alteration has a direct connection to improved health, the biomarker may serve as a surrogate endpoint for evaluating clinical benefit. Clinical endpoints are variables that can be used to measure how patients feel, function or survive. Surrogate endpoints are biomarkers that are intended to substitute for a clinical endpoint; these biomarkers are demonstrated to predict a clinical endpoint with a confidence level acceptable to regulators and the clinical community.
[0146] The term cDNA refers to DNA synthesized from a mature mRNA template. cDNA most often is synthesized from mature mRNA using the enzyme reverse transcriptase. The enzyme operates on a single strand of mRNA, generating its complementary DNA based on the pairing of RNA base pairs (A, U, G, C) to their DNA complements (T, A, C, G). There are several methods known for generating cDNA to obtain, for example, eukaryotic cDNA whose introns have been spliced. Generally, these methods incorporate the following steps: a) a eukaryotic cell transcribes the DNA (from genes) into RNA (pre-mRNA); b) the same cell processes the pre-mRNA strands by splicing out introns, and adding a poly-A tail and 5 methyl-guanine cap; c) this mixture of mature mRNA strands are extracted from the cell; d) a poly-T oligonucleotide primer is hybridized onto the poly-A tail of the mature mRNA template (reverse transcriptase requires this double-stranded segment as a primer to start its operation); e) reverse transcriptase is added, along with deoxynucleotide triphosphates (A, T, G, C); f) the reverse transcriptase scans the mature mRNA and synthesizes a sequence of DNA that complements the mRNA template. This strand of DNA is complementary DNA (see also Current Protocols in Molecular Biology, John Wiley & Sons, incorporated in its entirety herein).
[0147] The term cell is used herein to refer to the structural and functional unit of living organisms and is the smallest unit of an organism classified as living.
[0148] The term cell culture as used herein refers to establishment and maintenance of cultures derived from dispersed cells taken from original tissues, primary culture, or from a cell line or cell strain.
[0149] The term cell line as used herein refers to an immortalized cell, which have undergone transformation and can be passed indefinitely in culture.
[0150] The term compatible as used herein means that the components of a composition are capable of being combined with each other in a manner such that there is no interaction that would substantially reduce the efficacy of the composition under ordinary use conditions.
[0151] The terms composition and formulation are used interchangeably herein to refer to a product of the described invention that comprises all active and inert ingredients. The terms pharmaceutical composition or pharmaceutical formulation as used herein refer to a composition or formulation that is employed to prevent, reduce in intensity, cure or otherwise treat a target condition or disease.
[0152] The term contacting as used herein refers to bring or put in contact, to be in or come into contact. The term contact as used herein refers to a state or condition of touching or of immediate or local proximity. Contacting a composition to a target destination, such as, but not limited to, an organ, a tissue, or a cell, may occur by any means of administration known to the skilled artisan.
[0153] The terms deletion and deletion mutation are used interchangeably herein to refer to that in which a base or bases are lost from the DNA.
[0154] The term derivative as used herein means a compound that may be produced from another compound of similar structure in one or more steps. A derivative or derivatives of a peptide or a compound retains at least a degree of the desired function of the peptide or compound. Accordingly, an alternate term for derivative may be functional derivative. Derivatives can include chemical modifications of the peptide, such as akylation, acylation, carbamylation, iodination or any modification that derivatizes the peptide. Such derivatized molecules include, for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formal groups. Free carboxyl groups can be derivatized to form salts, esters, amides, or hydrazides. Free hydroxyl groups can be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine can be derivatized to form N-im-benzylhistidine. Also included as derivatives or analogues are those peptides that contain one or more naturally occurring amino acid derivative of the twenty standard amino acids, for example, 4-hydroxyproline, 5-hydroxylysine, 3-methylhistidine, homoserine, ornithine or carboxyglutamiate, and can include amino acids that are not linked by peptide bonds. Such peptide derivatives can be incorporated during synthesis of a peptide, or a peptide can be modified by well-known chemical modification methods (see, e.g., Glazer et al. (1975), Chemical Modification of Proteins, Selected Methods and Analytical Procedures, Elsevier Biomedical Press, New York).
[0155] The term detectable marker encompasses both selectable markers and assay markers. The term selectable markers refers to a variety of gene products to which cells transformed with an expression construct can be selected or screened, including drug-resistance markers, antigenic markers useful in fluorescence-activated cell sorting, adherence markers such as receptors for adherence ligands allowing selective adherence, and the like. When a nucleic acid is prepared or altered synthetically, advantage can be taken of known codon preferences of the intended host where the nucleic acid is to be expressed.
[0156] The term detectable response refers to any signal or response that may be detected in an assay, which may be performed with or without a detection reagent. Detectable responses include, but are not limited to, radioactive decay and energy (e.g., fluorescent, ultraviolet, infrared, visible) emission, absorption, polarization, fluorescence, phosphorescence, transmission, reflection or resonance transfer. Detectable responses also include chromatographic mobility, turbidity, electrophoretic mobility, mass spectrum, ultraviolet spectrum, infrared spectrum, nuclear magnetic resonance spectrum and x-ray diffraction. Alternatively, a detectable response may be the result of an assay to measure one or more properties of a biologic material, such as melting point, density, conductivity, surface acoustic waves, catalytic activity or elemental composition. A detection reagent is any molecule that generates a detectable response indicative of the presence or absence of a substance of interest. Detection reagents include any of a variety of molecules, such as antibodies, nucleic acid sequences and enzymes. To facilitate detection, a detection reagent may comprise a marker.
[0157] The term differentiation as used herein refers to a property of cells to exhibit tissue-specific differentiated properties in culture.
[0158] The term effective amount refers to the amount necessary or sufficient to realize a desired biologic effect.
[0159] The term EC50 as used herein refers to the concentration (expressed in molar units or g/L) of a drug that produces 50% of the maximal possible effect of that drug.
[0160] The term expression system refers to a genetic sequence, which includes a protein encoding region operably linked to all of the genetic signals necessary to achieve expression of the protein encoding region. Traditionally, the expression system will include a regulatory element such as, for example, a promoter or enhancer, to increase transcription and/or translation of the protein encoding region, or to provide control over expression. The regulatory element may be located upstream or downstream of the protein encoding region, or may be located at an intron (non-coding portion) interrupting the protein encoding region. Alternatively, it also is possible for the sequence of the protein encoding region itself to comprise regulatory ability.
[0161] The term hpf as used herein refers to hours post fertilization.
[0162] The term hybridization refers to the process of combining complementary, single-stranded nucleic acids into a single molecule. Nucleotides will bind to their complement under normal conditions, so two perfectly complementary strands will bind (or anneal) to each other readily. However, due to the different molecular geometries of the nucleotides, a single inconsistency between the two strands will make binding between them more energetically unfavorable. Measuring the effects of base incompatibility by quantifying the rate at which two strands anneal can provide information as to the similarity in base sequence between the two strands being annealed. The term specifically hybridizes as used herein refers to the process whereby a nucleic acid distinctively or definitively forming base pairs with complementary regions of at least one strand of DNA that was not originally paired to the nucleic acid. A nucleic acid that selectively hybridizes undergoes hybridization, under stringent hybridization conditions, of the nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, or 100% sequence identity (i.e., complementary) with each other.
[0163] The term hypomorphic mutation as used herein refers to a type of mutation in which the altered gene product possesses a reduced level of activity, or in which the wild-type gene product is expressed at a reduced level.
[0164] The terms inhibiting, inhibit or inhibition are used herein to refer to reducing the amount or rate of a process, to stopping the process entirely, or to decreasing, limiting, or blocking the action or function thereof. Inhibition may include a reduction or decrease of the amount, rate, action function, or process of a substance by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%.
[0165] The term inhibitor as used herein refers to a molecule that binds to an enzyme thereby decreasing enzyme activity. Enzyme inhibitors are molecules that bind to enzymes thereby decreasing enzyme activity. The binding of an inhibitor may stop substrate from entering the active site of the enzyme and/or hinder the enzyme from catalyzing its reaction. Inhibitor binding is either reversible or irreversible. Irreversible inhibitors usually react with the enzyme and change it chemically, for example, by modifying key amino acid residues needed for enzymatic activity. In contrast, reversible inhibitors bind non-covalently and produce different types of inhibition depending on whether these inhibitors bind the enzyme, the enzyme-substrate complex, or both. Enzyme inhibitors often are evaluated by their specificity and potency.
[0166] An isolated molecule is a molecule that is substantially pure and is free of other substances with which it is ordinarily found in nature or in vivo systems to an extent practical and appropriate for its intended use. In particular, the compositions are sufficiently pure and are sufficiently free from other biological constituents of host cells so as to be useful in, for example, producing pharmaceutical preparations or sequencing if the composition is a nucleic acid, peptide, or polysaccharide. Because compositions may be admixed with a pharmaceutically-acceptable carrier in a pharmaceutical preparation, the compositions may comprise only a small percentage by weight of the preparation. The composition is nonetheless substantially pure in that it has been substantially separated from the substances with which it may be associated in living systems or during synthesis. As used herein, the term substantially pure refers purity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% pure as determined by an analytical protocol. Such protocols may include, for example, but are not limited to, fluorescence activated cell sorting, high performance liquid chromatography, gel electrophoresis, chromatography, and the like.
[0167] The term minimizing progression as used herein refers to reducing the amount, extent, size, or degree of development of a sequence or series of events.
[0168] The term modulate as used herein means to regulate, alter, adapt, or adjust to a certain measure or proportion.
[0169] The term morpholino oligonucleotides (MO) as used herein refer to nonionic DNA analogs with a phosphorodiamidate molecular backbone, which blocks access of other molecules to specific sequences within antisense nucleic acid sequences. Although they possess altered backbone linkages compared with DNA or RNA, morpholinos bind to complementary nucleic acid sequences by Watson-Crick base-pairing. This binding is no tighter than binding of analogous DNA and RNA oligomers, necessitating the use of relatively long 25-base morpholinos for antisense gene inhibition. The backbone makes morpholinos resistant to digestion by nucleases. Also, because the backbone lacks negative charge, it is thought that morpholinos are less likely to interact nonselectively with cellular proteins; such interactions often obscure the observation of informative phenotypes (Corey, D. R. and J. M. Abrams (2001) Morpholino antisense oligonucleotides: tools for investigating vertebrate development, Genome Biol. 2(5): 1015.1-1015.3). Duplex formation between MOs and mRNA prevents translation through MO hybridization near the mRNA translation initiation codon and disrupts correct splicing by targeting the splice donor site Wada, T. et al (2012) Antisense morpholino targeting just upstream from a poly(A) tail junction of material mRNA remoes the tail and inhibits translation, Nucleic Acids Res. 40 (22): e173).
[0170] The term mutation as used herein refers to a change of the DNA sequence within a gene or chromosome of an organism resulting in the creation of a new character or trait not found in the parental type, or the process by which such a change occurs in a chromosome, either through an alteration in the nucleotide sequence of the DNA coding for a gene or through a change in the physical arrangement of a chromosome. Three mechanisms of mutation include substitution (exchange of one base pair for another), addition (the insertion of one or more bases into a sequence), and deletion (loss of one or more base pairs).
[0171] The term nucleic acid is used herein to refer to a DNA or RNA polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., MO oligonucleotides).
[0172] The term nucleotide is used herein to refer to a chemical compound that consists of a heterocyclic base, a sugar, and one or more phosphate groups. In the most common nucleotides, the base is a derivative of purine or pyrimidine, and the sugar is the pentose deoxyribose or ribose. Nucleotides are the monomers of nucleic acids, with three or more bonding together in order to form a nucleic acid. Nucleotides are the structural units of RNA, DNA, and several cofactors, including, but not limited to, CoA, FAD, DMN, NAD, and NADP. Purines include adenine (A), and guanine (G); pyrimidines include cytosine (C), thymine (T), and uracil (U).
[0173] The phrase operably linked refers to a first sequence(s) or domain being positioned sufficiently proximal to a second sequence(s) or domain so that the first sequence(s) or domain can exert influence over the second sequence(s) or domain or a region under control of that second sequence or domain.
[0174] The term polynucleotide refers to a DNA, RNA or analogs thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and/or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide may be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are polynucleotides as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including among other things, simple and complex cells.
[0175] The term pharmaceutical composition as used herein refers to a composition that is employed to prevent, reduce in intensity, cure or otherwise treat a target condition, syndrome, disorder or disease.
[0176] The term pharmaceutically acceptable carrier as used herein refers to any substantially non-toxic carrier conventionally useable for administration of pharmaceuticals in which the isolated polypeptide of the present invention will remain stable and bioavailable. The pharmaceutically acceptable carrier must be of sufficiently high purity and of sufficiently low toxicity to render it suitable for administration to the mammal being treated. It further should maintain the stability and bioavailability of an active agent. The pharmaceutically acceptable carrier can be liquid or solid and is selected, with the planned manner of administration in mind, to provide for the desired bulk, consistency, etc., when combined with an active agent and other components of a given composition.
[0177] The term pharmaceutically acceptable salt as used herein refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like and are commensurate with a reasonable benefit/risk ratio. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts may be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. By pharmaceutically acceptable salt is meant those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well-known in the art. For example, P. H. Stahl, et al. describe pharmaceutically acceptable salts in detail in Handbook of Pharmaceutical Salts: Properties, Selection, and Use (Wiley VCH, Zurich, Switzerland: 2002). The salts may be prepared in situ during the final isolation and purification of the compounds described within the present invention or separately by reacting a free base function with a suitable organic acid. Representative acid addition salts include, but are not limited to, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsufonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethansulfonate(isethionate), lactate, maleate, methanesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate, glutamate, bicarbonate, p-toluenesulfonate and undecanoate. Also, the basic nitrogen-containing groups may be quaternized with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl, diethyl, dibutyl and diamyl sulfates; long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; arylalkyl halides like benzyl and phenethyl bromides and others. Water or oil-soluble or dispersible products are thereby obtained. Examples of acids which may be employed to form pharmaceutically acceptable acid addition salts include such inorganic acids as hydrochloric acid, hydrobromic acid, sulphuric acid and phosphoric acid and such organic acids as oxalic acid, maleic acid, succinic acid and citric acid. Basic addition salts may be prepared in situ during the final isolation and purification of compounds described within the invention by reacting a carboxylic acid-containing moiety with a suitable base such as the hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation or with ammonia or an organic primary, secondary or tertiary amine. Pharmaceutically acceptable salts include, but are not limited to, cations based on alkali metals or alkaline earth metals such as lithium, sodium, potassium, calcium, magnesium and aluminum salts and the like and nontoxic quaternary ammonia and amine cations including ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine and the like. Other representative organic amines useful for the formation of base addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine and the like. Pharmaceutically acceptable salts also may be obtained using standard procedures well known in the art, for example, by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium or magnesium) salts of carboxylic acids may also be made.
[0178] The term primer refers to a nucleic acid which, when hybridized to a strand of DNA, is capable of initiating the synthesis of an extension product in the presence of a suitable polymerization agent. The primer is sufficiently long to uniquely hybridize to a specific region of the DNA strand. A primer also may be used on RNA, for example, to synthesize the first strand of cDNA.
[0179] The term promoter refers to a region of DNA upstream, downstream, or distal, from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. For example, T7, T3 and Sp6 are RNA polymerase promoter sequences. In RNA synthesis, promoters are a means to demarcate which genes should be used for messenger RNA creation and by extension, control which proteins the cell manufactures. Promoters represent critical elements that can work in concert with other regulatory regions (enhancers, silencers, boundary elements/insulators) to direct the level of transcription of a given gene.
[0180] The term reduced or to reduce as used herein refer to a diminishment, a decrease, an attenuation or abatement of the degree, intensity, extent, size, amount, density or number of.
[0181] The term refractory as used herein refers to the state of being unaffected, unresponsive, resistant or not fully responsive.
[0182] The term restriction digestion refers to a procedure used to prepare DNA for analysis or other processing. Also known as DNA fragmentation, it uses a restriction enzyme to selectively cleave strands of DNA into shorter segments.
[0183] The term restriction enzyme (or restriction endonuclease) refers to an enzyme that cuts double-stranded DNA.
[0184] The term restriction sites or restriction recognition sites refer to particular sequences of nucleotides that are recognized by restriction enzymes as sites to cut a DNA molecule. The sites are generally, but not necessarily, palindromic, (because restriction enzymes usually bind as homodimers) and a particular enzyme may cut between two nucleotides within its recognition site, or somewhere nearby.
[0185] The term Rho as used herein refers to a subfamily of proteins related to the RAS subgroup thought to be involved in cell transformation and the regulation of morphology and function of dendritic cells. Non-limiting examples of Rho proteins include RhoA, RhoB and RhoC, RhoG, RhoH, RhoQ, RhoU RhoV, Rnd1, 2 and 3 (e.g., RhoE), and RAC1, 2, 3 and 4.
[0186] Sequence:
[0187] The following terms are used herein to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) reference sequence, (b) comparison window, (c) sequence identity, (d) percentage of sequence identity, and (e) substantial identity.
[0188] The term reference sequence refers to a sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
[0189] The term comparison window refers to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be at least 30 contiguous nucleotides in length, at least 40 contiguous nucleotides in length, at least 50 contiguous nucleotides in length, at least 100 contiguous nucleotides in length, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence, a gap penalty typically is introduced and is subtracted from the number of matches.
[0190] Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981), Adv. Appl. Math. 2:482; by the homology alignment algorithm of Needleman and Wunsch (1970), J. Mol. Biol. 48:443; by the search for similarity method of Pearson and Lipman (1988), Proc. Natl. Acad. Sci. 85:2444; by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif.; GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., USA; the CLUSTAL program is well described by Higgins and Sharp (1988), Gene 73:237-244; Higgins and Sharp (1989) CABIOS 5:151-153; Corpet, et al. (1988) Nucleic Acids Research 16:10881-90; Huang, et al. (1992) Computer Applications in the Biosciences 8:155-65, and Pearson, et al. (1994) Methods in Molecular Biology 24:307-331. The BLAST family of programs, which can be used for database similarity searches, includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995).
[0191] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology-Information (http://www.hcbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits then are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
[0192] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. BLAST searches assume that proteins may be modeled as random sequences. However, many real proteins comprise regions of nonrandom sequences which may be homopolymeric tracts, short-period repeats, or regions enriched in one or more amino acids. Such low-complexity regions may be aligned between unrelated proteins even though other regions of the protein are entirely dissimilar. A number of low-complexity filter programs may be employed to reduce such low-complexity alignments. For example, the SEG (Wooten and Federhen (1993), Comput. Chem., 17:149-163) and XNU (Claverie and States (1993) Comput. Chem., 17:191-201) low-complexity filters may be employed alone or in combination.
[0193] The term sequence identity or identity in the context of two nucleic acid or polypeptide sequences is used herein to refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, i.e., where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have sequence similarity or similarity. Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller (1988) Computer Applic. Biol. Sci., 4:11-17, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).
[0194] The term percentage of sequence identity as used herein means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
[0195] The term substantial identity of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity and at least 95% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill will recognize that these values may be adjusted appropriately to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 60%, or at least 70%, at least 80%, at least 90%, or at least 95%. Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. However, nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is that the polypeptide that the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
[0196] The terms substantial identity in the context of a peptide indicates that a peptide comprises a sequence with at least 70% sequence identity to a reference sequence, at least 80%, at least 85%, at least 90% or 95% sequence identity to the reference sequence over a specified comparison window. Optionally, optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443. An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. Peptides which are substantially similar share sequences as noted above except that residue positions that are not identical may differ by conservative amino acid changes.
[0197] The term subject or individual or patient are used interchangeably to refer to a member of an animal species of vertebrate origin, e.g., a zebrafish, to mammalian origin, including but not limited to, mouse, rat, cat, goat, sheep, horse, hamster, ferret, pig, dog, platypus, guinea pig, rabbit and a primate, such as, for example, a monkey, ape, or human.
[0198] The phrase subject in need thereof as used herein refers to a patient that (i) susceptible to ICH, BMH or CCM that will be administered a therapeutic agent according to the described invention to treat the ICH, BMH or CCM, (ii) is receiving a therapeutic agent according to the described invention to treat ICH/BMH or CCM; or (iii) has received a therapeutic agent according to the described invention to treat ICH/BMH or CCM, unless the context and usage of the phrase indicates otherwise.
[0199] The term substitution is used herein to refer to that in which a base or bases are exchanged for another base or bases in DNA. Substitutions may be synonymous substitutions or nonsynonymous substitutions. As used herein, synonymous substitutions refer to substitutions of one base for another in an exon of a gene coding for a protein, such that the amino acid sequence produced is not modified. The term nonsynonymous substitutions as used herein refer to substitutions of one base for another in an exon of a gene coding for a protein, such that the amino acid sequence produced is modified.
[0200] The term susceptible as used herein refers to a member of a population at risk.
[0201] The term therapeutic agent as used herein refers to a drug, molecule, nucleic acid, protein, composition or other substance that provides a therapeutic effect. The term active as used herein refers to the ingredient, component or constituent of the compositions of the present invention responsible for the intended therapeutic effect. The terms therapeutic agent and active agent are used interchangeably herein. The active agent may be a therapeutically effective amount of at least one of an active agent itself, a mimic, a derivative, an agonist of that active agent, or a pharmaceutically acceptable salt thereof.
[0202] The term therapeutic component as used herein refers to a therapeutically effective dosage (i.e., dose and frequency of administration) that eliminates, reduces, or prevents the progression of a particular disease manifestation in a percentage of a population. An example of a commonly used therapeutic component is the ED.sub.50, which describes the dose in a particular dosage that is therapeutically effective for a particular disease manifestation in 50% of a population.
[0203] The term therapeutic effect as used herein refers to a consequence of treatment, the results of which are judged to be desirable and beneficial. A therapeutic effect may include, directly or indirectly, the arrest, reduction, or elimination of a disease manifestation. A therapeutic effect also may include, directly or indirectly, the arrest reduction or elimination of the progression of a disease manifestation.
[0204] The terms therapeutic amount, an amount effective, or pharmaceutical amount of one or more of the active agents and used interchangeably to refer to an amount that is sufficient to provide the intended benefit of treatment.
[0205] The intensity of effect of a drug (y-axis) can be plotted as a function of the dose of drug administered (X-axis) (Goodman & Gilman's The Pharmacological Basis of Therapeutics, Ed. Joel G. Hardman, Lee E. Limbird, Eds., 10th Ed., McGraw Hill, New York (2001), p. 25, 50). These plots are referred to as dose-effect curves. Such a curve can be resolved into simpler curves for each of its components. These concentration-effect relationships can be viewed as having four characteristic variables: potency, slope, maximal efficacy, and individual variation.
[0206] The location of the dose-effect curve along the concentration axis is an expression of the potency of a drug (Id).
[0207] The slope of the dose-effect curve reflects the mechanism of action of a drug. The steepness of the curve dictates the range of doses useful for achieving a clinical effect.
[0208] The terms maximal efficacy or clinical efficacy as used interchangeably herein refer to the maximal effect that can be produced by a drug. Maximal efficacy is determined principally by the properties of the drug and its receptor-effector system and is reflected in the plateau of the curve. In clinical use, a drug's dosage may be limited by undesired effects.
[0209] The term biological variability as used herein refers to an effect of varying intensity that may occur in different individuals at a specified concentration of a drug. It follows that a range of concentrations may be required to produce an effect of specified intensity in all subjects.
[0210] Lastly, different individuals may vary in the magnitude of their response to the same concentration of a drug when the appropriate correction has been made for differences in potency, maximal efficacy and slope.
[0211] The duration of a drug's action is determined by the time period over which concentrations exceed the minimum effective concentration (MEC). Following administration of a dose of drug, its effects usually show a characteristic temporal pattern. A plot of drug effect versus time illustrates the temporal characteristics of drug effect and its relationship to the therapeutic window. A lag period is present before the drug concentration exceeds the MEC for the desired effect. Following onset of the response, the intensity of the effect increases as the drug continues to be absorbed and distributed. This reaches a peak, after which drug elimination results in a decline in the effect's intensity that disappears when the drug concentration falls back below the MEC. The therapeutic window reflects a concentration range that provides efficacy without unacceptable toxicity. Accordingly another dose of drug should be given to maintain concentrations within the therapeutic window.
[0212] The term transcription termination signal refers to a section of genetic sequence that marks the end of gene or operon on genomic DNA for transcription. In prokaryotes, two classes of transcription termination signals are known: 1) intrinsic transcription termination signals where a hairpin structure forms within the nascent transcript that disrupts the mRNA-DNA-RNA polymerase ternary complex; and 2) Rho-dependent transcription termination signal that require Rho factor, an RNA helicase protein complex to disrupt the nascent mRNA-DNA-RNA polymerase ternary complex. In eukaryotes, transcription termination signals are recognized by protein factors that co-transcriptionally cleave the nascent RNA at a polyadenlyation signal (i.e, poly-A signal or poly-A tail) halting further elongation of the transcript by RNA polymerase. The subsequent addition of the poly-A tail at this site stabilizes the mRNA and allows it to be exported outside the nucleus. Termination sequences are distinct from termination codons that occur in the mRNA and are the stopping signal for translation, which also may be called nonsense codons.
[0213] The term treat or treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a disease, condition or disorder, substantially ameliorating clinical or esthetical symptoms of a condition, substantially preventing the appearance of clinical or esthetical symptoms of a disease, condition, or disorder, and protecting from harmful or annoying symptoms. Treating further refers to accomplishing one or more of the following: (a) reducing the severity of the disorder; (b) limiting development of symptoms characteristic of the disorder(s) being treated; (c) limiting worsening of symptoms characteristic of the disorder(s) being treated; (d) limiting recurrence of the disorder(s) in patients that have previously had the disorder(s); and (e) limiting recurrence of symptoms in patients that were previously asymptomatic for the disorder(s).
[0214] The terms variants, mutants, and derivatives are used herein to refer to nucleotide sequences with substantial identity to a reference nucleotide sequence. The differences in the sequences may by the result of changes, either naturally or by design, in sequence or structure. Natural changes may arise during the course of normal replication or duplication in nature of the particular nucleic acid sequence. Designed changes may be specifically designed and introduced into the sequence for specific purposes. Such specific changes may be made in vitro using a variety of mutagenesis techniques. Such sequence variants generated specifically may be referred to as mutants or derivatives of the original sequence.
[0215] The term vascular leakage as used herein refers to a pathologic increase in vascular permeability.
[0216] The term vascular permeability as used herein refers to the net amount of a solute, typically a macromolecule that has crossed a vascular bed and accumulated in the interstitium in response to a vascular permeabilizing agent or at a site of pathological angiogenesis.
[0217] The term vascular stability as used herein includes the control of endothelial cell cytoskeleton and junction proteins and the interaction of endothelial cells with mural cells.
[0218] The term wild-type as used herein refers to the typical form of an organism, strain, gene, protein, nucleic acid, or characteristic as it occurs in nature. Wild-type refers to the most common phenotype in the natural population. The terms wild-type and naturally occurring are used interchangeably.
[0219] According to one aspect, the described invention provides a method for reducing incidence of bleeding in the brain by administering a pharmaceutical composition containing a small molecule therapeutic compound, a therapeutic amount of which is effective to reduce incidence of bleeding in the brain by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, by 60% or less, by 55% or less, by 50% or less, by 45% or less, by 40% or less, by 35% or less, by 30% or less, relative to a control.
[0220] According to some embodiments, the small molecule therapeutic compound is selected from the group consisting of artemether or a derivative of artemether. According to some embodiments, the derivative of artemisinin is dihydroartemisinin, artemesinin, or artesunate.
[0221] According to some embodiments, the small molecule therapeutic compound is selected from the group consisting of benidipine, lacidipine, ethynylestradiol or triptolide.
[0222] According to some embodiments, the bleeding in the brain is induced by a statin, by a lipopolysaccharide, or both.
[0223] According to some embodiments, the statin is atorvastatin.
[0224] According to some embodiments the bleeding in the brain is a spontaneous intracerebral hemorrhage.
[0225] According to some embodiments, the spontaneous intracerebral hemorrhage occurs in association with administration of a statin.
[0226] According to some embodiments, the bleeding in the brain is a brain microhemorrhage.
[0227] According to some embodiments, the brain microhemorrhage occurs in association with administration of a statin.
[0228] According to some embodiments, the bleeding in the brain comprises a brain vascular malformation.
[0229] According to some embodiments, the brain vascular malformation is a cerebral cavernous malformation.
[0230] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges which may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the invention.
[0231] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, exemplary methods and materials have been described. All publications mentioned herein are incorporated herein by reference to disclose and described the methods and/or materials in connection with which the publications are cited.
[0232] It must be noted that as used herein and in the appended claims, the singular forms a, and, and the include plural references unless the context clearly dictates otherwise.
[0233] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application and each is incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
EXAMPLES
[0234] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
[0235] Materials and Methods
[0236] Zebrafish Husbandry
[0237] All zebrafish (Danio rerio) experiments were conducted under St. Michael's Hospital Animal Care Committee (Toronto, Ontario, Canada) approved protocol ACC403. The zebrafish were housed in the Li Ka Shing Knowledge Institute (St. Michael's Hospital, Toronto, Ontario, Canada) research vivarium and maintained and staged as previously described (Avdesh A, Chen M, Martin-Iverson M T et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp 2012; e4196). In short, the fish were housed under a 14 h light: 10 h dark cycle at 28 C. Embryos were produced by pair mating and raised in 1E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl.sub.2, 0.33 mM MgSO.sub.4. Strains used in this study included Tg(Flk:GFP; Gata:dsRed) and bbh(m292); kdrl:mCherry /). The collection of fertilized eggs was obtained through pair-wise breeding according to the standard method previously described (Id.).
[0238] Statin-Induced Brain Hemorrhage in Zebrafish
[0239] Zebrafish as a model for hemorrhagic stroke has been proposed previously (Butler M G, Gore A V, Weinstein B M. Zebrafish as a model for hemorrhagic stroke. Methods Cell Biol 2011; 105:137-161). In addition to genetic models of brain hemorrhage, statins have been used to induce brain hemorrhage in zebrafish (Gjini E, Hekking L H, Kuchler A et al. Zebrafish Tie-2 shares a redundant role with Tie-1 in heart development and regulates vessel integrity. Dis Model Mech 2011; 4:57-66; Eisa-Beygi S, Hatch G, Noble S, Ekker M, Moon T W. The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) pathway regulates developmental cerebral-vascular stability via prenylation-dependent signalling pathway. Dev Biol 2013; 373:258-266). A statin-induced model was adopted for our NIH drug library screening project.
[0240] Zebrafish were set up the night before the experiment day. In the morning of the experimental day, we put breeders together for mating and fertilization. 6 hours post-fertilization (hpf), statins was added into a 96-well plate holding 100 l water with 7 to 8 fish eggs in each well, which was optimized through a serial pilot experiments. Statins were dissolved in DMSO and diluted with 0.5% of DMSO water into a working solution. 100 l water containing 0.5% of DMSO was the medium for all wells in the final assessment.
[0241] Initially, we tested both simvastatin and atorvastatin for induction of brain hemorrhage. Simvastatin was tested in final concentrations of 10, 25, 50, 100, and 200 nmol/L, and atorvastatin (ATV) was tested in concentrations of 50, 150, 300, 500 nmol/L and 1 M. After several batches of experiments, we found that ATV at 1 M gave the best reproducible brain hemorrhage in more than 80% of the larvae fish. Therefore, all subsequent screening work was done with 1 M ATV to induce brain hemorrhage in larvae zebrafish. Simvastatin (MW 558.6) was purchased from Cayman Chemical (Ann Arbor, Mich.) and atorvastatin calcium salt (MW 604.69) was purchased from Sigma (St Louis, Mo.).
[0242] For screening NIH compound libraries, 5 M of each of the drugs from the library was added at 24 hpf into wells containing fish eggs treated with 1 M ATV since 6 hpf. Hemorrhage positive control wells were treated with ATV but not treated with any drugs. Negative controls were not treated with any chemicals (fish with 0.5% of DMSO water). Geranylgeranyl pyrophosphate (GGPP, 4 mg/L) was used as positive rescue control.
[0243] Brain hemorrhage was assessed 72 hpf (66 hours after addition of statins) using stereomicroscopy by two observers. Percentage of brain hemorrhage was used as final readout. Compounds showing more than 70% of rescue of the brain hemorrhages in the initial test were re-tested to generate a final list of hits from the library.
[0244] Four other compounds plus artesunate and artemether were independently identified as positive hits from the library. Their derivatives (artemisinin and dihydro-artimisinin) were acquired (Sequoia Research Products, Pangbourne, U K) and tested positive in the same ATV zebrafish model. All subsequent EC50 assays of positive compounds were performed with protocols established and optimized during the screening.
[0245] Morpholino Injection
[0246] Morpholino oligonucleotides (MOs) were custom-synthesized by Gene Tools (Carvalis, Oreg.); their sequences are shown in Table 1.
TABLE-US-00001 TABLE1 Morpholinosequences Morpholino Sequence SEQIDNO: Rap1bEx3 5-AAATGATGCAGAACTTGCCTTTCTG-3 SEQIDNO:1 cdh5exon2 5-TACAAGACCGTCTACCTTTCCAATC-3 SEQIDNO:2 Pixexon6 5-GCGCATCTCTCTTACCACATTATAG-3 SEQIDNO:3 pak2aexon8 5-AATAGAGTACAACATACCTCTTGGC-3 SEQIDNO:4 Hmgcrb-splice 5-AACTGCATTCATAAACTCACCCAGT-3 SEQIDNO:5 Pggt1- 5-CACGCGGTGTGTGGACTCACGGTCA-3 SEQIDNO:6 MO/ggtaseI splice LissStdControl 5-CCTCTTACCTCAGTTACAATTTATA-3 SEQIDNO:7
[0247] Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO.sub.4, 0.6 mM Ca(NO.sub.3).sub.2, 5.0 mM HEPES, pH 7.6) was used to dilute the MO solutions to 0.2 mM final concentration. Individual wells were placed on a 1.0% agarose plate, in which the embryos were positioned. Afterwards, the MO solution was injected through the cell yolk into embryos of 1 to 4 cell-stage. The injected quantities varied from 0.5 to 15 ng.
[0248] bbhm292 zebrafish mutant has a hypomorphic mutation in Pix, resulting in ICH/BMH and hydrocephalus. The MO is Pixexon6-MO which blocks splicing of exon 6 and results in premature protein termination. Injection of 0.2 ng of Pixexon6-MO resulted in ICH in 61% of embryos. Higher doses of Pixexon6-MO (up to 8 ng) result in a lack of blood circulation, and therefore no ICH/BMH was detected. Injection of 8 ng results in complete missplicing of Pix and therefore a null phenotype, whereas lower doses retain some normally spliced Pix. The Pixexon6-MO sequence is 5-GCGCATCTCTCTTACCACATTATAG-3 [SEQ ID NO: 1]. 3Pixexon6-MO was injected into the embryos at the 1-2 cell stage, and compounds were added 12 hpf. Artesunate, 5 mol/L, prevented ICH (
[0249] Another MO was designed to block the splice-donor sites after exon 8 in pak2a. Pak2a is the gene mutated in the rhdmi149 zebrafish mutant that develops ICH/BMH. The pak2a-MO sequence is 5-AATAGAGTACAACATACCTCTTGGC-3 (SEQ ID NO: 2). Eight pg of pak2a-MO was injected per embryo, resulting in 80% of embryos with ICH/BMH with low mortality (
[0250]
[0251] Measuring the Expression of Cellular Junction Proteins
[0252] qRT-PCR was used to assess relative expression of selected genes (an average of two biological trial and three technical replicates and each trial is a pool of 60 larvae/treatment), using -actin as the housekeeping gene control. 3 dpf, Tg(Flk:GFP; Gata:dsRed) zebrafish larvae were used for RNA extraction and cDNA synthesis. Atorvastatin and drug treatment were performed as previously mentioned in drug screening. Total RNA was extracted from these larvae (a pool of 50-60 larvae/treatment) using the RNeasy extraction kit (Qiagen, Mississauga, ON, CAN) and treated with DNase. The concentration of total RNA was determined spectrophotometrically at 260/280 nm using a NanoDrop spectrophotometer. First-strand cDNA was synthesized from 1 g of total RNA using random hexamer primers.
[0253] PCR Conditions:
[0254] The genes of interest and the primer pairs used are shown in Table 2. In each case, forward primer is shown on the top and reverse primer on the bottom.
TABLE-US-00002 TABLE2 PrimersequencesforselectedgenestoperformqPCR. Proteinname Genename PrimerSequences(5-3) SEQIDNO: VE-Cadherin Cdh5 ACGATGTCTCCATCCTGTCT SEQIDNO:8 TAGTGATTCGGTTCCCTCAT SEQIDNO:9 CCM1 Ccm1 TCACGCTATTCCTGCTCTGT SEQIDNO:10 ACTGCAGATCTGAGCCGTAC SEQIDNO:11 CCM2 Ccm2 GGACAGCCAGCATTTTGAGA SEQIDNO:12 GTCTGAAATCATGCGGTCCC SEQIDNO:13 CCM3 Ccm3 CATGATTGACAGGCCCGAG SEQIDNO:14 TGATTGTCTGCAGGAATCGG SEQIDNO:15 Integrin3 Itgb3 TCACTGTGGACTTTGCTTGC SEQIDNO:16 CACATTCACAGAACGGACCC SEQIDNO:17
[0255] Amplification of cDNA was achieved with an initial denaturation at 94 C. for 2 min followed by 40 cycles of denaturation (94 C. for 30 sec), annealing (60 C. for 30 sec) and extension (72 C. for 1 min) followed by a final extension period of 10 min at 72 C. before termination. PCR was carried out in a 20 l total volume and included 1PCR buffer, 1.25 mM MgCl.sub.2, 0.25 mM dNTP, 1 U Taq polymerase, 0.5 mol/L forward, and reverse primers and 1 l cDNA.
[0256] Toxicity Assay
[0257] The embryos were collected and distributed into a 96-well plate in 0.5% DMSO, similar to efficacy assays. Drugs were added at 24 hpf from a range of 50 nmol/L to 100 mol/L. 3 days postfertilization (dpf), larvae were observed for heart beat, blood flow and cardiac edema; the drug treated larvae were compared to non-treated samples in 0.5% DMSO. Heart beat and blood flow were ranked from 3 (normal heart beat or blood flow) to 0 (no heart beat or blood flow). Cardiac edema was ranked from 0 (normal heart without edema) to 3 (severe cardiac edema). TC50 is the concentration of the drug at 50% of maximum toxicity. The ratio of TC50/EC50 was calculated in each case.
[0258] Mouse Model Work
[0259] Animals and Animal Husbandry
[0260] All mice were housed in individually ventilated microisolator cages at St. Michael's Hospital vivarium facility. Rooms were kept at an ambient temperature of 21 C. and subjected to a 12 hour light/dark cycles. Humidity was kept between 30-50%. All mice had access to autoclaved food and water ad libitum. Virox was used as disinfectant. Environmental Enrichment was provided for mice in each cage. The Animal Care Committee at St. Michael's Hospital approved all protocols and procedures in this study.
[0261] Lipopolysaccharide (LPS)-Induced Microbleeding Model
[0262] An LPS-mediated micro bleeding model was created similar to that described in Lui et al (Liu S, Grigoryan M M, Vasilevko V et al. Comparative analysis of H&E and Prussian blue staining in a mouse model of cerebral microbleeds. J Histochem Cytochem 2014; 62:767-773). 9-10 week old C57BL/6 mice of both sexes were purchased from Charles River, and randomly assigned to control or treatment groups in equal numbers. LPS from Salmonella enterica (Sigma Aldrich, St Louis, Mo.) was reconstituted with PBS to a final concentration of 5 mg/ml. Both control (n=16) and drug treatment (n=16) groups received injections of 5 mg/kg LPS at times 0 and 24 hrs. The drug treatment group, further divided into high dose (n=4) and low dose (n=12), received intraperitoneal injections of artemether (ARM) (25 mg/kg for Low dose and 100 mg/kg for High dose) at time points 72, 48, 24, 0 and 24 hrs of LPS treatment. All mice were sacrificed at 48 hrs after the first LPS injection.
[0263] The brains were used for either histological studies or MRI study.
[0264] Anti-3 Integrin Model of Intracerebral Hemorrhage (ICH)
[0265] An anti-3 integrin model of intracerebral hemorrhage (ICH) was generated according to our previously reported methods (Yougbare I, Lang S, Yang H et al. Maternal anti-platelet beta3 integrins impair angiogenesis and cause intracranial hemorrhage. J Clin Invest 2015; 125:1545-1556). Briefly, serum containing anti-3 antibodies was generated by immunizing 3/ female mice with gel-filtered wild type platelets via tail-vein injections twice a week. To detect anti-3 antibody, blood was collected from the saphenous vein of immunized female mice and left to clot. Serum was extracted by centrifuging blood at 9600 g for 5 minutes, incubated with FITC-conjugated anti-mouse IgG, and assayed by flow cytometer (FACSCalibur, BD Biosciences, Mississauga, ON).
[0266] To generate 3+/ mice, 6-8 week old 3/ female mice were crossed with wild type male BALB/c. The resulting pups were randomly assigned to either control (n=29, without any treatment) or drug treatment group (n=24). To induce ICH in the pups, each mouse was injected intraperitoneally with either 50 L of the anti-3 sera (the Control group) or 50 L anti-3 sera with 25 mg/kg ARM (Drug Treatment group) at postnatal day 2 (P2). All Neonates were sacrificed by decapitation at P3.
[0267] Histological Studies on Mouse Brains
[0268] All histological studies are done according to our established protocols (D'Abbondanza J A, Ai J, Lass E et al. Robust effects of genetic background on responses to subarachnoid hemorrhage in mice. J Cereb Blood Flow Metab 2016; 36:1942-19547-13; Sabri M, Kawashima A, Ai J, Macdonald R L. Neuronal and astrocytic apoptosis after subarachnoid hemorrhage: a possible cause for poor prognosis. Brain Res 2008; 1238:163-171; Sabri M, Jeon H, Ai J et al. Anterior circulation mouse model of subarachnoid hemorrhage. Brain Res 2009; 1295:179-185; Sabri M, Ai J, Macdonald R L. Dissociation of vasospasm and secondary effects of experimental subarachnoid hemorrhage by clazosentan. Stroke 2011; 42:1454-1460; Sabri M, Ai J, Marsden P A, Macdonald R L. Simvastatin re-couples dysfunctional endothelial nitric oxide synthase in experimental subarachnoid hemorrhage. PLoS One 2011; 6:e17062; Sabri M, Ai J, Lakovic K, D'Abbondanza J, Ilodigwe D, Macdonald R L. Mechanisms of microthrombi formation after experimental subarachnoid hemorrhage. Neuroscience 2012; 224:26-37; Sabri M, Ai J, Lass E, D'Abbondanza J, Macdonald R L. Genetic elimination of eNOS reduces secondary complications of experimental subarachnoid hemorrhage. J Cereb Blood Flow Metab 2013; 33:1008-1014).
[0269] LPS-Induced Microbleeding Model:
[0270] All mice in the LPS study were deeply anesthetized with ketamine and xylazine and perfused through the left cardiac ventricle with NaCl, 0.9%, followed by 4% paraformaldehyde (PFA) in 1PBS buffer and 2 mM Gadoteridol contrast agent for 24 hours. Each brain was transferred into a 1PBS+0.02% sodium azide and 2 mM Gadoteridol contrast agent. Brains were kept in this immersion solution for 14 days before imaging to ensure proper contrast diffusion in the brain for magnetic resonance imaging (MRI) scan. For non-MRI scan brains, after gross examination, brains were fixed with 4% paraformaldehyde (PFA) in 1PBS buffer for 24 hours and then transferred into a 1PBS+0.02% sodium azide for storage before processing for histology. For histology, brains were cut in a mouse brain matrix (Zivic Instruments, Pittsburgh, Pa.). Three (3) coronal cuts were made at 6 mm from bregma, middle line of cerebellum), then 4 mm anterior (2 mm from bregma) and then 3 mm anterior to the second cut (+1 from bregma). Blocks were embedded in paraffin and 7 m sections cut using a microtome.
[0271] Anti-3 ICH Model:
[0272] For a subset of mice (n=16) intended for MRI, the whole head was severed from the neck and was immediately fixed with 4% paraformaldehyde (PFA) in 1PBS buffer and 2 mM Gadoteridol contrast agent for 24 hours. Each brain was transferred into a 1PBS+0.02% sodium azide and 2 mM Gadoteridol contrast agent. Heads were kept in this immersion solution for 14 days before imaging to ensure proper contrast diffusion in the brain. For non-MRI brains, after gross examination, brains were fixed with 4% paraformaldehyde (PFA) in 1PBS buffer for 24 hours and then transferred into a 1PBS+0.02% sodium azide for storage before processed for histology.
[0273] Hematoxylin and Eosin Staining
[0274] Brain blocks were processed and embedded in paraffin. Seven micron sections were cut using a microtome. Sections were deparaffinized in xylene and rehydrated through a decreasing gradient of ethanol solutions. Slides were stained with hematoxylin and eosin, coverslipped with xylene-based mounting medium (Permount, Sigma Chemical Company, St. Louis, Mo.) and viewed under a light microscope.
[0275] Fluoro-Jade Staining
[0276] Fluoro-jade B (Histo-Chem Inc., Jefferson, Ark.) was used to assess neuronal degeneration. Brain sections were deparaffinized and rehydrated. Following incubation with deionized water, the slides were incubated in 0.06% potassium permanganate (Sigma-Aldrich) for 15 minutes. Slides were then rinsed in deionized water and immersed for 30 minutes in 0.001% Fluoro-jade B working solution (0.1% acetic acid). Slides were washed and dried (60 C.) for 15 minutes, then cleared in xylene and coverslipped with a non-aqueous, low fluorescence, styrene based mounting media (DPX, Sigma-Aldrich). Slides were viewed under a fluorescent light microscope (Olympus BX50, Olympus, Richmond Hill, ON, Canada) and images were taken using constant parameters (exposure time and contrast values).
[0277] Gross Examination
[0278] For the integrin ICH model, brains were taken out of the skull, cut at the mid-coronal position and assessed in a binary manner for whether or not there was any evidence of ICH. Brains were immediately fixed following assessment. For the LPS model, brains were extracted after perfusion fixation, and images were taken for the whole brain to examine the appearance of microbleeding spots.
[0279] Contrast Enhanced Magnetic Resonance Imaging
[0280] Brains were scanned using 7T Burker MRI with 16-channel solenoid coils. Pulse sequence utilized was a FLASH T2* gradient echo (GRE) sequence with the following parameters: TR=30.2 ms and TE=12 ms. matrix=250200200. FOV=FOV=2.52.02.0 gcrush=6 tcrush=0.002. FA was 11. (Liu S, Grigoryan M M, Vasilevko V et al. Comparative analysis of H&E and Prussian blue staining in a mouse model of cerebral microbleeds. J Histochem Cytochem 2014; 62:767-773). Voxel size was 100*100*100 m. Following the reconstruction of images and applying image distortion correction algorithms, all brains were processed and analyzed for total volume of brain and total volume of hemorrhage. Quantification was done using percentage of bleeding (normalized to each brain size). Experimental blinding was done to ensure unbiased work at all levels of preparation and analysis. First, samples were prepared and coded not knowing which group they belong to. Secondly, a separate technician blinded to groups scanned the brains. Lastly, quantification was done in a blinded fashion. All quantifications and 3D reconstructions were performed using a combination of Display and Amira processing software.
[0281] Spectrophotometer Analysis of Hemoglobin Concentration
[0282] Drabkin's reagent (Sigma Aldrich) was used for calorimetric quantification of hemoglobin concentration at 540 nm. C57BL/6 mice were randomly assigned to three groups (each n=4): Control, Low-dose ARM, and High-dose ARM. For ARM groups, three days of 25 mg/kg/day and 100 mg/kg/day ARM were administered for low and high dose, respectively. Blood from saphenous vein were collected at day 4 and tested for hemoglobin concentration using UV 3600 Shimadzu spectrophotometer. A standard curve was generated using a known standard solution of cyanmethemoglobin, and blood concentrations of Hb was compared to the standard curve.
[0283] Data Analysis and Statistics
[0284] A-priori power analysis was done to estimate the number of samples in each group for a two-tailed, unpaired two-sample t-test with a power of 0.8 and a of 0.05 to detect a 1 standard deviation difference in bleeding volume. P values were determined by unpaired, two-tailed t-test with Welch correction, analysis of variance (ANOVA). All bar graphs and Dose-Response curves are expressed as meanSEM or SD.
[0285] Chemicals
[0286] For all mouse model work, artemether (80 mg.Math.ml-1) was obtained from Dafra Pharma and diluted 1:15 in fractionated coconut oil, and was administered intraperitoneally. For zebrafish work, artesunate were purchased from Guilin Pharmaceutical (Guangxi, China), together with artemether from Dafra are named GMP drugs. Both ART compounds were also purchased from Sigma Aldrich (Sigma) for comparison studies with GMP drugs.
Example 1. Zebrafish Screen to Identify Lead Compounds
[0287] Several models of ICH/BMH in zebrafish have been used, including statins, bbh.sup.m292 and rhd.sup.mi149 mutants and MOs to reduce expression of pak2a, Pix, Rap1b and cdh5. In addition, low doses of LPS were determined to induce ICH in zebrafish, consistent with the mouse BMH model. LPS destabilizes the vasculature and causes vascular leakage throughout the fish, including in the brain.
[0288]
[0289] Screening of NCC libraries. The National Institutes of Health (NIH) Clinical Collections 1 and 2 consist of 727 compounds including many Food and Drug Administration-approved drugs for drug repurposing (www.nihclinicalcollection.com). These compounds are mostly drugs that have been in phase 1 to 3 clinical trials and are not represented on other arrayed collections. They have favorable properties such as purity, solubility and commercial availability. Many have known safety profiles.
[0290] After optimizing the brain hemorrhage model with 1 mol/L atorvastatin, 727 compounds in NIH compound libraries 1 and 2 (http://nihsmr.evotec.com/evotec/sets/ncc) were screened using the conditions described (96 well plates with 7 embryos per well, and atorvastatin, 1 mol/L). Six active compounds from four families (two dihydropyridine calcium channel blockers (benidipine and lacidipine), ethynylestradiol, triptolide, two anti-malaria drugs (artesunate and artemether)) were identified independently from the libraries. Chemical structure and properties of these six active compounds plus two of the derivatives of ART family compounds are summarized in Table 3 and
[0291]
TABLE-US-00003 TABLE 3 EC.sub.50 (in Property nmol/L) on Efficacy on Efficacy on or atorfvastatin Name of Chemical atorvastatin -Pix MO Clinical model Compound Structure Hemorrhage Hemorrhage Application (mol/L) Artemisinin
[0292] Three of the four ART compounds showed high potency with EC50 less than 100 nmol/L. Due to the moderate potency of the other four compounds (EC50 ranging 191 to 290 nmol/L), we did not investigate them further.
Example 2. Studies on Mechanisms of Action of ART Compounds in Zebrafish
[0293] Clinical studies have disclosed a link between cholesterol-lowering 3-hydroxy-methylglutaryl-coenzyme A reductase (HMGCR) inhibitors (statins) and increased risk of ICH. The HMGCR pathway is connected to components of the Rho guanosine triphosphatase (GTPase) signaling pathway by prenylation of Cdc42/Rac (
[0294] 1. ART Compounds Rescued Bbh Genetic Model of Brain Hemorrhage.
[0295] A specific zebrafish line with a gene mutation called bubblehead (bbh) was used. This line has spontaneous ICH. Bubblehead phenotype is caused by a mutation in Pix. Adult homozygous zebrafish were viable and fertile. Bubblehead embryos develop ICH and brain edema 36 to 52 hours postfertilization (hpf) (Liu J, Zeng L, Kennedy R M, Gruenig N M, Childs S J. betaPix plays a dual role in cerebral vascular stability and angiogenesis, and interacts with integrin alphavbeta8. Dev Biol 2012; 363:95-105; Liu J, Fraser S D, Faloon P W et al. A betaPix Pak2a signaling pathway regulates cerebral vascular stability in zebrafish. Proc Natl Acad Sci USA 2007; 104:13990-13995). More than 85% of zebrafish larvae display an ICH phenotype. Interestingly, we found that treating with the ART drugs could completely rescue the hemorrhage in bbh mutants.
TABLE-US-00004 TABLE 4 Comparison of efficacy (EC50 values) of different drugs to rescue brain hemorrhage in statin and bbh models. For the statin model, n = 15-20 larvae per condition; the experiment was performed three times per compound. For the bbh mutant model, n = 15-20 larvae per condition; the experiment was performed 1-3 times per compound. bbh Mutant Model Drug Statin Model (nmol/L) (nmol/L) ART (GMP) 182.2 126.9 ART (Sigma) 105.0 140.3 ARM (Sigma) 24.7 37.5 ARS (Sigma) 81.3 176.6 DHA (Sigma) 80.8 107.1
[0296] The obtained EC50 values of the ART drugs from the bbh mutant model and from the atorvastatin-induced ICH model were comparable. This confirms the validity of the statin model which was used for initial screening (Table 3).
[0297] 2. ART Compounds Rescued ICH Induced by Gene Knockdown of Key Proteins in the HMBCR/Rho Kinase Pathway
[0298] Besides using bbh, the other method to induce ICH in zebrafish is genetic gene knockdown. We used specific morpholinos to knock down some key genes in both HMGCR and Rho guanosine triphosphatase (GTPase) signaling pathways (
[0299] 1) Pak2a: p21 protein (Cdc42/Rac)-activated kinase 2a regulates activity of Rho GTPases, Rac and Cdc42, and may be involved in a complex with Pix.
[0300] 2) Pix: Pak-interacting exchange factor R facilitates conversion of GDP-Rho GTPases (Rac and Cdc42) to GTP-RhoGTPase.
[0301] 3) HMGCR: 3-hydroxy-3-methylglutaryl-coenzyme A reductase catalyzes conversion of HMG-Co A to mevalonate.
[0302] 4) VE-Cadherin: Vascular Endothelial Cadherin is a transmembrane protein that connects the intracellular cytoskeleton to the extracellular matrix.
[0303] 5) Rap1b: Ras GTPase effector protein facilitates recruiting of CCM proteins to the cell membrane.
[0304] 6) GGTase 1: geranylgeranyltransferase 1 post-translationally modifies Rac and Cdc42 by adding a mevalonate-derived GGPP which is required to activate these GTPases.
[0305]
[0306] Artesunate dose-dependently reduced ICH/BMH after treatment with pak2a-MO (
[0307] Finally, a role for the VE-cadherin homologue in zebrafish, cdh5, was demonstrated in that MO-knockdown of cdh5 induced ICH in zebrafish (
[0308] We found that injection of any of the above morpholinos causes hemorrhage in 3 dpf zebrafish larvae indicating the important roles these genes play in vascular stability. Next, optimum amount of each morpholino was determined. The goal was to induce an acceptable percentage of hemorrhage (ideally between 40-80%), without having toxicity from morpholino injection. The results are summarized in Table 5.
TABLE-US-00005 TABLE 5 Optimizing the amount of injected morpholinos, n = 150-250 larvae per condition; the experiment was performed at least two times. Morpholino Optimum amount (ng) Hemorrhage Pix - exon6 0.8 72.1% Pak2a - exon8 5.0 43.7% Hmgcrb - splice 2.0 67.9% Cdh5 - exon2 1.0 39.4% 35.0% (Cardiac Edema) Rap1b - exon3 9.0 30.8% (Faint) GGTasel 2.5 11.4% (Faint)
[0309] The first three morpholino pairs were good for the efficacy study. Efficacy assays were performed using Artemether (ARM, Sigma) and artemesunate (ART, GMP). The results showed that defects induced by Pak2a, Pix, and HMGCR morpholinos could induce hemorrhage in independent experiments. Treating these morphants with the drugs rescued the ICH phenotype.
TABLE-US-00006 TABLE 6 Efficacy comparison (EC50) of ARM (Sigma) and ART (GMP) to rescue the hemorrhage induced by different morpholinos; n = 150-250 larvae per condition, and the experiment was performed at least two times. Morpholino ARM (Sigma) (nmol/L) ART (GMP) (nmol/L) Pix - exon6 51.6 11.7 95.6 27.9 Pak2a - exon8 39.1 8.0 169.2 39.5 Hmgcrb - splice 62.5 8.3 166.7 9.3 Cdh5 - exon2 Rescue effect Rescue effect
[0310] Suppression of VE-cadherin induces hemorrhage. However, cardiac edema was observed in some morphants. The efficacy assays were performed using ARM and ART, and in both cases rescue was observed.
[0311] Consistent with what we found in the atorvastatin-induced ICH model and bbh mutant model, ARM showed the highest efficacy to rescue the hemorrhage in morphants (Table 4 and Table 6).
[0312] Studies on Toxicity of ART Compounds in Zebrafish
[0313] Toxicity assays were performed to measure TC50 values considering three parameters: heartbeat, blood flow and cardiac edema As an example,
TABLE-US-00007 TABLE 7 Comparison of toxicity (TC50 values) of different drugs. TC50/EC50 ratio is in parenthesis; n = 15-20 larvae per condition, and the experiment was performed three times per compound. TC50 TC50 TC50 (Heart beat) (Blood flow) (Edema) Drug Company [nmol/L] [nmol/L] [nmol/L] Artemisinin (ARS) Sigma 8501 (104.5) 1058 (13) 34134 (419) Artesunate (ART) Sigma 8884 (84.6) 741.5 (7.1) 5367 (51.1) Artemether (ARM) Sigma 2328 (94.3) 975.3 (39.5) 19564 (87.1) Dihydroartemisinin Sigma 5.011e+0.11 (6.2e+009) 890 (11.0) 748.5 (9..2) (DHA) Artemisinin (ARS) Sequoia Rsearch 1.217e+010 4.6e+007) 5340 (20.4) 6347 24.2) (UK) Artesunate (ART) Sequoia 9539 (59.5) 1036 (6.5) 937.8 (5.9) Research (UK) Artemether (ARM) Sequoia 1.084e+013 (1.3e+011) 746.3 (9.2) 5.253e+012 (6.5e+010) Research (UK) Dihydroartemisinin Sequoia 1.110e+008 (8.3e+005) 979.5 (7.3) 1021 (7.6) (DHA) Research (UK) Artesunate (ART) GMP-Artesunate 2525 (13.9) 794.4 (4.4) 3196 (17.5) ZA102 Life Chemicals 376 (2.1) 695.3 (3.8) 24444 (135) ZA113 Life Chemicals 2283 (17.3) 572.3 (4.3) 5883 (44.5) ZA123 Life Chemicals 6.491e+007 (5.2e+005) 989.3 (7.9) 55912 (445.5)
[0314] We found ARM to be a safe drug, as its EC50 is much lower than TC50 (Table 7) in zebrafish embryos.
[0315] 3) ART Compounds Upregulate Key Proteins Vital for Vascular Stability
[0316] We considered a list of 20 genes that are potentially involved in ICH mechanism, and evaluated the changes in transcription of five of them after in atorvastatin-induced brain hemorrhage model and treated with ART drugs. These genes are: VE-Cadherin (Cdh5), Integrin (Itgb3a) and three cerebral cavernous malformation genes (ccm1, ccm2 and ccm3).
[0317]
[0318] The results showed that in the statin-induced ICH model, upregulation at the transcription level occurs for Integrin 3 and VE-cadherin upon treatment with ARM. CCM3 showed a decrease after inducing hemorrhage with atorvastatin. Upon treatment with ARM, the transcription level returned to normal in parallel with hemorrhage rescue in zebrafish larvae.
Example 3. Other Zebrafish Models to Validate Anti-ICH Efficacy of Compounds Identified from Statin-Derived Embryonic Screens
[0319] Experiment 1: LPS-Induced ICH/BMH in Zebrafish Embryos.
[0320] The lead compounds will be tested in a LPS model of ICH/BMH to determine if rescue of the ICH/BMH phenotype is a general property of these compounds or it is specific to statin-induced ICH/BMH. Preliminary data suggested that artemether reduced mortality from LPS (
Example 4. Work in Mouse Models of ICH
[0321] We employed two models of brain hemorrhage. Our results show that in both LPS and Integrin models of ICH, ARM effectively prevented or ameliorated hemorrhage.
[0322] LPS-Induced Microbleeding Mouse Model
[0323] 1. ARM (GMP) Reduces Both Surface and Deep Brain Microbleeds Induced by LPS
[0324] LPS and its main receptor TLR4 have been extensively studied, and recent literature characterized a model of brain micro-bleeds that are both present on the surface cortical areas and in the deep lobar areas (Liu S, Grigoryan M M, Vasilevko V et al. Comparative analysis of H&E and Prussian blue staining in a mouse model of cerebral microbleeds. J Histochem Cytochem 2014; 62:767-773; Sumbria R K, Grigoryan M M, Vasilevko V et al. A murine model of inflammation-induced cerebral microbleeds. J Neuroinflammation 2016; 13:218). The number of surface micro-bleeds of each brain was counted using a stereomicroscope, and an average determined for LPS control and LPS+ARM treatment groups.
[0325] To further assess microbeeding inside the brains, we quantified the numbers of microbleeds in H&E stained brain slides. Panel B shows data from quantification of microbleeds on brain slices stained by hematoxylin and eosin. The left panel shows representative images of stained brain slices with microbleeds from each of the two groups; the arrows indicate microbleeds on the slices; the right panel chart shows a statistical analysis on microbleeds count (**P<0.01, unpaired two-tailed t-test with Welch's correction. Data is expressed as meanSD, n=8 for both LPS treated and LPS+ARM treated groups.
[0326] Similar to the surface microbleed counts, ARM treatment significantly reduced the total number of microbleeds inside the mouse brains (
[0327] 2. The Reduction of Total LPS-Induced Microbleeds in Mouse Brains by ARM (GMP) is Verified by MRI
[0328] To confirm the result from gross anatomy and histology, we examined the brains in the subsequent experiments using a MRI with 3D FLASH GRE sequence. Total volume of hemorrhage was quantified and percent bleeding was calculated for each brain.
[0329] The data confirm that there is a significant reduction of bleeding (about reduction) in the ARM treated group in comparison to the model control group (
[0330] 3. LPS Did not Induce Significant Neuronal Cell Death or Hemosiderin Deposition
[0331] We did Fluoro-jade C and Perl's staining to detect neuronal degeneration and hemosiderin deposition, respectively. The results of both of these assays were negative for both control and treatment groups, suggesting that the observed micro-bleeds induced by LPS are acute and that the microbleeds did not cause neuronal cell death, at least in the time scale we tested on this model.
[0332] Integrin ICH Mouse Model
[0333] 1. ARM (GMP) Reduces the Incidence Rate of ICH
[0334] Previous studies suggested that by forming a heterodimer with the V subunit of integrin, 3 integrin plays a role in proliferating endothelial cells, specifically during angiogenesis (Yougbare I, Lang S, Yang H et al. Maternal anti-platelet beta3 integrins impair angiogenesis and cause intracranial hemorrhage. J Clin Invest 2015; 125:1545-1556). It has already been shown that using antibodies especially during the developmental stage creates vascular instability and improper angiogenesis and hence rapid ICH development. Id.
[0335] We employed two end points to examine the treatment effect of ARM in the anti-3 integrin model of intracerebral hemorrhage.
[0336] 2. ARM (GMP) Reduces the Total Volume of ICH Verified by MRI
[0337] Preliminary data shows that ARM reduced total volume of ICH as compared to controls. (data not shown).
[0338] To assess possible anemia effect from ARM treatment as some previous studies speculated, blood samples were tested for hemoglobin concentration after ARM treatment. Blood hemoglobin concentration was assessed using Drabkins' method. Spectrophotometer data was compared to a standard curve from standard cyanmethemoglobin concentrations. The control group received no drug. The Treatment Dose group received 3 days injection of low dose ARM (25 mg/kg), 4 Treatment Dose group received 3 days injection of high dose ARM (100 mg/kg).
[0339]
[0340]