Production of polypeptides relevant to human and animal health using Yarrowia lipolytica
09908917 ยท 2018-03-06
Assignee
Inventors
- Robert Richard Bragg (Bloemfontein, ZA)
- Charlotte Enastacia Boucher (Bloemfontein, ZA)
- Chrispian William Theron (Bloemfontein, ZA)
- Arina Corli Hitzeroth (Bloemfontein, ZA)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/10051
CHEMISTRY; METALLURGY
A23V2002/00
HUMAN NECESSITIES
C12N2750/10022
CHEMISTRY; METALLURGY
C12N2750/10034
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the expression of polypeptides using Yarrowia lipolytica, in particular the secretion of expressed polypeptides into either the extracellular space or the surface of the Y. lipolytica host cell wall. The invention also extends to the use of the polypeptides so expressed in biotechnological applications. The present invention provides an expression construct for the expression of polypeptides using at least a single Yarrowia lipolytica yeast cell, the expression construct having at least one expression cassette, the expression cassette including an acid extracellular protease secretion signal sequence and flanking zeta sequence recombination sites.
Claims
1. A genetic construct for inducing expression of a polypeptide in Yarrowia lipolytica (Y. lipolytica), the construct comprising an expression cassette comprising an acid extracellular protease secretion signal sequence, flanking zeta sequence recombination sites, at least one promoter element, at least one polypeptide encoding region and at least one terminator element; wherein the at least one promoter drives expression of the at least one polypeptide encopding region; wherein the polypeptide encoded by the at least one polypeptide encoding region is SEQ ID NO: 6 and the polypeptide encoding region is SEQ ID NO: 5; wherein the polypeptide encoding region of SEQ ID NO: 5 is a sequence that has been codon-optimized for expression in Y. lipolytica; and wherein the expressed polypeptide of SEQ ID NO: 6 maintains its immunogenicity.
2. The genetic construct of claim 1, wherein the extracellular protease secretion signal sequence comprises the nucleotide sequence of SEQ ID NO: 1 and the flanking zeta sequence recombination sites comprise the nucleotide sequence of SEQ ID NO: 2.
3. The genetic construct of claim 1, wherein the construct is in the form of a plasmid.
4. The genetic construct of claim 1, wherein the construct comprises a Y. lipolytica cell wall protein encoding element, located between the polypeptide encoding region and the terminator element.
5. The genetic construct of claim 1, wherein the genetic construct comprises a Multiple Cloning Site (MCS) located between the acid extracellular protease secretion signal sequence and the terminator element of the expression cassette.
6. The genetic construct of claim 5, wherein the genetic construct comprises a Y. lipolytica cell wall protein encoding element located between the MCS and the terminator element.
7. The genetic construct of claim 4, wherein the cell wall protein encoding element comprises the nucleotide sequence of SEQ ID NO: 3, or a fragment thereof.
8. The genetic construct of claim 1, wherein the acid extracellular protease secretion signal sequence is located between the promoter element and the polypeptide encoding region.
9. The genetic construct of claim 1, wherein the acid extracellular protease secretion signal sequence is located between the promoter element and a Multiple Cloning Site (MCS).
10. The genetic construct of claim 1, wherein the promoter element comprises the nucleotide sequence of SEQ ID NO: 4.
11. The genetic construct of claim 1, wherein the construct comprises one or more auxotrophic marker regions for the purposes of replication and selection in yeast host cells.
12. The genetic construct of claim 1, wherein the genetic construct comprises one or more bacterial moiety regions for the purposes of replication and selection in bacterial host cells.
13. A method of transforming a Y. lipolytica host cell with a genetic construct or a combination of genetic constructs as claimed in claim 1, the method including the steps of: transforming the expression cassette or cassettes into a Y. lipolytica yeast cell; isolating the transformed Y. lipolytica yeast cell; and culturing the transformed Y. lipolytica yeast host cell so as to express one or more polypeptides into the extracellular space or onto the host cell wall.
14. The method of claim 13, wherein the Y. lipolytica host cell is selected from the group consisting of: Po1h (MatA, ura3-302, xpr2-322, axp1-2); Po1f (MatA, leu2-270, ura3-302, xpr2-322, axp-2); E129 (MatA, lys11-23, ura3-302, leu2-270, xpr2-322) and E150 (MatB, his-1, leu2-270, ura3-302, xpr2-322).
15. A non-yeast host cell comprising a genetic construct as claimed in claim 1.
16. A Y. lipolytica host cell comprising a genetic construct as claimed in claim 1.
17. A method of producing a polypeptide wherein said method comprises transforming a host cell with a genetic construct of claim 1, and expressing said polypeptide from said transformed host cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5) The presently disclosed subject matter will now be described more fully hereinafter with reference to the accompanying Examples, in which representative embodiments are shown. The presently disclosed subject matter can, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the embodiments to those skilled in the art.
EXAMPLES OF THE INVENTION
(6) The invention was performed in accordance with the following steps.
Example 1 Production of Recombinant Psittacine Beak and Feather Disease Virus Coat Protein (BFDV CP) Using the Yarrowia lipolytica Expression System of the Present Invention
(7) Materials and Methods
(8) Capsid Protein Gene of Interest
(9) The gene encoding the BFDV CP was codon-optimized for expression in Yarrowia lipolytica, and synthesized by GeneArt. The initiation codon (CTG) and stop codon (TAA) were removed and SfiI (5) and HindIII (3) restriction endonuclease recognition sites were added to the sequence [AY450443Beak and Feather disease virus isolate AFG3-ZA, complete genome]. The supplied lyophilised synthetic gene (5 g plasmid DNA) was reconstituted in 50 l 10 mM Tris-HCl (pH 8.0) upon arrival.
(10) Strains and Media
(11) Escherichia coli JM109 (endA1, recA1, gyrA96, thi, hsdR17 (r.sub.k.sup., m.sub.k.sup.+), relA1, supE44, (lac-proAB), [F traD36, proAB, laqI.sup.qZM15]) cells were used for plasmid manipulations and propagation. Standard molecular biology techniques were used as described in Sambrook and Russel (2001), unless explicitly stated otherwise. The E. coli transformants were grown at 37 C. in 5.0 ml Luria-Bertani (LB) broth [0.5% (w/v) yeast extract, 1% (w/v) sodium chloride and 1% (w/v) tryptone] supplemented with 30 g/ml of kanamycin and on LB-agar plates supplemented with 1.5% w/v agar and 30 g/ml of kanamycin.
(12) The Y. lipolytica yeast strains used was Po1h (MatA, ura3-302, xpr2-322, axp1-2). The yeast strain was supplied by CBAI, AgroParisTech, 78850 Thiverval-Grignon, France. The yeast strain was grown in 50 ml of YPD [1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose] medium in 250 ml flasks at 28-30 C. Yeast transformants were grown on YNB-N.sub.5000 [0.17% (w/v) yeast nitrogen base without amino acids and ammonium sulphate, 1% (w/v) glucose and 0.5% (w/v) ammonium sulphate] or alternative Ura-selective medium [0.17% (w/v) yeast nitrogen base without amino acids and ammonium sulphate, 1% (w/v) glucose, 0.4% (w/v) ammonium chloride and 0.2% (w/v) CAS amino acids] plates at 28-30 C.
(13) Other Yarrowia lipolytica strains besides Po1h that are included in this invention are Po1f (MatA, leu2-270, ura3-302, xpr2-322, axp-2); E129 (MatA, lys11-23, ura3-302, leu2-270, xpr2-322) and E150 (MatB, his-1, leu2-270, ura3-302, xpr2-322).
(14) Plasmid/Expression Vector
(15) The SURFACE DISPLAY EXPRESSION VECTOR is described as the plasmid pINA1317-YICWP110, while the SECRETORY EXPRESSION VECTOR is plasmid pINA1317 alone, i.e. without the gene encoding YICWP110. Both of these vectors contain the recombinant Yarrowia lipolytica-derived hp4d promoter to drive expression of genes of interest, and hence produce the corresponding protein of interest in a growth-phase-dependent manner. Due to the use of said hp4d promoter, the SECRETORY EXPRESSION VECTOR, the SURFACE DISPLAY EXPRESSION VECTOR, and derivatives of either vector that also contain said promoter, are protected by PCT/IB96/00562 to INRA and INA (presently AgroParisTech). This patent application protects the recombinant promoter, the vectors carrying it and the recombinant yeasts transformed with the said vectors.
(16) The SECRETORY EXPRESSION VECTOR and the SURFACE DISPLAY EXPRESSION VECTOR use zeta sequences (Long Terminal Repeats of Ylt1 retrotransposon), which promote homologous (directed) integration of said vectors into the genome of Ylt1-containing Yarrowia lipolytica strains and non-homologous (random) integration of said vectors into the genome of Ylt1-devoid Yarrowia lipolytica strains. Due to the potential use of said zeta sequences for non-homologous integration, the SECRETORY EXPRESSION VECTOR, the SURFACE DISPLAY EXPRESSION VECTOR, and derivatives of either vector that also contain said zeta sequences are also protected by PCT/FR99/02079 to INRA and CNRS. This patent application protects the use of zeta sequences for promoting non-homologous integration into the genome of Ylt1-devoid Yarrowia lipolytica strains, and the recombinant yeasts obtained by such process.
(17) Both the SECRETORY EXPRESSION VECTOR and the SURFACE DISPLAY EXPRESSION VECTOR contain the Ura3d1 marker for complementation of defective uracil auxotrophic markers present in receptive mutant strains. Variations of the vector have been constructed that contain the Leu2 marker for complementation of defective leucine auxotrophic markers present in receptive mutant strains, and are included in this invention. Furthermore, variations of the SECRETORY EXPRESSION VECTOR and the SURFACE DISPLAY EXPRESSION VECTOR which contain a promoter-deficient variation of the Ura marker, Ura3d4, which promotes multiple-copy integration into the genome of receptive strains, are also included in this invention.
(18) Cloning of the Gene Encoding BFDV CP into the SECRETORY EXPRESSION VECTOR and the SURFACE DISPLAY EXPRESSION VECTOR
(19) For cloning of the BFDV CP gene into the SURFACE DISPLAY EXPRESSION VECTOR, endonuclease digestion of the vector containing the capsid gene (provided by GeneArt) as well as the SURFACE DISPLAY EXPRESSION VECTOR was performed, using SfiI and HindIII. The digestion reaction mixtures were electrophoresed on an agarose gel containing ethidium bromide. The appropriate sized bands were excised from the gel and purified using a gel band purification kit (GE Healthcare).
(20) For cloning of the BFDV CP gene into the Secretion EXPRESSION VECTOR, the BFDV CP was amplified from the vector supplied by GeneArt using the primers BFDV SCF (5-TCAAGGCCACGTGTCTTGTCC-3)(SEQ ID NO:7) and BFDV SCR (5-TCCAGGTACCT TACTAGGTGGGGTTGGGGTTG-3) (SEQ ID NO:8), using Kapa HiFi polymerase. The thermal cycling conditions included an initial denaturation step of 3 min at 95 C., followed by 25 cycles of denaturation at 98 C. for 20 sec, annealing at 60 C. for 15 sec, and extension at 72 C. for 1 min; followed by a final extension step at 72 for 1 min. The PCR products were also sequenced for authenticity verification.
(21) The resultant PCR product (amplicon), referred to as BFDV CP PCR product, was electrophoresed on an agarose gel containing ethidium bromide. The amplicon was excised from the gel and purified using a gel band purification kit (GE Healthcare). The purified amplicon was then phosphorylated using polynucleotide kinase, and sub-cloned into pSMART by ligation. The PCR product contained a new stop codon (TAA) on the 3 end, followed by a KpnI recognition site.
(22) Endonuclease digestion was performed on the pSMART vector containing the BFDV CP PCR product as well as on the SECRETORY EXPRESSION VECTOR using SfiI and KpnIII. The digestion reaction mixtures were electrophoresed on an agarose gel containing ethidium bromide. The appropriate sized bands were excised from the gel and purified using a gel band purification kit (GE Healthcare).
(23) In both instances, purified BFDV insert DNA fragments were ligated to the appropriately prepared expression vector. Ligation mixtures were used to transform Escherichia coli JM109 cells that had been made competent using rubidium chloride, and transformed cells were streaked out on LB plates supplemented with kanamycin. Single colonies that formed on the LB-kanamycin plates were used to inoculate test tubes containing 5 ml LB broth supplemented with kanamycin, and the tubes were incubated at 37 C. for 16 hours.
(24) Plasmids were isolated from the inoculated cultures using the lysis by a boiling method for mini-preparation of plasmid DNA, or by using the QIAamp DNA mini kit (Qiagen). The presence of the inserted gene of interest in the expression vectors was confirmed by restriction analysis or PCR on isolated plasmids.
(25) Prior to transformation of Yarrowia lipolytica, the isolated recombinant plasmids were digested with NotI, to separate the yeast-integrative cassettes from the bacterial moieties of the vectors, resulting in yeast-integrative cassette devoid of a bacterial genetic material. The yeast-integrative cassette was separated from the bacterial backbone by agarose gel electrophoresis, followed by excision from the gel and purification gel band purification kit (GE Healthcare).
(26) Yarrowia lipolytica strains were transformed using the purified yeast-integrative cassettes according to the methods of Madzak et al. (2005) or Chen et al. (1997). Recipient Yarrowia lipolytica strains were also transformed with the empty expression vectors, i.e. expression vectors into which no gene was inserted. Transformants (as shown in
(27) Total genomic DNA (gDNA) was extracted from Yarrowia lipolytica transfromants using the method described by Albertyn and Labuschagne (2007). Isolated transformant gDNA samples were used as templates for PCR confirmation of the integration of the BFDV CP gene. This was done using the primers: Chen6560F (GATCCGGCATGCACTGATC) (SEQ ID NO:9) and CM-terX (GAACCTCGTCATTGATGGAC) (SEQ ID NO:10). The forward primer Chen6560F was designed based on the XPR2 promoter region of the vectors, while the reverse primer CM-terX was designed based on the terminator region of the plasmid.
(28) The primer combination therefore amplifies the MCS and parts of the surrounding regions. In the absence of an insert, these primers result in amplicons that are 235 base pairs (bp) in length for the SECRETORY EXPRESSION VECTOR and 575 bp in length for the SURFACE DISPLAY EXPRESSION VECTOR. The difference in length is due to the presence of the GPI-anchored YICWP in the SURFACE DISPLAY EXPRESSION VECTOR. In the presence of the BFDV CP gene within the expression cassette, the primer combination results in amplicons that are 974 bp in length for the SECRETORY EXPRESSION VECTOR and 1316 bp in length for the SURFACE DISPLAY EXPRESSION VECTOR.
(29) The thermal cycling conditions included an initial denaturation step of 2 min at 95 C., followed by 30 cycles of denaturation at 95 C. for 30 sec, annealing at 55 C. for 1 min and extension at 70 C. for 1.30 min; followed by a final extension step at 70 for 5 min. PCR amplifications were also performed using Ready-to-go PCR Beads (GE Healthcare). The resultant amplicons were also sequenced for authenticity verification.
(30) Once transformants had been confirmed to have integrated the cassette, glycerol (15% v/v) was added to culture aliquots, followed by cryopreservation at 80 C. Transformants were revived by streaking from the frozen stocks onto selective YNB-based agar plates, which were incubated at 28-30 C. Pre-cultures of 5 ml YPD were inoculated from the plates, followed by incubation for 16 h on a rotary shaker at 28-30 C. at 160 rpm. The 16 h pre-cultures were used as inoculums for main cultures of 45 ml YPD (hence 1/10 dilution). Main cultures were incubated for 48 h on a rotary shaker at 28-30 C. at 160 rpm.
(31) Cells were harvested by centrifugation at 7000 rcf for 10 min, separating the cells (pellet) from the surrounding medium (supernatant). When using the SURFACE DISPLAY EXPRESSION VECTOR, the cell pellet is washed and resuspended in PBS (5.84 g sodium chloride (NaCl), 4.72 disodium hydrogen phosphate (Na.sub.2HPO.sub.4) and 2.64 g sodium dihydrogen phosphate (NaH.sub.2PO.sub.4), pH 7.2), while the supernatant is discarded. When using the SECRETORY EXPRESSION VECTOR, the supernatant is collected for further use while the cellular pellet may be discarded.
(32) Preliminary Tests of Applications
(33) Rapid Plate Agglutination Test for the Detection of Antibodies
(34) For rapid plate agglutination the SURFACE DISPLAY EXPRESSION VECTOR was used. Yeast transformants were harvested by centrifugation at 7000 rcf for 10 min, separating the cells (pellet) from the surrounding medium (supernatant). The cell pellet was washed and resuspended in PBS (5.84 g sodium chloride (NaCl), 4.72 disodium hydrogen phosphate (Na.sub.2HPO.sub.4) and 2.64 g sodium dihydrogen phosphate (NaH.sub.2PO.sub.4), pH 7.2). All reagents were allowed to come to room temperature, so as to eliminate the possibility of non-specific reactions. A drop of the antigen (yeast transformant culture) (10 l) was placed on a clean microscope slide, after which 10 l of serum was added. The slide was rotated for 30 seconds and the presence or absence of agglutination was noted. A serum sample was considered positive when clear agglutination was observed, as easily visible clumps, whereas the absence of agglutination was interpreted as negative (
(35) Immunofluorescence
(36) Aliquots (20 l) of yeast transformants were dropped onto cleaned microscope slides and the yeast cells were heat-fixed onto the slides. This was followed by a 15 min blocking step at room temperature (RT) using 20 l of a solution of 5% skim milk in PBS-Tween. The slides were washed using PBS-Tween, before addition of specific mouse-raised monoclonal antibodies (GenScript), diluted 1:100 in PBS (starting concentration 4.51 mg/ml). The slide was incubated for 1 h at RT. The slides were washed using PBS-Tween, before addition of Fluorochrome-conjugated secondary antibody (FITC) conjugated, anti-mouse IgG (whole molecule, Sigma), diluted 1:1000 in PBS; and further incubation for 1 h at RT in the dark. The slides were washed using PBS-Tween. The slides were immediately viewed using a fluorescence cell imager (ZOE Fluorescent cell imager, Bio-Rad laboratories) at an excitation of 480 nm and emission of 517 nm, using the green channel.