Compositions and methods for producing isoprene
09909144 ยท 2018-03-06
Assignee
Inventors
- Marguerite A. Cervin (Redwood City, CA)
- Gopal K. Chotani (Cupertino, CA)
- Frank J. Feher (Copley, OH, US)
- Richard La Duca (Pleasanton, CA, US)
- Joseph C. McAuliffe (Sunnyvale, CA)
- Andrei Miasnikov (Mountain View, CA)
- Caroline M. Peres (Palo Alto, CA)
- Aaron S. Puhala (Kent, OH)
- Karl J. Sanford (Cupertino, CA)
- Fernando Valle (Burlingame, CA)
- Gregory M. Whited (Belmont, CA)
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12Y203/01009
CHEMISTRY; METALLURGY
C12N9/1229
CHEMISTRY; METALLURGY
C12P5/007
CHEMISTRY; METALLURGY
Y02E50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/1022
CHEMISTRY; METALLURGY
C12Y503/03002
CHEMISTRY; METALLURGY
C12Y401/01033
CHEMISTRY; METALLURGY
International classification
C12N1/00
CHEMISTRY; METALLURGY
C12N15/00
CHEMISTRY; METALLURGY
C12P5/00
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The invention features methods for producing isoprene from cultured cells. The invention also provides compositions that include these cultured cells.
Claims
1. Recombinant cells capable of producing isoprene, the cells comprising (a) heterologous nucleic acid encoding an isoprene synthase polypeptide and (b) two or more heterologous mevalonate (MVA) pathway polypeptides and wherein the cells (i) produce greater than about 400 nmole/g.sub.wcm/hr of isoprene, (ii) convert more than about 0.002 molar percent of the carbon that the cells consume from a cell culture medium into isoprene, or (iii) have an average volumetric productivity of isoprene greater than about 0.1 mg/L.sub.broth/hr.
2. The cells of claim 1, wherein the heterologous nucleic acid encoding an isoprene synthase polypeptide is operably linked to a promoter.
3. The cells of claim 1, wherein the isoprene synthase polypeptide is a plant isoprene synthase polypeptide.
4. The cells of claim 3, wherein the plant isoprene synthase polypeptide is a poplar isoprene synthase polypeptide or a kudzu isoprene synthase polypeptide.
5. The cells of claim 1, wherein the heterologous nucleic acid encoding an isoprene synthase polypeptide is in a vector or is integrated into a chromosome of the cells.
6. The cells of claim 1, further comprising nucleic acids encoding: (a) an isopentenyl-diphosphate delta-isomerase (IDI) polypeptide or (b) a 1-Deoxyxylulose-5-phosphate synthase (DXS) polypeptide.
7. The cells of claim 1, wherein at least one of the nucleic acids encoding one or more MVA pathway polypeptides is a heterologous nucleic acid or a copy of an endogenous nucleic acid.
8. The cells of claim 1, wherein the cells comprise polypeptides of the entire MVA pathway.
9. The cells of claim 1, wherein at least one of the nucleic acids encoding the isoprene synthase polypeptide and two or more heterologous mevalonate (MVA) pathway polypeptides is over-expressed.
10. The cells of claim 9, wherein the over-expressed nucleic acid is cloned into a multicopy plasmid.
11. The cells of claim 9, wherein the over-expressed nucleic acid is placed under an inducible promoter or a constitutive promoter.
12. The cells of claim 1, wherein the cells are gram-positive bacterial cells or gram-negative bacterial cells.
13. The cells of claim 12, wherein the cells are selected from the group consisting of E. coli, P. citrea, B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, B. thuringiensis, S. albus, S. lividans, S. coelicolor, S. griseus, Pseudomonas sp., and P. alcaligenes cells.
14. The cells of claim 1, wherein the cells are fungal cells.
15. The cells of claim 14, wherein the fungal cells are Aspergillus, yeast, Trichoderma, or Yarrowia cells.
16. The cells of claim 15, where the yeast cells are Saccharomyces sp., Schizosaccharomyces sp., Pichia sp., or Candida sp. cells.
17. The cells of claim 14, where the fungal cells are selected from the group consisting of A. oryzae, A. niger, S. cerevisiae, S. pombe, T. reesei, H. insolens, H. lanuginose, H. grisea, C. lucknowense, A. oryzae, A. niger, A sojae, A. japonicus, A. nidulans, A. aculeatus, A. awamori, F. roseum, F. graminum F. cerealis, F. oxysporuim, F. venenatum, N. crassa, M. miehei, T. viride, F. oxysporum, and F. solan cells.
18. The cells of claim 1, wherein the cells are algal cells.
19. The cells of claim 18, wherein the algal cells are selected from the group consisting of: green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, and dinoflagellates.
20. The cells of claim 1, wherein the cells produce greater than about 400 nmole/g.sub.wcm/hr of isoprene.
21. The cells of claim 1, wherein the cells convert more than about 0.002 molar percent of the carbon that the cells consume from a cell culture medium into isoprene.
22. The cells of claim 1, wherein the cells have an average volumetric productivity of isoprene greater than about 0.1 mg/L.sub.broth/hr.
23. A method for producing isoprene, the method comprising (a) culturing the recombinant cells of claim 1 under suitable conditions for the production of isoprene; and (b) producing isoprene.
24. The method of claim 23, further comprising (c) recovering the isoprene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88)
(89)
(90)
(91)
(92)
(93)
(94)
(95)
(96)
(97)
(98)
(99)
(100)
(101)
(102)
(103)
(104)
(105)
DETAILED DESCRIPTION OF THE INVENTION
(106) The invention features compositions and methods for the production of increased amounts of isoprene. In particular, these compositions and methods increase the rate of isoprene production and increase the total amount of isoprene that is produced. For example, cell culture systems that generate 4.810.sup.4 nmole/g.sub.wcm/hr of isoprene have been produced (Table 1). The efficiency of these systems is demonstrated by the conversion of 23.6 molar % yield (10.7 weight % yield) of the carbon that the cells consume from a cell culture medium into isoprene (% carbon yield). As shown in the Examples and Table 2, approximately 60.5 g of isoprene per liter of broth was generated. Isoprene was produced at a peak specific rate of 1.8810.sup.5 nmol/OD/hr (1.8810.sup.5 nmole/g.sub.wcm/hr). If desired, even greater amounts of isoprene can be obtained using other conditions, such as those described herein. In some embodiments, a renewable carbon source is used for the production of isoprene. The compositions and methods of the present invention are desirable because they allow high isoprene yield per cell, high carbon yield, high isoprene purity, high productivity, low energy usage, low production cost and investment, and minimal side reactions. This efficient, large scale, biosynthetic process for isoprene production provides an isoprene source for synthetic isoprene-based rubber and provides a desirable, low-cost alternative to using natural rubber.
(107) As discussed further below, the amount of isoprene produced by cells can be greatly increased by introducing a heterologous nucleic acid encoding an isoprene synthase polypeptide (e.g., a plant isoprene synthase polypeptide) into the cells. Isoprene synthase polypeptides convert dimethylallyl diphosphate (DMAPP) into isoprene. As shown in the Examples, a heterologous Pueraria Montana (kudzu) or Populus alba (Poplar) isoprene synthase polypeptide was expressed in a variety of host cells, such as Escherichia coli, Panteoa citrea, Bacillus subtilis, Yarrowia lipolytica, and Trichoderma reesei. As also shown in the Examples, a heterologous Methanosarcina mazei (M. mazei) mevalonate kinase (MVK) was expressed in host cells such as Escherichia coli to increase isoprene production. All of these cells produced more isoprene than the corresponding cells without the heterologous isoprene synthase polypeptide. As illustrated in Tables 1 and 2, large amounts of isoprene are produced using the methods described herein. For example, B. subtilis cells with a heterologous isoprene synthase nucleic acid produced approximately 10-fold more isoprene in a 14 liter fermentor than the corresponding control B. subtilis cells without the heterologous nucleic acid (Table 2). The production of 60.5 g of isoprene per liter of broth (mg/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells) by E. coli and 30 mg/L by B. subtilis in fermentors indicates that significant amounts of isoprene can be generated (Table 2). If desired, isoprene can be produced on an even larger scale or other conditions described herein can be used to further increase the amount of isoprene. The vectors listed in Tables 1 and 2 and the experimental conditions are described in further detail below and in the Examples section.
(108) TABLE-US-00001 TABLE 1 Exemplary yields of isoprene from a shake flask using the cell cultures and methods of the invention. The assay for measuring isoprene production is described in Example I, part II. For this assay, a sample was removed at one or more time points from the shake flask and cultured for 30 minutes. The amount of isoprene produced in this sample was then measured. The headspace concentration and specific rate of isoprene production are listed in Table 1 and described further herein. Isoprene Production in a Headspace vial* Headspace Specific Rate concentration g/L.sub.broth/hr/OD Strain g/L.sub.gas (nmol/g.sub.wcm/hr) E. coli BL21/pTrcKudzu IS 1.40 53.2 (781.2) E. coli BL21/Pcl DXS yidi 7.61 289.1 Kudzu IS (4.25 10.sup.3) E. coli BL21/MCM127 with 23.0 874.1 kudzu IS and entire MVA (1.28 10.sup.4) pathway E. coli BL21/Pet N- 1.49 56.6 HisKudzu IS (831.1) Pantoea citrea/pTrcKudzu 0.66 25.1 IS (368.6) E. coli w/Poplar IS 5.6 [Miller (2001)] (82.2) Bacillis licheniformis Fall 4.2 U.S. Pat. No. 5,849,970 (61.4) Yarrowia lipolytica with ~0.05 g/L ~2 kudzu isoprene synthase (~30) Trichoderma reesei with ~0.05 g/L ~2 kudzu isoprene synthase (~30) E. coli BL21/ 85.9 3.2 10.sup.3 pTrcKKD.sub.yI.sub.kIS with kudzu (4.8 10.sup.4) IS and lower MVA pathway *Normalized to 1 mL of 1 OD.sub.600, cultured for 1 hour in a sealed headspace vial with a liquid to headspace volume ratio of 1:19.
(109) TABLE-US-00002 TABLE 2 Exemplary yields of isoprene in a fermentor using the cell cultures and methods of the invention. The assay for measuring isoprene production is described in Example I, part II. For this assay, a sample of the off-gas of the fermentor was taken and analyzed for the amount of isoprene. The peak headspace concentration (which is the highest headspace concentration during the fermentation), titer (which is the cumulative, total amount of isoprene produced per liter of broth), and peak specific rate of isoprene production (which is the highest specific rate during the fermentation) are listed in Table 2 and described further herein. Isoprene Production in Fermentors Peak Peak Headspace Specific rate concentration** Titer g/L.sub.broth/hr/OD Strain (ug/L.sub.gas) (mg/L.sub.broth) (nmol/g.sub.wcm/hr) E. coli BL21/ 52 41.2 37 pTrcKudzu with (543.3) Kudzu IS E. coli 3 3.5 21.4 FM5/pTrcKudzu IS (308.1) E. coli BL21/triple 285 300 240 strain (DXS, yidi, (3.52 10.sup.3) IS) E. coli FM5/triple 50.8 29 180.8 strain (DXS, yidi, (2.65 10.sup.3) IS) E. coli/MCM127 1094 250 875 with Kudzu IS and (1.28 10.sup.4) entire MVA pathway Bacillus subtilis 1.5 2.5 0.8 wild-type (11.7) Bacillus pBS Kudzu 16.6 ~30 5 IS (over 100 (73.4) hours) Bacillus Marburg 2.04 0.61 24.5 6051 [Wagner and (359.8) Fall (1999)] Bacillus Marburg 0.7 0.15 6.8 6051 Fall U.S. Pat. No. (100) 5,849,970 E. coli 2.03 10.sup.4 3.22 10.sup.4 5.9 10.sup.3 BL21/pCLPtrcUpper (8.66 10.sup.4) Pathway and gil.2KKDyI and pTrcAlba-mMVK E. coli 3.22 10.sup.4 6.05 10.sup.4 1.28 10.sup.4 BL21/pCLPtrcUpper (1.88 10.sup.5) Pathway and gi1.2KKDyI and pTrcAlba-mMVK plus pBBRCMPGI1.5pgl **Normalized to an off-gas flow rate of 1 vvm (1 volume off-gas per 1 L.sub.broth per minute).
(110) Additionally, isoprene production by cells that contain a heterologous isoprene synthase nucleic acid can be enhanced by increasing the amount of a 1-deoxy-D-xylulose-5-phosphate synthase (DXS) polypeptide and/or an isopentenyl diphosphate isomerase (IDI) polypeptide expressed by the cells. For example, a DXS nucleic acid and/or an IDI nucleic acid can be introduced into the cells. The DXS nucleic acid may be a heterologous nucleic acid or a duplicate copy of an endogenous nucleic acid. Similarly, the IDI nucleic acid may be a heterologous nucleic acid or a duplicate copy of an endogenous nucleic acid. In some embodiments, the amount of DXS and/or IDI polypeptide is increased by replacing the endogenous DXS and/or IDI promoters or regulatory regions with other promoters and/or regulatory regions that result in greater transcription of the DXS and/or IDI nucleic acids. In some embodiments, the cells contain both a heterologous nucleic acid encoding an isoprene synthase polypeptide (e.g., a plant isoprene synthase nucleic acid) and a duplicate copy of an endogenous nucleic acid encoding an isoprene synthase polypeptide.
(111) The encoded DXS and IDI polypeptides are part of the DXP pathway for the biosynthesis of isoprene (
(112) For example, fermentation of E. coli cells with a kudzu isoprene synthase, S. cerevisia IDI, and E. coli DXS nucleic acids was used to produce isoprene. The levels of isoprene varied from 50 to 300 g/L over a time period of 15 hours (Example 7, part VII). As another example, fermentation of E. coli with M. mazei mevalonate kinase (MVK), P. alba isoprene synthase, the upper MVA pathway, and the integrated lower MVA pathway was used to produce isoprene. The levels of isoprene varied from 32 to 35.6 g/L over a time period of 67 hours (Example 10, part III).
(113) In yet another example, fermentation of E. coli with M. mazei mevalonate kinase (MVK), P. alba isoprene synthase, pgl over-expression (RHM111608-2), the upper MVA pathway, and the integrated lower MVA pathway were used to produce isoprene. The levels of isoprene vary from 33.2 g/L to 40.0 g/L over a time period of 40 hours or 48.6 g/L to 60.5 g/L over a time period of 59 hours (Example 13, part (ii)).
(114) In some embodiments, the presence of heterologous or extra endogenous isoprene synthase, IDI, and DXS nucleic acids causes cells to grow more reproducibly or remain viable for longer compared to the corresponding cell with only one or two of these heterologous or extra endogenous nucleic acids. For example, cells containing heterologous isoprene synthase, IDI, and DXS nucleic acids grew better than cells with only heterologous isoprene synthase and DXS nucleic acids or with only a heterologous isoprene synthase nucleic acid. Also, heterologous isoprene synthase, IDI, and DXS nucleic acids were successfully operably linked to a strong promoter on a high copy plasmid that was maintained by E. coli cells, suggesting that large amounts of these polypeptides could be expressed in the cells without causing an excessive amount of toxicity to the cells. While not intending to be bound to a particular theory, it is believed that the presence of heterologous or extra endogenous isoprene synthase and IDI nucleic acids may reduce the amount of one or more potentially toxic intermediates that would otherwise accumulate if only a heterologous or extra endogenous DXS nucleic acid was present in the cells.
(115) In some embodiments, the production of isoprene by cells that contain a heterologous isoprene synthase nucleic acid is augmented by increasing the amount of a MVA polypeptide expressed by the cells (
(116) For example, E. coli cells containing a nucleic acid encoding a kudzu isoprene synthase polypeptide and nucleic acids encoding Saccharomyces cerevisia MVK, PMK, MVD, and IDI polypeptides generated isoprene at a rate of 6.6710.sup.4 nmol/L.sub.broth/OD.sub.600/hr (see Example 8). Additionally, a 14 liter fermentation of E. coli cells with nucleic acids encoding Enterococcus faecalis AA-CoA thiolase, HMG-CoA synthase, and HMG-CoA reductase polypeptides produced 22 grams of mevalonic acid (an intermediate of the MVA pathway). A shake flask of these cells produced 2-4 grams of mevalonic acid per liter. These results indicate that heterologous MVA pathways nucleic acids are active in E. coli. E. coli cells that contain nucleic acids for both the upper MVA pathway and the lower MVA pathway as well as a kudzu isoprene synthase (strain MCM 127) produced significantly more isoprene (874 g/L.sub.broth/hr/OD) compared to E. coli cells with nucleic acids for only the lower MVA pathway and the kudzu isoprene synthase (strain MCM 131) (see Table 3 and Example 8, part VIII).
(117) As another example, E. coli cells containing a nucleic acid encoding a P. alba isoprene synthase polypeptide and a nucleic acid encoding M. mazei MVK polypeptide generated 320.6 g (at a peak specific rate of 9.5410.sup.4 nmol/L.sub.broth/OD.sub.600/hr (i.e. 9.510.sup.5 mol/L.sub.broth/OD.sub.600/hr)) of isoprene during a 67 hour fermentation in the absence of yeast extract feeding or 395.5 g (at a peak specific rate of 8.6610.sup.4 nmol/L.sub.broth/OD.sub.600/hr) during a 68 hour fermentation in the presence of yeast extract feeding (see Example 10).
(118) In some embodiments, at least a portion of the cells maintain the heterologous isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acid for at least about 5, 10, 20, 50, 75, 100, 200, 300, or more cell divisions in a continuous culture (such as a continuous culture without dilution). In some embodiments of any of the aspects of the invention, the nucleic acid comprising the heterologous or duplicate copy of an endogenous isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acid also comprises a selective marker, such as a kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, phleomycin, bleomycin, neomycin, or chloramphenicol antibiotic resistance nucleic acid.
(119) As indicated in Example 7, part VI, the amount of isoprene produced can be further increased by adding yeast extract to the cell culture medium using E. coli cells with kudzu isoprene synthase, S. cerevisia IDI, and E. coli DXS nucleic acids to produce isoprene. In particular, the amount of isoprene produced was linearly proportional to the amount of yeast extract in the cell medium for the concentrations tested (
(120) Isoprene production was also demonstrated using three types of hydrolyzed biomass (bagasse, corn stover, and soft wood pulp) as the carbon source (
(121) Additionally, invert sugar was shown to function as a carbon source for the generation of isoprene (
(122) Additionally, xylose, acetate, and glycerol were also shown to function as a carbon source for the generation of isoprene (
(123) In some embodiments, an oil is included in the cell medium. For example, B. subtilis cells containing a kudzu isoprene synthase nucleic acid produced isoprene when cultured in a cell medium containing an oil and a source of glucose (Example 4, part III). As another example, E. coli fadR atoC mutant cells containing the upper and lower MVA pathway plus kudzu isoprene synthase produced isoprene when cultured in a cell medium containing palm oil and a source of glucose (Example 12, part II). In some embodiments, more than one oil (such as 2, 3, 4, 5, or more oils) is included in the cell medium. While not intending to be bound to any particular theory, it is believed that (i) the oil may increase the amount of carbon in the cells that is available for conversion to isoprene, (ii) the oil may increase the amount of acetyl-CoA in the cells, thereby increasing the carbon flow through the MVA pathway, and/or (ii) the oil may provide extra nutrients to the cells, which is desirable since a lot of the carbon in the cells is converted to isoprene rather than other products. In some embodiments, cells that are cultured in a cell medium containing oil naturally use the MVA pathway to produce isoprene or are genetically modified to contain nucleic acids for the entire MVA pathway. In some embodiments, the oil is partially or completely hydrolyzed before being added to the cell culture medium to facilitate the use of the oil by the host cells.
(124) Exemplary Polypeptides and Nucleic Acids
(125) Various isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and nucleic acids can be used in the compositions and methods of the invention.
(126) As used herein, polypeptides includes polypeptides, proteins, peptides, fragments of polypeptides, and fusion polypeptides that include part or all of a first polypeptide (e.g., an isoprene synthase, DXS, IDI, or MVA pathway polypeptide) and part or all of a second polypeptide (e.g., a peptide that facilitates purification or detection of the fusion polypeptide, such as a His-tag). In some embodiments, the fusion polypeptide has an activity of two or more MVA pathway polypeptides (such as AA-CoA thiolase and HMG-CoA reductase polypeptides). In some embodiments, the polypeptide is a naturally-occurring polypeptide (such as the polypeptide encoded by an Enterococcus faecalis mvaE nucleic acid) that has an activity of two or more MVA pathway polypeptides.
(127) In various embodiments, a polypeptide has at least or about 50, 100, 150, 175, 200, 250, 300, 350, 400, or more amino acids. In some embodiments, the polypeptide fragment contains at least or about 25, 50, 75, 100, 150, 200, 300, or more contiguous amino acids from a full-length polypeptide and has at least or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of an activity of a corresponding full-length polypeptide. In particular embodiments, the polypeptide includes a segment of or the entire amino acid sequence of any naturally-occurring isoprene synthase, DXS, IDI, or MVA pathway polypeptide. In some embodiments, the polypeptide has one or more mutations compared to the sequence of a wild-type (i.e., a sequence occurring in nature) isoprene synthase, DXS, IDI, or MVA pathway polypeptide.
(128) In some embodiments, the polypeptide is an isolated polypeptide. As used herein, an isolated polypeptide is not part of a library of polypeptides, such as a library of 2, 5, 10, 20, 50 or more different polypeptides and is separated from at least one component with which it occurs in nature. An isolated polypeptide can be obtained, for example, by expression of a recombinant nucleic acid encoding the polypeptide.
(129) In some embodiments, the polypeptide is a heterologous polypeptide. By heterologous polypeptide is meant a polypeptide whose amino acid sequence is not identical to that of another polypeptide naturally expressed in the same host cell.
(130) As used herein, a nucleic acid refers to two or more deoxyribonucleotides and/or ribonucleotides in either single or double-stranded form. In some embodiments, the nucleic acid is a recombinant nucleic acid. By recombinant nucleic acid means a nucleic acid of interest that is free of one or more nucleic acids (e.g., genes) which, in the genome occurring in nature of the organism from which the nucleic acid of interest is derived, flank the nucleic acid of interest. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA, a genomic DNA fragment, or a cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In some embodiments, an isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is operably linked to another nucleic acid encoding all or a portion of another polypeptide such that the recombinant nucleic acid encodes a fusion polypeptide that includes an isoprene synthase, DXS, IDI, or MVA pathway polypeptide and all or part of another polypeptide (e.g., a peptide that facilitates purification or detection of the fusion polypeptide, such as a His-tag). In some embodiments, part or all of a recombinant nucleic acid is chemically synthesized.
(131) In some embodiments, the nucleic acid is a heterologous nucleic acid. By heterologous nucleic acid is meant a nucleic acid whose nucleic acid sequence is not identical to that of another nucleic acid naturally found in the same host cell.
(132) In particular embodiments, the nucleic acid includes a segment of or the entire nucleic acid sequence of any naturally-occurring isoprene synthase, DXS, IDI, or MVA pathway nucleic acid.
(133) In some embodiments, the nucleic acid includes at least or about 50, 100, 150, 200, 300, 400, 500, 600, 700, 800, or more contiguous nucleotides from a naturally-occurring isoprene synthase nucleic acid DXS, IDI, or MVA pathway nucleic acid. In some embodiments, the nucleic acid has one or more mutations compared to the sequence of a wild-type (i.e., a sequence occurring in nature) isoprene synthase, DXS, IDI, or MVA pathway nucleic acid. In some embodiments, the nucleic acid has one or more mutations (e.g., a silent mutation) that increase the transcription or translation of isoprene synthase, DXS, IDI, or MVA pathway nucleic acid. In some embodiments, the nucleic acid is a degenerate variant of any nucleic acid encoding an isoprene synthase, DXS, IDI, or MVA pathway polypeptide.
(134) Codon degeneracy refers to divergence in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. The skilled artisan is well aware of the codon-bias exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a nucleic acid for improved expression in a host cell, it is desirable in some embodiments to design the nucleic acid such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
(135) The accession numbers of exemplary isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and nucleic acids are listed in Appendix 1 (the accession numbers of Appendix 1 and their corresponding sequences are herein incorporated by reference in their entireties, particularly with respect to the amino acid and nucleic acid sequences of isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and nucleic acids). The Kegg database also contains the amino acid and nucleic acid sequences of numerous exemplary isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and nucleic acids (see, for example, the world-wide web at genome.jp/kegg/pathway/map/map00100.html and the sequences therein, which are each hereby incorporated by reference in their entireties, particularly with respect to the amino acid and nucleic acid sequences of isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and nucleic acids). In some embodiments, one or more of the isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and/or nucleic acids have a sequence identical to a sequence publicly available on Dec. 12, 2007 or Dec. 11, 2008, such as any of the sequences that correspond to any of the accession numbers in Appendix 1 or any of the sequences present in the Kegg database. Additional exemplary isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and nucleic acids are described further below.
(136) Exemplary Isoprene Synthase Polypeptides and Nucleic Acids
(137) As noted above, isoprene synthase polypeptides convert dimethylallyl diphosphate (DMAPP) into isoprene. Exemplary isoprene synthase polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an isoprene synthase polypeptide. Standard methods can be used to determine whether a polypeptide has isoprene synthase polypeptide activity by measuring the ability of the polypeptide to convert DMAPP into isoprene in vitro, in a cell extract, or in vivo. In an exemplary assay, cell extracts are prepared by growing a strain (e.g., the E. coli/pTrcKudzu strain described herein) in the shake flask method as described in Example 1. After induction is complete, approximately 10 mLs of cells are pelleted by centrifugation at 7000g for 10 minutes and resuspended in 5 ml of PEB without glycerol. The cells are lysed using a French Pressure cell using standard procedures. Alternatively the cells are treated with lysozyme (Ready-Lyse lysozyme solution; EpiCentre) after a freeze/thaw at 80 C.
(138) Isoprene synthase polypeptide activity in the cell extract can be measured, for example, as described in Silver et al., J. Biol. Chem. 270:13010-13016, 1995 and references therein, which are each hereby incorporated by reference in their entireties, particularly with respect to assays for isoprene synthase polypeptide activity. DMAPP (Sigma) is evaporated to dryness under a stream of nitrogen and rehydrated to a concentration of 100 mM in 100 mM potassium phosphate buffer pH 8.2 and stored at 20 0 C. To perform the assay, a solution of 5 l of 1M MgCl.sub.2, 1 mM (250 g/ml) DMAPP, 65
l of Plant Extract Buffer (PEB) (50 mM Tris-HCl, pH 8.0, 20 mM MgCl.sub.2, 5% glycerol, and 2 mM DTT) is added to 25
l of cell extract in a 20 ml Headspace vial with a metal screw cap and teflon coated silicon septum (Agilent Technologies) and cultured at 37 0 C for 15 minutes with shaking. The reaction is quenched by adding 200
l of 250 mM EDTA and quantified by GC/MS as described in Example 1, part II.
(139) Exemplary isoprene synthase nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an isoprene synthase polypeptide. Exemplary isoprene synthase polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
(140) In some embodiments, the isoprene synthase polypeptide or nucleic acid is from the family Fabaceae, such as the Faboideae subfamily. In some embodiments, the isoprene synthase polypeptide or nucleic acid is a polypeptide or nucleic acid from Pueraria montana (kudzu) (Sharkey et al., Plant Physiology 137: 700-712, 2005), Pueraria lobata, poplar (such as Populus alba, Populus nigra, Populus trichocarpa, Populus albatremula (CAC35696), or Populus alba) (Sasaki et al., FEBS Letters 579(11): 2514-2518, 2005; Miller et al., Planta 213: 483-487, 2001), aspen (such as Populus tremuloides) (Silver et al., JBC 270(22): 13010-1316, 1995), or English Oak (Quercus robur) (Zimmer et al., WO 98/02550), which are each hereby incorporated by reference in their entireties, particularly with respect to isoprene synthase nucleic acids and the expression of isoprene synthase polypeptides. Suitable isoprene synthases include, but are not limited to, those identified by Genbank Accession Nos. AY341431, AY316691, AY279379, AJ457070, and AY182241, which are each hereby incorporated by reference in their entireties, particularly with respect to sequences of isoprene synthase nucleic acids and polypeptides. In some embodiments, the isoprene synthase polypeptide or nucleic acid is not a naturally-occurring polypeptide or nucleic acid from Quercus robur (i.e., the isoprene synthase polypeptide or nucleic acid is an isoprene synthase polypeptide or nucleic acid other than a naturally-occurring polypeptide or nucleic acid from Quercus robur). In some embodiments, the isoprene synthase nucleic acid or polypeptide is a naturally-occurring polypeptide or nucleic acid from poplar. In some embodiments, the isoprene synthase nucleic acid or polypeptide is not a naturally-occurring polypeptide or nucleic acid from poplar.
(141) Exemplary DXS Polypeptides and Nucleic Acids
(142) As noted above, 1-deoxy-D-xylulose-5-phosphate synthase (DXS) polypeptides convert pyruvate and D-glyceraldehyde-3-phosphate into 1-deoxy-D-xylulose-5-phosphate. Exemplary DXS polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXS polypeptide. Standard methods (such as those described herein) can be used to determine whether a polypeptide has DXS polypeptide activity by measuring the ability of the polypeptide to convert pyruvate and D-glyceraldehyde-3-phosphate into 1-deoxy-D-xylulose-5-phosphate in vitro, in a cell extract, or in vivo. Exemplary DXS nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a DXS polypeptide. Exemplary DXS polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
(143) Exemplary IDI Polypeptides and Nucleic Acids
(144) Isopentenyl diphosphate isomerase polypeptides (isopentenyl-diphosphate delta-isomerase or IDI) catalyses the interconversion of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) (e.g., converting IPP into DMAPP and/or converting DMAPP into IPP).
(145) Exemplary IDI polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an IDI polypeptide. Standard methods (such as those described herein) can be used to determine whether a polypeptide has IDI polypeptide activity by measuring the ability of the polypeptide to interconvert IPP and DMAPP in vitro, in a cell extract, or in vivo. Exemplary IDI nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an IDI polypeptide. Exemplary IDI polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
(146) Exemplary MVA Pathway Polypeptides and Nucleic Acids
(147) Exemplary MVA pathway polypeptides include acetyl-CoA acetyltransferase (AA-CoA thiolase) polypeptides, 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides, 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides, mevalonate kinase (MVK) polypeptides, phosphomevalonate kinase (PMK) polypeptides, diphosphomevalonte decarboxylase (MVD) polypeptides, phosphomevalonate decarboxylase (PMDC) polypeptides, isopentenyl phosphate kinase (IPK) polypeptides, IDI polypeptides, and polypeptides (e.g., fusion polypeptides) having an activity of two or more MVA pathway polypeptides. In particular, MVA pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an MVA pathway polypeptide. Exemplary MVA pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an MVA pathway polypeptide. Exemplary MVA pathway polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
(148) In particular, acetyl-CoA acetyltransferase polypeptides (AA-CoA thiolase or AACT) convert two molecules of acetyl-CoA into acetoacetyl-CoA. Standard methods (such as those described herein) can be used to determine whether a polypeptide has AA-CoA thiolase polypeptide activity by measuring the ability of the polypeptide to convert two molecules of acetyl-CoA into acetoacetyl-CoA in vitro, in a cell extract, or in vivo.
(149) 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase or HMGS) polypeptides convert acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA. Standard methods (such as those described herein) can be used to determine whether a polypeptide has HMG-CoA synthase polypeptide activity by measuring the ability of the polypeptide to convert acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA in vitro, in a cell extract, or in vivo.
(150) 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase or HMGR) polypeptides convert 3-hydroxy-3-methylglutaryl-CoA into mevalonate. Standard methods (such as those described herein) can be used to determine whether a polypeptide has HMG-CoA reductase polypeptide activity by measuring the ability of the polypeptide to convert 3-hydroxy-3-methylglutaryl-CoA into mevalonate in vitro, in a cell extract, or in vivo.
(151) Mevalonate kinase (MVK) polypeptide phosphorylates mevalonate to form mevalonate-5-phosphate. Standard methods (such as those described herein) can be used to determine whether a polypeptide has MVK polypeptide activity by measuring the ability of the polypeptide to convert mevalonate into mevalonate-5-phosphate in vitro, in a cell extract, or in vivo.
(152) Phosphomevalonate kinase (PMK) polypeptides phosphorylates mevalonate-5-phosphate to form mevalonate-5-diphosphate. Standard methods (such as those described herein) can be used to determine whether a polypeptide has PMK polypeptide activity by measuring the ability of the polypeptide to convert mevalonate-5-phosphate into mevalonate-5-diphosphate in vitro, in a cell extract, or in vivo.
(153) Diphosphomevalonte decarboxylase (MVD or DPMDC) polypeptides convert mevalonate-5-diphosphate into isopentenyl diphosphate (IPP). Standard methods (such as those described herein) can be used to determine whether a polypeptide has MVD polypeptide activity by measuring the ability of the polypeptide to convert mevalonate-5-diphosphate into IPP in vitro, in a cell extract, or in vivo.
(154) Phosphomevalonate decarboxylase (PMDC) polypeptides convert mevalonate-5-phosphate into isopentenyl phosphate (IP). Standard methods (such as those described herein) can be used to determine whether a polypeptide has PMDC polypeptide activity by measuring the ability of the polypeptide to convert mevalonate-5-phosphate into IP in vitro, in a cell extract, or in vivo.
(155) Isopentenyl phosphate kinase (IPK) polypeptides phosphorylate isopentyl phosphate (IP) to form isopentenyl diphosphate (IPP). Standard methods (such as those described herein) can be used to determine whether a polypeptide has IPK polypeptide activity by measuring the ability of the polypeptide to convert IP into IPP in vitro, in a cell extract, or in vivo.
(156) Exemplary IDI polypeptides and nucleic acids are described above.
(157) Exemplary Methods for Isolating Nucleic Acids
(158) Isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids can be isolated using standard methods. Methods of obtaining desired nucleic acids from a source organism of interest (such as a bacterial genome) are common and well known in the art of molecular biology (see, for example, WO 2004/033646 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect to the isolation of nucleic acids of interest). For example, if the sequence of the nucleic acid is known (such as any of the known nucleic acids described herein), suitable genomic libraries may be created by restriction endonuclease digestion and may be screened with probes complementary to the desired nucleic acid sequence. Once the sequence is isolated, the DNA may be amplified using standard primer directed amplification methods such as polymerase chain reaction (PCR) (U.S. Pat. No. 4,683,202, which is incorporated by reference in its entirety, particularly with respect to PCR methods) to obtain amounts of DNA suitable for transformation using appropriate vectors.
(159) Alternatively, isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids (such as any isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids with a known nucleic acid sequence) can be chemically synthesized using standard methods.
(160) Additional isoprene synthase, DXS, IDI, or MVA pathway polypeptides and nucleic acids which may be suitable for use in the compositions and methods described herein can be identified using standard methods. For example, cosmid libraries of the chromosomal DNA of organisms known to produce isoprene naturally can be constructed in organisms such as E. coli, and then screened for isoprene production. In particular, cosmid libraries may be created where large segments of genomic DNA (35-45 kb) are packaged into vectors and used to transform appropriate hosts. Cosmid vectors are unique in being able to accommodate large quantities of DNA. Generally cosmid vectors have at least one copy of the cos DNA sequence which is needed for packaging and subsequent circularization of the heterologous DNA. In addition to the cos sequence, these vectors also contain an origin of replication such as ColEI and drug resistance markers such as a nucleic acid resistant to ampicillin or neomycin. Methods of using cosmid vectors for the transformation of suitable bacterial hosts are well described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989, which is hereby incorporated by reference in its entirety, particularly with respect to transformation methods.
(161) Typically to clone cosmids, heterologous DNA is isolated using the appropriate restriction endonucleases and ligated adjacent to the cos region of the cosmid vector using the appropriate ligases. Cosmid vectors containing the linearized heterologous DNA are then reacted with a DNA packaging vehicle such as bacteriophage. During the packaging process, the cos sites are cleaved and the heterologous DNA is packaged into the head portion of the bacterial viral particle. These particles are then used to transfect suitable host cells such as E. coli. Once injected into the cell, the heterologous DNA circularizes under the influence of the cos sticky ends. In this manner, large segments of heterologous DNA can be introduced and expressed in host cells.
(162) Additional methods for obtaining isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids include screening a metagenomic library by assay (such as the headspace assay described herein) or by PCR using primers directed against nucleotides encoding for a length of conserved amino acids (for example, at least 3 conserved amino acids). Conserved amino acids can be identified by aligning amino acid sequences of known isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides. Conserved amino acids for isoprene synthase polypeptides can be identified based on aligned sequences of known isoprene synthase polypeptides. An organism found to produce isoprene naturally can be subjected to standard protein purification methods (which are well known in the art) and the resulting purified polypeptide can be sequenced using standard methods. Other methods are found in the literature (see, for example, Julsing et al., Applied. Microbiol. Biotechnol. 75: 1377-84, 2007; Withers et al., Appl Environ Microbiol. 73(19):6277-83, 2007, which are each hereby incorporated by reference in their entireties, particularly with respect to identification of nucleic acids involved in the synthesis of isoprene).
(163) Additionally, standard sequence alignment and/or structure prediction programs can be used to identify additional DXS, IDI, or MVA pathway polypeptides and nucleic acids based on the similarity of their primary and/or predicted polypeptide secondary structure with that of known DXS, IDI, or MVA pathway polypeptides and nucleic acids. Standard databases such as the swissprot-trembl database (world-wide web at expasy.org, Swiss Institute of Bioinformatics Swiss-Prot group CMU-1 rue Michel Servet CH-1211 Geneva 4, Switzerland) can also be used to identify isoprene synthase, DXS, IDI, or MVA pathway polypeptides and nucleic acids. The secondary and/or tertiary structure of an isoprene synthase, DXS, IDI, or MVA pathway polypeptide can be predicted using the default settings of standard structure prediction programs, such as PredictProtein (630 West, 168 Street, BB217, New York, N.Y. 10032, USA). Alternatively, the actual secondary and/or tertiary structure of an isoprene synthase, DXS, IDI, or MVA pathway polypeptide can be determined using standard methods. Additional isoprene synthase, DXS, IDI, or MVA pathway nucleic acids can also be identified by hybridization to probes generated from known isoprene synthase, DXS, IDI, or MVA pathway nucleic acids.
(164) Exemplary Promoters and Vectors
(165) Any of the isoprene synthase, DXS, IDI, or MVA pathway nucleic acid described herein can be included in one or more vectors. Accordingly, the invention also features vectors with one more nucleic acids encoding any of the isoprene synthase, DXS, IDI, or MVA pathway polypeptides that are described herein. As used herein, a vector means a construct that is capable of delivering, and desirably expressing one or more nucleic acids of interest in a host cell. Examples of vectors include, but are not limited to, plasmids, viral vectors, DNA or RNA expression vectors, cosmids, and phage vectors. In some embodiments, the vector contains a nucleic acid under the control of an expression control sequence.
(166) As used herein, an expression control sequence means a nucleic acid sequence that directs transcription of a nucleic acid of interest. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. An inducible promoter is a promoter that is active under environmental or developmental regulation. The expression control sequence is operably linked to the nucleic acid segment to be transcribed.
(167) In some embodiments, the vector contains a selective marker. The term selective marker refers to a nucleic acid capable of expression in a host cell that allows for ease of selection of those host cells containing an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, antibiotic resistance nucleic acids (e.g., kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, phleomycin, bleomycin, neomycin, or chloramphenicol) and/or nucleic acids that confer a metabolic advantage, such as a nutritional advantage on the host cell. Exemplary nutritional selective markers include those markers known in the art as amdS, argB, and pyr4. Markers useful in vector systems for transformation of Trichoderma are known in the art (see, e.g., Finkelstein, Chapter 6 in Biotechnology of Filamentous Fungi, Finkelstein et al., Eds. Butterworth-Heinemann, Boston, Mass., Chap. 6, 1992; and Kinghorn et al., Applied Molecular Genetics of Filamentous Fungi, Blackie Academic and Professional, Chapman and Hall, London, 1992, which are each hereby incorporated by reference in their entireties, particularly with respect to selective markers). In some embodiments, the selective marker is the amdS nucleic acid, which encodes the enzyme acetamidase, allowing transformed cells to grow on acetamide as a nitrogen source. The use of an A. nidulans amdS nucleic acid as a selective marker is described in Kelley et al., EMBO J. 4:475-479, 1985 and Penttila et al., Gene 61:155-164, 1987 (which are each hereby incorporated by reference in their entireties, particularly with respect to selective markers). In some embodiments, an isoprene synthase, DXS, IDI, or MVA pathway nucleic acid integrates into a chromosome of the cells without a selective marker.
(168) Suitable vectors are those which are compatible with the host cell employed. Suitable vectors can be derived, for example, from a bacterium, a virus (such as bacteriophage T7 or a M-13 derived phage), a cosmid, a yeast, or a plant. Protocols for obtaining and using such vectors are known to those in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989, which is hereby incorporated by reference in its entirety, particularly with respect to the use of vectors).
(169) Promoters are well known in the art. Any promoter that functions in the host cell can be used for expression of an isoprene synthase, DXS, IDI, or MVA pathway nucleic acid in the host cell. Initiation control regions or promoters, which are useful to drive expression of isoprene synthase, DXS, IDI, or MVA pathway nucleic acids in various host cells are numerous and familiar to those skilled in the art (see, for example, WO 2004/033646 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect to vectors for the expression of nucleic acids of interest). Virtually any promoter capable of driving these nucleic acids is suitable for the present invention including, but not limited to, CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADCI, TRP1, URA3, LEU2, ENO, and TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, trp, P.sub.L,
P.sub.R, T7, tac, and trc (useful for expression in E. coli).
(170) In some embodiments, a glucose isomerase promoter is used (see, for example, U.S. Pat. No. 7,132,527 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect promoters and plasmid systems for expressing polypeptides of interest). Reported glucose isomerase promoter mutants can be used to vary the level of expression of the polypeptide encoded by a nucleic acid operably linked to the glucose isomerase promoter (U.S. Pat. No. 7,132,527). In various embodiments, the glucose isomerase promoter is contained in a low, medium, or high copy plasmid (U.S. Pat. No. 7,132,527).
(171) In various embodiments, an isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acid is contained in a low copy plasmid (e.g., a plasmid that is maintained at about 1 to about 4 copies per cell), medium copy plasmid (e.g., a plasmid that is maintained at about 10 to about 15 copies per cell), or high copy plasmid (e.g., a plasmid that is maintained at about 50 or more copies per cell). In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is operably linked to a T7 promoter. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid operably linked to a T7 promoter is contained in a medium or high copy plasmid. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is operably linked to a Trc promoter. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid operably linked to a Trc promoter is contained in a medium or high copy plasmid. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is operably linked to a Lac promoter. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid operably linked to a Lac promoter is contained in a low copy plasmid. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is operably linked to an endogenous promoter, such as an endogenous Escherichia, Panteoa, Bacillus, Yarrowia, Streptomyces, or Trichoderma promoter or an endogenous alkaline serine protease, isoprene synthase, DXS, IDI, or MVA pathway promoter. In some embodiments, the heterologous or extra endogenous isoprene synthase, DXS, IDI, or MVA pathway nucleic acid operably linked to an endogenous promoter is contained in a high copy plasmid. In some embodiments, the vector is a replicating plasmid that does not integrate into a chromosome in the cells. In some embodiments, part or all of the vector integrates into a chromosome in the cells.
(172) In some embodiments, the vector is any vector which when introduced into a fungal host cell is integrated into the host cell genome and is replicated. Reference is made to the Fungal Genetics Stock Center Catalogue of Strains (FGSC, the world-wide web at fgsc.net and the references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect to vectors) for a list of vectors. Additional examples of suitable expression and/or integration vectors are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989, Current Protocols in Molecular Biology (F. M. Ausubel et al. (eds) 1987, Supplement 30, section 7.7.18); van den Hondel et al. in Bennett and Lasure (Eds.) More Gene Manipulations in Fungi, Academic Press pp. 396-428, 1991; and U.S. Pat. No. 5,874,276, which are each hereby incorporated by reference in their entireties, particularly with respect to vectors. Particularly useful vectors include pFB6, pBR322, PUC 18, pUC100, and pENTR/D.
(173) In some embodiments, an isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is operably linked to a suitable promoter that shows transcriptional activity in a fungal host cell. The promoter may be derived from one or more nucleic acids encoding a polypeptide that is either endogenous or heterologous to the host cell. In some embodiments, the promoter is useful in a Trichoderma host. Suitable non-limiting examples of promoters include cbh1, cbh2, egl1, egl2, pepA, hfb1, hfb2, xyn1, and amy. In some embodiments, the promoter is one that is native to the host cell. For example, in some embodiments when T. reesei is the host, the promoter is a native T. reesei promoter. In some embodiments, the promoter is T. reesei cbh1, which is an inducible promoter and has been deposited in GenBank under Accession No. D86235, which is incorporated by reference in its entirety, particularly with respect to promoters. In some embodiments, the promoter is one that is heterologous to the fungal host cell. Other examples of useful promoters include promoters from the genes of A. awamori and A. niger glucoamylase (glaA) (Nunberg et al., Mol. Cell Biol. 4:2306-2315, 1984 and Boel et al., EMBO J. 3:1581-1585, 1984, which are each hereby incorporated by reference in their entireties, particularly with respect to promoters); Aspergillus niger alpha amylases, Aspergillus oryzae TAKA amylase, T. reesei xln1, and the T. reesei cellobiohydrolase 1 (EP 137280, which is incorporated by reference in its entirety, particularly with respect to promoters).
(174) In some embodiments, the expression vector also includes a termination sequence. Termination control regions may also be derived from various genes native to the host cell. In some embodiments, the termination sequence and the promoter sequence are derived from the same source. In another embodiment, the termination sequence is endogenous to the host cell. A particularly suitable terminator sequence is cbh1 derived from a Trichoderma strain (such as T. reesei). Other useful fungal terminators include the terminator from an A. niger or A. awamori glucoamylase nucleic acid (Nunberg et al., Mol. Cell Biol. 4:2306-2315, 1984 and Boel et al., EMBO J. 3:1581-1585, 1984; which are each hereby incorporated by reference in their entireties, particularly with respect to fungal terminators). Optionally, a termination site may be included. For effective expression of the polypeptides, DNA encoding the polypeptide are linked operably through initiation codons to selected expression control regions such that expression results in the formation of the appropriate messenger RNA.
(175) In some embodiments, the promoter, coding, region, and terminator all originate from the isoprene synthase, DXS, IDI, or MVA pathway nucleic acid to be expressed. In some embodiments, the coding region for an isoprene synthase, DXS, IDI, or MVA pathway nucleic acid is inserted into a general-purpose expression vector such that it is under the transcriptional control of the expression construct promoter and terminator sequences. In some embodiments, genes or part thereof are inserted downstream of the strong cbh1 promoter.
(176) An isoprene synthase, DXS, IDI, or MVA pathway nucleic acid can be incorporated into a vector, such as an expression vector, using standard techniques (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1982, which is hereby incorporated by reference in its entirety, particularly with respect to the screening of appropriate DNA sequences and the construction of vectors). Methods used to ligate the DNA construct comprising a nucleic acid of interest (such as an isoprene synthase, DXS, IDI, or MVA pathway nucleic acid), a promoter, a terminator, and other sequences and to insert them into a suitable vector are well known in the art. For example, restriction enzymes can be used to cleave the isoprene synthase, DXS, IDI, or MVA pathway nucleic acid and the vector. Then, the compatible ends of the cleaved isoprene synthase, DXS, IDI, or MVA pathway nucleic acid and the cleaved vector can be ligated. Linking is generally accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide linkers are used in accordance with conventional practice (see, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989, and Bennett and Lasure, More Gene Manipulations in Fungi, Academic Press, San Diego, pp 70-76, 1991, which are each hereby incorporated by reference in their entireties, particularly with respect to oligonucleotide linkers). Additionally, vectors can be constructed using known recombination techniques (e.g., Invitrogen Life Technologies, Gateway Technology).
(177) In some embodiments, it may be desirable to over-express isoprene synthase, DXS, IDI, or MVA pathway nucleic acids at levels far higher than currently found in naturally-occurring cells. This result may be accomplished by the selective cloning of the nucleic acids encoding those polypeptides into multicopy plasmids or placing those nucleic acids under a strong inducible or constitutive promoter. Methods for over-expressing desired polypeptides are common and well known in the art of molecular biology and examples may be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989, which is hereby incorporated by reference in its entirety, particularly with respect to cloning techniques.
(178) The following resources include descriptions of additional general methodology useful in accordance with the invention: Kreigler, Gene Transfer and Expression; A Laboratory Manual, 1990 and Ausubel et al., Eds. Current Protocols in Molecular Biology, 1994, which are each hereby incorporated by reference in their entireties, particularly with respect to molecular biology and cloning techniques.
(179) Exemplary Source Organisms
(180) Isoprene synthase, DXS, IDI, or MVA pathway nucleic acids (and their encoded polypeptides) can be obtained from any organism that naturally contains isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids. As noted above, isoprene is formed naturally by a variety of organisms, such as bacteria, yeast, plants, and animals. Organisms contain the MVA pathway, DXP pathway, or both the MVA and DXP pathways for producing isoprene (
(181) In some embodiments, the nucleic acid sequence of the isoprene synthase, DXS, IDI, or MVA pathway nucleic is identical to the sequence of a nucleic acid that is produced by any of the following organisms in nature. In some embodiments, the amino acid sequence of the isoprene synthase, DXS, IDI, or MVA pathway polypeptide is identical to the sequence of a polypeptide that is produced by any of the following organisms in nature. In some embodiments, the isoprene synthase, DXS, IDI, or MVA pathway nucleic acid or polypeptide is a mutant nucleic acid or polypeptide derived from any of the organisms described herein. As used herein, derived from refers to the source of the nucleic acid or polypeptide into which one or more mutations is introduced. For example, a polypeptide that is derived from a plant polypeptide refers to polypeptide of interest that results from introducing one or more mutations into the sequence of a wild-type (i.e., a sequence occurring in nature) plant polypeptide.
(182) In some embodiments, the source organism is a fungus, examples of which are species of Aspergillus such as A. oryzae and A. niger, species of Saccharomyces such as S. cerevisiae, species of Schizosaccharomyces such as S. pombe, and species of Trichoderma such as T. reesei. In some embodiments, the source organism is a filamentous fungal cell. The term filamentous fungi refers to all filamentous forms of the subdivision Eumycotina (see, Alexopoulos, C. J. (1962), Introductory Mycology, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic. The filamentous fungal parent cell may be a cell of a species of, but not limited to, Trichoderma, (e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified as T. longibrachiatum, Trichoderma viride, Trichoderma koningii, Trichoderma harzianum) (Sheir-Neirs et al., Appl. Microbiol. Biotechnol 20: 46-53, 1984; ATCC No. 56765 and ATCC No. 26921); Penicillium sp., Humicola sp. (e.g., H. insolens, H. lanuginose, or H. grisea); Chrysosporium sp. (e.g., C. lucknowense), Gliocladium sp., Aspergillus sp. (e.g., A. oryzae, A. niger, A sojae, A. japonicus, A. nidulans, or A. awamori) (Ward et al., Appl. Microbiol. Biotechnol. 39: 7380743, 1993 and Goedegebuur et al., Genet 41: 89-98, 2002), Fusarium sp., (e.g., F. roseum, F. graminum F. cerealis, F. oxysporuim, or F. venenatum), Neurospora sp., (e.g., N. crassa), Hypocrea sp., Mucor sp., (e.g., M. miehei), Rhizopus sp. and Emericella sp. (see also, Innis et al., Sci. 228: 21-26, 1985). The term Trichoderma or Trichoderma sp. or Trichoderma spp. refer to any fungal genus previously or currently classified as Trichoderma.
(183) In some embodiments, the fungus is A. nidulans, A. awamori, A. oryzae, A. aculeatus, A. niger, A. japonicus, T. reesei, T. viride, F. oxysporum, or F. solani. Aspergillus strains are disclosed in Ward et al., Appl. Microbiol. Biotechnol. 39:738-743, 1993 and Goedegebuur et al., Curr Gene 41:89-98, 2002, which are each hereby incorporated by reference in their entireties, particularly with respect to fungi. In particular embodiments, the fungus is a strain of Trichoderma, such as a strain of T. reesei. Strains of T. reesei are known and non-limiting examples include ATCC No. 13631, ATCC No. 26921, ATCC No. 56764, ATCC No. 56765, ATCC No. 56767, and NRRL 15709, which are each hereby incorporated by reference in their entireties, particularly with respect to strains of T. reesei. In some embodiments, the host strain is a derivative of RL-P37. RL-P37 is disclosed in Sheir-Neiss et al., Appl. Microbiol. Biotechnology 20:46-53, 1984, which is hereby incorporated by reference in its entirety, particularly with respect to strains of T. reesei.
(184) In some embodiments, the source organism is a yeast, such as Saccharomyces sp., Schizosaccharomyces sp., Pichia sp., or Candida sp.
(185) In some embodiments, the source organism is a bacterium, such as strains of Bacillus such as B. lichenformis or B. subtilis, strains of Pantoea such as P. citrea, strains of Pseudomonas such as P. alcaligenes, strains of Streptomyces such as S. albus, S. lividans, or S. rubiginosus, or strains of Escherichia such as E. coli.
(186) As used herein, the genus Bacillus includes all species within the genus Bacillus, as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, and B. thuringiensis. It is recognized that the genus Bacillus continues to undergo taxonomical reorganization. Thus, it is intended that the genus include species that have been reclassified, including but not limited to such organisms as B. stearothermophilus, which is now named Geobacillus stearothermophilus. The production of resistant endospores in the presence of oxygen is considered the defining feature of the genus Bacillus, although this characteristic also applies to the recently named Alicyclobacillus, Amphibacillus, Aneurinibacillus, Anoxybacillus, Brevibacillus, Filobacillus, Gracilibacillus, Halobacillus, Paenibacillus, Salibacillus, Thermobacillus, Ureibacillus, and Virgibacillus.
(187) In some embodiments, the source organism is a gram-positive bacterium. Non-limiting examples include strains of Streptomyces (e.g., S. albus, S. lividans, S. coelicolor, or S. griseus) and Bacillus. In some embodiments, the source organism is a gram-negative bacterium, such as E. coli or Pseudomonas sp.
(188) In some embodiments, the source organism is a plant, such as a plant from the family Fabaceae, such as the Faboideae subfamily. In some embodiments, the source organism is kudzu, poplar (such as Populus albatremula CAC35696 or Populus alba) (Sasaki et al., FEBS Letters 579(11): 2514-2518, 2005), aspen (such as Populus tremuloides), or Quercus robur.
(189) In some embodiments, the source organism is an algae, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
(190) In some embodiments, the source organism is a cyanobacteria, such as cyanobacteria classified into any of the following groups based on morphology: Chroococcales, Pleurocapsales, Oscillatoriales, Nostocales, or Stigonematales.
(191) Exemplary Host Cells
(192) A variety of host cells can be used to express isoprene synthase, DXS, IDI, and/or MVA pathway polypeptides and to produce isoprene in the methods of the claimed invention. Exemplary host cells include cells from any of the organisms listed in the prior section under the heading Exemplary Source Organisms. The host cell may be a cell that naturally produces isoprene or a cell that does not naturally produce isoprene. In some embodiments, the host cell naturally produces isoprene using the DXP pathway, and an isoprene synthase, DXS, and/or IDI nucleic acid is added to enhance production of isoprene using this pathway. In some embodiments, the host cell naturally produces isoprene using the MVA pathway, and an isoprene synthase and/or one or more MVA pathway nucleic acids are added to enhance production of isoprene using this pathway. In some embodiments, the host cell naturally produces isoprene using the DXP pathway and one or more MVA pathway nucleic acids are added to produce isoprene using part or all of the MVA pathway as well as the DXP pathway. In some embodiments, the host cell naturally produces isoprene using both the DXP and MVA pathways and one or more isoprene synthase, DXS, IDI, or MVA pathway nucleic acids are added to enhance production of isoprene by one or both of these pathways.
(193) Exemplary Transformation Methods
(194) Isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids or vectors containing them can be inserted into a host cell (e.g., a plant cell, a fungal cell, a yeast cell, or a bacterial cell described herein) using standard techniques for expression of the encoded isoprene synthase, DXS, IDI, and/or MVA pathway polypeptide. Introduction of a DNA construct or vector into a host cell can be performed using techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection mediated or DEAE-Dextrin mediated transfection or transfection using a recombinant phage virus), incubation with calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated microprojectiles, and protoplast fusion. General transformation techniques are known in the art (see, e.g., Current Protocols in Molecular Biology (F. M. Ausubel et al. (eds) Chapter 9, 1987; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989; and Campbell et al., Curr. Genet. 16:53-56, 1989, which are each hereby incorporated by reference in their entireties, particularly with respect to transformation methods). The expression of heterologous polypeptide in Trichoderma is described in U.S. Pat. No. 6,022,725; U.S. Pat. No. 6,268,328; U.S. Pat. No. 7,262,041; WO 2005/001036; Harkki et al.; Enzyme Microb. Technol. 13:227-233, 1991; Harkki et al., Bio Technol. 7:596-603, 1989; EP 244,234; EP 215,594; and Nevalainen et al., The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes, in Molecular Industrial Mycology, Eds. Leong and Berka, Marcel Dekker Inc., NY pp. 129-148, 1992, which are each hereby incorporated by reference in their entireties, particularly with respect to transformation and expression methods). Reference is also made to Cao et al., (Sci. 9:991-1001, 2000; EP 238023; and Yelton et al., Proceedings. Natl. Acad Sci. USA 81:1470-1474, 1984 (which are each hereby incorporated by reference in their entireties, particularly with respect to transformation methods) for transformation of Aspergillus strains. The introduced nucleic acids may be integrated into chromosomal DNA or maintained as extrachromosomal replicating sequences.
(195) Any method known in the art may be used to select transformants. In one non-limiting example, stable transformants including an amdS marker are distinguished from unstable transformants by their faster growth rate and the formation of circular colonies with a smooth, rather than ragged outline on solid culture medium containing acetamide. Additionally, in some cases a further test of stability is conducted by growing the transformants on a solid non-selective medium (e.g., a medium that lacks acetamide), harvesting spores from this culture medium, and determining the percentage of these spores which subsequently germinate and grow on selective medium containing acetamide.
(196) In some embodiments, fungal cells are transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a known manner. In one specific embodiment, the preparation of Trichoderma sp. for transformation involves the preparation of protoplasts from fungal mycelia (see, Campbell et al., Curr. Genet. 16:53-56, 1989, which is incorporated by reference in its entirety, particularly with respect to transformation methods). In some embodiments, the mycelia are obtained from germinated vegetative spores. The mycelia are treated with an enzyme that digests the cell wall resulting in protoplasts. The protoplasts are then protected by the presence of an osmotic stabilizer in the suspending medium. These stabilizers include sorbitol, mannitol, potassium chloride, magnesium sulfate, and the like. Usually the concentration of these stabilizers varies between 0.8 M and 1.2 M. It is desirable to use about a 1.2 M solution of sorbitol in the suspension medium.
(197) Uptake of DNA into the host Trichoderma sp. strain is dependent upon the calcium ion concentration. Generally, between about 10 mM CaCl.sub.2 and 50 mM CaCl.sub.2 is used in an uptake solution. In addition to the calcium ion in the uptake solution, other compounds generally included are a buffering system such as TE buffer (10 Mm Tris, pH 7.4; 1 mM EDTA) or 10 mM MOPS, pH 6.0 buffer (morpholinepropanesulfonic acid) and polyethylene glycol (PEG). While not intending to be bound to any particular theory, it is believed that the polyethylene glycol acts to fuse the cell membranes, thus permitting the contents of the medium to be delivered into the cytoplasm of the Trichoderma sp. strain and the plasmid DNA to be transferred to the nucleus. This fusion frequently leaves multiple copies of the plasmid DNA integrated into the host chromosome.
(198) Usually a suspension containing the Trichoderma sp. protoplasts or cells that have been subjected to a permeability treatment at a density of 10.sup.5 to 10.sup.7/mL (such as 210.sup.6/mL) are used in the transformation. A volume of 100 L of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl.sub.2) are mixed with the desired DNA. Generally, a high concentration of PEG is added to the uptake solution. From 0.1 to 1 volume of 25% PEG 4000 can be added to the protoplast suspension. In some embodiments, about 0.25 volumes are added to the protoplast suspension. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, and the like may also be added to the uptake solution and aid in transformation. Similar procedures are available for other fungal host cells (see, e.g., U.S. Pat. Nos. 6,022,725 and 6,268,328, which are each hereby incorporated by reference in their entireties, particularly with respect to transformation methods).
(199) Generally, the mixture is then cultured at approximately 0 C. for a period of between 10 to 30 minutes. Additional PEG is then added to the mixture to further enhance the uptake of the desired nucleic acid sequence. The 25% PEG 4000 is generally added in volumes of 5 to 15 times the volume of the transformation mixture; however, greater and lesser volumes may be suitable. The 25% PEG 4000 is desirably about 10 times the volume of the transformation mixture. After the PEG is added, the transformation mixture is then cultured either at room temperature or on ice before the addition of a sorbitol and CaCl.sub.2 solution. The protoplast suspension is then further added to molten aliquots of a growth medium. When the growth medium includes a growth selection (e.g., acetamide or an antibiotic) it permits the growth of transformants only.
(200) The transformation of bacterial cells may be performed according to conventional methods, e.g., as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1982, which is hereby incorporated by reference in its entirety, particularly with respect to transformation methods.
(201) Exemplary Cell Culture Media
(202) The invention also includes a cell or a population of cells in culture that produce isoprene. By cells in culture is meant two or more cells in a solution (e.g., a cell medium) that allows the cells to undergo one or more cell divisions. Cells in culture do not include plant cells that are part of a living, multicellular plant containing cells that have differentiated into plant tissues. In various embodiments, the cell culture includes at least or about 10, 20, 50, 100, 200, 500, 1,000, 5,000, 10,000 or more cells.
(203) Any carbon source can be used to cultivate the host cells. The term carbon source refers to one or more carbon-containing compounds capable of being metabolized by a host cell or organism. For example, the cell medium used to cultivate the host cells may include any carbon source suitable for maintaining the viability or growing the host cells.
(204) In some embodiments, the carbon source is a carbohydrate (such as monosaccharide, disaccharide, oligosaccharide, or polysaccharids), invert sugar (e.g., enzymatically treated sucrose syrup), glycerol, glycerine (e.g., a glycerine byproduct of a biodiesel or soap-making process), dihydroxyacetone, one-carbon source, oil (e.g., a plant or vegetable oil such as corn, palm, or soybean oil), acetate, animal fat, animal oil, fatty acid (e.g., a saturated fatty acid, unsaturated fatty acid, or polyunsaturated fatty acid), lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, polypeptide (e.g., a microbial or plant protein or peptide), renewable carbon source (e.g., a biomass carbon source such as a hydrolyzed biomass carbon source), yeast extract, component from a yeast extract, polymer, acid, alcohol, aldehyde, ketone, amino acid, succinate, lactate, acetate, ethanol, or any combination of two or more of the foregoing. In some embodiments, the carbon source is a product of photosynthesis, including, but not limited to, glucose. In some embodiment, the carbohydrate is xylose or glucose.
(205) Exemplary monosaccharides include glucose and fructose; exemplary oligosaccharides include lactose and sucrose, and exemplary polysaccharides include starch and cellulose. Exemplary carbohydrates include C6 sugars (e.g., fructose, mannose, galactose, or glucose) and C5 sugars (e.g., xylose or arabinose). In some embodiments, the cell medium includes a carbohydrate as well as a carbon source other than a carbohydrate (e.g., glycerol, glycerine, dihydroxyacetone, one-carbon source, oil, animal fat, animal oil, fatty acid, lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, renewable carbon source, or a component from a yeast extract). In some embodiments, the cell medium includes a carbohydrate as well as a polypeptide (e.g., a microbial or plant protein or peptide). In some embodiments, the microbial polypeptide is a polypeptide from yeast or bacteria. In some embodiments, the plant polypeptide is a polypeptide from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
(206) In some embodiments, the concentration of the carbohydrate is at least or about 5 grams per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, 400, or more g/L. In some embodiments, the concentration of the carbohydrate is between about 50 and about 400 g/L, such as between about 100 and about 360 g/L, between about 120 and about 360 g/L, or between about 200 and about 300 g/L. In some embodiments, this concentration of carbohydrate includes the total amount of carbohydrate that is added before and/or during the culturing of the host cells.
(207) Exemplary lipids are any substance containing one or more fatty acids that are C4 and above fatty acids that are saturated, unsaturated, or branched.
(208) Exemplary oils are lipids that are liquid at room temperature. In some embodiments, the lipid contains one or more C4 or above fatty acids (e.g., contains one or more saturated, unsaturated, or branched fatty acid with four or more carbons). In some embodiments, the oil is obtained from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, linseed, oleagineous microbial cells, Chinese tallow, or any combination of two or more of the foregoing.
(209) Exemplary fatty acids include compounds of the formula RCOOH, where R is a hydrocarbon. Exemplary unsaturated fatty acids include compounds where R includes at least one carbon-carbon double bond. Exemplary unsaturated fatty acids include, but are not limited to, oleic acid, vaccenic acid, linoleic acid, palmitelaidic acid, and arachidonic acid. Exemplary polyunsaturated fatty acids include compounds where R includes a plurality of carbon-carbon double bonds. Exemplary saturated fatty acids include compounds where R is a saturated aliphatic group. In some embodiments, the carbon source includes one or more C.sub.12-C.sub.22 fatty acids, such as a C.sub.12 saturated fatty acid, a C.sub.14 saturated fatty acid, a C.sub.16 saturated fatty acid, a C.sub.18 saturated fatty acid, a C.sub.20 saturated fatty acid, or a C.sub.22 saturated fatty acid. In an exemplary embodiment, the fatty acid is palmitic acid. In some embodiments, the carbon source is a salt of a fatty acid (e.g., an unsaturated fatty acid), a derivative of a fatty acid (e.g., an unsaturated fatty acid), or a salt of a derivative of fatty acid (e.g., an unsaturated fatty acid). Suitable salts include, but are not limited to, lithium salts, potassium salts, sodium salts, and the like. Di- and triglycerols are fatty acid esters of glycerol.
(210) In some embodiments, the concentration of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is at least or about 1 gram per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, 400, or more g/L. In some embodiments, the concentration of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 10 and about 400 g/L, such as between about 25 and about 300 g/L, between about 60 and about 180 g/L, or between about 75 and about 150 g/L. In some embodiments, the concentration includes the total amount of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride that is added before and/or during the culturing of the host cells. In some embodiments, the carbon source includes both (i) a lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride and (ii) a carbohydrate, such as glucose. In some embodiments, the ratio of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride to the carbohydrate is about 1:1 on a carbon basis (i.e., one carbon in the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride per carbohydrate carbon). In particular embodiments, the amount of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 60 and 180 g/L, and the amount of the carbohydrate is between about 120 and 360 g/L.
(211) Exemplary microbial polypeptide carbon sources include one or more polypeptides from yeast or bacteria. Exemplary plant polypeptide carbon sources include one or more polypeptides from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
(212) Exemplary renewable carbon sources include cheese whey permeate, cornsteep liquor, sugar beet molasses, barley malt, and components from any of the foregoing. Exemplary renewable carbon sources also include acetate, glucose, hexose, pentose and xylose present in biomass, such as corn, switchgrass, sugar cane, cell waste of fermentation processes, and protein by-product from the milling of soy, corn, or wheat. In some embodiments, the biomass carbon source is a lignocellulosic, hemicellulosic, or cellulosic material such as, but are not limited to, a grass, wheat, wheat straw, bagasse, sugar cane bagasse, soft wood pulp, corn, corn cob or husk, corn kernel, fiber from corn kernels, corn stover, switch grass, rice hull product, or a by-product from wet or dry milling of grains (e.g., corn, sorghum, rye, triticate, barley, wheat, and/or distillers grains). Exemplary cellulosic materials include wood, paper and pulp waste, herbaceous plants, and fruit pulp. In some embodiments, the carbon source includes any plant part, such as stems, grains, roots, or tubers. In some embodiments, all or part of any of the following plants are used as a carbon source: corn, wheat, rye, sorghum, triticate, rice, millet, barley, cassava, legumes, such as beans and peas, potatoes, sweet potatoes, bananas, sugarcane, and/or tapioca. In some embodiments, the carbon source is a biomass hydrolysate, such as a biomass hydrolysate that includes both xylose and glucose or that includes both sucrose and glucose.
(213) In some embodiments, the renewable carbon source (such as biomass) is pretreated before it is added to the cell culture medium. In some embodiments, the pretreatment includes enzymatic pretreatment, chemical pretreatment, or a combination of both enzymatic and chemical pretreatment (see, for example, Farzaneh et al., Bioresource Technology 96 (18): 2014-2018, 2005; U.S. Pat. No. 6,176,176; U.S. Pat. No. 6,106,888; which are each hereby incorporated by reference in their entireties, particularly with respect to the pretreatment of renewable carbon sources). In some embodiments, the renewable carbon source is partially or completely hydrolyzed before it is added to the cell culture medium.
(214) In some embodiments, the renewable carbon source (such as corn stover) undergoes ammonia fiber expansion (AFEX) pretreatment before it is added to the cell culture medium (see, for example, Farzaneh et al., Bioresource Technology 96 (18): 2014-2018, 2005). During AFEX pretreatment, a renewable carbon source is treated with liquid anhydrous ammonia at moderate temperatures (such as about 60 to about 100 C.) and high pressure (such as about 250 to about 300 psi) for about 5 minutes. Then, the pressure is rapidly released. In this process, the combined chemical and physical effects of lignin solubilization, hemicellulose hydrolysis, cellulose decrystallization, and increased surface area enables near complete enzymatic conversion of cellulose and hemicellulose to fermentable sugars. AFEX pretreatment has the advantage that nearly all of the ammonia can be recovered and reused, while the remaining serves as nitrogen source for microbes in downstream processes. Also, a wash stream is not required for AFEX pretreatment. Thus, dry matter recovery following the AFEX treatment is essentially 100%. AFEX is basically a dry to dry process. The treated renewable carbon source is stable for long periods and can be fed at very high solid loadings in enzymatic hydrolysis or fermentation processes. Cellulose and hemicellulose are well preserved in the AFEX process, with little or no degradation. There is no need for neutralization prior to the enzymatic hydrolysis of a renewable carbon source that has undergone AFEX pretreatment. Enzymatic hydrolysis of AFEX-treated carbon sources produces clean sugar streams for subsequent fermentation use.
(215) In some embodiments, the concentration of the carbon source (e.g., a renewable carbon source) is equivalent to at least or about 0.1, 0.5, 1, 1.5 2, 3, 4, 5, 10, 15, 20, 30, 40, or 50% glucose (w/v). The equivalent amount of glucose can be determined by using standard HPLC methods with glucose as a reference to measure the amount of glucose generated from the carbon source. In some embodiments, the concentration of the carbon source (e.g., a renewable carbon source) is equivalent to between about 0.1 and about 20% glucose, such as between about 0.1 and about 10% glucose, between about 0.5 and about 10% glucose, between about 1 and about 10% glucose, between about 1 and about 5% glucose, or between about 1 and about 2% glucose.
(216) In some embodiments, the carbon source includes yeast extract or one or more components of yeast extract. In some embodiments, the concentration of yeast extract is at least 1 gram of yeast extract per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, or more g/L. In some embodiments, the concentration of yeast extract is between about 1 and about 300 g/L, such as between about 1 and about 200 g/L, between about 5 and about 200 g/L, between about 5 and about 100 g/L, or between about 5 and about 60 g/L. In some embodiments, the concentration includes the total amount of yeast extract that is added before and/or during the culturing of the host cells. In some embodiments, the carbon source includes both yeast extract (or one or more components thereof) and another carbon source, such as glucose. In some embodiments, the ratio of yeast extract to the other carbon source is about 1:5, about 1:10, or about 1:20 (w/w).
(217) Additionally the carbon source may also be one-carbon substrates such as carbon dioxide, or methanol. Glycerol production from single carbon sources (e.g., methanol, formaldehyde, or formate) has been reported in methylotrophic yeasts (Yamada et al., Agric. Biol. Chem., 53(2) 541-543, 1989, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources) and in bacteria (Hunter et. al., Biochemistry, 24, 4148-4155, 1985, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources). These organisms can assimilate single carbon compounds, ranging in oxidation state from methane to formate, and produce glycerol. The pathway of carbon assimilation can be through ribulose monophosphate, through serine, or through xylulose-momophosphate (Gottschalk, Bacterial Metabolism, Second Edition, Springer-Verlag: New York, 1986, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources). The ribulose monophosphate pathway involves the condensation of formate with ribulose-5-phosphate to form a six carbon sugar that becomes fructose and eventually the three carbon product glyceraldehyde-3-phosphate. Likewise, the serine pathway assimilates the one-carbon compound into the glycolytic pathway via methylenetetrahydrofolate.
(218) In addition to one and two carbon substrates, methylotrophic organisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth Cl Compd., [Int. Symp.], 7.sup.th ed., 415-32. Editors: Murrell et al., Publisher: Intercept, Andover, UK, 1993, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources). Similarly, various species of Candida metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol. 153(5), 485-9, 1990, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources).
(219) In some embodiments, cells are cultured in a standard medium containing physiological salts and nutrients (see, e.g., Pourquie, J. et al., Biochemistry and Genetics of Cellulose Degradation, eds. Aubert et al., Academic Press, pp. 71-86, 1988 and Ilmen et al., Appl. Environ. Microbiol. 63:1298-1306, 1997, which are each hereby incorporated by reference in their entireties, particularly with respect to cell media). Exemplary growth media are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, or Yeast medium (YM) broth. Other defined or synthetic growth media may also be used, and the appropriate medium for growth of particular host cells are known by someone skilled in the art of microbiology or fermentation science.
(220) In addition to an appropriate carbon source, the cell medium desirably contains suitable minerals, salts, cofactors, buffers, and other components known to those skilled in the art suitable for the growth of the cultures or the enhancement of isoprene production (see, for example, WO 2004/033646 and references cited therein and WO 96/35796 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect cell medias and cell culture conditions). In some embodiments where an isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acid is under the control of an inducible promoter, the inducing agent (e.g., a sugar, metal salt or antimicrobial), is desirably added to the medium at a concentration effective to induce expression of an isoprene synthase, DXS, IDI, and/or MVA pathway polypeptide. In some embodiments, cell medium has an antibiotic (such as kanamycin) that corresponds to the antibiotic resistance nucleic acid (such as a kanamycin resistance nucleic acid) on a vector that has one or more DXS, IDI, or MVA pathway nucleic acids.
(221) Exemplary Cell Culture Conditions
(222) Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Exemplary techniques may be found in Manual of Methods for General Bacteriology Gerhardt et al., eds), American Society for Microbiology, Washington, D.C. (1994) or Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., which are each hereby incorporated by reference in their entireties, particularly with respect to cell culture techniques. In some embodiments, the cells are cultured in a culture medium under conditions permitting the expression of one or more isoprene synthase, DXS, IDI, or MVA pathway polypeptides encoded by a nucleic acid inserted into the host cells.
(223) Standard cell culture conditions can be used to culture the cells (see, for example, WO 2004/033646 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect to cell culture and fermentation conditions). Cells are grown and maintained at an appropriate temperature, gas mixture, and pH (such as at about 20 to about 37 C., at about 6% to about 84% CO.sub.2, and at a pH between about 5 to about 9). In some embodiments, cells are grown at 35 C. in an appropriate cell medium. In some embodiments, e.g., cultures are cultured at approximately 28 C. in appropriate medium in shake cultures or fermentors until desired amount of isoprene production is achieved. In some embodiments, the pH ranges for fermentation are between about pH 5.0 to about pH 9.0 (such as about pH 6.0 to about pH 8.0 or about 6.5 to about 7.0). Reactions may be performed under aerobic, anoxic, or anaerobic conditions based on the requirements of the host cells. Exemplary culture conditions for a given filamentous fungus are known in the art and may be found in the scientific literature and/or from the source of the fungi such as the American Type Culture Collection and Fungal Genetics Stock Center.
(224) In various embodiments, the cells are grown using any known mode of fermentation, such as batch, fed-batch, or continuous processes. In some embodiments, a batch method of fermentation is used. Classical batch fermentation is a closed system where the composition of the media is set at the beginning of the fermentation and is not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the cell medium is inoculated with the desired host cells and fermentation is permitted to occur adding nothing to the system. Typically, however, batch fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems, the metabolite and biomass compositions of the system change constantly until the time the fermentation is stopped. Within batch cultures, cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. In some embodiments, cells in log phase are responsible for the bulk of the isoprene production. In some embodiments, cells in stationary phase produce isoprene.
(225) In some embodiments, a variation on the standard batch system is used, such as the Fed-Batch system. Fed-Batch fermentation processes comprise a typical batch system with the exception that the carbon source is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of carbon source in the cell medium. Fed-batch fermentations may be performed with the carbon source (e.g., glucose) in a limited or excess amount. Measurement of the actual carbon source concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen, and the partial pressure of waste gases such as CO.sub.2. Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Brock, Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., which is hereby incorporated by reference in its entirety, particularly with respect to cell culture and fermentation conditions.
(226) In some embodiments, continuous fermentation methods are used. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
(227) Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or isoprene production. For example, one method maintains a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allows all other parameters to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration (e.g., the concentration measured by media turbidity) is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, the cell loss due to media being drawn off is balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., which is hereby incorporated by reference in its entirety, particularly with respect to cell culture and fermentation conditions.
(228) In some embodiments, cells are immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for isoprene production.
(229) In some embodiments, bottles of liquid culture are placed in shakers in order to introduce oxygen to the liquid and maintain the uniformity of the culture. In some embodiments, an incubator is used to control the temperature, humidity, shake speed, and/or other conditions in which a culture is grown. The simplest incubators are insulated boxes with an adjustable heater, typically going up to 65 C. More elaborate incubators can also include the ability to lower the temperature (via refrigeration), or the ability to control humidity or CO.sub.2 levels. Most incubators include a timer; some can also be programmed to cycle through different temperatures, humidity levels, etc. Incubators can vary in size from tabletop to units the size of small rooms.
(230) If desired, a portion or all of the cell medium can be changed to replenish nutrients and/or avoid the build up of potentially harmful metabolic byproducts and dead cells. In the case of suspension cultures, cells can be separated from the media by centrifuging or filtering the suspension culture and then resuspending the cells in fresh media. In the case of adherent cultures, the media can be removed directly by aspiration and replaced. In some embodiments, the cell medium allows at least a portion of the cells to divide for at least or about 5, 10, 20, 40, 50, 60, 65, or more cell divisions in a continuous culture (such as a continuous culture without dilution).
(231) In some embodiments, a constitutive or leaky promoter (such as a Trc promoter) is used and a compound (such as IPTG) is not added to induce expression of the isoprene synthase, DXS, IDI, or MVA pathway nucleic acid(s) operably linked to the promoter. In some embodiments, a compound (such as IPTG) is added to induce expression of the isoprene synthase, DXS, IDI, or MVA pathway nucleic acid(s) operably linked to the promoter.
(232) Exemplary Production of Isoprene
(233) In some embodiments, the cells are cultured in a culture medium under conditions permitting the production of isoprene by the cells. By peak absolute productivity is meant the maximum absolute amount of isoprene in the off-gas during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). By peak absolute productivity time point is meant the time point during a fermentation run when the absolute amount of isoprene in the off-gas is at a maximum during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). In some embodiments, the isoprene amount is measured at the peak absolute productivity time point. In some embodiments, the peak absolute productivity for the cells is about any of the isoprene amounts disclosed herein.
(234) By peak specific productivity is meant the maximum amount of isoprene produced per cell during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). By peak specific productivity time point is meant the time point during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run) when the amount of isoprene produced per cell is at a maximum. The peak specific productivity is determined by dividing the total productivity by the amount of cells, as determined by optical density at 600 nm (OD.sub.600). In some embodiments, the isoprene amount is measured at the peak specific productivity time point. In some embodiments, the peak specific productivity for the cells is about any of the isoprene amounts per cell disclosed herein.
(235) By peak volumetric productivity is meant the maximum amount of isoprene produced per volume of broth (including the volume of the cells and the cell medium) during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). By peak specific volumetric productivity time point is meant the time point during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run) when the amount of isoprene produced per volume of broth is at a maximum. The peak specific volumetric productivity is determined by dividing the total productivity by the volume of broth and amount of time. In some embodiments, the isoprene amount is measured at the peak specific volumetric productivity time point. In some embodiments, the peak specific volumetric productivity for the cells is about any of the isoprene amounts per volume per time disclosed herein.
(236) By peak concentration is meant the maximum amount of isoprene produced during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). By peak concentration time point is meant the time point during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run) when the amount of isoprene produced per cell is at a maximum. In some embodiments, the isoprene amount is measured at the peak concentration time point. In some embodiments, the peak concentration for the cells is about any of the isoprene amounts disclosed herein.
(237) By average volumetric productivity is meant the average amount of isoprene produced per volume of broth (including the volume of the cells and the cell medium) during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). The average volumetric productivity is determined by dividing the total productivity by the volume of broth and amount of time. In some embodiments, the average specific volumetric productivity for the cells is about any of the isoprene amounts per volume per time disclosed herein.
(238) By cumulative total productivity is meant the cumulative, total amount of isoprene produced during the culturing of cells for a particular period of time (e.g., the culturing of cells during a particular fermentation run). In some embodiments, the cumulative, total amount of isoprene is measured. In some embodiments, the cumulative total productivity for the cells is about any of the isoprene amounts disclosed herein.
(239) In some embodiments, the cells in culture produce isoprene at greater than or about 1, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 4,000, 5,000, 10,000, 12,500, 20,000, 30,000, 40,000, 50,000, 75,000, 100,000, 125,000, 150,000, 188,000, or more nmole of isoprene/gram of cells for the wet weight of the cells/hour (nmole/g.sub.wcm/hr). In some embodiments, the amount of isoprene is between about 2 to about 200,000 nmole/g.sub.wcm/hr, such as between about 2 to about 100 nmole/g.sub.wcm/hr, about 100 to about 500 nmole/g.sub.wcm/hr, about 150 to about 500 nmole/g.sub.wcm/hr, about 500 to about 1,000 nmole/g.sub.wcm/hr, about 1,000 to about 2,000 nmole/g.sub.wcm/hr, about 2,000 to about 5,000 nmole/g.sub.wcm/hr, about 5,000 to about 10,000 nmole/g.sub.wcm/hr, about 10,000 to about 50,000 nmole/g.sub.wcm/hr, about 50,000 to about 100,000 nmole/g.sub.wcm/hr, about 100,000 to about 150,000 nmole/g.sub.wcm/hr, or about 150,000 to about 200,000 nmole/g.sub.wcm/hr. In some embodiments, the amount of isoprene is between about 20 to about 200,000 nmole/g.sub.wcm/hr, about 100 to about 5,000 nmole/g.sub.wcm/hr, about 200 to about 2,000 nmole/g.sub.wcm/hr, about 200 to about 1,000 nmole/g.sub.wcm/hr, about 300 to about 1,000 nmole/g.sub.wcm/hr, about 400 to about 1,000 nmole/g.sub.wcm/hr, about 1,000 to about 5,000 nmole/g.sub.wcm/hr, about 2,000 to about 20,000 nmole/g.sub.wcm/hr, about 5,000 to about 50,000 nmole/g.sub.wcm/hr, about 10,000 to about 100,000 nmole/g.sub.wcm/hr, about 20,000 to about 150,000 nmole/g.sub.wcm/hr, or about 20,000 to about 200,000 nmole/g.sub.wcm/hr.
(240) The amount of isoprene in units of nmole/g.sub.wcm/hr can be measured as disclosed in U.S. Pat. No. 5,849,970, which is hereby incorporated by reference in its entirety, particularly with respect to the measurement of isoprene production. For example, two mL of headspace (e.g., headspace from a culture such as 2 mL of culture cultured in sealed vials at 32 0 C with shaking at 200 rpm for approximately 3 hours) are analyzed for isoprene using a standard gas chromatography system, such as a system operated isothermally (85 0 C) with an n-octane/porasil C column (Alltech Associates, Inc., Deerfield, Ill.) and coupled to a RGD2 mercuric oxide reduction gas detector (Trace Analytical, Menlo Park, Calif.) (see, for example, Greenberg et al, Atmos. Environ. 27A: 2689-2692, 1993; Silver et al., Plant Physiol. 97:1588-1591, 1991, which are each hereby incorporated by reference in their entireties, particularly with respect to the measurement of isoprene production). The gas chromatography area units are converted to nmol isoprene via a standard isoprene concentration calibration curve. In some embodiments, the value for the grams of cells for the wet weight of the cells is calculated by obtaining the A.sub.600 value for a sample of the cell culture, and then converting the A.sub.600 value to grams of cells based on a calibration curve of wet weights for cell cultures with a known A.sub.600 value. In some embodiments, the grams of the cells is estimated by assuming that one liter of broth (including cell medium and cells) with an A.sub.600 value of 1 has a wet cell weight of 1 gram. The value is also divided by the number of hours the culture has been incubating for, such as three hours.
(241) In some embodiments, the cells in culture produce isoprene at greater than or about 1, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 4,000, 5,000, 10,000, 100,000, or more ng of isoprene/gram of cells for the wet weight of the cells/hr (ng/g.sub.wcm/h). In some embodiments, the amount of isoprene is between about 2 to about 5,000 ng/g.sub.wcm/h, such as between about 2 to about 100 ng/g.sub.wcm/h, about 100 to about 500 ng/g.sub.wcm/h, about 500 to about 1,000 ng/g.sub.wcm/h, about 1,000 to about 2,000 ng/g.sub.wcm/h, or about 2,000 to about 5,000 ng/g.sub.wcm/h. In some embodiments, the amount of isoprene is between about 20 to about 5,000 ng/g.sub.wcm/h, about 100 to about 5,000 ng/g.sub.wcm/h, about 200 to about 2,000 ng/g.sub.wcm/h, about 200 to about 1,000 ng/g.sub.wcm/h, about 300 to about 1,000 ng/g.sub.wcm/h, or about 400 to about 1,000 ng/g.sub.wcm/h. The amount of isoprene in ng/g.sub.wcm/h can be calculated by multiplying the value for isoprene production in the units of nmole/g.sub.wcm/hr discussed above by 68.1 (as described in Equation 5 below).
(242) In some embodiments, the cells in culture produce a cumulative titer (total amount) of isoprene at greater than or about 1, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 4,000, 5,000, 10,000, 50,000, 100,000, or more mg of isoprene/L of broth (mg/L.sub.broth, wherein the volume of broth includes the volume of the cells and the cell medium). In some embodiments, the amount of isoprene is between about 2 to about 5,000 mg/L.sub.broth, such as between about 2 to about 100 mg/L.sub.broth, about 100 to about 500 mg/L.sub.broth, about 500 to about 1,000 mg/L.sub.broth, about 1,000 to about 2,000 mg/L.sub.broth, or about 2,000 to about 5,000 mg/L.sub.broth. In some embodiments, the amount of isoprene is between about 20 to about 5,000 mg/L.sub.broth, about 100 to about 5,000 mg/L.sub.broth, about 200 to about 2,000 mg/L.sub.broth, about 200 to about 1,000 mg/L.sub.broth, about 300 to about 1,000 mg/L.sub.broth, or about 400 to about 1,000 mg/L.sub.broth.
(243) The specific productivity of isoprene in mg of isoprene/L of headspace from shake flask or similar cultures can be measured by taking a 1 ml sample from the cell culture at an OD.sub.600 value of approximately 1.0, putting it in a 20 mL vial, incubating for 30 minutes, and then measuring the amount of isoprene in the headspace (as described, for example, in Example I, part II). If the OD.sub.600 value is not 1.0, then the measurement can be normalized to an OD.sub.600 value of 1.0 by dividing by the OD.sub.600 value. The value of mg isoprene/L headspace can be converted to mg/L.sub.broth/hr/OD.sub.600 of culture broth by multiplying by a factor of 38. The value in units of mg/L.sub.broth/hr/OD.sub.600 can be multiplied by the number of hours and the OD.sub.600 value to obtain the cumulative titer in units of mg of isoprene/L of broth.
(244) In some embodiments, the cells in culture have an average volumetric productivity of isoprene at greater than or about 0.1, 1.0, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1100, 1200, 1300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, 2,900, 3,000, 3,100, 3,200, 3,300, 3,400, 3,500, or more mg of isoprene/L of broth/hr (mg/L.sub.broth/hr, wherein the volume of broth includes the volume of the cells and the cell medium). In some embodiments, the average volumetric productivity of isoprene is between about 0.1 to about 3,500 mg/L.sub.broth/hr, such as between about 0.1 to about 100 mg/L.sub.broth/hr, about 100 to about 500 mg/L.sub.broth/hr, about 500 to about 1,000 mg/L.sub.broth/hr, about 1,000 to about 1,500 mg/L.sub.broth/hr, about 1,500 to about 2,000 mg/L.sub.broth/hr, about 2,000 to about 2,500 mg/L.sub.broth/hr, about 2,500 to about 3,000 mg/L.sub.broth/hr, or about 3,000 to about 3,500 mg/L.sub.broth/hr. In some embodiments, the average volumetric productivity of isoprene is between about 10 to about 3,500 mg/L.sub.broth/hr, about 100 to about 3,500 mg/L.sub.broth/hr, about 200 to about 1,000 mg/L.sub.broth/hr, about 200 to about 1,500 mg/L.sub.broth/hr, about 1,000 to about 3,000 mg/L.sub.broth/hr, or about 1,500 to about 3,000 mg/L.sub.broth/hr.
(245) In some embodiments, the cells in culture have a peak volumetric productivity of isoprene at greater than or about 0.5, 1.0, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1100, 1200, 1300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, 2,900, 3,000, 3,100, 3,200, 3,300, 3,400, 3,500, 3,750, 4,000, 4,250, 4,500, 4,750, 5,000, 5,250, 5,500, 5,750, 6,000, 6,250, 6,500, 6,750, 7,000, 7,250, 7,500, 7,750, 8,000, 8,250, 8,500, 8,750, 9,000, 9,250, 9,500, 9,750, 10,000, 12,500, 15,000, or more mg of isoprene/L of broth/hr (mg/L.sub.broth/hr, wherein the volume of broth includes the volume of the cells and the cell medium). In some embodiments, the peak volumetric productivity of isoprene is between about 0.5 to about 15,000 mg/L.sub.broth/hr, such as between about 0.5 to about 10 mg/L.sub.broth/hr, about 1.0 to about 100 mg/L.sub.broth/hr, about 100 to about 500 mg/L.sub.broth/hr, about 500 to about 1,000 mg/L.sub.broth/hr, about 1,000 to about 1,500 mg/L.sub.broth/hr, about 1,500 to about 2,000 mg/L.sub.broth/hr, about 2,000 to about 2,500 mg/L.sub.broth/hr, about 2,500 to about 3,000 mg/L.sub.broth/hr, about 3,000 to about 3,500 mg/L.sub.broth/hr, about 3,500 to about 5,000 mg/L.sub.broth/hr, about 5,000 to about 7,500 mg/L.sub.broth/hr, about 7,500 to about 10,000 mg/L.sub.broth/hr, about 10,000 to about 12,500 mg/L.sub.broth/h, or about 12,500 to about 15,000 mg/L.sub.broth/hr. In some embodiments, the peak volumetric productivity of isoprene is between about 10 to about 15,000 mg/L.sub.broth/hr, about 100 to about 2,500 mg/L.sub.broth/hr, about 1,000 to about 5,000 mg/L.sub.broth/hr, about 2,500 to about 7,500 mg/L.sub.broth/hr, about 5,000 to about 10,000 mg/L.sub.broth/hr, about 7,500 to about 12,500 mg/L.sub.broth/hr, or about 10,000 to about 15,000 mg/L.sub.broth/hr.
(246) The instantaneous isoprene production rate in mg/L.sub.broth/hr in a fermentor can be measured by taking a sample of the fermentor off-gas, analyzing it for the amount of isoprene (in units such as mg of isoprene per L.sub.gas) as described, for example, in Example I, part II and multiplying this value by the rate at which off-gas is passed though each liter of broth (e.g., at 1 vvm (volume of air/volume of broth/minute) this is 60 L.sub.gas per hour). Thus, an off-gas level of 1 mg/L.sub.gas corresponds to an instantaneous production rate of 60 mg/L.sub.broth/hr at air flow of 1 vvm. If desired, the value in the units mg/L.sub.broth/hr can be divided by the OD.sub.600 value to obtain the specific rate in units of mg/L.sub.broth/hr/OD. The average value of mg isoprene/L.sub.gas can be converted to the total product productivity (grams of isoprene per liter of fermentation broth, mg/L.sub.broth) by multiplying this average off-gas isoprene concentration by the total amount of off-gas sparged per liter of fermentation broth during the fermentation. Thus, an average off-gas isoprene concentration of 0.5 mg/L.sub.broth/hr over 10 hours at 1 vvm corresponds to a total product concentration of 300 mg isoprene/L.sub.broth.
(247) In some embodiments, the cells in culture convert greater than or about 0.0015, 0.002, 0.005, 0.01, 0.02, 0.05, 0.1, 0.12, 0.14, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.4, 1.6, 2.0, 2.2, 2.4, 2.6, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 23.2, 23.4, 23.6, 23.8, 24.0, 25.0, 30.0, 31.0, 32.0, 33.0, 35.0, 37.5, 40.0, 45.0, 47.5, 50.0, 55.0, 60.0, 65.0, 70.0, 75.0, 80.0, 85.0, or 90.0 molar % of the carbon in the cell culture medium into isoprene. In some embodiments, the percent conversion of carbon into isoprene is between about 0.002 to about 90.0 molar %, such as about 0.002 to about 0.005%, about 0.005 to about 0.01%, about 0.01 to about 0.05%, about 0.05 to about 0.15%, 0.15 to about 0.2%, about 0.2 to about 0.3%, about 0.3 to about 0.5%, about 0.5 to about 0.8%, about 0.8 to about 1.0%, about 1.0 to about 1.6%, about 1.6 to about 3.0%, about 3.0 to about 5.0%, about 5.0 to about 8.0%, about 8.0 to about 10.0%, about 10.0 to about 15.0%, about 15.0 to about 20.0%, about 20.0 to about 25.0%, about 25.0% to 30.0%, about 30.0% to 35.0%, about 35.0% to 40.0%, about 45.0% to 50.0%, about 50.0% to 55.0%, about 55.0% to 60.0%, about 60.0% to 65.0%, about 65.0% to 70.0%, about 75.0% to 80.0%, about 80.0% to 85.0%, or about 85.0% to 90.0%. In some embodiments, the percent conversion of carbon into isoprene is between about 0.002 to about 0.4 molar %, 0.002 to about 0.16 molar %, 0.04 to about 0.16 molar %, about 0.005 to about 0.3 molar %, about 0.01 to about 0.3 molar %, about 0.05 to about 0.3 molar %, about 0.1 to 0.3 molar %, about 0.3 to about 1.0 molar %, about 1.0 to about 5.0 molar %, about 2 to about 5.0 molar %, about 5.0 to about 10.0 molar %, about 7 to about 10.0 molar %, about 10.0 to about 20.0 molar %, about 12 to about 20.0 molar %, about 16 to about 20.0 molar %, about 18 to about 20.0 molar %, about 18 to 23.2 molar %, about 18 to 23.6 molar %, about 18 to about 23.8 molar %, about 18 to about 24.0 molar %, about 18 to about 25.0 molar %, about 20 to about 30.0 molar %, about 30 to about 40.0 molar %, about 30 to about 50.0 molar %, about 30 to about 60.0 molar %, about 30 to about 70.0 molar %, about 30 to about 80.0 molar %, or about 30 to about 90.0 molar %
(248) The percent conversion of carbon into isoprene (also referred to as % carbon yield) can be measured by dividing the moles carbon in the isoprene produced by the moles carbon in the carbon source (such as the moles of carbon in batched and fed glucose and yeast extract). This number is multiplied by 100% to give a percentage value (as indicated in Equation 1).
% Carbon Yield=(moles carbon in isoprene produced)/(moles carbon in carbon source)*100Equation 1
(249) For this calculation, yeast extract can be assumed to contain 50% w/w carbon. As an example, for the 500 liter described in Example 7, part VIII, the percent conversion of carbon into isoprene can be calculated as shown in Equation 2.
% Carbon Yield=(39.1 g isoprene*1/68.1 mol/g*5 C/mol)/[(181221 g glucose*1/180 mol/g*6 C/mol)+(17780 g yeast extract*0.5*1/12 mol/g)]*100=0.042%Equation 2
(250) For the two 500 liter fermentations described herein (Example 7, parts VII and VIII), the percent conversion of carbon into isoprene was between 0.04-0.06%. A 0.11-0.16% carbon yield has been achieved using 14 liter systems as described herein.
(251) One skilled in the art can readily convert the rates of isoprene production or amount of isoprene produced into any other units. Exemplary equations are listed below for interconverting between units.
(252) Units for Rate of Isoprene Production (Total and Specific)
1 g isoprene/L.sub.broth/hr=14.7 mmol isoprene/L.sub.broth/hr(total volumetric rate)Equation 3
1 nmol isoprene/g.sub.wcm/hr=1 nmol isoprene/L.sub.broth/hr/OD.sub.600 (This conversion assumes that one liter of broth with an OD.sub.600 value of 1 has a wet cell weight of 1 gram.)Equation 4
1 nmol isoprene/g.sub.wcm/hr=68.1 ng isoprene/g.sub.wcm/hr(given the molecular weight of isoprene)Equation 5
1 nmol isoprene/L.sub.gas O.sub.2/hr=90 nmol isoprene/L.sub.broth/hr(at an O.sub.2 flow rate of 90 L/hr per L of culture broth)Equation 6
1 ug isoprene/L.sub.gas isoprene in off-gas=60 ug isoprene/L.sub.broth/hr at a flow rate of 60 L.sub.gas per L.sub.broth (1 vvm)Equation 7
Units for Titer (Total and Specific)
1 nmol isoprene/mg cell protein=150 nmol isoprene/L.sub.broth/OD.sub.600 (This conversion assumes that one liter of broth with an OD.sub.600 value of 1 has a total cell protein of approximately 150 mg) (specific productivity)Equation 8
1 g isoprene/L.sub.broth=14.7 mmol isoprene/L.sub.broth (total titer)Equation 9
(253) If desired, Equation 10 can be used to convert any of the units that include the wet weight of the cells into the corresponding units that include the dry weight of the cells.
Dry weight of cells=(wet weight of cells)/3.3Equation 10
(254) In some embodiments encompassed by the invention, a cell comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide produces an amount of isoprene that is at least or about 2-fold, 3-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 150-fold, 200-fold, 400-fold, or greater than the amount of isoprene produced from a corresponding cell grown under essentially the same conditions without the heterologous nucleic acid encoding the isoprene synthase polypeptide.
(255) In some embodiments encompassed by the invention, a cell comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide and one or more heterologous nucleic acids encoding a DXS, IDI, and/or MVA pathway polypeptide produces an amount of isoprene that is at least or about 2-fold, 3-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 150-fold, 200-fold, 400-fold, or greater than the amount of isoprene produced from a corresponding cell grown under essentially the same conditions without the heterologous nucleic acids.
(256) Exemplary Isoprene Purification Methods
(257) In some embodiments, any of the methods described herein further include recovering the isoprene. For example, the isoprene produced using the compositions and methods of the invention can be recovered using standard techniques. such as gas stripping, fractionation, adsorption/desorption, pervaporation, thermal or vacuum desorption of isoprene from a solid phase, or extraction of isoprene immobilized or absorbed to a solid phase with a solvent (see, for example, U.S. Pat. Nos. 4,703,007 and 4,570,029, which are each hereby incorporated by reference in their entireties, particularly with respect to isoprene recovery and purification methods). In some embodiments, the recovery of isoprene involves the isolation of isoprene in a liquid form (such as a neat solution of isoprene or a solution of isoprene in a solvent). Gas stripping involves the removal of isoprene vapor from the fermentation off-gas stream in a continuous manner. Such removal can be achieved in several different ways including, but not limited to, adsorption to a solid phase, partition into a liquid phase, or direct condensation. In some embodiments, membrane enrichment of a dilute isoprene vapor stream above the dew point of the vapor resulting in the condensation of liquid isoprene.
(258) The recovery of isoprene may involve one step or multiple steps. In some embodiments, the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed simultaneously. For example, isoprene can be directly condensed from the off-gas stream to form a liquid. In some embodiments, the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed sequentially. For example, isoprene may be adsorbed to a solid phase and then extracted from the solid phase with a solvent.
(259) In some embodiments, any of the methods described herein further include purifying the isoprene. For example, the isoprene produced using the compositions and methods of the invention can be purified using standard techniques. Purification refers to a process through which isoprene is separated from one or more components that are present when the isoprene is produced. In some embodiments, the isoprene is obtained as a substantially pure liquid. Examples of purification methods include (i) distillation from a solution in a liquid extractant and (ii) chromatography. As used herein, purified isoprene means isoprene that has been separated from one or more components that are present when the isoprene is produced. In some embodiments, the isoprene is at least about 20%, by weight, free from other components that are present when the isoprene is produced. In various embodiments, the isoprene is at least or about 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, or 99%, by weight, pure. Purity can be assayed by any appropriate method, e.g., by column chromatography, HPLC analysis, or GC-MS analysis.
(260) In some embodiments, any of the methods described herein further include polymerizing the isoprene. For example, standard methods can be used to polymerize the purified isoprene to form cis-polyisoprene or other down stream products using standard methods.
(261) Additional methods and compositions are described in U.S. Provisional patent application No. 61/097,186, filed on Sep. 15, 2008, U.S. Provisional patent application No. 61/097,189, filed on Sep. 15, 2008, and U.S. Provisional patent application No. 61/097,163, filed on Sep. 15, 2008, all of which are incorporated by reference in their entireties, particular with respect to compositions and methods for producing isoprene.
EXAMPLES
(262) The examples, which are intended to be purely exemplary of the invention and should therefore not be considered to limit the invention in any way, also describe and detail aspects and embodiments of the invention discussed above. Unless indicated otherwise, temperature is in degrees Centigrade and pressure is at or near atmospheric. The foregoing examples and detailed description are offered by way of illustration and not by way of limitation. All publications, patent applications, and patents cited in this specification are herein incorporated by reference as if each individual publication, patent application, or patent were specifically and individually indicated to be incorporated by reference. In particular, all publications cited herein are expressly incorporated herein by reference for the purpose of describing and disclosing compositions and methodologies which might be used in connection with the invention. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
Example 1: Production of Isoprene in E. coli Expressing Recombinant Kudzu Isoprene Synthase
(263) I. Construction of Vectors for Expression of the Kudzu Isoprene Synthase in E. coli
(264) The protein sequence for the kudzu (Pueraria montana) isoprene synthase gene (IspS) was obtained from GenBank (AAQ84170). A kudzu isoprene synthase gene, optimized for E. coli codon usage, was purchased from DNA2.0 (SEQ ID NO: 1). The isoprene synthase gene was removed from the supplied plasmid by restriction endonuclease digestion with BspLU11I/PstI, gel-purified, and ligated into pTrcHis2B (Invitrogen) that had been digested with NcoI/PstI. The construct was designed such that the stop codon in the isoprene synthase gene 5 to the PstI site. As a result, when the construct was expressed the His-Tag is not attached to the isoprene synthase protein. The resulting plasmid, pTrcKudzu, was verified by sequencing (
(265) The isoprene synthase gene was also cloned into pET16b (Novagen). In this case, the isoprene synthase gene was inserted into pET16b such that the recombinant isoprene synthase protein contained the N-terminal His tag. The isoprene synthase gene was amplified from pTrcKudzu by PCR using the primer set pET-His-Kudzu-2F: 5-CGTGAGATCATATGTGTGCGACCTCTTCTCAATTTAC (SEQ ID NO:3) and pET-His-Kudzu-R: 5-CGGTCGACGGATCCCTGCAGTTAGACATACATCAGCTG (SEQ ID NO:4). These primers added an NdeI site at the 5-end and a BamH1 site at the 3 end of the gene respectively. The plasmid pTrcKudzu, described above, was used as template DNA, Herculase polymerase (Stratagene) was used according to manufacture's directions, and primers were added at a concentration of 10 pMols. The PCR was carried out in a total volume of 25 al. The PCR product was digested with NdeI/BamH1 and cloned into pET16b digested with the same enzymes. The ligation mix was transformed into E. coli Top10 (Invitrogen) and the correct clone selected by sequencing. The resulting plasmid, in which the kudzu isoprene synthase gene was expressed from the T7 promoter, was designated pETNHisKudzu (
(266) The kudzu isoprene synthase gene was also cloned into the low copy number plasmid pCL1920. Primers were used to amplify the kudzu isoprene synthase gene from pTrcKudzu described above. The forward primer added a HindIII site and an E. coli consensus RBS to the 5 end. The PstI cloning site was already present in pTrcKudzu just 3 of the stop codon so the reverse primer was constructed such that the final PCR product includes the PstI site. The sequences of the primers were: HindIII-rbs-Kudzu F: 5-CATATGAAAGCTTGTATCGATTAAATAAGGAGGAATAAACC (SEQ ID NO:6) and BamH1-Kudzu R:
(267) 5-CGGTCGACGGATCCCTGCAGTTAGACATACATCAGCTG (SEQ ID NO:4). The PCR product was amplified using Herculase polymerase with primers at a concentration of 10 pmol and with 1 ng of template DNA (pTrcKudzu). The amplification protocol included 30 cycles of (95 C. for 1 minute, 60 C. for 1 minute, 72 C. for 2 minutes). The product was digested with HindIII and PstI and ligated into pCL1920 which had also been digested with HindIII and PstI. The ligation mix was transformed into E. coli Top10. Several transformants were checked by sequencing. The resulting plasmid was designated pCL-lac-Kudzu (
(268) II. Determination of Isoprene Production
(269) For the shake flask cultures, one ml of a culture was transferred from shake flasks to 20 ml CTC headspace vials (Agilent vial cat#5188 2753; cap cat#5188 2759). The cap was screwed on tightly and the vials incubated at the equivalent temperature with shaking at 250 rpm. After 30 minutes the vials were removed from the incubator and analyzed as described below (see Table 1 for some experimental values from this assay).
(270) In cases where isoprene production in fermentors was determined, samples were taken from the off-gas of the fermentor and analyzed directly as described below (see Table 2 for some experimental values from this assay).
(271) The analysis was performed using an Agilent 6890 GC/MS system interfaced with a CTC Analytics (Switzerland) CombiPAL autosampler operating in headspace mode. An Agilent HP-5MS GC/MS column (30 m0.25 mm; 0.25 m film thickness) was used for separation of analytes. The sampler was set up to inject 500 L of headspace gas. The GC/MS method utilized helium as the carrier gas at a flow of 1 ml/minutes The injection port was held at 250 C. with a split ratio of 50:1. The oven temperature was held at 37 C. for the 2 minute duration of the analysis. The Agilent 5793N mass selective detector was run in single ion monitoring (SIM) mode on m/z 67. The detector was switched off from 1.4 to 1.7 minutes to allow the elution of permanent gases. Under these conditions isoprene (2-methyl-1,3-butadiene) was observed to elute at 1.78 minutes. A calibration table was used to quantify the absolute amount of isoprene and was found to be linear from 1 g/L to 200 g/L. The limit of detection was estimated to be 50 to 100 ng/L using this method.
(272) III. Production of Isoprene in Shake Flasks Containing E. coli Cells Expressing Recombinant Isoprene Synthase
(273) The vectors described above were introduced to E. coli strain BL21 (Novagen) to produce strains BL21/ptrcKudzu, BL21/pCL-lac-Kudzu and BL21/pETHisKudzu. The strains were spread for isolation onto LA (Luria agar) and carbenicillin (50 g/ml) and incubated overnight at 37 C. Single colonies were inoculated into 250 ml baffled shake flasks containing 20 ml Luria Bertani broth (LB) and carbenicillin (100 g/ml). Cultures were grown overnight at 20 C. with shaking at 200 rpm. The OD.sub.600 of the overnight cultures were measured and the cultures were diluted into a 250 ml baffled shake flask containing 30 ml MagicMedia (Invitrogen) and carbenicillin (100 g/ml) to an OD.sub.6000.05. The culture was incubated at 30 C. with shaking at 200 rpm. When the OD.sub.6000.5-0.8, 400 M IPTG was added and the cells were incubated for a further 6 hours at 30 C. with shaking at 200 rpm. At 0, 2, 4 and 6 hours after induction with IPTG, 1 ml aliquots of the cultures were collected, the OD.sub.600 was determined and the amount of isoprene produced was measured as described above. Results are shown in
(274) IV. Production of Isoprene from BL21/ptrcKudzu in 14 Liter Fermentation
(275) Large scale production of isoprene from E. coli containing the recombinant kudzu isoprene synthase gene was determined from a fed-batch culture. The recipe for the fermentation media (TM2) per liter of fermentation medium was as follows: K.sub.2HPO.sub.4 13.6 g, KH.sub.2PO.sub.4 13.6 g, MgSO4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, (NH.sub.4).sub.2SO.sub.4 3.2 g, yeast extract 5 g, 1000 Modified Trace Metal Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. The pH was adjusted to 6.8 with potassium hydroxide (KOH) and q.s. to volume. The final product was filter sterilized with 0.22 filter (only, do not autoclave). The recipe for 1000 Modified Trace Metal Solution was as follows: Citric Acids*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g, CoCl.sub.2*6H.sub.2O 1 g, ZnSO*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component was dissolved one at a time in diH.sub.2O, pH to 3.0 with HCl/NaOH, then q.s. to volume and filter sterilized with a 0.22 filter.
(276) This experiment was carried out in 14 L bioreactor to monitor isoprene formation from glucose at the desired fermentation, pH 6.7 and temperature 34 C. An inoculum of E. coli strain BL21/ptrcKudzu taken from a frozen vial was prepared in soytone-yeast extract-glucose medium. After the inoculum grew to OD.sub.550=0.6, two 600 ml flasks were centrifuged and the contents resuspended in 70 ml supernatant to transfer the cell pellet (70 ml of OD 3.1 material) to the bioreactor. At various times after inoculation, samples were removed and the amount of isoprene produced was determined as described above. Results are shown in
Example 2: Production of Isoprene in E. coli Expressing Recombinant Poplar Isoprene Synthase
(277) The protein sequence for the poplar (Populus albaPopulus tremula) isoprene synthase (Schnitzler, J-P, et al. (2005) Planta 222:777-786) was obtained from GenBank (CAC35696). A gene, codon optimized for E. coli, was purchased from DNA2.0 (p9796-poplar,
Example 3: Production of Isoprene in Panteoa citrea Expressing Recombinant Kudzu Isoprene Synthase
(278) The pTrcKudzu and pCL-lac Kudzu plasmids described in Example 1 were electroporated into P. citrea (U.S. Pat. No. 7,241,587). Transformants were selected on LA containing carbenicillin (200 g/ml) or spectinomycin (50 g/ml) respectively. Production of isoprene from shake flasks and determination of the amount of isoprene produced was performed as described in Example 1 for E. coli strains expressing recombinant kudzu isoprene synthase. Results are shown in
Example 4: Production of Isoprene in Bacillus subtilis Expressing Recombinant Kudzu Isoprene Synthase
(279) I. Construction of a B. subtilis Replicating Plasmid for the Expression of Kudzu Isoprene Synthase
(280) The kudzu isoprene synthase gene was expressed in Bacillus subtilis aprEnprE Pxyl-comK strain (BG3594comK) using a replicating plasmid (pBS19 with a chloramphenicol resistance cassette) under control of the aprE promoter. The isoprene synthase gene, the aprE promoter and the transcription terminator were amplified separately and fused using PCR. The construct was then cloned into pBS19 and transformed into B. subtilis.
(281) a) Amplification of the aprE Promoter
(282) The aprE promoter was amplified from chromosomal DNA from Bacillus subtilis using the following primers:
(283) TABLE-US-00003 CF797(+)StartaprEpromoterMfeI (SEQIDNO:58) 5-GACATCAATTGCTCCATTTTCTTCTGCTATC CF07-43(-)FuseaprEpromotertoKudzuispS (SEQIDNO:59) 5-ATTGAGAAGAGGTCGCACACACTCTTTACCCTCTCCTTTTA
b) Amplification of the Isoprene Synthase Gene
(284) The kudzu isoprene synthase gene was amplified from plasmid pTrcKudzu (SEQ ID NO:2). The gene had been codon optimized for E. coli and synthesized by DNA 2.0. The following primers were used:
(285) TABLE-US-00004 CF07-42(+)FusetheaprEpromotertokudzu isoprenesynthasegene(GTGstartcodon) (SEQIDNO:60) 5-TAAAAGGAGAGGGTAAAGAGTGTGTGCGACCTCTTCTCAAT CF07-45(-)Fusethe3 endofkudzuisoprene synthasegenetotheterminator (SEQIDNO:61) 5-CCAAGGCCGGTTTTTTTTAGACATACATCAGCTGGTTAATC
c) Amplification of the Transcription Terminator
(286) The terminator from the alkaline serine protease of Bacillus amyliquefaciens was amplified from a previously sequenced plasmid pJHPms382 using the following primers:
(287) TABLE-US-00005 CF07-44(+)Fusethe3 endofkudzuisoprene synthasetotheterminator (SEQIDNO:62) 5-GATTAACCAGCTGATGTATGTCTAAAAAAAACCGGCCTTGG CF07-46(-)EndofB.amyliquefaciens terminator(BamHI) (SEQIDNO:63) 5-GACATGACGGATCCGATTACGAATGCCGTCTC
(288) The kudzu fragment was fused to the terminator fragment using PCR with the following primers:
(289) TABLE-US-00006 CF07-42(+)FusetheaprEpromotertokudzu isoprenesynthasegene(GTGstartcodon) (SEQIDNO:61) 5-TAAAAGGAGAGGGTAAAGAGTGTGTGCGACCTCTTCTCAAT CF07-46(-)EndofB.amyliquefaciens terminator(BamHI) (SEQIDNO:63) 5-GACATGACGGATCCGATTACGAATGCCGTCTC
(290) The kudzu-terminator fragment was fused to the promoter fragment using PCR with the following primers:
(291) TABLE-US-00007 CF797(+)StartaprEpromoterMfeI (SEQIDNO:64) 5-GACATCAATTGCTCCATTTTCTTCTGCTATC CF07-46(-)EndofB.amyliquefaciens terminator(BamHI) (SEQIDNO:63) 5-GACATGACGGATCCGATTACGAATGCCGTCTC
(292) The fusion PCR fragment was purified using a Qiagen kit and digested with the restriction enzymes MfeI and BamHI. This digested DNA fragment was gel purified using a Qiagen kit and ligated to a vector known as pBS19, which had been digested with EcoRI and BamHI and gel purified.
(293) The ligation mix was transformed into E. coli Top 10 cells and colonies were selected on LA and 50 carbenicillin plates. A total of six colonies were chosen and grown overnight in LB and 50 carbenicillin and then plasmids were isolated using a Qiagen kit. The plasmids were digested with EcoRI and BamHI to check for inserts and three of the correct plasmids were sent in for sequencing with the following primers:
(294) TABLE-US-00008 CF149(+)EcoRIstartofaprEpromoter (SEQIDNO:65) 5-GACATGAATTCCTCCATTTTCTTCTGC CF847(+)SequenceinpXX049(endofaprE promoter) (SEQIDNO:66) 5-AGGAGAGGGTAAAGAGTGAG CF07-45(-)Fusethe3 endofkudzuisoprene synthasetotheterminator (SEQIDNO:61) 5-CCAAGGCCGGTTTTTTTTAGACATACATCAGCTGGTTAATC CF07-48(+)Sequencingprimerforkudzu isoprenesynthase (SEQIDNO:67) 5-CTTTTCCATCACCCACCTGAAG CF07-49(+)Sequencinginkudzuisoprene synthase (SEQIDNO:68) 5-GGCGAAATGGTCCAACAACAAAATTATC
(295) The plasmid designated pBS Kudzu #2 (
(296) II. Production of Isoprene in Shake Flasks Containing B. subtilis Cells Expressing Recombinant Isoprene Synthase
(297) Overnight cultures were inoculated with a single colony of CF 443 from a LA and Chloramphenicol (Cm, 25 jag/ml). Cultures were grown in LB and Cm at 37 C. with shaking at 200 rpm. These overnight cultures (1 ml) were used to inoculate 250 ml baffled shake flasks containing 25 ml Grants II media and chloramphenicol at a final concentration of 25 jag/ml. Grants II Media recipe was 10 g soytone, 3 ml 1M K.sub.2HPO.sub.4, 75 g glucose, 3.6 g urea, 100 ml 10MOPS, q.s. to 1 L with H.sub.2O, pH 7.2; 10MOPS recipe was 83.72 g MOPS, 7.17 g tricine, 12 g KOH pellets, 10 ml 0.276M K.sub.2SO.sub.4 solution, 10 ml 0.528M MgCl.sub.2 solution, 29.22 g NaCl, 100 ml 100 micronutrients, q.s. to 1 L with H.sub.2O; and 100 micronutrients recipe was 1.47 g CaCl.sub.2*2H.sub.2O, 0.4 g FeSO.sub.4*7H.sub.2O, 0.1 g MnSO.sub.4*H.sub.2O, 0.1 g ZnSO.sub.4*H.sub.2O, 0.05 g CuCl.sub.2*2H.sub.2O, 0.1 g CoCl.sub.2*6H.sub.2O, 0.1 g Na.sub.2MoO.sub.4*2H.sub.2O, q.s. to 1 L with H.sub.2O. Shake flasks were incubated at 37 C. and samples were taken at 18, 24, and 44 hours. At 18 hours the headspaces of CF443 and the control strain were sampled. This represented 18 hours of accumulation of isoprene. The amount of isoprene was determined by gas chromatography as described in Example 1. Production of isoprene was enhanced significantly by expressing recombinant isoprene synthase (
(298) III. Production of Isoprene by CF443 in 14 L Fermentation
(299) Large scale production of isoprene from B. subtilis containing the recombinant kudzu isoprene synthase gene on a replication plasmid was determined from a fed-batch culture. Bacillus strain CF 443, expressing a kudzu isoprene synthase gene, or control stain which does not express a kudzu isoprene synthase gene were cultivated by conventional fed-batch fermentation in a nutrient medium containing soy meal (Cargill), sodium and potassium phosphate, magnesium sulfate and a solution of citric acid, ferric chloride and manganese chloride. Prior to fermentation the media is macerated for 90 minutes using a mixture of enzymes including cellulases, hemicellulases and pectinases (see, WO95/04134). 14-L batch fermentations are fed with 60% wt/wt glucose (Cargill DE99 dextrose, ADM Versadex greens or Danisco invert sugar) and 99% wt/wt oil (Western Family soy oil, where the 99% wt/wt is the concentration of oil before it was added to the cell culture medium). Feed was started when glucose in the batch was non-detectable. The feed rate was ramped over several hours and was adjusted to add oil on an equal carbon basis. The pH was controlled at 6.8-7.4 using 28% w/v ammonium hydroxide. In case of foaming, antifoam agent was added to the media. The fermentation temperature was controlled at 37 C. and the fermentation culture was agitated at 750 rpm. Various other parameters such as pH, DO %, airflow, and pressure were monitored throughout the entire process. The DO % is maintained above 20. Samples were taken over the time course of 36 hours and analyzed for cell growth (OD.sub.550) and isoprene production. Results of these experiments are presented in
(300) IV. Integration of the Kudzu Isoprene Synthase (ispS) in B. subtilis.
(301) The kudzu isoprene synthase gene was cloned in an integrating plasmid (pJH101-cmpR) under the control of the aprE promoter. Under the conditions tested, no isoprene was detected.
Example 5: Production of Isoprene in Trichoderma
(302) I. Construction of Vectors for Expression of the Kudzu Isoprene Synthase in Trichoderma reesei
(303) The Yarrowia lipolytica codon-optimized kudzu IS gene was synthesized by DNA 2.0 (SEQ ID NO:8) (
(304) The PCR product was then cloned using the TOPO pENTR/D-TOPO Cloning Kit following manufacturer's protocol: 1 l PCR reaction, 1 l Salt solution, 1 l TOPO pENTR/D-TOPO vector and 3 l water in a total reaction volume of 6 al. The reaction was incubated at room temperature for 5 minutes. One microliter of TOPO reaction was transformed into TOP 10 chemically competent E. coli cells. The transformants were selected on LA and 50 g/ml kanamycin plates. Several colonies were picked and each was inoculated into a 5 ml tube containing LB and 50 g/ml kanamycin and the cultures grown overnight at 37 C. with shaking at 200 rpm. Plasmids were isolated from the overnight culture tubes using QIAprep Spin Miniprep Kit, following manufacturer's protocol. Several plasmids were sequenced to verify that the DNA sequence was correct.
(305) A single pENTR/D-TOPO plasmid, encoding a Y. lipolytica codon-optimized kudzu isoprene synthase gene, was used for Gateway Cloning into a custom-made pTrex3g vector. Construction of pTrex3g is described in WO 2005/001036 A2. The reaction was performed following manufacturer's protocol for the Gateway LR Clonase II Enzyme Mix Kit (Invitrogen): 1 l Y. lipolytica codon-optimized kudzu isoprene synthase gene pENTR/D-TOPO donor vector, 1 l pTrex3g destination vector, 6 l TE buffer, pH 8.0 in a total reaction volume of 8 al. The reaction was incubated at room temperature for 1 hour and then 1 l proteinase K solution was added and the incubation continued at 37 C. for 10 minutes. Then 1 l of reaction was transformed into TOP10 chemically competent E. coli cells. The transformants were selected on LA and 50 g/ml carbenicillin plates. Several colonies were picked and each was inoculated into a 5 ml tube containing LB and 50 lg/ml carbenicillin and the cultures were grown overnight at 37 C. with shaking at 200 rpm. Plasmids were isolated from the overnight culture tubes using QIAprep Spin Miniprep Kit (Qiagen, Inc.), following manufacturer's protocol. Several plasmids were sequenced to verify that the DNA sequence was correct.
(306) Biolistic transformation of Y. lipolytica codon-optimized kudzu isoprene synthase pTrex3g plasmid (
(307) II. Production of Isoprene in Recombinant Strains of T. reesei
(308) One ml of 15 and 36 hour old cultures of isoprene synthase transformants described above were transferred to head space vials. The vials were sealed and incubated for 5 hours at 30 C. Head space gas was measured and isoprene was identified by the method described in Example 1. Two of the transformants showed traces of isoprene. The amount of isoprene could be increased by a 14 hour incubation. The two positive samples showed isoprene at levels of about 0.5 g/L for the 14 hour incubation. The untransformed control showed no detectable levels of isoprene. This experiment shows that T. reesei is capable of producing isoprene from endogenous precursor when supplied with an exogenous isoprene synthase.
Example 6: Production of Isoprene in Yarrowia
(309) I. Construction of Vectors for Expression of the Kudzu Isoprene Synthase in Yarrowia lipolytica.
(310) The starting point for the construction of vectors for the expression of the kudzu isoprene synthase gene in Yarrowia lipolytica was the vector pSPZ1(MAP29Spb). The complete sequence of this vector (SEQ ID No:11) is shown in
(311) The following fragments were amplified by PCR using chromosomal DNA of a Y. lipolytica strain GICC 120285 as the template: a promotorless form of the URA3 gene, a fragment of 18S ribosomal RNA gene, a transcription terminator of the Y. lipolytica XPR2 gene and two DNA fragments containing the promoters of XPR2 and ICL1 genes. The following PCR primers were used:
(312) TABLE-US-00009 ICL13 (SEQIDNO:69) 5-GGTGAATTCAGTCTACTGGGGATTCCCAAATCTATATATA CTGCAGGTGAC ICL15 (SEQIDNO:70) 5-GCAGGTGGGAAACTATGCACTCC XPR3 (SEQIDNO:71) 5-CCTGAATTCTGTTGGATTGGAGGATTGGATAGTGGG XPR5 (SEQIDNO:72) 5-GGTGTCGACGTACGGTCGAGCTTATTGACC XPRT3 (SEQIDNO:73) 5-GGTGGGCCCGCATTTTGCCACCTACAAGCCAG XPRT5 (SEQIDNO:74) 5-GGTGAATTCTAGAGGATCCCAACGCTGTTGCCTACAACGG Y18S3 (SEQIDNO:75) 5-GGTGCGGCCGCTGTCTGGACCTGGTGAGTTTCCCCG Y18S5 (SEQIDNO:76) 5-GGTGGGCCCATTAAATCAGTTATCGTTTATTTGATAG YURA3 (SEQIDNO:77) 5-GGTGACCAGCAAGTCCATGGGTGGTTTGATCATGG YURA50 (SEQIDNO:78) 5-GGTGCGGCCGCCTTTGGAGTACGACTCCAACTATG YURA51 (SEQIDNO:79) 5-GCGGCCGCAGACTAAATTTATTTCAGTCTCC
(313) For PCR amplification the PfuUltraII polymerase (Stratagene), supplier-provided buffer and dNTPs, 2.5 M primers and the indicated template DNA were used as per the manufacturer's instructions. The amplification was done using the following cycle: 95 C. for 1 min; 34 (95 C. for 30 sec; 55 C. for 30 sec; 72 C. for 3 min) and 10 min at 72 C. followed by a 4 C. incubation.
(314) Synthetic DNA molecules encoding the kudzu isoprene synthase gene, codon-optimized for expression in Yarrowia, was obtained from DNA 2.0 (
(315) A similar cloning procedure can be used to express a poplar (Populus albaPopulus tremula) isoprene synthase gene. The sequence of the poplar isoprene is described in Miller B. et al. (2001) Planta 213, 483-487 and shown in
(316) II. Production of Isoprene by Recombinant Strains of Y. lipolytica.
(317) Vectors pYLA(KZ1), pYLI(KZ1), pYLA(MAP29) and pYLI(MAP29) were digested with SacII and used to transform the strain Y. lipolytica CLIB 122 by a standard lithium acetate/polyethylene glycol procedure to uridine prototrophy. Briefly, the yeast cells grown in YEPD (1% yeast extract, 2% peptone, 2% glucose) overnight, were collected by centrifugation (4000 rpm, 10 min), washed once with sterile water and suspended in 0.1 M lithium acetate, pH 6.0. Two hundred l aliquots of the cell suspension were mixed with linearized plasmid DNA solution (10-20 g), incubated for 10 minutes at room temperature and mixed with 1 ml of 50% PEG 4000 in the same buffer. The suspensions were further incubated for 1 hour at room temperature followed by a 2 minutes heat shock at 42 C. Cells were then plated on SC his leu plates (0.67% yeast nitrogen base, 2% glucose, 100 mg/L each of leucine and histidine). Transformants appeared after 3-4 days of incubation at 30 C.
(318) Three isolates from the pYLA(KZ1) transformation, three isolates from the pYLI(KZ1) transformation, two isolates from the pYLA(MAP29) transformation and two isolates from the pYLI(MAP29) transformation were grown for 24 hours in YEP7 medium (1% yeast extract, 2% peptone, pH 7.0) at 30 C. with shaking. Cells from 10 ml of culture were collected by centrifugation, resuspended in 3 ml of fresh YEP7 and placed into 15 ml screw cap vials. The vials were incubated overnight at room temperature with gentle (60 rpm) shaking. Isoprene content in the headspace of these vials was analyzed by gas chromatography using mass-spectrometric detector as described in Example 1. All transformants obtained with pYLA(KZ1) and pYLI(KZ1) produced readily detectable amounts of isoprene (0.5 g/L to 1 g/L,
Example 7: Production of Isoprene in E. coli Expressing Kudzu Isoprene Synthase and idi, or dxs, or idi and dxs
(319) I. Construction of Vectors Encoding Kudzu Isoprene Synthase and idi, or dxs, or idi and dxs for the Production of Isoprene in E. coli
(320) i) Construction of pTrcKudzuKan
(321) The bla gene of pTrcKudzu (described in Example 1) was replaced with the gene conferring kanamycin resistance. To remove the bla gene, pTrcKudzu was digested with BspHI, treated with Shrimp Alkaline Phosphatase (SAP), heat killed at 65 C., then end-filled with Klenow fragment and dNTPs. The 5 kbp large fragment was purified from an agarose gel and ligated to the kan.sup.r gene which had been PCR amplified from pCR-Blunt-II-TOPO using primers MCM22 5-GATCAAGCTTAACCGGAATTGCCAGCTG (SEQ ID NO: 14) and MCM23 5-GATCCGATCGTCAGAAGAACTCGTCAAGAAGGC (SEQ ID NO:15), digested with HindIII and PvuI, and end-filled. A transformant carrying a plasmid conferring kanamycin resistance (pTrcKudzuKan) was selected on LA containing kanamycin 50 jag/ml.
(322) ii) Construction of pTrcKudzu yIDI Kan
(323) pTrcKudzuKan was digested with PstI, treated with SAP, heat killed and gel purified. It was ligated to a PCR product encoding idi from S. cerevisiae with a synthetic RBS. The primers for PCR were NsiI-YIDI 1 F 5-CATCAATGCATCGCCCTTAGGAGGTAAAAAAAAATGAC (SEQ ID NO: 16) and PstI-YIDI 1 R 5-CCTTCTGCAGGACGCGTTGTTATAGC (SEQ ID NO: 17); and the template was S. cerevisiae genomic DNA. The PCR product was digested with NsiI and PstI and gel purified prior to ligation. The ligation mixture was transformed into chemically competent TOP10 cells and selected on LA containing 50 g/ml kanamycin. Several transformants were isolated and sequenced and the resulting plasmid was called pTrcKudzu-yIDI(kan) (
(324) iii) Construction of pTrcKudzu DXS Kan
(325) Plasmid pTrcKudzuKan was digested with PstI, treated with SAP, heat killed and gel purified. It was ligated to a PCR product encoding dxs from E. coli with a synthetic RBS. The primers for PCR were MCM13 5-GATCATGCATTCGCCCTTAGGAGGTAAAAAAACATGAGTTTTGATATTGCCAAATACCC G (SEQ ID NO:18) and MCM14 5-CATGCTGCAGTTATGCCAGCCAGGCCTTGAT (SEQ ID NO: 19); and the template was E. coli genomic DNA. The PCR product was digested with NsiI and PstI and gel purified prior to ligation. The resulting transformation reaction was transformed into TOP 10 cells and selected on LA with kanamycin 50 g/ml. Several transformants were isolated and sequenced and the resulting plasmid was called pTrcKudzu-DXS(kan) (
(326) iv) Construction of pTrcKudzu-yIDI-dxs (kan)
(327) pTrcKudzu-yIDI(kan) was digested with PstI, treated with SAP, heat killed and gel purified. It was ligated to a PCR product encoding E. coli dxs with a synthetic RBS (primers MCM13 5-GATCATGCATTCGCCCTTAGGAGGTAAAAAAACATGAGTTTTGATATTGCCAAATACCC G (SEQ ID NO:18) and MCM14 5-CATGCTGCAGTTATGCCAGCCAGGCCTTGAT (SEQ ID NO: 19); template TOP10 cells) which had been digested with NsiI and PstI and gel purified. The final plasmid was called pTrcKudzu-yIDI-dxs (kan) (
(328) v) Construction of pCL PtrcKudzu
(329) A fragment of DNA containing the promoter, structural gene and terminator from Example 1 above was digested from pTrcKudzu using SspI and gel purified. It was ligated to pCL1920 which had been digested with PvuII, treated with SAP and heat killed. The resulting ligation mixture was transformed into TOP 10 cells and selected in LA containing spectinomycin 50 g/ml. Several clones were isolated and sequenced and two were selected. pCL PtrcKudzu and pCL PtrcKudzu (A3) have the insert in opposite orientations (
(330) vi) Construction of pCL PtrcKudzu yIDI
(331) The NsiI-PstI digested, gel purified, IDI PCR amplicon from (ii) above was ligated into pCL PtrcKudzu which had been digested with PstI, treated with SAP, and heat killed. The ligation mixture was transformed into TOP 10 cells and selected in LA containing spectinomycin 50 g/ml. Several clones were isolated and sequenced and the resulting plasmid is called pCL PtrcKudzu yIDI (
(332) vii) Construction of pCL PtrcKudzu DXS
(333) The NsiI-PstI digested, gel purified, DXS PCR amplicon from (iii) above was ligated into pCL PtrcKudzu (A3) which had been digested with PstI, treated with SAP, and heat killed. The ligation mixture was transformed into TOP 10 cells and selected in LA containing spectinomycin 50 jag/ml. Several clones were isolated and sequenced and the resulting plasmid is called pCL PtrcKudzu DXS (
(334) II. Measurement of Isoprene in Headspace from Cultures Expressing Kudzu Isoprene Synthase, idi, and/or dxs at Different Copy Numbers.
(335) Cultures of E. coli BL21(DE3) previously transformed with plasmids pTrcKudzu(kan) (A), pTrcKudzu-yIDI kan (B), pTrcKudzu-DXS kan (C), pTrcKudzu-yIDI-DXS kan (D) were grown in LB kanamycin 50 jag/mL. Cultures of pCL PtrcKudzu (E), pCL PtrcKudzu, pCL PtrcKudzu-yIDI (F) and pCL PtrcKudzu-DXS (G) were grown in LB spectinomycin 50 jag/mL. Cultures were induced with 400 M IPTG at time 0 (OD.sub.600 approximately 0.5) and samples taken for isoprene headspace measurement (see Example 1). Results are shown in
(336) Plasmid pTrcKudzu-yIDI-dxs (kan) was introduced into E. coli strain BL21 by transformation. The resulting strain BL21/pTrc Kudzu IDI DXS was grown overnight in LB containing kanamycin (50 g/ml) at 20 C. and used to inoculate shake flasks of TM3 (13.6 g K.sub.2PO.sub.4, 13.6 g KH.sub.2PO.sub.4, 2.0 g MgSO.sub.4*7H.sub.2O), 2.0 g citric acid monohydrate, 0.3 g ferric ammonium citrate, 3.2 g (NH.sub.4).sub.2SO.sub.4, 0.2 g yeast extract, 1.0 ml 1000 Modified Trace Metal Solution, adjusted to pH 6.8 and q.s. to H.sub.2O, and filter sterilized) containing 1% glucose. Flasks were incubated at 30 C. until an OD.sub.600 of 0.8 was reached, and then induced with 400 M IPTG. Samples were taken at various times after induction and the amount of isoprene in the head space was measured as described in Example 1. Results are shown in
(337) III. Production of Isoprene from Biomass in E. coli/pTrcKudzu yIDI DXS
(338) The strain BL21 pTrcKudzuIDIDXS was tested for the ability to generate isoprene from three types of biomass; bagasse, corn stover and soft wood pulp with glucose as a control. Hydrolysates of the biomass were prepared by enzymatic hydrolysis (Brown, L and Torget, R., 1996, NREL standard assay method Lap-009 Enzymatic Saccharification of Lignocellulosic Biomass) and used at a dilution based upon glucose equivalents. In this example, glucose equivalents were equal to 1% glucose. A single colony from a plate freshly transformed cells of BL21 (DE3) pTrcKudzu yIDI DXS (kan) was used to inoculate 5 ml of LB plus kanamycin (50 g/ml). The culture was incubated overnight at 25 C. with shaking. The following day the overnight culture was diluted to an OD.sub.600 of 0.05 in 25 ml of TM3 and 0.2% YE and 1% feedstock. The feedstock was corn stover, bagasse, or softwood pulp. Glucose was used as a positive control and no glucose was used as a negative control. Cultures were incubated at 30 C. with shaking at 180 rpm. The culture was monitored for OD.sub.600 and when it reached an OD.sub.600 of 0.8, cultures were analyzed at 1 and 3 hours for isoprene production as described in Example 1. Cultures are not induced. All cultures containing added feedstock produce isoprene equivalent to those of the glucose positive control. Experiments were done in duplicate and are shown in
(339) IV. Production of Isoprene from Invert Sugar in E. coli/pTrcKudzuIDIDXS
(340) A single colony from a plate freshly transformed cells of BL21 (DE3)/pTrcKudzu yIDI DXS (kan) was used to inoculate 5 mL of LB and kanamycin (50 jag/ml). The culture was incubated overnight at 25 C. with shaking. The following day the overnight culture was diluted to an OD.sub.600 of 0.05 in 25 ml of TM3 and 0.2% YE and 1% feedstock. Feedstock was glucose, inverted glucose or corn stover. The invert sugar feedstock (Danisco Invert Sugar) was prepared by enzymatically treating sucrose syrup. AFEX corn stover was prepared as described below (Part V). The cells were grown at 30 C. and the first sample was measured when the cultures reached an OD.sub.6000.8-1.0 (0 hour). The cultures were analyzed for growth as measured by OD.sub.600 and for isoprene production as in Example 1 at 0, 1 and 3 hours. Results are shown in
(341) V. Preparation of Hydrolysate from AFEX Pretreated Corn Stover
(342) AFEX pretreated corn stover was obtained from Michigan Biotechnology Institute. The pretreatment conditions were 60% moisture, 1:1 ammonia loading, and 90 C. for 30 minutes, then air dried. The moisture content in the AFEX pretreated corn stover was 21.27%. The contents of glucan and xylan in the AFEX pretreated corn stover were 31.7% and 19.1% (dry basis), respectively. The saccharification process was as follows; 20 g of AFEX pretreated corn stover was added into a 500 ml flask with 5 ml of 1 M sodium citrate buffer pH 4.8, 2.25 ml of Accellerase 1000, 0.1 ml of Grindamyl H121 (Danisco xylanase product from Aspergillus niger for bread-making industry), and 72.65 ml of DI water. The flask was put in an orbital shaker and incubated at 50 C. for 96 hours. One sample was taken from the shaker and analyzed using HPLC. The hydrolysate contained 38.5 g/l of glucose, 21.8 g/l of xylose, and 10.3 g/l of oligomers of glucose and/or xylose.
(343) VI. The Effect of Yeast Extract on Isoprene Production in E. coli Grown in Fed-Batch Culture
(344) Fermentation was performed at the 14-L scale as previously described with E. coli cells containing the pTrcKudzu yIDI DXS plasmid described above. Yeast extract (Bio Springer, Montreal, Quebec, Canada) was fed at an exponential rate. The total amount of yeast extract delivered to the fermentor was varied between 70-830 g during the 40 hour fermentation. Optical density of the fermentation broth was measured at a wavelength of 550 nm. The final optical density within the fermentors was proportional to the amount of yeast extract added (
(345) VII. Production of Isoprene in 500 L Fermentation of pTrcKudzu DXS yIDI
(346) A 500 liter fermentation of E. coli cells with a kudzu isoprene synthase, S. cerevisiae IDI, and E. coli DXS nucleic acids (E. coli BL21 (DE3) pTrc Kudzu dxs yidi) was used to produce isoprene. The levels of isoprene varied from 50 to 300 g/L over a time period of 15 hours. On the basis of the average isoprene concentrations, the average flow through the device and the extent of isoprene breakthrough, the amount of isoprene collected was calculated to be approximately 17 g.
(347) VIII. Production of Isoprene in 500 L Fermentation of E. coli Grown in Fed-Batch Culture Medium Recipe (Per Liter Fermentation Medium):
(348) K.sub.2HPO.sub.4 7.5 g, MgSO.sub.4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, yeast extract 0.5 g, 1000 Modified Trace Metal Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. This solution was autoclaved. The pH was adjusted to 7.0 with ammonium gas (NH.sub.3) and q.s. to volume. Glucose 10 g, thiamine*HCl 0.1 g, and antibiotic were added after sterilization and pH adjustment.
(349) 1000 Modified Trace Metal Solution:
(350) Citric Acids*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g, CoCl.sub.2*6H.sub.2O 1 g, ZnSO.sub.4*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component is dissolved one at a time in DI H.sub.2O, pH to 3.0 with HCl/NaOH, then q.s. to volume and filter sterilized with 0.22 micron filter.
(351) Fermentation was performed in a 500-L bioreactor with E. coli cells containing the pTrcKudzu yIDI DXS plasmid. This experiment was carried out to monitor isoprene formation from glucose and yeast extract at the desired fermentation pH 7.0 and temperature 30 C. An inoculum of E. coli strain taken from a frozen vial was prepared in soytone-yeast extract-glucose medium. After the inoculum grew to OD 0.15, measured at 550 nm, 20 ml was used to inoculate a bioreactor containing 2.5-L soytone-yeast extract-glucose medium. The 2.5-L bioreactor was grown at 30 C. to OD 1.0 and 2.0-L was transferred to the 500-L bioreactor.
(352) Yeast extract (Bio Springer, Montreal, Quebec, Canada) and glucose were fed at exponential rates. The total amount of glucose and yeast extract delivered to the bioreactor during the 50 hour fermentation was 181.2 kg and 17.6 kg, respectively. The optical density within the bioreactor over time is shown in
Example 8: Production of Isoprene in E. coli Expressing Kudzu Isoprene Synthase and Recombinant Mevalonic Acid Pathway Genes
(353) I. Cloning the Lower MVA Pathway
(354) The strategy for cloning the lower mevalonic pathway was as follows. Four genes of the mevalonic acid biosynthesis pathway; mevalonate kinase (MVK), phosphomevalonate kinase (PMK), diphosphomevalonte decarboxylase (MVD) and isopentenyl diphosphate isomerase genes were amplified by PCR from S. cerevisiae chromosomal DNA and cloned individually into the pCR BluntII TOPO plasmid (Invitrogen). In some cases, the idi gene was amplified from E. coli chromosomal DNA. The primers were designed such that an E. coli consensus RBS (AGGAGGT (SEQ ID NO:80) or AAGGAGG (SEQ ID NO:81)) was inserted at the 5 end, 8 bp upstream of the start codon and a PstI site was added at the 3 end. The genes were then cloned one by one into the pTrcHis2B vector until the entire pathway was assembled.
(355) Chromosomal DNA from S. cerevisiae S288C was obtained from ATCC (ATCC 204508D). The MVK gene was amplified from the chromosome of S. cerevisiae using primers MVKF (5-AGGAGGTAAAAAAACATGTCATTACCGTTCTTAACTTCTGC, SEQ ID NO:21) and MVK-Pst1-R (5-ATGGCTGCAGGCCTATCGCAAATTAGCTTATGAAGTCCATGGTAAATTCGTG, SEQ ID NO:22) using PfuTurbo as per manufacturer's instructions. The correct sized PCR product (1370 bp) was identified by electrophoresis through a 1.2% E-gel (Invitrogen) and cloned into pZeroBLUNT TOPO. The resulting plasmid was designated pMVK1. The plasmid pMVK1 was digested with SacI and Taq1 restriction endonucleases and the fragment was gel purified and ligated into pTrcHis2B digested with SacI and BstBI. The resulting plasmid was named pTrcMVK1.
(356) The second gene in the mevalonic acid biosynthesis pathway, PMK, was amplified by PCR using primers: PstI-PMK1 R (5-GAATTCGCCCTTCTGCAGCTACC, SEQ ID NO:23) and BsiHKA I-PMK1 F (5-CGACTGGTGCACCCTTAAGGAGGAAAAAAACATGTCAG, SEQ ID NO:24). The PCR reaction was performed using Pfu Turbo polymerase (Stratagene) as per manufacturer's instructions. The correct sized product (1387 bp) was digested with PstI and BsiHKI and ligated into pTrcMVK1 digested with PstI. The resulting plasmid was named pTrcKK. The MVD and the idi genes were cloned in the same manner. PCR was carried out using the primer pairs PstI-MVD 1 R (5-GTGCTGGAATTCGCCCTTCTGCAGC, SEQ ID NO:25) and NsiI-MVD 1 F (5-GTAGATGCATGCAGAATTCGCCCTTAAGGAGG, SEQ ID NO:26) to amplify the MVD gene and PstI-YIDI 1 R (5-CCTTCTGCAGGACGCGTTGTTATAGC, SEQ ID NO:27) and NsiI-YIDI 1 F (5-CATCAATGCATCGCCCTTAGGAGGTAAAAAAAAATGAC, SEQ ID NO:28) to amplify the yIDI gene. In some cases the IPP isomerase gene, idi from E. coli was used. To amplify idi from E. coli chromosomal DNA, the following primer set was used: PstI-CIDI 1 R (5-GTGTGATGGATATCTGCAGAATTCG, SEQ ID NO:29) and NsiI-CIDI 1 F (5-CATCAATGCATCGCCCTTAGGAGGTAAAAAAACATG, SEQ ID NO:30). Template DNA was chromosomal DNA isolated by standard methods from E. coli FM5 (WO 96/35796 and WO 2004/033646, which are each hereby incorporated by reference in their entireties, particularly with respect to isolation of nucleic acids). The final plasmids were named pKKDIy for the construct encoding the yeast idi gene or pKKDIc for the construct encoding the E. coli idi gene. The plasmids were transformed into E. coli hosts BL21 for subsequent analysis. In some cases the isoprene synthase from kudzu was cloned into pKKDIy yielding plasmid pKKDIyIS.
(357) The lower MVA pathway was also cloned into pTrc containing a kanamycin antibiotic resistance marker. The plasmid pTrcKKDIy was digested with restriction endonucleases ApaI and PstI, the 5930 bp fragment was separated on a 1.2% agarose E-gel and purified using the Qiagen Gel Purification kit according to the manufacturer's instructions. The plasmid pTrcKudzuKan, described in Example 7, was digested with restriction endonucleases ApaI and PstI, and the 3338 bp fragment containing the vector was purified from a 1.2% E-gel using the Qiagen Gel Purification kit. The 3338 bp vector fragment and the 5930 bp lower MVA pathway fragment were ligated using the Roche Quick Ligation kit. The ligation mix was transformed into E. coli TOP10 cells and tranformants were grown at 37 C. overnight with selection on LA containing kanamycin (50 jag/ml). The transformants were verified by restriction enzyme digestion and one was frozen as a stock. The plasmid was designated pTrcKanKKDIy.
(358) II. Cloning a Kudzu Isoprene Synthase Gene into pTrcKanKKDIy
(359) The kudzu isoprene synthase gene was amplified by PCR from pTrcKudzu, described in Example 1, using primers MCM50 5-GATCATGCATTCGCCCTTAGGAGGTAAAAAAACATGTGTGCGACCTCTTCTCAATTTAC T (SEQ ID NO:31) and MCM53 5-CGGTCGACGGATCCCTGCAGTTAGACATACATCAGCTG (SEQ ID NO:32). The resulting PCR fragment was cloned into pCR2.1 and transformed into E. coli TOP10. This fragment contains the coding sequence for kudzu isoprene synthase and an upstream region containing a RBS from E. coli. Transformants were incubated overnight at 37 C. with selection on LA containing carbenicillin (50 jag/ml). The correct insertion of the fragment was verified by sequencing and this strain was designated MCM93.
(360) The plasmid from strain MCM93 was digested with restriction endonucleases NsiI and PstI to liberate a 1724 bp insert containing the RBS and kudzu isoprene synthase. The 1724 bp fragment was separated on a 1.2% agarose E-gel and purified using the Qiagen Gel Purification kit according to the manufacturer's instructions. Plasmid pTrcKanKKDIy was digested with the restriction endonuclease PstI, treated with SAP for 30 minutes at 37 C. and purified using the Qiagen PCR cleanup kit. The plasmid and kudzu isoprene synthase encoding DNA fragment were ligated using the Roche Quick Ligation kit. The ligation mix was transformed into E. coli TOP10 cells and transformants were grown overnight at 37 C. with selection on LA containing Kanamycin at 50 jag/ml. The correct transformant was verified by restriction digestion and the plasmid was designated pTrcKKDyIkISKan (
(361) III. Isoprene Production from Mevalonate in E. coli Expressing the Recombinant Lower Mevalonate Pathway and Isoprene Synthase from Kudzu.
(362) Strain BL21/pTrcKKDyIkISKan was cultured in MOPS medium (Neidhardt et al., (1974) J. Bacteriology 119:736-747) adjusted to pH 7.1 and supplemented with 0.5% glucose and 0.5% mevalonic acid. A control culture was also set up using identical conditions but without the addition of 0.5% mevalonic acid. The culture was started from an overnight seed culture with a 1% inoculum and induced with 500 M IPTG when the culture had reached an OD.sub.600 of 0.3 to 0.5. The cultures were grown at 30 C. with shaking at 250 rpm. The production of isoprene was analyzed 3 hours after induction by using the head space assay described in Example 1. Maximum production of isoprene was 6.6710.sup.4 nmol/L.sub.broth/OD.sub.600/hr where L.sub.broth is the volume of broth and includes both the volume of the cell medium and the volume of the cells. The control culture not supplemented with mevalonic acid did not produce measurable isoprene.
(363) IV. Cloning the Upper MVA Pathway
(364) The upper mevalonate biosynthetic pathway, comprising two genes encoding three enzymatic activities, was cloned from Enterococcus faecalis. The mvaE gene encodes a protein with the enzymatic activities of both acetyl-CoA acetyltransferase and 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase, the first and third proteins in the pathway, and the mvaS gene encodes second enzyme in the pathway, HMG-CoA synthase. The mvaE gene was amplified from E. faecalis genomic DNA (ATCC 700802D-5) with an E. coli ribosome binding site and a spacer in front using the following primers:
(365) TABLE-US-00010 CF07-60(+)StartofmvaEw/RBS+ ATGstartcodon SacI (SEQIDNO:34) 5-GAGACATGAGCTCAGGAGGTAAAAAAACATGAAAACAGTAGTTATTA TTG CF07-62()FusemvaEtomvaSwithRBSinbetween (SEQIDNO:35) 5-TTTATCAATCCCAATTGTCATGTTTTTTTACCTCCTTTATTGTTTTC TTAAATC
(366) The mvaS gene was amplified from E. faecalis genomic DNA (ATCC 700802D-5) with a RBS and spacer from E. coli in front using the following primers:
(367) TABLE-US-00011 CF07-61(+)FusemvaEtomvaSwithRBSinbetween (SEQIDNO:36) 5-GATTTAAGAAAACAATAAAGGAGGTAAAAAAACATGACAATTGGGAT TGATAAA (SEQIDNO:37) CF07-102()EndofmvaSgeneBglII 5-GACATGACATAGATCTTTAGTTTCGATAAGAACGAACGGT
(368) The PCR fragments were fused together with PCR using the following primers:
(369) TABLE-US-00012 CF07-60(+)StartofmvaEw/RBS+ ATGstartcodon SacI (SEQIDNO:34) 5-GAGACATGAGCTCAGGAGGTAAAAAAACATGAAAACAGTAGTTATTA TTG CF07-102()EndofmvaSgeneBglII (SEQIDNO:37) 5-GACATGACATAGATCTTTAGTTTCGATAAGAACGAACGGT
(370) The fusion PCR fragment was purified using a Qiagen kit and digested with the restriction enzymes SacI and BglII. This digested DNA fragment was gel purified using a Qiagen kit and ligated into the commercially available vector pTrcHis2A, which had been digested with SacI and BglII and gel purified.
(371) The ligation mix was transformed into E. coli Top 10 cells and colonies were selected on LA and 50 g/ml carbenicillin plates. A total of six colonies were chosen and grown overnight in LB and 50 g/ml carbenicillin and plasmids were isolated using a Qiagen kit. The plasmids were digested with SacI and BglII to check for inserts and one correct plasmid was sequenced with the following primers:
(372) TABLE-US-00013 CF07-58(+)StartofmvaEgene (SEQIDNO:38) 5-ATGAAAACAGTAGTTATTATTGATGC CF07-59()EndofmvaEgene (SEQIDNO:39) 5-ATGTTATTGTTTTCTTAAATCATTTAAAATAGC CF07-82(+)StartofmvaSgene (SEQIDNO:40) 5-ATGACAATTGGGATTGATAAAATTAG CF07-83()EndofmvaSgene (SEQIDNO:41) 5-TTAGTTTCGATAAGAACGAACGGT CF07-86(+)SequenceinmvaE (SEQIDNO:42) 5-GAAATAGCCCCATTAGAAGTATC CF07-87(+)SequenceinmvaE (SEQIDNO:43) 5-TTGCCAATCATATGATTGAAAATC CF07-88(+)SequenceinmvaE (SEQIDNO:44) 5-GCTATGCTTCATTAGATCCTTATCG CF07-89(+)SequencemvaS (SEQIDNO:45) 5-GAAACCTACATCCAATCTTTTGCCC
(373) The plasmid called pTrcHis2AUpperPathway#1 was correct by sequencing and was transformed into the commercially available E. coli strain BL21. Selection was done on LA and 50 g/ml carbenicillin. Two transformants were chosen and grown in LB and 50 g/ml carbenicillin until they reached an OD.sub.600 of 1.5. Both strains were frozen in a vial at 80 C. in the presence of glycerol. Strains were designated CF 449 for pTrcHis2AUpperPathway#1 in BL21, isolate #1 and CF 450 for pTrcHis2AUpperPathway#1 in BL21, isolate #2. Both clones were found to behave identically when analyzed.
(374) V. Cloning of UpperMVA Pathway into pCL1920
(375) The plasmid pTrcHis2AUpperPathway was digested with the restriction endonuclease SspI to release a fragment containing pTrc-mvaE-mvaS-(His tag)-terminator. In this fragment, the his-tag was not translated. This blunt ended 4.5 kbp fragment was purified from a 1.2% E-gel using the Qiagen Gel Purification kit. A dephosphorylated, blunt ended 4.2 kbp fragment from pCL1920 was prepared by digesting the vector with the restriction endonuclease PvuII, treating with SAP and gel purifying from a 1.2% E-gel using the Qiagen Gel Purification kit. The two fragments were ligated using the Roche Quick Ligation Kit and transformed into TOP 10 chemically competent cells. Transformants were selected on LA containing spectinomycin (50 jag/ml). A correct colony was identified by screening for the presence of the insert by PCR. The plasmid was designated pCL PtrcUpperPathway (
(376) VI. Strains Expressing the Combined Upper and Lower Mevalonic Acid Pathways
(377) To obtain a strain with a complete mevalonic acid pathway plus kudzu isoprene synthase, plasmids pTrcKKDyIkISkan and pCLpTrcUpperPathway were both transformed into BL21(DE3) competent cells (Invitrogen) and transformants were selected on LA containing kanamycin (50 g/ml) and Spectinomycin (50 jag/ml). The transformants were checked by plasmid prep to ensure that both plasmids were retained in the host. The strain was designated MCM127.
(378) VII. Production of Mevalonic Acid from Glucose in E. coli/pUpperpathway
(379) Single colonies of the BL21/pTrcHis2A-mvaE/mvaS or FM5/p pTrcHis2A-mvaE/mvaS are inoculated into LB and carbenicillin (100 g/ml) and are grown overnight at 37 C. with shaking at 200 rpm. These cultures were diluted into 50 ml medium in 250 ml baffled flasks to an OD.sub.600 of 0.1. The medium was TM3, 1 or 2% glucose, carbenicillin (100 ug/ml) or TM3, 1% glucose. hydrolyzed soy oil, and carbenicillin (100 ug/ml) or TM3 and biomass (prepared bagasse, corn stover or switchgrass). Cultures were grown at 30 C. with shaking at 200 rpm for approximately 2-3 hours until an OD.sub.600 of 0.4 was reached. At this point the expression from the mvaE mvaS construct was induced by the addition of IPTG (400 M). Cultures were incubated for a further 20 or 40 hours with samples taken at 2 hour intervals to 6 hour post induction and then at 24, 36 and 48 hours as needed. Sampling was done by removing 1 ml of culture, measuring the OD.sub.600, pelleting the cells in a microfuge, removing the supernatant and analyzing it for mevalonic acid.
(380) A 14 liter fermentation of E. coli cells with nucleic acids encoding Enterococcus faecalis AA-CoA thiolase, HMG-CoA synthase, and HMG-CoA reductase polypeptides produced 22 grams of mevalonic acid with TM3 medium and 2% glucose as the cell medium. A shake flask of these cells produced 2-4 grams of mevalonic acid per liter with LB medium and 1% glucose as the cell culture medium. The production of mevalonic acid in these strains indicated that the MVA pathway was functional in E. coli.
(381) VIII. Production of Isoprene from E. coli BL21 Containing the Upper and Lower MVA Pathway Plus Kudzu Isoprene Synthase.
(382) The following strains were created by transforming in various combinations of plasmids containing the upper and lower MVA pathway and the kudzu isoprene synthase gene as described above and the plasmids containing the idi, dxs, and dxr and isoprene synthase genes described in Example 7. The host cells used were chemically competent BL21(DE3) and the transformations were done by standard methods. Transformants were selected on L agar containing kanamycin (50 g/ml) or kanamycin plus spectinomycin (both at a concentration of 50 jag/ml). Plates were grown at 37 C. The resulting strains were designated as follows:
(383) Grown on Kanamycin plus Spectinomycin (50 g/ml each)
(384) MCM127-pCL Upper MVA and pTrcKKDyIkIS (kan) in BL21(DE3)
(385) MCM131-pCL1920 and pTrcKKDyIkIS (kan) in BL21(DE3)
(386) MCM125-pCL Upper MVA and pTrcHis2B (kan) in BL21(DE3)
(387) Grown on Kanamycin (50 g/ml)
(388) MCM64-pTrcKudzu yIDI DXS (kan) in BL21(DE3)
(389) MCM50-pTrcKudzu (kan) in BL21(DE3)
(390) MCM123-pTrcKudzu yIDI DXS DXR (kan) in BL21(DE3)
(391) The above strains were streaked from freezer stocks to LA and appropriate antibiotic and grown overnight at 37 C. A single colony from each plate was used to inoculate shake flasks (25 ml LB and the appropriate antibiotic). The flasks were incubated at 22 C. overnight with shaking at 200 rpm. The next morning the flasks were transferred to a 37 C. incubator and grown for a further 4.5 hours with shaking at 200 rpm. The 25 ml cultures were centrifuged to pellet the cells and the cells were resuspended in 5 ml LB and the appropriate antibiotic. The cultures were then diluted into 25 ml LB, % glucose, and the appropriate antibiotic to an OD.sub.600 of 0.1. Two flasks for each strain were set up, one set for induction with IPTG (800 M) the second set was not induced. The cultures were incubated at 37 C. with shaking at 250 rpm. One set of the cultures were induced after 1.50 hours (immediately following sampling time point 1). At each sampling time point, the OD.sub.600 was measured and the amount of isoprene determined as described in Example 1. Results are presented in Table 3. The amount of isoprene made is presented as the amount at the peak production for the particular strain.
(392) TABLE-US-00014 TABLE 3 Production of isoprene in E. coli strains Strain Isoprene (g/L.sub.broth/hr/OD MCM50 23.8 MCM64 289 MCM125 ND MCM131 Trace MCM127 874 ND: not detected Trace: peak present but not integrable.
IX. Analysis of Mevalonic Acid
(393) Mevalonolactone (1.0 g, 7.7 mmol) (CAS#503-48-0) was supplied from Sigma-Aldrich (WI, USA) as a syrup that was dissolved in water (7.7 mL) and was treated with potassium hydroxide (7.7 mmol) in order to generate the potassium salt of mevalonic acid. The conversion to mevalonic acid was confirmed by .sup.1H NMR analysis. Samples for HPLC analysis were prepared by centrifugation at 14,000 rpm for 5 minutes to remove cells, followed by the addition of a 300 l aliquot of supernatant to 900 l of H.sub.2O. Perchloric acid (36 l of a 70% solution) was then added followed by mixing and cooling on ice for 5 minutes. The samples were then centrifuged again (14,000 rpm for 5 min) and the supernatant transferred to HPLC. Mevalonic acid standards (20, 10, 5, 1 and 0.5 g/L) were prepared in the same fashion. Analysis of mevalonic acid (20 uL injection volume) was performed by HPLC using a BioRad Aminex 87-H+ column (300 mm by 7.0 mm) eluted with 5 mM sulfuric acid at 0.6 mL/min with refractive index (RI) detection. Under these conditions mevalonic acid eluted as the lactone form at 18.5 minutes.
Example 9: Construction of the Upper and Lower MVA Pathway for Integration into Bacillus subtilis
(394) I. Construction of the Upper MVA Pathway in Bacillus subtilis
(395) The upper pathway from Enterococcus faecalis is integrated into B. subtilis under control of the aprE promoter. The upper pathway consists of two genes; mvaE, which encodes for AACT and HMGR, and mvaS, which encodes for HMGS. The two genes are fused together with a stop codon in between, an RB S site in front of mvaS, and are under the control of the aprE promoter. A terminator is situated after the mvaE gene. The chloramphenicol resistance marker is cloned after the mvaE gene and the construct is integrated at the aprE locus by double cross over using flanking regions of homology.
(396) Four DNA fragments are amplified by PCR such that they contain overhangs that will allow them to be fused together by a PCR reaction. PCR amplifications are carried out using Herculase polymerase according to manufacturer's instructions.
(397) 1: PaprE
(398) TABLE-US-00015 CF07-134(+)StartofaprEpromoterPstI (SEQIDNO:82) 5-GACATCTGCAGCTCCATTTTCTTCTGC CF07-94()FusePaprEtomvaE (SEQIDNO:83) 5-CAATAATAACTACTGTTTTCACTCTTTACCCTCTCCTTTTAA
Template: Bacillus subtilis chromosomal DNA
2: mvaE
(399) TABLE-US-00016 CF07-93(+)fusemvaEtotheaprEpromoter (GTGstartcodon) (SEQIDNO:84) 5-TTAAAAGGAGAGGGTAAAGAGTGAAAACAGTAGTTATTATTG CF07-62()FusemvaEtomvaSwithRBSinbetween (SEQIDNO:35) 5-TTTATCAATCCCAATTGTCATGTTTTTTTACCTCCTTTATTGTTTTC TTAAATC
Template: Enterococcus faecalis chromosomal DNA (from ATCC)
3. mvaS
(400) TABLE-US-00017 CF07-61(+)FusemvaEtomvaSwithRBSinbetween (SEQIDNO:36) 5-GATTTAAGAAAACAATAAAGGAGGTAAAAAAACATGACAATTGGGAT TGATAAA CF07-124()FusetheendofmvaStothe terminator (SEQIDNO:85) 5-CGGGGCCAAGGCCGGTTTTTTTTAGTTTCGATAAGAACGAACGGT
Template: Enterococcus faecalis chromosomal DNA
4. B. amyliquefaciens alkaline serine protease terminator
(401) TABLE-US-00018 CF07-123(+)FusetheendofmvaStothe terminator (SEQIDNO:86) 5-ACCGTTCGTTCTTATCGAAACTAAAAAAAACCGGCCTTGGCCCCG CF07-46()EndofB.amyliquefaciensterminator BamHI (SEQIDNO:63) 5-GACATGACGGATCCGATTACGAATGCCGTCTC
Template: Bacillus amyliquefaciens chromosomal DNA
PCR Fusion Reactions
5. Fuse mvaE to mvaS
(402) TABLE-US-00019 CF07-93(+)fusemvaEtotheaprEpromoter (GTGstartcodon) (SEQIDNO:84) 5-TTAAAAGGAGAGGGTAAAGAGTGAAAACAGTAGTTATTATTG CF07-124()FusetheendofmvaStothe terminator (SEQIDNO:85) 5-CGGGGCCAAGGCCGGTTTTTTTTAGTTTCGATAAGAACGAACGGT
Template: #2 and 3 from above
6. Fuse mvaE-mvaS to aprE promoter
(403) TABLE-US-00020 CF07-134(+)StartofaprEpromoterPstI (SEQIDNO:82) 5-GACATCTGCAGCTCCATTTTCTTCTGC CF07-124()FusetheendofmvaStothe terminator (SEQIDNO:85) 5-CGGGGCCAAGGCCGGTTTTTTTTAGTTTCGATAAGAACGAACGGT
Template #1 and #4 from above
7. Fuse PaprE-mvaE-mvaS to terminator
(404) TABLE-US-00021 CF07-134(+)StartofaprEpromoterPstI (SEQIDNO:82) 5-GACATCTGCAGCTCCATTTTCTTCTGC CF07-46()EndofB.amyliquefaciensterminator BamHI (SEQIDNO:63) 5-GACATGACGGATCCGATTACGAATGCCGTCTC
Template: #4 and #6
(405) The product is digested with restriction endonucleases PstI/BamHI and ligated to pJM102 (Perego, M. 1993. Integrational vectors for genetic manipulation in Bacillus subtilis, p. 615-624. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.) which is digested with PstI/BamHI. The ligation is transformed into E. coli TOP 10 chemically competent cells and transformants are selected on LA containing carbenicillin (50 g/ml). The correct plasmid is identified by sequencing and is designated pJMUpperpathway2 (
(406) The resulting strain is tested for mevalonic acid production by growing in LB containing 1% glucose and 1%. Cultures are analyzed by GC for the production of mevalonic acid.
(407) This strain is used subsequently as a host for the integration of the lower mevalonic acid pathway.
(408) The following primers are used to sequence the various constructs above.
(409) Sequencing Primers:
(410) TABLE-US-00022 CF07-134(+)StartofaprEpromoterPstI (SEQIDNO:82) 5-GACATCTGCAGCTCCATTTTCTTCTGC CF07-58(+)StartofmvaEgene (SEQIDNO:38) 5-ATGAAAACAGTAGTTATTATTGATGC CF07-59()EndofmvaEgene (SEQIDNO:39) 5-ATGTTATTGTTTTCTTAAATCATTTAAAATAGC CF07-82(+)StartofmvaSgene (SEQIDNO:40) 5-ATGACAATTGGGATTGATAAAATTAG CF07-83()EndofmvaSgene (SEQIDNO:41) 5-TTAGTTTCGATAAGAACGAACGGT CF07-86(+)SequenceinmvaE (SEQIDNO:42) 5-GAAATAGCCCCATTAGAAGTATC CF07-87(+)SequenceinmvaE (SEQIDNO:43) 5-TTGCCAATCATATGATTGAAAATC CF07-88(+)SequenceinmvaE (SEQIDNO:44) 5-GCTATGCTTCATTAGATCCTTATCG CF07-89(+)SequencemvaS (SEQIDNO:45) 5-GAAACCTACATCCAATCTTTTGCCC
(411) Transformants are selected on LA containing chloramphenicol at a concentration of 5 g/ml. One colony is confirmed to have the correct integration by sequencing and is plated on LA containing increasing concentrations of chloramphenicol over several days, to a final level of 25 g/ml. This results in amplification of the cassette containing the genes of interest. The resulting strain is designated CF 455: pJMupperpathway#1 Bacillus subtilis aprEnprE Pxyl comK (amplified to grow on LA containing chloramphenicol 25 g/ml).
(412) II. Construction of the Lower MVA Pathway in Bacillus subtilis
(413) The lower MVA pathway, consisting of the genes mvk1, pmk, mpd and idi are combined in a cassette consisting of flanking DNA regions from the nprE region of the B. subtilis chromosome (site of integration), the aprE promoter, and the spectinomycin resistance marker (see
Example 10: Production of Isoprene in E. coli Expressing M. mazei Mevalonate Kinase and P. alba Isoprene Synthase
(414) I. Construction of Vectors and Strains Encoding M. mazei Mevalonate Kinase (MVK) and P. alba Isoprene Synthase
(415) (i) Construction of Strain EWL201 (BL21, Cm-GI1.2-KKDyI)
(416) E. coli BL21 (Novagen brand, EMD Biosciences, Inc.) was a recipient strain, transduced with MCM331 P1 lysate (lysate prepared according to the method described in Ausubel, et al., Current Protocols in Molecular Biology. John Wiley and Sons, Inc.). Transductants were selected for by spreading cells onto L Agar and 20 g/l chloramphenicol. The plates were incubated overnight at 30 C. Analysis of transductants showed no colonies on control plates (water+ cells control plate for reversion and water and P1 lysate control plate for lysate contamination.
(417) Four transductants were picked and used to inoculate 5 mL L Broth and 20 g/l chloramphenicol. The cultures were grown overnight at 30 C. with shaking at 200 rpm. To make genomic DNA preps of each transductant for PCR analysis, 1.5 mL of overnight cell culture were centrifuged. The cell pellet was resuspended with 400 l Resuspension Buffer (20 mM Tris, 1 mM EDTA, 50 mM NaCl, pH 7.5) and 4 l RNase, DNase-free (Roche) was added. The tubes were incubated at 37 C. for 30 minutes followed by the addition of 4 l 10% SDS and 4 l of 10 mg/ml Proteinase K stock solution (Sigma-Aldrich). The tubes were incubated at 37 C. for 1 hour. The cell lysate was transferred into 2 ml Phase Lock Light Gel tubes (Eppendorf) and 200 l each of saturated phenol pH7.9 (Ambion Inc.) and chloroform were added. The tubes were mixed well and microcentrifuged for 5 minutes. A second extraction was done with 400 l chloroform and the aqueous layer was transferred to a new eppendorf tube. The genomic DNA was precipitated by the addition of 1 ml of 100% ethanol and centrifugation for 5 minutes. The genomic DNA pellet was washed with 1 ml 70% ethanol. The ethanol was removed and the genomic DNA pellet was allowed to air dry briefly. The genomic DNA pellet was resuspended with 200 l TE.
(418) Using Pfu Ultra II DNA polymerase (Stratagene) and 200 ng/l of genomic DNA as template, 2 different sets of PCR reaction tubes were prepared according to manufacturer's protocol. For set 1, primers MCM130 and GB Cm-Rev (Table 4) were used to ensure transductants were successfully integrated into the attTn7 locus. PCR parameters for set 1 were 95 C. for 2 minutes (first cycle only), 95 C. for 25 seconds, 55 C. for 25 seconds, 72 C. for 25 seconds (repeat steps 2-4 for 28 cycles), 72 C. for 1 minute. For set 2, primers MVD For and MVD Rev (Table 4) were used to ensure that the gi1.2-KKDyI operon integrated properly. PCR parameters for set 2 were 95 C. for 2 minutes (first cycle only), 95 C. for 25 seconds, 55 C. for 25 seconds, 72 C. for 10 seconds (repeat steps 2-4 for 28 cycles), 72 C. for 1 minute. Analysis of PCR amplicons on a 1.2% E-gel (Invitrogen Corp.) showed that all 4 transductant clones were correct (picked one and designated as strain EWL201).
(419) ii) Construction of Strain EWL204 (BL21, Loopout-GI1.2-KKDyI)
(420) The chloramphenicol marker was looped out of strain EWL201 using plasmid pCP20 as described by Datsenko and Wanner (2000) (Datsenko et al., Proc Natl. Acad. Sci USA 97:6640-6645, 2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. (Datsenko et al., PNAS, 97: 6640-6645, 2000). EWL201 cells were grown in L Broth to midlog phase and then washed three times in ice-cold, sterile water. An aliquot of 50 l of cell suspension was mixed with 1 l of pCP20 and the cell suspension mixture was electroporated in a 2 mm cuvette (Invitrogen Corp.) at 2.5 Volts and 25uFd using a Gene Pulser Electroporator (Bio-Rad Inc.). 1 ml of LB was immediately added to the cells, then transferred to a 14 ml polypropylene tube (Sarstedt) with a metal cap. Cells were allowed to recover by growing for 1 hour at 30 C. Transformants were selected on L Agar and 20 g/l chloramphenicol and 50 g/l carbenicillin and incubated at 30 C. overnight. The next day, a single clone was grown in 10 ml L Broth and 50 g/l carbenicillin at 30 C. until early log phase. The temperature of the growing culture was then shifted to 42 C. for 2 hours. Serial dilutions were made, the cells were then spread onto LA plates (no antibiotic selection), and incubated overnight at 30 C. The next day, 20 colonies were picked and patched onto L Agar (no antibiotics) and LA and 20 g/l chloramphenicol plates. Plates were then incubated overnight at 30 C. Cells able to grow on LA plates, but not LA and 20 g/l chloramphenicol plates, were deemed to have the chloramphenicol marker looped out (picked one and designated as strain EWL204).
(421) iii) Construction of Plasmid pEWL230 (pTrc P. alba)
(422) Generation of a synthetic gene encoding Populus alba isoprene synthase (P. alba HGS) was outsourced to DNA2.0 Inc. (Menlo Park, Calif.) based on their codon optimization method for E. coli expression. The synthetic gene was custom cloned into plasmid pET24a (Novagen brand, EMD Biosciences, Inc.) and delivered lyophilized (
(423) A PCR reaction was performed to amplify the P. alba isoprene synthase (P. alba HGS) gene using pET24 P. alba HGS as the template, primers MCM182 and MCM192, and Herculase II Fusion DNA polymerase (Stratagene) according to manufacturer's protocol. PCR conditions were as follows: 95 C. for 2 minutes (first cycle only), 95 C. for 25 seconds, 55 C. for 20 seconds, 72 C. for 1 minute, repeat for 25 cycles, with final extension at 72 C. for 3 minutes. The P. alba isoprene synthase PCR product was purified using QIAquick PCR Purification Kit (Qiagen Inc.).
(424) P. alba isoprene synthase PCR product was then digested in a 20 l reaction containing 1 l BspHI endonuclease (New England Biolabs) with 2 l 10NEB Buffer 4. The reaction was incubated for 2 hours at 37 C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. A secondary restriction digest was performed in a 20 l reaction containing 1 l PstI endonuclease (Roche) with 2 l 10 Buffer H. The reaction was incubated for 2 hours at 37 C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. Plasmid pTrcHis2B (Invitrogen Corp.) was digested in a 20 l reaction containing 1 l NcoI endonuclease (Roche), 1 l PstI endonuclease, and 2 l 10 Buffer H. The reaction was incubated for 2 hours at 37 C. The digested pTrcHis2B vector was gel purified using a 1.2% E-gel (Invitrogen Corp.) and extracted using the QIAquick Gel Extraction Kit (Qiagen) (
(425) iv) Construction of Plasmid pEWL244 (pTrc P. alba-mMVK)
(426) A PCR reaction was performed to amplify the Methanosarcina mazei (M. mazei) MVK gene using MCM376 as the template (see section v), primers MCM165 and MCM177 (see Table 4), and Pfu Ultra II Fusion DNA polymerase (Stratagene) according to manufacturer's protocol. PCR conditions were as follows: 95 C. for 2 minutes (first cycle only), 95 C. for 25 seconds, 55 C. for 25 seconds, 72 C. for 18 seconds, repeat for 28 cycles, with final extension at 72 C. for 1 minute. The M. mazei MVK PCR product was purified using QIAquick PCR Purification Kit (Qiagen Inc.,)
(427) The M. mazei MVK PCR product was then digested in a 40 l reaction containing 8 l PCR product, 2 l PmeI endonuclease (New England Biolabs), 4 l 10NEB Buffer 4, 4 l 10 NEB BSA, and 22 l of ddH.sub.2O. The reaction was incubated for 3 hours at 37 C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. A secondary restriction digest was performed in a 47 l reaction containing 2 l NsiI endonuclease (Roche), 4.7 l 10 Buffer H, and 40 l of PmeI digested M. mazei MVK fragment. The reaction was incubated for 3 hours at 37 C. The digested PCR fragment was then gel purified using a 1.2% E-gel and extracted using the QIAquick Gel Extraction Kit. Plasmid EWL230 was digested in a 40 l reaction containing 10 l plasmid, 2 l PmeI endonuclease, 4 l 10NEB Buffer 4, 4 l 10NEB BSA, and 20 l of ddH.sub.2O. The reaction was incubated for 3 hours at 37 C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. A secondary restriction digest was performed in a 47 l reaction containing 2 l PstI endonuclease, 4.7 l 10 Buffer H, and 40 l of PmeI digested EWL230 linear fragment. The reaction was incubated for 3 hours at 37 C. The digested PCR fragment was then gel purified using a 1.2% E-gel and extracted using the QIAquick Gel Extraction Kit (
(428) v) Construction of Plasmid MCM376-MVK from M. mazei Archaeal Lower in pET200D.
(429) The MVK ORF from the M. mazei archaeal Lower Pathway operon (
(430) vi) Construction of strain EWL251 (BL21(DE3), Cm-GI1.2-KKDyI, pTrc P. alba-mMVK)
(431) MCM331 cells (which contain chromosomal construct gi1.2KKDyI encoding S. cerevisiae mevalonate kinase, mevalonate phosphate kinase, mevalonate pyrophosphate decarboxylase, and IPP isomerase) were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 l of cell suspension with 1 l of plasmid EWL244. The cell suspension mixture was electroporated in a 2 mm cuvette at 2.5 Volts and 25uFd using a Gene Pulser Electroporator. 1 ml of LB is immediately added to the cells, then the cells were transferred to a 14 ml polypropylene tube with a metal cap. Cells were allowed to recover by growing for 2 hours at 30 C. Transformants were selected on LA and 50 g/l carbenicillin and 5 mM mevalonic acid plates and incubated at 37 C. One colony was selected and designated as strain EWL251.
(432) vii) Construction of Strain EWL256 (BL21(DE3), Cm-GI1.2-KKDyI, pTrc P. alba-mMVK, pCL Upper MVA)
(433) EWL251 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 l of cell suspension with 1 l of plasmid MCM82 (which is pCL PtrcUpperPathway encoding E. faecalis mvaE and mvaS). The cell suspension mixture was electroporated in a 2 mm cuvette at 2.5 Volts and 25uFd using a Gene Pulser Electroporator. 1 ml of LB was immediately added to the cells, then transferred to a 14 ml polypropylene tube with a metal cap. Cells were allowed to recover by growing for 2 hour at 30 C. Transformants were selected on LA and 50 g/l carbenicillin and 50 g/l spectinomycin plates and incubated at 37 C. Picked one colony and designated as strain EWL256.
(434) TABLE-US-00023 TABLE4 PrimerSequences Primer name Primersequence MCM130 ACCAATTGCACCCGGCAGA (SEQIDNO:94) GBCm GCTAAAGCGCATGCTCCAGAC Rev (SEQIDNO:95) MVD GACTGGCCTCAGATGAAAGC For (SEQIDNO:96) MVD CAAACATGTGGCATGGAAAG Rev (SEQIDNO:97) MCM182 GGGCCCGTTTAAACTTTAACTAGACTCTGCAGTTAGCGTTC AAACGGCAGAA (SEQIDNO:98) MCM192 CGCATGCATGTCATGAGATGTAGCGTGTCCACCGAAAA (SEQIDNO:99 MCM65 ACAATTTCACACAGGAAACAGC (SEQIDNO:100) MCM66 CCAGGCAAATTCTGTTTTATCAG (SEQIDNO:101) EL1000 GCACTGTCTTTCCGTCTGCTGC (SEQIDNO:102) MCM165 GCGAACGATGCATAAAGGAGGTAAAAAAACATGGTATCCTG TTCTGCGCCGGGTAAGATTTACCTG (SEQIDNO:103) MCM177 GGGCCCGTTTAAACTTTAACTAGACTTTAATCTACTTTCAG ACCTTGC (SEQIDNO:104) EL1003 GATAGTAACGGCTGCGCTGCTACC (SEQIDNO:105) EL1006 GACAGCTTATCATCGACTGCACG (SEQIDNO:106) MCM161 CACCATGGTATCCTGTTCTGCG (SEQIDNO:107) MCM162 TTAATCTACTTTCAGACCTTGC (SEQIDNO:108)
II. Construction of MCM442-449: BL21 and BL21(DE3) with FRT-cmR-FRT-gi1.x-mKKDyI
i) Construction of Template for Recombination
(435) FRT-based recombination cassettes, and plasmids for Red/ET-mediated integration and antibiotic marker loopout were obtained from Gene Bridges GmbH (Germany). Procedures using these materials were carried out according to Gene Bridges protocols. Primers MCM193 and MCM195 were used to amplify the resistance cassette from the FRT-gb2-Cm-FRT template using Stratagene Herculase II Fusion kit according to the manufacturer's protocol. The 50 uL reaction was cycled as follows: 95 C., 2 minutes; (95 C., 20 seconds, 55 C., 20 seconds, 72 C., 1 minute)5, (95 C., 20 seconds, 60 C., 20 seconds, 72 C., 1 minute)25; 72 C., 3 minutes; 4 C. until cool. The amplicon was purified by a Qiagen PCR column according to the manufacturer's protocol and eluted in 30 uL EB (Elution Buffer). DNA was digested with NdeI and PciI in a 20 uL reaction with 1 Roche H buffer and 0.5 uL BSA. Plasmid MCM376 was digested in a 10 uL reaction containing 1 uL each of NdeI, NcoI, and Roche H buffer. Reactions proceeded overnight at 37 C., and then cut DNA was purified on Qiagen PCR columns and eluted in 30 uL EB. The PCR product was ligated into MCM376 in a reaction containing 1 uL vector, 3 uL PCR product, 1 uL Roche Quick Ligase Buffer 2, 5 uL Buffer1, and 1 uL Ligase. The reaction proceeded at room temperature for 3 hours and then 5 uL was transformed into Invitrogen TOP 10 cells according to the manufacturer's protocol. Transformants were selected on L agar (LA) and chloramphenicol (10 ug/mLO) at 37 C. overnight.
(436) Transformant colonies were patched onto LA containing chloramphenicol (30 ug/mL) and kanamycin (50 ug/ml) for storage and sent to Quintara (Berkeley, Calif.) for sequencing. Four clones, one each with the four different nucleotides at the N in primer MCM195, were found to have the correct sequence for the inserted promoter. Clones were grown in 5 mL LB containing chloramphenicol (30 ug/mL) and kanamycin (50 ug/mL) and used for the preparation of plasmid DNA. This plasmid was retransformed into TOP10 cells and strains were frozen as:
(437) TABLE-US-00024 TABLE 5 MCM484-487 MCM484 cmR-gi1.6-MVK(mazei) in pET (clone A1-3, variable nt A) MCM485 cmR-gi1.0-MVK(mazei) in pET (clone B4-6, variable nt C) MCM486 cmR-gi1.2-MVK(mazei) in pET (clone C1-5, variable nt G) MCM487 cmR-gi1.5-MVK(mazei) in pET (clone C3-3, variable nt T)
ii) Creation of Recombination Target Strains MCM349 and MCM441
(438) The chloramphenicol resistance (cmR) marker was looped out of strain MCM331 using plasmid pGB706 (GeneBridges) according to Manufacturer's instructions. MCM331 cells were grown to mid-log in LB and washed three times in iced, sterile water. A 1 uL aliquot of pGB706 DNA was added to 50 uL of cell suspension and this mixture was electroporated in a 2 mm cuvette at 2.5 volts, 25uFd followed immediately by recovery in 500 uL LB for one hour at 30 C. Transformants were selected on LB containing tetracycline (5 ug/ml) at 30 C. The following day, a clone was grown up at 30 C. in LB containing tetracycline (5 ug/ml) until visibly turbid (OD600-0.5-0.8). This culture was streaked onto LB and grown overnight at 37 C. A clone that was unable to grow on LB containing chloramphenicol (10 ug/mL) or LB containing tetracycline (5 ug/mL) was frozen as MCM348. Plasmid MCM356 (pRedET carbencillin; GeneBridges) was electroporated in as described above and transformants were selected on LB containing carbenicillin (50 ug/mL) at 30 C. A clone was grown in LB carbenicillin (50 ug/mL) at 30 C. and frozen as MCM349.
(439) Strain MCM441 was created by electrotransforming plasmid MCM356 into EWL204 as above.
(440) iii) Recombination of FRT-cmR-FRT-gi1.x-mMVK into MCM349 and MCM441
(441) Plasmids MCM484-487 were used as template for PCR amplification with primers MCM120 and MCM196 and Herculase II Fusion kit, according to the manufacturer's protocol. Three reactions per template were carried out, with 0, 1, or 3 uL DMSO. The 50 uL reactions were cycled as follows: 95 C., 2 minutes; (95 C., 20 seconds; 55 C. 20 seconds; 72 C., 1.5 minutes) for five cycles; (95 C., 20 seconds; 60 C. 20 seconds; 72 C., 1.5 minutes) for 25 cycles; 72 C. for 3 minutes; 4 C., overnight.] The three reactions from a given template were pooled and purified on Qiagen PCR columns and eluted with 30 uL EB at 60 C. 5 uL DNA was digested with 1 uL DpnI in 1 Roche Buffer A for 3 hours at 37 C. This DNA was then microdialyzed against excess water for 30 minutes.
(442) Strains were grown in 5 mL LB containing carbenicillin (50 ug/mL) from fresh streaks at 30 C to an OD600 of 0.5. 40 mM L-arabinose was added and cultures were incubated at 37 C for 1.5 hours. Cells were harvested and electroporated with 3 uL dialyzed amplicons above, and then recovered in 500 uL SOC at 37 C for 1.5-3 hours. Transformants were selected on LA plates containing chloramphenicol (5 ug/mL) at 37 C.
(443) Kanamycin sensitive clones were screened by PCR for insertion of the amplicon. PCR products from positive clones were sequenced to verify the sequence of inserted DNA. Amplicons were consistent with the FRT-gi 1.2-yKKDyI at attTn7 in MCM441 and 348 being replaced by FRT-cmR-FRT-gi1.x-mKKDyI (The yK and mK designations refer to the mevalonate kinase from Saccharomyces cerevisiae and Methanosarcina mazei respectively).
(444) TABLE-US-00025 TABLE 6A The following strains were grown in LB containing chloramphenicol (5 ug/mL) and frozen. Recom- bination Amplicon Strain ID Name Parent Template MCM442 BL21(DE3) cmR-gi1.6mKKDyI A1, MCM349 MCM484 clone37 (A) MCM443 BL21(DE3) cmR-gi1.0mKKDyI B4, MCM349 MCM485 clone27 (C) MCM444 BL21(DE3) cmR-gi1.2mKKDyI C1, MCM349 MCM486 clone16 (G) MCM445 BL21(DE3) cmR-gi1.5mKKDyI MCM349 MCM487 C3, clone7 (T) MCM446 BL21 cmR-gi1.6mKKDyI A1-3 (A) MCM441 MCM484 MCM447 BL21 cmR-gi1.0mKKDyI B4-6 (C) MCM441 MCM485 MCM448 BL21 cmR-gi1.2mKKDyI C1-5 (G) MCM441 MCM486 MCM449 BL21 cmR-gi1.5mKKDyI C3-3 (T) MCM441 MCM487
(445) TABLE-US-00026 TABLE6B Primers MCM120 AAAGTAGCCGAAGATGACGGTTTGTCACATGGAGTTGGCAGGA TGTTTGATTAAAAGCAATTAACCCTCACTAAAGGGCGG (SEQIDNO:109) MCM193 GATATACATATGAATTAACCCTCACTAAAGG (SEQIDNO:110) MCM195 GCATGCATGACATGTTTTTTTACCTCCTTTGTTATCCGCTCAC AATTAGTGGTTGAATTATTTGCTCAGGATGTGGCATNGTCAAG GGCGCGGCCGCGATCTAATACGACTCACTATAGGGCTCG (SEQIDNO:111) MCM196 AGGCTCTCAACTCTGACATGTTTTTTTCCTCCTTAAGGGTGCA GGCCTATCGCAAATTAGCTTAATCTACTTTCAGACCTTGCTCG G (SEQIDNO:112)
III. The Effect of Yeast Extract on Isoprene Production in E. coli Expressing Genes from the Mevalonic Acid Pathway and Grown in Fed-Batch Culture at the 15-L Scale
(446) Medium Recipe (Per Liter Fermentation Medium):
(447) K.sub.2HPO.sub.4 7.5 g, MgSO.sub.4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, yeast extract 0.5 g, 1000 Modified Trace Metal Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. This solution was autoclaved. The pH was adjusted to 7.0 with ammonium hydroxide (30%) and q.s. to volume. Glucose 10 g, thiamine*HCl 0.1 g, and antibiotics were added after sterilization and pH adjustment.
(448) 1000 Modified Trace Metal Solution:
(449) Citric Acids*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g, CoCl.sub.2*6H.sub.2O 1 g, ZnSO.sub.4*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component is dissolved one at a time in Di H.sub.2O, pH to 3.0 with HCl/NaOH, then q.s. to volume and filter sterilized with a 0.22 micron filter.
(450) Fermentation was performed in a 15-L bioreactor with BL21 (DE3) E. coli cells containing the upper mevalonic acid (MVA) pathway (pCL Upper), the integrated lower MVA pathway (gi1.2KKDyI), and high expression of mevalonate kinase from M. mazei and isoprene synthase from P. alba (pTrcAlba-mMVK). This experiment was carried out to monitor isoprene formation from glucose at the desired fermentation pH 7.0 and temperature 30 C. A frozen vial of the E. coli strain was thawed and inoculated into tryptone-yeast extract medium. After the inoculum grew to OD 1.0, measured at 550 nm, 500 mL was used to inoculate a 15-L bioreactor bringing the initial volume to 5-L.
(451) i) Production of Isoprene in E. coli Cells (EL256) Grown in Fed-Batch Culture without Yeast Extract Feeding
(452) Glucose was fed at an exponential rate until cells reached the stationary phase. After this time the glucose feed was decreased to meet metabolic demands. The total amount of glucose delivered to the bioreactor during the 67 hour fermentation was 3.9 kg. Induction was achieved by adding isopropyl-beta-D-1-thiogalactopyranoside (IPTG). The IPTG concentration was brought to 102 uM when the optical density at 550 nm (OD.sub.550) reached a value of 9. The IPTG concentration was raised to 192 uM when OD.sub.550 reached 140. The OD.sub.550 profile within the bioreactor over time is shown in
(453) Production of Isoprene in E. coli Cells (EL256) Grown in Fed-Batch Culture with Yeast Extract Feeding
(454) Glucose was fed at an exponential rate until cells reached the stationary phase. After this time the glucose feed was decreased to meet metabolic demands. The total amount of glucose delivered to the bioreactor during the 68 hour fermentation was 7.1 kg. A total of 1.06 kg of yeast extract was also fed during the fermentation. Induction was achieved by adding IPTG. The IPTG concentration was brought to 208 uM when the optical density at 550 nm (OD.sub.550) reached a value of 7. The IPTG concentration was raised to 193 uM when OD.sub.550 reached 180. The OD.sub.550 profile within the bioreactor over time is shown in
(455) IV. Production of Isoprene from Different Carbon Sources in E. coli Harboring the Mevalonic Acid (MVA) Pathway and Isoprene Synthase (EWL256)
(456) Media Recipe (Per Liter Fermentation Media):
(457) K.sub.2HPO.sub.4 13.6 g, KH.sub.2PO.sub.4 13.6 g, MgSO.sub.4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, (NH.sub.4).sub.2SO.sub.4 3.2 g, yeast extract 0.2 g, 1000 Modified Trace Metal Solution 1 ml. All of the components were dissolved sequentially in diH.sub.2O. The pH was adjusted to 6.8 with ammonium hydroxide (30%) and brought to volume. Media was filter sterilized with a 0.22 micron filter. Carbon source was added to a final concentration of 1%. Required antibiotics were added after sterilization and pH adjustment.
(458) 1000 Trace Metal Solution (Per Liter Fermentation Media):
(459) Citric Acids*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g, CoCl.sub.2*6H.sub.2O 1 g, ZnSO.sub.4*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component was dissolved one at a time in diH.sub.2O, pH to 3.0 with HCl/NaOH, and then brought to volume and filter sterilized with a 0.22 micron filter.
(460) i) Preparation of AFEX Biomass Hydrolysate
(461) AFEX pretreated corn stover was hydrolyzed to prepare biomass hydrolysate containing both xylose, glucose and acetate.
(462) AFEX pretreated corn stover, received from Michigan Biotechnology Institute, was used. The pretreatment conditions were, 60% moisture, 1:1 ammonia loading, and 90 C. for 30 minutes, then air dried. The moisture content in the AFEX pretreated corn stover was 21.27%. Content of glucan and xylan in the AFEX pretreated corn stover were 31.7% and 19.1% (dry basis) respectively. The enzyme used was accellerase 1000, Grindamyl H121 (Danisco xylanase product from Aspergillus niger for bread-making industry).
(463) For saccharification, 20 g of AFEX pretreated corn stover was added into a 500 ml flask, together with 5 ml of 1 M pH 4.8 sodium citrate buffer, 2.25 ml of Accellerase 1000, 0.1 ml of Grindamyl H121, and 72.65 ml of DI water. The flask was put in an orbital shaker, and incubated at 50 C. for 96 hours.
(464) For analysis, one sample was taken from the shaker, and analyzed using HPLC. The hydrolysate contained 37.2 g/l of glucose and 24.3 g/L of xylose, and 7.6 g/L of oligomers of glucose and/or xylose. Additionally, the hydrolysate also contains 1.17 g/L acetate.
(465) ii) Experimental Procedure
(466) An inoculum of the E. coli strain EWL256 containing the MVA pathway and isoprene synthase was taken from a frozen vial and streaked onto an LB broth agar plate containing spectinomycin (50 ug/mL) and carbinicllin (50 ug/mL) and incubated at 30 C. overnight. A single colony was inoculated into TM3 media containing glucose, xylose, glycerol, acetate or biomass as only carbon source and grown overnight at 30 C. Cells grow on acetate reached a significantly lower optical density. Cells grown on glucose, glycerol, biomass hydrolysate or acetate were diluted into 20 mL of TM3 media containing the respective carbon sources to reach an optical density of between 0.1 measured at 600 nM. A negative control not containing any carbon source was prepared from the glucose overnight culture. A separate experiment was performed with glucose and xylose, where the cultures were diluted to an optical density of 0.05. All culture conditions (except for acetate and glycerol) were tested in duplicates and the presented results are averaged between these cultures. Production of isoprene was induced with 200 M IPTG from the beginning of the experiment. The flasks were incubated at 30 C. in an orbital shaker (200 rpm) and growth was followed by measuring optical density. After the glucose fed cultures had reached an optical density of approximately 0.4, samples were analyzed for isoprene production from all the tested carbon sources every hour for three hours. Samples of 100 L were transferred in duplicates to 2 mL glass vials, sealed and incubated for 30 min at 30 C. The bacteria were then heat killed by incubation at 80 C. for 8 minutes. The amount of produced isoprene was measured using GC-MS and specific productivity (g/L*hr) was calculated.
(467) iii) Results
(468) Significant production of isoprene could be demonstrated during growth on all the tested carbon sources. These carbon sources are examples of common alcohols, organic acids, sugars containing 5 or 6 carbon units (C5 or C6), and biomass hydrolysate.
(469) The initial growth rate on biomass hydrolysate was comparable to the growth rate on glucose (
(470) Suprisingly, bacteria grown on acetate as the only carbon source had a specific productivity of isoprene approximately twice as high as during growth on glucose (
(471) The bacteria grew well with glycerol as only carbon source (
Example 11: Expression of Isoprene-Synthase from Plant in Streptomyces sp.
(472) The gene for isoprene synthase Kudzu was obtained from plasmid pJ201:19813. Plasmid pJ201:19813 encodes isoprene synthase from Pueraia lobata (Kudzu plant) and was codon-optimized for Pseudomonas fluorescens, Pseudomonas putida, Rhodopseudomonas palustris and Corynebacterium (
(473) PUWL201PW (no insert) and pUWL201_iso were introduced in Streptomyces albus J1074 (Sanchez et al., Chem. Biol. 9:519-531, 2002) by transformation of protoplasts as described by Hopwood et al., The John innes foundation, Norwich, 1985.
(474) A 200 l aliquot of protoplast suspensions was transformed with 1.9 g pUWL201PW or 2.9 g pUWL201_iso. After incubation overnight at 28 C. on non-selective R5-agarplates, positive transformants were selected by further incubation for 4 days in R3-overlay agar containing thiostrepton (250 g/ml). Thiostrepton resistant transformants were examined for presence of the pUWL-plasmids by plasmid preparation using Plasmid Mini Kit (Qiagen). Prepared plasmid DNA was reintroduced in E. coli DH5 to generate sufficient amounts of plasmid DNA to be analyzed by restriction analysis. Positive transformants were selected on ampicillin-containing L-agar plates and insert analysis was done by digestion of plasmid DNA with NdeI and BamHI endonucleases. Isoprene synthase was identified as a 1.7 kb fragment in positive pUWL201 iso clones while in the control strains (pUWL201PW) no such fragment was observed.
(475) Wild type strain and transformants of S. albus containing control plasmid pUWL201PW or isoprene synthase encoding pUWL201_iso were analyzed for isoprene formation. Strains were cultivated in duplicate on solid media (tryptic soy broth agar, TSB; 2.5 ml) in presence or absence of thiostrepton (200 g/ml) and incubated for 4 days at 28 C. in sealed head-space vials (total volume 20 ml). 500 l head-space samples (end point measurements) were analyzed by GC-MS in SIM-mode and isoprene was identified according to reference retention times and molecular masses (67 m/z). Isoprene present in head-space samples was quantified by previously generated calibration curves. While wild-type S. albus and control strains harboring pUWL201PW produced isoprene in concentrations slightly higher than the detection limit (0.04-0.07 ppm), S. albus harboring pUWL201_iso produced isoprene in at least tenfold excess compared to controls (0.75 ppm;
Example 12: Production of Isoprene or Mevalonate from Fatty Acid or Palm Oil in E. coli fadR atoC LS5218 Containing the Upper or Upper and Lower Mevalonic Acid Pathway Plus Kudzu Isoprene Synthase
(476) Escherichia coli fadR atoC strain LS5218 (#6966) was obtained from the Coli Genetic Stock Center. FadR encodes a transcription repressor that negatively regulates expression of the genes encoding fatty acid degradation enzymes (Campbell et al., J. Bacteriol. 183: 5982-5990, 2001). AtoC is a response regulator in a two-component regulatory system with AtoS, regulates acetolactate metabolism. The fadR atoC strain allows constitutive expression of the fatty acid degradation genes and incorporates long chain fatty acids into long-chain-length polyhydroxyalkanoates. When palm oil is used as a carbon source for either mevalonate or isoprene production, the palm oil was converted to glycerol plus fatty acid. Methods for this are well known in the art, and it can be done either enzymatically by incubation with a lipase (for example Porcine pancreatic lipase, Candida rugosa lipase, or other similar lipases) or chemically by saponification with a base such as sodium hydroxide.
(477) i) E. coli fadR atoC Strain Expressing the Upper Mevalonic Acid Pathway
(478) Strain WW4 was created by electroporating pCLPtrcUpperPathway into LS5218 using standard methods (Sambrooke et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989). Incorporation of the plasmid was demonstrated by the production of mevalonic acid (MVA) when cells were cultured in TM3 medium supplemented with either C12 fatty acid (FA) or palm oil as the carbon source. To demonstrate production of MVA by WW4 from fatty acid, cells from an overnight culture were diluted 1 to 100 into 5 mL of modified TM3 medium (TM3 without yeast extract) supplemented with 0.25% C12 FA (Sigma cat #L9755). The first sign of MVA production (24 mg/L) was apparent after overnight incubation at 30 C. of the IPTG induced culture. Production increased over three days with the final level of 194 mg/L of MVA produced. To demonstrate production of MVA by WW4 from oil, cells from an overnight culture were diluted 1 to 100 into modified TM3 medium supplemented with 200 mg of digested palm oil per 5 mL of TM3 medium. The first sign of MVA production (50 mg/L) was apparent after overnight incubation of the IPTG induced culture at 30 C. Production increased over three days with a final level of 500 mg/L of MVA produced.
(479) ii) E. coli fadR atoC Strain Expressing the Upper and Lower MVA Pathway Plus Kudzu Isoprene Synthase
(480) Escherichia coli strain WW4 (LS5218 fadR atoC pCLPtrcUpperPathway) was transformed with pMCM118 [pTrcKKDyIkIS] to yield WW10. The incorporation of the plasmid was demonstrated by evidence of production of isoprene when the strain was cultured in TM3 and glucose and induced with IPTG (100, 300, or 900 uM). The strain was relatively sensitive to IPTG and showed a significant growth defect even at 100 uM IPTG. These results are shown in
(481) To test isoprene production from dodecanoic acid, WW10 was cultured overnight in L broth containing spectinomycin (50 ug/ml), and kanamycin (50 ug/ml) at 37 C with shaking at 200 rpm. The cells were washed with modified TM3 medium by centrifugation and resuspension in their original culture volume with this medium. The washed and resuspended cells from this starter culture were diluted 1 to 100 and 1 to 10 into 5 mL of modified TM3 medium containing 0.125% C12 Fatty Acid (Sigma cat #L9755).
(482) To demonstrate production of mevalonate from palm oil, the oil was predigested with lipase at 37 C. and 250 rpm for several days to release the fatty acids (evidence of hydrolysis was judged by the foam formed when tubes were shaken).
(483) In addition, a culture was set up by diluting the washed cells at 1 to 10 into modified TM3 medium contained in test tubes with palm oil. A further tube was set up by the addition of 0.125% C12FA to the remainder (2.5 mL) of the washed cells without further dilution (bioconversion). After 3.75 hours of growth at 30 C. with shaking at 250 rpm all of the cultures were induced by the addition of 50 uM IPTG. Incubation was continued for 4 hours after which time 200 uL of each of the cultures was assayed for isoprene accumulation with a modified head space assay (1 hour accumulation at 30 C. with shaking at 500 rpm). An additional isoprene assay was conducted by a 12 hour incubation of the assay glass block prior to GCMS analysis. Incubation of the induced cultures was continued overnight and 200 uL aliquots were again assayed for isoprene production (1 hour, 30 deg, 500 rpm Shel-Lab shaker) the following morning. Analysis of these cultures showed the production of significant levels of isoprene. The highest levels of isoprene were observed in the culture which was seeded at 1/10 dilution from the overnight starter culture after it had been incubated and induced overnight. This result suggests that this culture continued to grow and increase in cell density. These results are shown in
Example 13: Improvement of Isoprene Production by Constitutive Expression of ybhE in E. coli
(484) This example shows production of isoprene in a strain constitutively expressing ybhE (pgl) compared to a control strain with wild type ybhE. The gene ybhE (pgl) encodes a 6-phosphogluconolactonase that suppresses posttranslational gluconylation of heterologously expressed proteins and improves product solubility and yield while also improving biomass yield and flux through the pentose phosphate pathway (Aon et al. Applied and Environmental Microbiology, 74(4): 950-958, 2008).
(485) The BL21 strain of E. coli producing isoprene (EWL256) was constructed with constitutive expression of the ybhE gene on a replicating plasmid pBBR1MCS5 (Gentamycin) (obtained from Dr. K. Peterson, Louisiana State University).
(486) FRT-based recombination cassettes, and plasmids for Red/ET-mediated integration and antibiotic marker loopout were obtained from Gene Bridges GmbH (Germany). Procedures using these materials were carried out according to Gene Bridges protocols. Primers Pgl-F and PglGI1.5-R were used to amplify the resistance cassette from the FRT-gb2-Cm-FRT template using Stratagene Herculase II Fusion kit according to the manufacturer's protocol. The PCR reaction (50 uL final volume) contained: 5 uL buffer, 1 uL template DNA (FRT-gb2-Cm-F from Gene Bridges), 10 pmols of each primer, and 1.5 uL 25 mM dNTP mix, made to 50 uL with dH.sub.2O. The reaction was cycled as follows: 12 minutes, 95 C. then 30 cycles of (30 seconds at 95 C.; 30 seconds at 63 C.; 3 minutes at 72 C.).
(487) The resulting PCR product was purified using the QiaQick PCR purification kit (Qiagen) and electroporated into electrocompetent MG1655 cells harboring the pRed-ET recombinase-containing plasmid as follows. Cells were prepared by growing in 5 mLs of L broth to and OD6000.6 at 30 C. The cells were induced for recombinase expression by the addition of 4% arabinose and allowed to grow for 30 minutes at 30 C. followed by 30 minutes of growth at 37 C. An aliquot of 1.5 mLs of the cells was washed 3-4 times in ice cold dH.sub.2O. The final cell pellet was resuspended in 40 uL of ice cold dH.sub.2O and 2-5 uL of the PCR product was added. The electroporation was carried out in 1-mm gap cuvettes, at 1.3 kV in a Gene Pulser Electroporator (Bio-Rad Inc.). Cells were recovered for 1-2 hours at 30 C. and plated on L agar containing chloramphenicol (5 ug/mL). Five transformants were analyzed by PCR and sequencing using primers flanking the integration site (2 primer sets: pgl and 49 rev and 3 EcoRV-pglstop; Bottom Pgb2 and Top GB's CMP (946)). A correct transformant was selected and this strain was designated MG1655 GI1.5-pgl::CMP.
(488) The chromosomal DNA of MG1655 GI1.5-pgl::CMP was used as template to generate a PCR fragment containing the FRT-CMP-FRT-GI1.5-ybhE construct. This construct was cloned into pBBR1MCS5 (Gentamycin) as follows. The fragment, here on referred to as CMP-GI1.5-pgl, was amplified using the 5 primer Pglconfirm-F and 3 primer 3 EcoRV-pglstop. The resulting fragment was cloned using the Invitrogen TOPO-Blunt cloning kit into the plasmid vector pCR-Blunt II-TOPO as suggested from the manufacturer. The NsiI fragment harboring the CMP-GI1.5-pgl fragment was cloned into the PstI site of pBBR1MCS5 (Gentamycin). A 20 l ligation reaction was prepared containing 5 l CMP-GI1.5-pgl insert, 2 l pBBR1MCS5 (Gentamycin) vector, 1 l T4 DNA ligase (New England Biolabs), 2 l 10 ligase buffer, and 10 l ddH.sub.2O. The ligation mixture was incubated at room temperature for 40 minutes then 2-4 uL were electroporated into electrocompetent Top 10 cells (Invitrogen) using the parameters disclosed above. Transformants were selected on L agar containing 10 ug/ml chloramphenicol and 5 ug/ml Gentamycin. The sequence of the selected clone was determined using a number of the primers described above as well as with the in-house T3 and Reverse primers provided by Sequetech, CA. This plasmid was designated pBBRCMPGI1.5-pgl (
(489) Plasmid pBBRCMPGI1.5-pgl was electroporated into EWL256, as described above in Example 10 and transformants were plated on L agar containing Chloramphenicol (10 ug/mL), Gentamycin (5 ug/mL), spectinomycin (50 ug/mL), and carbenicillin (50 ug/mL). One transformant was selected and designated RM11608-2.
(490) Primers:
(491) TABLE-US-00027 Pgl-F (SEQIDNO:115) 5-ACCGCCAAAAGCGACTAATTTTAGCTGTTACAGTCAGTTGAATTAA CCCTCACTAAAGGGCGGCCGC-3 PglGI1.5-R (SEQIDNO:116) 5-GCTGGCGATATAAACTGTTTGCTTCATGAATGCTCCTTTGGGTTAC CTCCGGGAAACGCGGTTGATTTGTTTAGTGGTTGAATTATTTGCTCAGG ATGTGGCATAGTCAAGGGCGTGACGGCTCGCTAATACGACTCACTATAG GGCTCGAG-3 3 EcoRV-pglstop: (SEQIDNO:117) 5-CTTGATATCTTAGTGTGCGTTAACCACCAC pgl+49rev: (SEQIDNO:118) CGTGAATTTGCTGGCTCTCAG BottomPgb2: (SEQIDNO:119) GGTTTAGTTCCTCACCTTGTC TopGBsCMP(946): (SEQIDNO:120) ACTGAAACGTTTTCATCGCTC Pglconfirm-F (SEQIDNO:121) 5-ACCGCCAAAAGCGACTAATTTTAGCT-3
i) Small Scale Analysis
(492) Media Recipe (Per Liter Fermentation Media):
(493) K.sub.2HPO.sub.4 13.6 g, KH.sub.2PO.sub.4 13.6 g, MgSO.sub.4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, (NH.sub.4).sub.2SO.sub.4 3.2 g, yeast extract 1 g, 1000 Trace Metals Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. The pH was adjusted to 6.8 with ammonium hydroxide (30%) and brought to volume. Media was filter-sterilized with a 0.22 micron filter. Glucose 5.0 g and antibiotics were added after sterilization and pH adjustment.
(494) 1000 Trace Metal Solution (Per Liter Fermentation Media):
(495) Citric Acid*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g, CoCl.sub.2*6H.sub.2O 1 g, ZnSO.sub.4*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component is dissolved one at a time in diH.sub.2O. The pH is adjusted to 3.0 with HCl/NaOH, and then the solution is brought to volume and filter-sterilized with a 0.22 micron filter.
(496) a) Experimental Procedure
(497) Isoprene production was analyzed by growing the strains in a Cellerator from MicroReactor Technologies, Inc. The working volume in each of the 24 wells was 4.5 mL. The temperature was maintained at 30 C., the pH setpoint was 7.0, the oxygen flow setpoint was 20 sccm and the agitation rate was 800 rpm. An inoculum of E. coli strain taken from a frozen vial was streaked onto an LB broth agar plate (with antibiotics) and incubated at 30 C. A single colony was inoculated into media with antibiotics and grown overnight. The bacteria were diluted into 4.5 mL of media with antibiotics to reach an optical density of 0.05 measured at 550 nm.
(498) Off-gas analysis of isoprene was performed using a gas chromatograph-mass spectrometer (GC-MS) (Agilent) headspace assay. Sample preparation was as follows: 100 pL of whole broth was placed in a sealed GC vial and incubated at 30 C. for a fixed time of 30 minutes. Following a heat kill step, consisting of incubation at 70 C. for 5 minutes, the sample was loaded on the GC.
(499) Optical density (OD) at a wavelength of 550 nm was obtained using a microplate reader (Spectramax) during the course of the run. Specific productivity was obtained by dividing the isoprene concentration (g/L) by the OD reading and the time (hour).
(500) The two strains EWL256 and RM11608-2 were assessed at 200 and 400 uM IPTG induction levels. Samples were analyzed for isoprene production and cell growth (OD550) at 1, 2.5, 4.75, and 8 hours post-induction. Samples were done in duplicate.
(501) b) Results
(502) The experiment demonstrated that at 2 different concentrations of IPTG the strain expressing the ybhE (pgl) had a dramatic 2-3 fold increase in specific productivity of isoprene compared to the control strain.
(503) ii) Isoprene Fermentation from E. coli Expressing M. mazei Mevalonate Kinase, P. alba Isoprene Synthase, and Pgl Over-Expression (RHM111608-2) and Grown in Fed-Batch Culture at the 15-L Scale
(504) Medium Recipe (Per Liter Fermentation Medium)
(505) K.sub.2HPO.sub.4 7.5 g, MgSO.sub.4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, yeast extract 0.5 g, 1000 Modified Trace Metal Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. This solution was autoclaved. The pH was adjusted to 7.0 with ammonium hydroxide (30%) and q.s. to volume. Glucose 10 g, thiamine*HCl 0.1 g, and antibiotics were added after sterilization and pH adjustment.
(506) 1000 Modified Trace Metal Solution:
(507) Citric Acids*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g, CoCl.sub.2*6H.sub.2O 1 g, ZnSO.sub.4*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component is dissolved one at a time in Di H.sub.2O, pH to 3.0 with HCl/NaOH, then q.s. to volume and filter sterilized with a 0.22 micron filter
(508) Fermentation was performed in a 15-L bioreactor with BL21 (DE3) E. coli cells containing the upper mevalonic acid (MVA) pathway (pCL Upper), the integrated lower MVA pathway (gi1.2KKDyI), high expression of mevalonate kinase from M. mazei and isoprene synthase from P. alba (pTrcAlba-mMVK), and high expression of pgl (pBBR-pgl). This experiment was carried out to monitor isoprene formation from glucose at the desired fermentation pH 7.0 and temperature 34 C. A frozen vial of the E. coli strain was thawed and inoculated into tryptone-yeast extract medium. After the inoculum grew to OD 1.0, measured at 550 nm, 500 mL was used to inoculate a 15-L bioreactor bringing the initial volume to 5-L.
(509) Glucose was fed at an exponential rate until cells reached the stationary phase. After this time the glucose feed was decreased to meet metabolic demands. The total amount of glucose delivered to the bioreactor during the 40 hour (59 hour) fermentation was 3.1 kg (4.2 kg at 59 hour). Induction was achieved by adding IPTG. The IPTG concentration was brought to 110 uM when the optical density at 550 nm (OD.sub.550) reached a value of 4. The IPTG concentration was raised to 192 uM when OD.sub.550 reached 150. The OD.sub.550 profile within the bioreactor over time is shown in
(510) Unless defined otherwise, the meanings of all technical and scientific terms used herein are those commonly understood by one of skill in the art to which this invention belongs. Singleton, et al., Dictionary of Microbiology and Molecular Biology, 2nd ed., John Wiley and Sons, New York (1994), and Hale & Marham, The Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) provide one of skill with a general dictionary of many of the terms used in this invention. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary. One of skill in the art will also appreciate that any methods and materials similar or equivalent to those described herein can also be used to practice or test the invention.
(511) The headings provided herein are not limitations of the various aspects or embodiments of the invention which can be had by reference to the specification as a whole.
(512) For use herein, unless clearly indicated otherwise, use of the terms a, an, and the like refers to one or more.
(513) Reference to about a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to about X includes description of X. Numeric ranges are inclusive of the numbers defining the range.
(514) It is understood that aspects and embodiments of the invention described herein include comprising, consisting, and consisting essentially of aspects and embodiments.
APPENDIX 1
Exemplary 1-deoxy-D-xylulose-5-phosphate synthase nucleic acids and polypeptides
(515) ATH: AT3G21500(DXPS1) AT4G15560(CLA1) AT5G11380(DXPS3)
(516) OSA: 4338768 4340090 4342614
(517) CME: CMFO89C
(518) PFA: MAL13P1.186
(519) TAN: TA20470
(520) TPV: TP01_0516
(521) ECO: b0420(dxs)
(522) ECJ: JW0410(dxs)
(523) ECE: Z0523(dxs)
(524) ECS: ECs0474
(525) ECC: c0531(dxs)
(526) ECI: UTI89_C0443(dxs)
(527) ECP: ECP_0479
(528) ECV: APECO1_1590(dxs)
(529) ECW: EcE24377A_0451(dxs)
(530) ECX: EcHS_A0491
(531) STY: STY0461(dxs)
(532) STT: t2441(dxs)
(533) SPT: SPA2301(dxs)
(534) SEC: SC0463(dxs)
(535) STM: STM0422(dxs)
(536) YPE: YPO3177(dxs)
(537) YPK: y1008(dxs)
(538) YPM: YP_0754(dxs)
(539) YPA: YPA_2671
(540) YPN: YPN_0911
(541) YPP: YPDSF_2812
(542) YPS: YPTB0939(dxs)
(543) YPI: YpsIP31758_3112(dxs)
(544) SFL: SF0357(dxs)
(545) SFX: S0365(dxs)
(546) SFV: SFV_0385(dxs)
(547) SSN: SSON_0397(dxs)
(548) SBO: SBO_0314(dxs)
(549) SDY: SDY_0310(dxs)
(550) ECA: ECA1131(dxs)
(551) PLU: plu3887(dxs)
(552) BUC: BU464(dxs)
(553) BAS: BUsg448(dxs)
(554) WBR: WGLp144(dxs)
(555) SGL: SG0656
(556) KPN: KPN_00372(dxs)
(557) BFL: Bfl238(dxs)
(558) BPN: BPEN_244(dxs)
(559) HIN: HI1439(dxs)
(560) HIT: NTHI1691(dxs)
(561) HIP: CGSHiEE_04795
(562) HIQ: CGSHiGG_01080
(563) HDU: HD0441(dxs)
(564) HSO: HS_0905(dxs)
(565) PMU: PM0532(dxs)
(566) MSU: MS 1059(dxs)
(567) APL: APL_0207(dxs)
(568) XFA: XF2249
(569) XFT: PD1293(dxs)
(570) XCC: XCC2434(dxs)
(571) XCB: XC_1678
(572) XCV: XCV2764(dxs)
(573) XAC: XAC2565(dxs)
(574) XOO: XOO2017(dxs)
(575) XOM: XOO_1900(XOO1900)
(576) VCH: VC0889
(577) VVU: VV1_0315
(578) VVY: VV0868
(579) VPA: VP0686
(580) VFI: VF0711
(581) PPR: PBPRA0805
(582) PAE: PA4044(dxs)
(583) PAU: PA14_11550(dxs)
(584) PAP: PSPA7_1057(dxs)
(585) PPU: PP_0527(dxs)
(586) PST: PSPTO_0698(dxs)
(587) PSB: Psyr_0604
(588) PSP: PSPPH_0599(dxs)
(589) PFL: PFL_5510(dxs)
(590) PFO: Pfl_5007
(591) PEN: PSEEN0600(dxs)
(592) PMY: Pmen_3844
(593) PAR: Psyc_0221(dxs)
(594) PCR: Pcryo_0245
(595) ACI: ACIAD3247(dxs)
(596) SON: SO_1525(dxs)
(597) SDN: Sden_2571
(598) SFR: Sfri_2790
(599) SAZ: Sama_2436
(600) SBL: Sbal_1357
(601) SLO: Shew_2771
(602) SHE: Shewmr4_2731
(603) SHM: Shewmr7_2804
(604) SHN: Shewana3_2901
(605) SHW: Sputw3181_2831
(606) ILO: IL2138(dxs)
(607) CPS: CPS_1088(dxs)
(608) PHA: PSHAa2366(dxs)
(609) PAT: Patl_1319
(610) SDE: Sde_3381
(611) PIN: Ping_2240
(612) MAQ: Maqu_2438
(613) MCA: MCA0817(dxs)
(614) FTU: FTT1018c(dxs)
(615) FTF: FTF1018c(dxs)
(616) FTW: FTW_0925(dxs)
(617) FTL: FTL_1072
(618) FTH: FTH_1047(dxs)
(619) FTA: FTA_1131(dxs)
(620) FTN: FTN_0896(dxs)
(621) NOC: Noc_1743
(622) AEH: Mlg_1381
(623) HCH: HCH_05866(dxs)
(624) CSA: Csal_0099
(625) ABO: ABO_2166(dxs)
(626) AHA: AHA_3321(dxs)
(627) BCI: BCI_0275(dxs)
(628) RMA: Rmag_0386
(629) VOK: COSY_0360(dxs)
(630) NME: NMB1867
(631) NMA: NMA0589(dxs)
(632) NMC: NMC0352(dxs)
(633) NGO: NGO0036
(634) CVI: CV_2692(dxs)
(635) RSO: RSc2221(dxs)
(636) REU: Reut_A0882
(637) REH: H16_A2732(dxs)
(638) RME: Rmet_2615
(639) BMA: BMAA0330(dxs)
(640) BMV: BMASAVP1_1512(dxs)
(641) BML: BMA10299_1706(dxs)
(642) BMN: BMA10247_A0364(dxs)
(643) BXE: Bxe_B2827
(644) BUR: Bcep18194_B2211
(645) BCN: Bcen_4486
(646) BCH: Bcen2424_3879
(647) BAM: Bamb_3250
(648) BPS: BPSS1762(dxs)
(649) BPM: BURPS1710b_A0842(dxs)
(650) BPL: BURPS1106A_A2392(dxs)
(651) BPD: BURPS668_A2534(dxs)
(652) BTE: BTH_II0614(dxs)
(653) BPE: BP2798(dxs)
(654) BPA: BPP2464(dxs)
(655) BBR: BB1912(dxs)
(656) RFR: Rfer_2875
(657) POL: Bpro_1747
(658) PNA: Pnap_1501
(659) AJS: Ajs_1038
(660) MPT: Mpe_A2631
(661) HAR: HEAR0279(dxs)
(662) MMS: mma_0331
(663) NEU: NE1161(dxs)
(664) NET: Neut_1501
(665) NMU: Nmul_A0236
(666) EBA: ebA4439(dxs)
(667) AZO: azol 198(dxs)
(668) DAR: Daro_3061
(669) TBD: Tbd_0879
(670) MFA: Mfla_2133
(671) HPY: HP0354(dxs)
(672) HPJ: jhp0328(dxs)
(673) HPA: HPAG1_0349
(674) HHE: HH0608(dxs)
(675) HAC: Hac_0968(dxs)
(676) WSU: WS1996
(677) TDN: Tmden_0475
(678) CJE: Cj0321(dxs)
(679) CJR: CJE0366(dxs)
(680) CJJ: CJJ81176_0343(dxs)
(681) CJU: C8J_0298(dxs)
(682) CJD: JJD26997_1642(dxs)
(683) CFF: CFF8240_0264(dxs)
(684) CCV: CCV52592_1671(dxs) CCV52592_1722
(685) CHA: CHAB381_1297(dxs)
(686) CCO: CCC13826_1594(dxs)
(687) ABU: Abu_2139(dxs)
(688) NIS: NIS_0391(dxs)
(689) SUN: SUN_2055(dxs)
(690) GSU: GSU0686(dxs-1) GSU1764(dxs-2)
(691) GME: Gmet_1934 Gmet_2822
(692) PCA: Pcar_1667
(693) PPD: Ppro_1191 Ppro_2403
(694) DVU: DVU1350(dxs)
(695) DVL: Dvul_1718
(696) DDE: Dde_2200
(697) LIP: LI0408(dsx)
(698) DPS: DP2700
(699) ADE: Adeh_1097
(700) MXA: MXAN_4643(dxs)
(701) SAT: SYN_02456
(702) SFU: Sfum_1418
(703) PUB: SAR11_0611(dxs)
(704) MLO: mlr7474
(705) MES: Meso_0735
(706) SME: SMc00972(dxs)
(707) ATU: Atu0745(dxs)
(708) ATC: AGR_C_1351
(709) RET: RHE_CH00913(dxs)
(710) RLE: RL0973(dxs)
(711) BME: BMEI1498
(712) BMF: BAB1_0462(dxs)
(713) BMS: BR0436(dxs)
(714) BMB: BruAb1_0458(dxs)
(715) BOV: BOV_0443(dxs)
(716) BJA: bll2651(dxs)
(717) BRA: BRADO2161(dxs)
(718) BBT: BBta_2479(dxs)
(719) RPA: RPA0952(dxs)
(720) RPB: RPB_4460
(721) RPC: RPC_1149
(722) RPD: RPD_4305
(723) RPE: RPE_1067
(724) NWI: Nwi_0633
(725) NHA: Nham_0778
(726) BHE: BH04350(dxs)
(727) BQU: BQ03540(dxs)
(728) BBK: BARBAKC583_0400(dxs)
(729) CCR: CC_2068
(730) SIL: SPO0247(dxs)
(731) SIT: TM1040 2920
(732) RSP: RSP_0254(dxsA) RSP_1134(dxs)
(733) JAN: Jann_0088 Jann_0170
(734) RDE: RD1_0101(dxs) RD1_0548(dxs)
(735) MMR: Mmar10_0849
(736) HNE: HNE_1838(dxs)
(737) ZMO: ZMO1234(dxs) ZMO1598(dxs)
(738) NAR: Saro_0161
(739) SAL: Sala_2354
(740) ELI: ELI_12520
(741) GOX: GOX0252
(742) GBE: GbCGDNIH1_0221 GbCGDNIH1_2404
(743) RRU: Rru_A0054 Rru_A2619
(744) MAG: amb2904
(745) MGM: Mmc1_1048
(746) SUS: Acid_1783
(747) BSU: BG11715(dxs)
(748) BHA: BH2779
(749) BAN: BA4400(dxs)
(750) BAR: GBAA4400(dxs)
(751) BAA: BA_4853
(752) BAT: BAS4081
(753) BCE: BC4176(dxs)
(754) BCA: BCE_4249(dxs)
(755) BCZ: BCZK3930(dxs)
(756) BTK: BT9727_3919(dxs)
(757) BTL: BALH_3785(dxs)
(758) BLI: BL01523(dxs)
(759) BLD: BLi02598(dxs)
(760) BCL: ABC2462(dxs)
(761) BAY: RBAM_022600
(762) BPU: BPUM_2159
(763) GKA: GK2392
(764) GTN: GTNG_2322
(765) LMO: lmo1365(tktB)
(766) LMF: LMOf2365_1382(dxs)
(767) LIN: linl402(tktB)
(768) LWE: lwe1380(tktB)
(769) LLA: L108911(dxsA) L123365(dxsB)
(770) LLC: LACR_1572 LACR_1843
(771) LLM: llmg_0749(dxsB)
(772) SAK: SAK_0263
(773) LPL: lp_2610(dxs)
(774) LJO: LJ0406
(775) LAC: LBA0356
(776) LSL: LSL_0209(dxs)
(777) LGA: LGAS_0350
(778) STH: STH1842
(779) CAC: CAC2077 CA_P0106(dxs)
(780) CPE: CPE1819
(781) CPF: CPF_2073(dxs)
(782) CPR: CPR_1787(dxs)
(783) CTC: CTC01575
(784) CNO: NT01CX_1983
(785) CTH: Cthe_0828
(786) CDF: CD1207(dxs)
(787) CBO: CBO1881(dxs)
(788) CBA: CLB_1818(dxs)
(789) CBH: CLC_1825(dxs)
(790) CBF: CLI_1945(dxs)
(791) CKL: CKL_1231(dxs)
(792) CHY: CHY_1985(dxs)
(793) DSY: DSY2348
(794) DRM: Dred_1078
(795) PTH: PTH_1196(dxs)
(796) SWO: Swol_0582
(797) CSC: Csac_1853
(798) TTE: TTE1298(dxs)
(799) MTA: Moth_1511
(800) MPE: MYPE730
(801) MGA: MGA_1268(dxs)
(802) MTU: Rv2682c(dxs1) Rv3379c(dxs2)
(803) MTC: MT2756(dxs)
(804) MBO: Mb2701c(dxs1) Mb3413c(dxs2)
(805) MLE: ML1038(dxs)
(806) MPA: MAP2803c(dxs)
(807) MAV: MAV_3577(dxs)
(808) MSM: MSMEG_2776(dxs)
(809) MMC: Mmcs_2208
(810) CGL: NCgl1827(cgl 1902)
(811) CGB: cg2083(dxs)
(812) CEF: CE1796
(813) CDI: DIP1397(dxs)
(814) CJK: jk1078(dxs)
(815) NFA: nfa37410(dxs)
(816) RHA: RHA1_ro06843
(817) SCO: SCO6013(SC1C3.01) SCO6768(SC6A5.17)
(818) SMA: SAV1646(dxs1) SAV2244(dxs2)
(819) TWH: TWT484
(820) TWS: TW280(Dxs)
(821) LXX: Lxx10450(dxs)
(822) CMI: CMM_1660(dxsA)
(823) AAU: AAur_1790(dxs)
(824) PAC: PPA1062
(825) TFU: Tfu_1917
(826) FRA: Francci3_1326
(827) FAL: FRAAL2088(dxs)
(828) ACE: Acel_1393
(829) SEN: SACE_1815(dxs) SACE_4351
(830) BLO: BL1132(dxs)
(831) BAD: BAD_0513(dxs)
(832) FNU: FN1208 FN1464
(833) RBA: RB2143(dxs)
(834) CTR: CT331(dxs)
(835) CTA: CTA_0359(dxs)
(836) CMU: TC0608
(837) CPN: CPn1060(tktB_2)
(838) CPA: CP0790
(839) CPJ: CPj 1060(tktB_2)
(840) CPT: CpB1102
(841) CCA: CCA00304(dxs)
(842) CAB: CAB301(dxs)
(843) CFE: CF0699(dxs)
(844) PCU: pc0619(dxs)
(845) TPA: TP0824
(846) TDE: TDE1910(dxs)
(847) LIL: LA3285(dxs)
(848) LIC: LIC10863(dxs)
(849) LBJ: LBJ_0917(dxs)
(850) LBL: LBL_0932(dxs)
(851) SYN: sll1945(dxs)
(852) SYW: SYNW1292(Dxs)
(853) SYC: sycl087_c(dxs)
(854) SYF: Synpcc7942_0430
(855) SYD: Syncc9605_1430
(856) SYE: Syncc9902_1069
(857) SYG: sync_1410(dxs)
(858) SYR: SynRCC307_1390(dxs)
(859) SYX: SynWH7803_1223(dxs)
(860) CYA: CYA_1701(dxs)
(861) CYB: CYB_1983(dxs)
(862) TEL: tll0623
(863) GVI: gll0194
(864) ANA: alr0599
(865) AVA: Ava_4532
(866) PMA: Pro0928(dxs)
(867) PMM: PMM0907(Dxs)
(868) PMT: PMT0685(dxs)
(869) PMN: PMN2A_0300
(870) PMI: PMT9312_0893
(871) PMB: A9601_09541(dxs)
(872) PMC: P9515_09901(dxs)
(873) PMF: P9303_15371(dxs)
(874) PMG: P9301_09521(dxs)
(875) PMH: P9215_09851
(876) PMJ: P9211_08521
(877) PME: NATL1_09721(dxs)
(878) TER: Tery_3042
(879) BTH: BT_1403 BT_4099
(880) BFR: BF0873 BF4306
(881) BFS: BF0796(dxs) BF4114
(882) PGI: PG2217(dxs)
(883) CHU: CHU_3643(dxs)
(884) GFO: GFO_3470(dxs)
(885) FPS: FP0279(dxs)
(886) CTE: CT0337(dxs)
(887) CPH: Cpha266_0671
(888) PVI: Cvib_0498
(889) PLT: Plut_0450
(890) DET: DET0745(dxs)
(891) DEH: cbdb_A720(dxs)
(892) DRA: DR_1475
(893) DGE: Dgeo_0994
(894) TTH: TTC1614
(895) TTJ: TTHA0006
(896) AAE: aq_881
(897) TMA: TM1770
(898) PMO: Pmob_1001
Exemplary Acetyl-CoA-Acetyltransferase Nucleic Acids and Polypeptides
(899) HSA: 38(ACAT1) 39(ACAT2) PTR: 451528(ACAT1) MCC: 707653(ACAT1) 708750(ACAT2) MMU: 110446(Acat1) 110460(Acat2) RNO: 25014(Acat1) CFA: 484063(ACAT2) 489421(ACAT1) GGA: 418968(ACAT1) 421587(RCJMB04_34i5) XLA: 379569(MGC69098) 414622(MGC81403) 414639(MGC81256) 444457(MGC83664) XTR: 394562(acat2) DRE: 30643(acat2) SPU: 759502(LOC759502) DME: Dmel_CG10932 Dmel_CG9149 CEL: T02G5.4 T02G5.7 T02G5.8(kat-1) ATH: AT5G48230(ACAT2/EMB 1276) OSA: 4326136 4346520 CME: CMA042C CME087C SCE: YPL028W(ERG10) AGO: AGOS_ADR165C PIC: PICST_31707(ERG10) CAL: CaO19.1591(ergl0) CGR: CAGL0L12364g SPO: SPBC215.09c MGR: MGG_01755 MGG_13499 ANI: AN1409.2 AFM: AFUA_6G14200 AFUA_8G04000 AOR: AO090103000012 AO090103000406 CNE: CNC05280 UMA: UM03571.1 DDI: DDB_0231621 PFA: PF14_0484 TET: TTHERM_00091590 TTHERM_00277470 TTHERM_00926980 TCR: 511003.60 ECO: b2224(atoB) ECJ: JW2218(atoB) JW5453(yqeF) ECE: Z4164(yqeF) ECS: ECs3701 ECC: c2767(atoB) c3441(yqeF) ECI: UTI89_C2506(atoB) UTI89_C3247(yqeF) ECP: ECP_2268 ECP_2857 ECV: APECO1_3662(yqeF) APECO1_4335(atoB) APECO1_43352(atoB) ECX: EcHS_A2365 STY: STY3164(yqeF) STT: t2929(yqeF) SPT: SPA2886(yqeF) SEC: SC2958(yqeF) STM: STM3019(yqeF) SFL: SF2854(yqeF) SFX: S3052(yqeF) SFV: SFV_2922(yqeF) SSN: SSON_2283(atoB) SSON_3004(yqeF) SBO: SBO_2736(yqeF) ECA: ECA1282(atoB) ENT: Ent638_3299 SPE: Spro_0592 HIT: NTHI0932(atoB) XCC: XCC1297(atoB) XCB: XC_2943 XCV: XCV1401(thlA) XAC: XAC1348(atoB) XOO: XOO1881(atoB) XOM: XOO_1778(XOO1778) VCH: VCA0690 VCO: VC0395 0630 VVU: VV2_0494 VV2_0741 VVY: VVA1043 VVA1210 VPA: VPA0620 VPA1123 VPA1204 PPR: PBPRB1112 PBPRB1840 PAE: PA2001(atoB) PA2553 PA3454 PA3589 PA3925 PAU: PA14_38630(atoB) PPU: PP_2051(atoB) PP_2215(fadAx) PP_3754 PP_4636 PPF: Pput_2009 Pput_2403 Pput_3523 Pput_4498 PST: PSPTO_0957(phbA-1) PSPTO_3164(phbA-2) PSB: Psyr_0824 Psyr_3031 PSP: PSPPH_0850(phbA1) PSPPH_2209(phbA2) PFL: PFL_1478(atoB-2) PFL_2321 PFL_3066 PFL_4330(atoB-2) PFL_5283 PFO: Pfl 1269 Pfl 1739 Pfl 2074 Pfl 2868 PEN: PSEEN3197 PSEEN3547(fadAx) PSEEN4635(phbA) PMY: Pmen_1138 Pmen_2036 Pmen_3597 Pmen_3662 Pmen_3820 PAR: Psyc_0252 Psyc_1169 PCR: Pcryo_0278 Pcryo_1236 Pcryo_1260 PRW: PsycPRwf_2011 ACI: ACIAD0694 ACIAD1612 ACIAD2516(atoB) SON: SO_1677(atoB) SDN: Sden_1943 SFR: Sfri_1338 Sfri_2063 SAZ: Sama_1375 SBL: Sbal_1495 SBM: Shew185_1489 SBN: Sbal195_1525 SLO: Shew_1667 Shew_2858 SPC: Sputcn32_1397 SSE: Ssed_1473 Ssed_3533 SPL: Spea_2783 SHE: Shewmr4_2597 SHM: Shewmr7_2664 SHN: Shewana3_2771 SHW: Sputw3181_2704 ILO: IL0872 CPS: CPS_1605 CPS_2626 PHA: PSHAa0908 PSHAa1454(atoB) PSHAal586(atoB) PAT: Patl_2923 SDE: Sde_3149 PIN: Ping_0659 Ping 2401 MAQ: Maqu_2117 Maqu_2489 Maqu_2696 Maqu_3162 CBU: CBU_0974 LPN: lpg1825(atoB) LPF: lpl1789 LPP: lpp1788 NOC: Noc_1891 AEH: Mlg_0688 Mlg_2706 HHA: Hhal_1685 HCH: HCH_05299 CSA: Csal_0301 Csal_3068 ABO: ABO_0648(fadAx) MMW: Mmwyl1_0073 Mmwyl1_3021 Mmwyl1_3053 Mmwyl1_3097 Mmwyl1_4182 AHA: AHA_2143(atoB) CVI: CV_2088(atoB) CV_2790(phaA) RSO: RSc0276(atoB) RSc1632(phbA) RSc1637(bktB) RSc1761(RS02948) REU: Reut_A0138 Reut_A1348 Reut_A1353 Reut_B4561 Reut_B4738 Reut_B5587 Reut_C5943 Reut_C6062 REH: H16_A0170 H16_A0867 H16_A0868 H16_A0872 H16_A1297 H16_A1438(phaA) H16_A1445(bktB) H16_A1528 H16_A1713 H16_A1720 H16_A1887 H16_A2148 H16_B0380 H16_B0381 H16_B0406 H16_B0662 H16_B0668 H16_B0759 H16_B1369 H16_B1771 RME: Rmet_0106 Rmet_1357 Rmet_1362 Rmet_5156 BMA: BMA1316 BMA1321(phbA) BMA1436 BMV: BMASAVP_A1805(bktB) BMASAVP1_A1810(phbA) BML: BMA10299_A0086(phbA) BMA10299_A0091 BMN: BMA10247_1076(bktB) BMA10247_1081(phbA) BXE: Bxe_A2273 Bxe_A2335 Bxe_A2342 Bxe_A4255 Bxe_B0377 Bxe_B0739 Bxe_C0332 Bxe_C0574 Bxe_C0915 BVI: Bcep1808_0519 Bcep1808_1717 Bcep1808_2877 Bcep1808_3594 Bcep1808_4015 Bcep1808_5507 Bcep1808_5644 BUR: Bcep18194_A3629 Bcep18194_A5080 Bcep18194_A5091 Bcep18194_A6102 Bcep18194_B0263 Bcep18194_B1439 Bcep18194_C6652 Bcep18194_C6802 Bcep18194_C6874 Bcep18194_C7118 Bcep18194_C7151 Bcep18194_C7332 BCN: Bcen_1553 Bcen_1599 Bcen_2158 Bcen_2563 Bcen_2998 Bcen_6289 BCH: Bcen2424_0542 Bcen2424_1790 Bcen2424_2772 Bcen2424_5368 Bcen2424_6232 Bcen2424_6276 BAM: Bamb_0447 Bamb_1728 Bamb_2824 Bamb_4717 Bamb_5771 Bamb_5969 BPS: BPSL1426 BPSL1535(phbA) BPSL1540 BPM: BURPS1710b_2325(bktB) BURPS1710b_2330(phbA) BURPS1710b_2453 (atoB-2) BPL: BURPS1106A_2197(bktB) BURPS1106A_2202(phbA) BPD: BURPS668_2160(bktB) BURPS668_2165(phbA) BTE: BTH_12144 BTH_12256 BTH_12261 PNU: Pnuc_0927 BPE: BP0447 BP0668 BP2059 BPA: BPP0608 BPP1744 BPP3805 BPP4216 BPP4361 BBR: BB0614 BB3364 BB4250 BB4804 BB4947 RFR: Rfer_0272 Rfer_1000 Rfer_1871 Rfer_2273 Rfer_2561 Rfer_2594 Rfer_3839 POL: Bpro_1577 Bpro_2140 Bpro_3113 Bpro_4187 PNA: Pnap_0060 Pnap_0458 Pnap_0867 Pnap_1159 Pnap_2136 Pnap_2804 AAV: Aave_0031 Aave_2478 Aave_3944 Aave_4368 AJS: Ajs_0014 Ajs_0124 Ajs_1931 Ajs_2073 Ajs_2317 Ajs_3548 Ajs_3738 Ajs_3776 VEI: Veis_1331 Veis_3818 Veis_4193 DAC: Daci_0025 Daci_0192 Daci_3601 Daci_5988 MPT: Mpe_A1536 Mpe_A1776 Mpe_A1869 Mpe_A3367 HAR: HEAR0577(phbA) MMS: mma_0555 NEU: NE2262(bktB) NET: Neut_0610 EBA: ebA5202 p2A409(tioL) AZO: azo0464(fadA1) azo0469(fadA2) azo2172(thlA) DAR: Daro_0098 Daro_3022 HPA: HPAG1_0675 HAC: Hac_0958(atoB) GME: Gmet_1719 Gmet_2074 Gmet_2213 Gmet_2268 Gmet_3302 GUR: Gura_3043 BBA: Bd0404(atoB) Bd2095 DOL: Dole_0671 Dole_1778 Dole_2160 Dole_2187 ADE: Adeh_0062 Adeh_2365 AFW: Anae109_0064 Anae109_1504 MXA: MXAN_3791 SAT: SYN_02642 SFU: Sfum_2280 Sfum_3582 RPR: RP737 RCO: RC1134 RC1135 RFE: RF_0163(paaJ) RBE: RBE_0139(paaJ) RAK: A1C_05820 RBO: A1I_07215 RCM: A1E_04760 PUB: SAR11_0428(thlA) MLO: mlr3847 MES: Meso_3374 PLA: Plav_1573 Plav_2783 SME: SMa1450 SMc03879(phbA) SMD: Smed_0499 Smed_3117 Smed_5094 Smed_5096 ATU: Atu2769(atoB) Atu3475 ATC: AGR_C_5022(phbA) AGR_L_2713 RET: RHE_CH04018(phbAch) RHE_PC00068(ypc00040) RHE_PF00014(phbAf) RLE: RL4621(phaA) pRL100301 pRL120369 BME: BMEI0274 BMEII0817 BMF: BAB1_1783(phbA-1) BAB2_0790(phbA-2) BMS: BR1772(phbA-1) BRA0448(phbA-2) BMB: BruAb1_1756(phbA-1) BruAb2_0774(phbA-2) BOV: BOV_1707(phbA-1) OAN: Oant_1130 Oant_3107 Oant_3718 Oant_4020 BJA: b110226(atoB) b113949 b117400 b117819 blr3724(phbA) BRA: BRADO0562(phbA) BRADOO0983(pimB) BRADO3110 BRADO3134(atoB) BBT: BBta_3558 BBta_3575(atoB) BBta_5147(pimB) BBta_7072(pimB) BBta_7614(phbA) RPA: RPA0513(pcaF) RPA0531 RPA3715(pimB) RPB: RPB_0509 RPB_0525 RPB_1748 RPC: RPC_0504 RPC_0636 RPC_0641 RPC_0832 RPC_1050 RPC_2005 RPC_2194 RPC_2228 RPD: RPD_0306 RPD_0320 RPD_3105 RPD_3306 RPE: RPE_0168 RPE_0248 RPE_3827 NWI: Nwi_3060 XAU: Xaut_3108 Xaut_4665 CCR: CC_0510 CC_0894 CC_3462 SIL: SPO0142(bktB) SPO0326(phbA) SPO0773 SPO3408 SIT: TM1040_0067 TM1040_2790 TM1040_3026 TM1040_3735 RSP: RSP_0745 RSP_1354 RSP_3184 RSH: Rsph17029_0022 Rsph17029_2401 Rsph17029_3179 Rsph17029_3921 RSQ: Rsph17025_0012 Rsph17025_2466 Rsph17025_2833 JAN: Jann_0262 Jann_0493 Jann_4050 RDE: RD1_0025 RD1_0201(bktB) RD1_3394(phbA) PDE: Pden_2026 Pden_2663 Pden_2870 Pden_2907 Pden_4811 Pden_5022 DSH: Dshi_0074 Dshi_3066 Dshi_3331 MMR: Mmar10_0697 HNE: HNE_2706 HNE_3065 HNE_3133 NAR: Saro_0809 Saro_1069 Saro_1222 Saro_2306 Saro_2349 SAL: Sala_0781 Sala_1244 Sala_2896 Sala_3158 SWI: Swit_0632 Swit_0752 Swit_2893 Swit_3602 Swit_4887 Swit_5019 Swit_5309 ELI: ELI_01475 ELI_06705 ELI_12035 GBE: GbCGDNIH1_0447 ACR: Acry_1847 Acry_2256 RRU: Rru_A0274 Rru_A1380 Rru_A1469 Rru_A1946 Rru_A3387 MAG: amb0842 MGM: Mmc1_1165 ABA: Acid345_3239 BSU: BG11319(mmgA) BG13063(yhfS) BHA: BH1997 BH2029 BH3801(mmgA) BAN: BA3687 BA4240 BA5589 BAR: GBAA3687 GBAA4240 GBAA5589 BAA: BA_0445 BA_4172 BA_4700 BAT: BAS3418 BAS3932 BAS5193 BCE: BC3627 BC4023 BC5344 BCA: BCE_3646 BCE_4076 BCE_5475 BCZ: BCZK3329(mmgA) BCZK3780(thl) BCZK5044(atoB) BCY: Bcer98_2722 Bcer98_3865 BTK: BT9727_3379(mmgA) BT9727_3765(thl) BT9727_5028(atoB) BTL: BALH_3262(mmgA) BALH_3642(fadA) BALH_4843(atoB) BLI: BL03925(mmgA) BLD: BLi03968(mmgA) BCL: ABC0345 ABC2989 ABC3617 ABC3891(mmgA) BAY: RBAM_022450 BPU: BPUM_2374(yhfS) BPUM_2941 BPUM_3373 OIH: OB0676 OB0689 OB2632 OB3013 GKA: GK1658 GK3397 SAU: SA0342 SA0534(vraB) SAV: SAV0354 SAV0576(vraB) SAM: MW0330 MW0531(vraB) SAR: SAR0351(thl) SAR0581 SAS: SAS0330 SAS0534 SAC: SACOL0426 SACOL0622(atoB) SAB: SAB0304(thl) SAB0526 SAA: SAUSA300_0355 SAUSA300_0560(vraB) SAO: SAOUHSC_00336 SAOUHSC_00558 SAJ: SaurJH9_0402 SAH: SaurJH1_0412 SEP: SE0346 SE2384 SER: SERP0032 SERP0220 SHA: SH0510(mvaC) SH2417 SSP: SSP0325 SSP2145 LMO: lmo1414 LMF: LMOf2365_1433 LIN: lin1453 LWE: lwe1431 LLA: L11745(thiL) L25946(fadA) LLC: LACR_1665 LACR_1956 LLM: llmg_0930(thiL) SPY: SPy_0140 SPy_1637(atoB) SPZ: M5005_Spy_0119 M5005_Spy_0432 M5005_Spy_1344(atoB) SPM: spyM18_0136 spyM18_1645(atoB) SPG: SpyM3_0108 SpyM3_1378(atoB) SPS: SPs0110 SPs0484 SPH: MGAS10270_Spy0121 MGAS10270_Spy0433 MGAS10270_Spy1461(atoB) SPI: MGAS10750_Spy0124 MGAS10750_Spy0452 MGAS10750_Spy1453(atoB) SPJ: MGAS2096_Spy0123 MGAS2096_Spy0451 MGAS2096_Spy1365(atoB) SPK: MGAS9429_Spy0121 MGAS9429_Spy0431 MGAS9429_Spy1339(atoB) SPF: SpyM50447(atoB2) SPA: M6_Spy0166 M6_Spy0466 M6_Spy1390 SPB: M28_Spy0117 M28_Spy0420 M28_Spy1385(atoB) SAK: SAK_0568 LJO: LJ1609 LAC: LBA0626(thiL) LSA: LSA1486 LDB: Ldb0879 LBU: LBUL_0804 LBR: LVIS_2218 LCA: LSEI_1787 LGA: LGAS_1374 LRE: Lreu_0052 EFA: EF1364 OOE: OEOE_0529 STH: STH2913 STH725 STH804 CAC: CAC2873 CA_P0078(thiL) CPE: CPE2195(atoB) CPF: CPF_2460 CPR: CPR_2170 CTC: CTC00312 CNO: NT01CX_0538 NT01CX_0603 CDF: CD1059(thlA1) CD2676(thlA2) CBO: CB03200(thl) CBE: Cbei_0411 Cbei_3630 CKL: CKL_3696(thlA1) CKL_3697(thlA2) CKL_3698(thlA3) AMT: Amet_4630 AOE: Clos_0084 Clos_0258 CHY: CHY_1288 CHY_1355(atoB) CHY_1604 CHY_1738 DSY: DSY0632 DSY0639 DSY1567 DSY1710 DSY2402 DSY3302 DRM: Dred_0400 Dred_1491 Dred_1784 Dred_1892 SWO: Swol_0308 Swol_0675 Swol_0789 Swol_1486 Swol_1934 Swol_2051 TTE: TTE0549(paaJ) MTA: Moth_1260 MTU: Rv11135A Rv1323(fadA4) Rv3546(fadA5) MTC: MT1365(phbA) MBO: Mb1167 Mb1358(fadA4) Mb3576(fadA5) Mb3586c(fadA6) MBB: BCG_1197 BCG_1385(fadA4) BCG_3610(fadA5) BCG_3620c(fadA6) MLE: ML1158(fadA4) MPA: MAP2407c(fadA3) MAP2436c(fadA4) MAV: MAV_1544 MAV_1573 MAV_1863 MAV_5081 MSM: MSMEG_2224 MSMEG_4920 MUL: MUL_0357 MVA: Mvan_1976 Mvan_1988 Mvan_4305 Mvan_4677 Mvan_4891 MGI: Mflv_1347 Mflv_1484 Mflv_2040 Mflv_2340 Mflv_4356 Mflv_4368 MMC: Mmcs_1758 Mmcs_1769 Mmcs_3796 Mmcs_3864 MKM: Mkms_0251 Mkms_1540 Mkms_1805 Mkms_1816 Mkms_2836 Mkms_3159 Mkms_3286 Mkms_3869 Mkms_3938 Mkms_4227 Mkms_4411 Mkms_4580 Mkms_4724 Mkms_4764 Mkms_4776 MJL: Mjls_0231 Mjls_1739 Mjls_1750 Mjls_2819 Mjls_3119 Mjls_3235 Mjls_3800 Mjls_3850 Mjls_4110 Mjls_4383 Mjls_4705 Mjls_4876 Mjls_5018 Mjls_5063 Mjls_5075 CGL: NCg12309(cg12392) CGB: cg2625(pcaF) CEF: CE0731 CE2295 CJK: jk1543(fadA3) NFA: nfa10750(fadA4) RHA: RHA1_ro01455 RHA1_ro01623 RHA1_ro01876 RHA1_ro02517(catF) RHA1_ro03022 RHA1_ro03024 RHA1_ro03391 RHA1_ro03892 RHA1_ro04599RHA1_ro05257RHA1_ro08871 SCO: SC05399(SC8F4.03) SMA: SAV1384(fadA5) SAV2856(fadA1) ART: Arth_1160 Arth_2986 Arth_3268 Arth_4073 NCA: Noca_1371 Noca_1797 Noca_1828 Noca_2764 Noca_4142 TFU: Tfu_1520 Tfu_2394 FRA: Francci3_3687 FRE: Franean1_1044 Franean1_2711 Franean1_2726 Franean1_3929 Franean1_4037Franean1_4577 FAL: FRAAL2514 FRAAL2618 FRAAL5910(atoB) ACE: Acel_0626 Acel_0672 SEN: SACE_1192(mmgA) SACE_2736(fadA6) SACE_4011(catF) SACE_6236(fadA4) STP: Strop_3610 SAQ: Sare_1316 Sare_3991 RXY: Rxyl_1582 Rxyl_1842 Rxyl_2389 Rxyl_2530 FNU: FN0495 BGA: BG0110(fadA) BAF: BAPKO_0110(fadA) LIL: LA0457(thiL1) LA0828(thiL2) LA4139(fadA) LIC: LIC10396(phbA) LBJ: LBJ_2862(paaJ-4) LBL: LBL_0209(paaJ-4) SYN: slr1993(phaA) SRU: SRU_1211(atoB) SRU_1547 CHU: CHU_1910(atoB) GFO: GFO_1507(atoB) FJO: Fjoh_4612 FPS: FP0770 FP1586 FP1725 RRS: RoseRS_3911 RoseRS_4348 RCA: Rcas_0702 Rcas_3206 HAU: Haur_0522 DRA: DR_1072 DR_1428 DR_1960 DR_2480 DR A0053 DGE: Dgeo_0755 Dgeo_1305 Dgeo_1441 Dgeo_1883 TTH: TTC0191 TTC0330 TTJ: TTHA0559 TME: Tmel_1134 FNO: Fnod_0314 PMO: Pmob_0515 HMA: rrnAC0896(acaB3) rrnAC2815(aca2) rrnAC3497(yqeF) rrnB0240(aca1) rmB0242(acaB2) rmB0309(acaB1) TAC: Ta0582 TVO: TVN0649 PTO: PT01505 APE: APE_2108 SSO: SSO2377(acaB-4) STO: ST0514 SAI: Saci_0963 Saci_1361(acaB1) MSE: Msed_0656 PAI: PAE1220 PIS: Pisl_0029 Pisl_1301 PCL: Pcal_0781 PAS: Pars_0309 Pars_1071 CMA: Cmaq_1941
Exemplary HMG-CoA Synthase Nucleic Acids and Polypeptides
(900) HSA: 3157(HMGCS1) 3158(HMGCS2)
(901) PTR: 457169(HMGCS2) 461892(HMGCS1)
(902) MCC: 702553(HMGCS1) 713541(HMGCS2)
(903) MMU: 15360(Hmgcs2) 208715(Hmgcs1)
(904) RNO: 24450(Hmgcs2) 29637(Hmgcs1)
(905) CFA: 479344(HMGCS1) 607923(HMGCS2)
(906) BTA: 407767(HMGCS1)
(907) SSC: 397673(CH242-38B5.1)
(908) GGA: 396379(HMGCS1)
(909) XLA: 380091(hmgcs1) 447204(MGC80816)
(910) DRE: 394060(hmgcs1)
(911) SPU: 578259(LOC578259)
(912) DME: Dmel_CG4311(Hmgs)
(913) CEL: F25B4.6
(914) ATH: AT4G11820(BAP 1)
(915) OSA: 4331418 4347614
(916) CME: CMM189C
(917) SCE: YML126C(ERG13)
(918) AGO: AGOS_ADL356C
(919) PIC: PICST_83020
(920) CAL: CaO19_7312(CaO19.7312)
(921) CGR: CAGLOH04081g
(922) SPO: SPAC4F8.14c(hcs)
(923) MGR: MGG_01026
(924) ANI: AN4923.2
(925) AFM: AFUA_3G10660 AFUA_8G07210
(926) AOR: AO090003000611 AO090010000487
(927) CNE: CNC05080 CNG02670
(928) UMA: UM05362.1
(929) ECU: ECU10_0510
(930) DDI: DDBDRAFT_0217522 DDB_0219924(hgsA)
(931) TET: TTHERM_00691190
(932) TBR: Tb927.8.6110
(933) YPE: YPO1457
(934) YPK: y2712(pksG)
(935) YPM: YP_1349(pksG)
(936) YPA: YPA_0750
(937) YPN: YPN_2521
(938) YPP: YPDSF_1517
(939) YPS: YPTB1475
(940) CBD: COXBU7E912_1931
(941) TCX: Tcr_1719
(942) DNO: DNO_0799
(943) BMA: BMAA1212
(944) BPS: BPSS1002
(945) BPM: BURPS1710b_A2613
(946) BPL: BURPS1106A_A1384
(947) BPD: BURPS668_A1470
(948) BTE: BTH_II1670
(949) MXA: MXAN_3948(tac) MXAN_4267(mvaS)
(950) BSU: BG10926(pksG)
(951) OIH: OB2248
(952) SAU: SA2334(mvaS)
(953) SAV: SAV2546(mvaS)
(954) SAM: MW2467(mvaS)
(955) SAR: SAR2626(mvaS)
(956) SAS: SAS2432
(957) SAC: SACOL2561
(958) SAB: SAB2420(mvaS)
(959) SAA: SAUSA300_2484
(960) SAO: SAOUHSC_02860
(961) SAJ: SaurJH9_2569
(962) SAH: SaurJH1_2622
(963) SEP: SE2110
(964) SER: SERP2122
(965) SHA: SH0508(mvaS)
(966) SSP: SSP0324
(967) LMO: lmo1415
(968) LMF: LMOf2365_1434(mvaS)
(969) LIN: lin1454
(970) LWE: lwe1432(mvaS)
(971) LLA: L13187(hmcM)
(972) LLC: LACR_1666
(973) LLM: llmg_0929(hmcM)
(974) SPY: SPy_0881(mvaS.2)
(975) SPZ: M5005_Spy_0687(mvaS.1)
(976) SPM: spyM18_0942(mvaS2)
(977) SPG: SpyM3_0600(mvaS.2)
(978) SPS: SPs1253
(979) SPH: MGAS10270_Spy0745(mvaS1)
(980) SPI: MGAS10750_Spy0779(mvaS1)
(981) SPJ: MGAS2096_Spy0759(mvaS1)
(982) SPK: MGAS9429_Spy0743(mvaS1)
(983) SPF: SpyM51121(mvaS)
(984) SPA: M6_Spy0704
(985) SPB: M28_Spy0667(mvaS.1)
(986) SPN: SP_1727
(987) SPR: spr1571(mvaS)
(988) SPD: SPD_1537(mvaS)
(989) SAG: SAG1316
(990) SAN: gbs1386
(991) SAK: SAK_1347
(992) SMU: SMU.943c
(993) STC: str0577(mvaS)
(994) STL: stu0577(mvaS)
(995) STE: STER_0621
(996) SSA: SSA_0338(mvaS)
(997) SSU: SSU05_1641
(998) SSV: SSU98_1652
(999) SGO: SGO_0244
(1000) LPL: lp_2067(mvaS)
(1001) LJO: LJ1607
(1002) LAC: LBA0628(hmcS)
(1003) LSA: LSA1484(mvaS)
(1004) LSL: LSL_0526
(1005) LDB: Ldb0881(mvaS)
(1006) LBU: LBUL_0806
(1007) LBR: LVIS_1363
(1008) LCA: LSEI_1785
(1009) LGA: LGAS_1372
(1010) LRE: Lreu_0676
(1011) PPE: PEPE_0868
(1012) EFA: EF1363
(1013) OOE: OEOE_0968
(1014) LME: LEUM_1184
(1015) NFA: nfa22120
(1016) SEN: SACE_4570(pksG)
(1017) BBU: BB0683
(1018) BGA: BG0706
(1019) BAF: BAPKO_0727
(1020) FJO: Fjoh_0678
(1021) HAL: VNG1615G(mvaB)
(1022) HMA: rrnAC1740(mvaS)
(1023) HWA: HQ2868A(mvaB)
(1024) NPH: NP2608A(mvaB_1) NP4836A(mvaB_2)
Exemplary Hydroxymethylglutaryl-CoA Reductase Nucleic Acids and Polypeptides
(1025) HSA: 3156(HMGCR)
(1026) PTR: 471516(HMGCR)
(1027) MCC: 705479(HMGCR)
(1028) MMU: 15357(Hmgcr)
(1029) RNO: 25675(Hmgcr)
(1030) CFA: 479182(HMGCR)
(1031) BTA: 407159(HMGCR)
(1032) GGA: 395145(RCJMB04_14m24)
(1033) SPU: 373355(LOC373355)
(1034) DME: Dmel_CG10367(Hmgcr)
(1035) CEL: F08F8.2
(1036) OSA: 4347443
(1037) SCE: YLR450W(HMG2) YML075C(HMG1)
(1038) AGO: AGOS_AER152W
(1039) CGR: CAGL0L11506g
(1040) SPO: SPCC162.09c(hmgl)
(1041) ANI: AN3817.2
(1042) AFM: AFUA_1G11230 AFUA_2G03700
(1043) AOR: AO090103000311 AO090120000217
(1044) CNE: CNF04830
(1045) UMA: UM03014.1
(1046) ECU: ECU10_1720
(1047) DDI: DDB_0191125(hmgA) DDB_0215357(hmgB)
(1048) TBR: Tb927.6.4540
(1049) TCR: 506831.40 509167.20
(1050) LMA: LmjF30.3190
(1051) VCH: VCA0723
(1052) VCO: VC0395_0662
(1053) VVU: VV2_0117
(1054) VVY: VVA0625
(1055) VPA: VPA0968
(1056) VFI: VFA0841
(1057) PAT: Patl_0427
(1058) CBU: CBU_0030 CBU_0610
(1059) CBD: COXBU7E912_0151 COXBU7E912_0622(hmgA)
(1060) TCX: Tcr_1717
(1061) DNO: DNO_0797
(1062) CVI: CV_1806
(1063) SUS: Acid_5728 Acid_6132
(1064) SAU: SA2333(mvaA)
(1065) SAV: SAV2545(mvaA)
(1066) SAM: MW2466(mvaA)
(1067) SAB: SAB2419c(mvaA)
(1068) SEP: SE2109
(1069) LWE: lwe0819(mvaA)
(1070) LLA: L10433(mvaA)
(1071) LLC: LACR_1664
(1072) LLM: llmg_0931(mvaA)
(1073) SPY: SPy_0880(mvaS.1)
(1074) SPM: spyM18_0941(mvaS1)
(1075) SPG: SpyM3_0599(mvaS.1)
(1076) SPS: SPs1254
(1077) SPH: MGAS10270_Spy0744
(1078) SPI: MGAS10750_Spy0778
(1079) SPJ: MGAS2096_Spy0758
(1080) SPK: MGAS9429_Spy0742
(1081) SPA: M6_Spy0703
(1082) SPN: SP_1726
(1083) SAG: SAG1317
(1084) SAN: gbs1387
(1085) STC: str0576(mvaA)
(1086) STL: stu0576(mvaA)
(1087) STE: STER_0620
(1088) SSA: SSA_0337(mvaA)
(1089) LPL: lp_0447(mvaA)
(1090) LJO: LJ1608
(1091) LSL: LSL_0224
(1092) LBR: LVIS_0450
(1093) LGA: LGAS_1373
(1094) EFA: EF1364
(1095) NFA: nfa22110
(1096) BGA: BG0708(mvaA)
(1097) SRU: SRU_2422
(1098) FPS: FP2341
(1099) MMP: MMP0087(hmgA)
(1100) MMQ: MmarC5_1589
(1101) MAC: MA3073(hmgA)
(1102) MBA: Mbar_A1972
(1103) MMA: MM_0335
(1104) MBU: Mbur_1098
(1105) MHU: Mhun_3004
(1106) MEM: Memar_2365
(1107) MBN: Mboo_0137
(1108) MTH: MTH562
(1109) MST: Msp_0584(hmgA)
(1110) MSI: Msm_0227
(1111) MKA: MK0355(HMG1)
(1112) AFU: AF1736(mvaA)
(1113) HAL: VNG1875G(mvaA)
(1114) HMA: rrnAC3412(mvaA)
(1115) HWA: HQ3215A(hmgR)
(1116) NPH: NP0368A(mvaA_2) NP2422A(mvaA_1)
(1117) TAC: Ta0406m
(1118) TVO: TVN1168
(1119) PTO: PTO1143
(1120) PAB: PAB2106(mvaA)
(1121) PFU: PF1848
(1122) TKO: TK0914
(1123) RCI: RCIX1027(hmgA) RCIX376(hmgA)
(1124) APE: APE_1869
(1125) IHO: Igni_0476
(1126) HBU: Hbut_1531
(1127) SSO: SSO0531
(1128) STO: ST1352
(1129) SAI: Saci_1359
(1130) PAI: PAE2182
(1131) PIS: Pisl_0814
(1132) PCL: Pcal_1085
(1133) PAS: Pars_0796
Exemplary Mevalonate Kinase Nucleic Acids and Polypeptides
(1134) HSA: 4598(MVK)
(1135) MCC: 707645(MVK)
(1136) MMU: 17855(Mvk)
(1137) RNO: 81727(Mvk)
(1138) CFA: 486309(MVK)
(1139) BTA: 505792(MVK)
(1140) GGA: 768555(MVK)
(1141) DRE: 492477(zgc: 103473)
(1142) SPU: 585785(LOC585785)
(1143) DME: Dmel_CG33671
(1144) OSA: 4348331
(1145) SCE: YMR208W(ERG12)
(1146) AGO: AGOS_AER335W
(1147) PIC: PICST_40742(ERG12)
(1148) CGR: CAGL0F03861g
(1149) SPO: SPAC13G6.11c
(1150) MGR: MGG_06946
(1151) ANI: AN3869.2
(1152) AFM: AFUA_4G07780
(1153) AOR: AO090023000793
(1154) CNE: CNK01740
(1155) ECU: ECU09_1780
(1156) DDI: DDBDRAFT_0168621
(1157) TET: TTHERM_00637680
(1158) TBR: Tb927.4.4070
(1159) TCR: 436521.9 509237.10
(1160) LMA: LmjF31.0560
(1161) CBU: CBU_0608 CBU_0609
(1162) CBD: COXBU7E912_0620(mvk)
(1163) LPN: lpg2039
(1164) LPF: lpl2017
(1165) LPP: lpp2022
(1166) BBA: Bd1027(lmbP) Bd1630(mvk)
(1167) MXA: MXAN_5019(mvk)
(1168) OIH: OB0225
(1169) SAU: SA0547(mvaK1)
(1170) SAV: SAV0590(mvaK1)
(1171) SAM: MW0545(mvaK1)
(1172) SAR: SAR0596(mvaK1)
(1173) SAS: SAS0549
(1174) SAC: SACOL0636(mvk)
(1175) SAB: SAB0540(mvaK1)
(1176) SAA: SAUSA300_0572(mvk)
(1177) SAO: SAOUHSC_00577
(1178) SEP: SE0361
(1179) SER: SERP0238(mvk)
(1180) SHA: SH2402(mvaK1)
(1181) SSP: SSP2122
(1182) LMO: lmo0010
(1183) LMF: LMOf2365_0011
(1184) LIN: lin0010
(1185) LWE: lwe0011(mvk)
(1186) LLA: L7866(yeaG)
(1187) LLC: LACR_0454
(1188) LLM: llmg_0425(mvk)
(1189) SPY: SPy_0876(mvaK1)
(1190) SPZ: M5005_Spy_0682(mvaK1)
(1191) SPM: spyM18_0937(mvaK1)
(1192) SPG: SpyM3_0595(mvaK1)
(1193) SPS: SPs1258
(1194) SPH: MGAS10270_Spy0740(mvaK1)
(1195) SPI: MGAS10750_Spy0774(mvaK1)
(1196) SPJ: MGAS2096_Spy0753(mvaK1)
(1197) SPK: MGAS9429_Spy0737(mvaK1)
(1198) SPF: SpyM51126(mvaK1)
(1199) SPA: M6_Spy0699
(1200) SPB: M28_Spy0662(mvaK1)
(1201) SPN: SP 0381
(1202) SPR: spr0338(mvk)
(1203) SPD: SPD_0346(mvk)
(1204) SAG: SAG1326
(1205) SAN: gbs1396
(1206) SAK: SAK_1357(mvk)
(1207) SMU: SMU.181
(1208) STC: str0559(mvaK1)
(1209) STL: stu0559(mvaK1)
(1210) STE: STER_0598
(1211) SSA: SSA_0333(mvaK1)
(1212) SSU: SSU05_0289
(1213) SSV: SSU98_0285
(1214) SGO: SGO_0239(mvk)
(1215) LPL: lp_1735(mvaK1)
(1216) LJO: LJ1205
(1217) LAC: LBA1167(mvaK)
(1218) LSA: LSA0908(mvaK1)
(1219) LSL: LSL_0685(eRG)
(1220) LDB: Ldb0999(mvk)
(1221) LBU: LBUL_0906
(1222) LBR: LVIS_0858
(1223) LCA: LSEI_1491
(1224) LGA: LGAS_1033
(1225) LRE: Lreu_0915
(1226) PPE: PEPE_0927
(1227) EFA: EF0904(mvk)
(1228) OOE: OEOE_1100
(1229) LME: LEUM_1385
(1230) NFA: nfa22070
(1231) BGA: BG0711
(1232) BAF: BAPKO_0732
(1233) FPS: FP0313
(1234) MMP: MMP1335
(1235) MAE: Maeo_0775
(1236) MAC: MA0602(mvk)
(1237) MBA: Mbar_A1421
(1238) MMA: MM_1762
(1239) MBU: Mbur_2395
(1240) MHU: Mhun_2890
(1241) MEM: Memar_1812
(1242) MBN: Mboo_2213
(1243) MST: Msp_0858(mvk)
(1244) MSI: Msm_1439
(1245) MKA: MK0993(ERG12)
(1246) HAL: VNG1145G(mvk)
(1247) HMA: rrnACOO77(mvk)
(1248) HWA: HQ2925A(mvk)
(1249) NPH: NP2850A(mvk)
(1250) PTO: PTO1352
(1251) PHO: PH1625
(1252) PAB: PAB0372(mvk)
(1253) PFU: PF1637(mvk)
(1254) TKO: TK1474
(1255) RCI: LRC399(mvk)
(1256) APE: APE_2439
(1257) HBU: Hbut_0877
(1258) SSO: SS00383
(1259) STO: ST2185
(1260) SAI: Saci_2365(mvk)
(1261) MSE: Msed_1602
(1262) PAI: PAE3108
(1263) PIS: Pisl_0467
(1264) PCL: Pcal_1835
Exemplary Phosphomevalonate Kinase Nucleic Acids and Polypeptides
(1265) HSA: 10654(PMVK)
(1266) PTR: 457350(PMVK)
(1267) MCC: 717014(PMVK)
(1268) MMU: 68603(Pmvk)
(1269) CFA: 612251(PMVK)
(1270) BTA: 513533(PMVK)
(1271) DME: Dmel_CG10268
(1272) ATH: AT1G31910
(1273) OSA: 4332275
(1274) SCE: YMR220W(ERG8)
(1275) AGO: AGOS_AER354W
(1276) PIC: PICST_52257(ERG8)
(1277) CGR: CAGL0F03993g
(1278) SPO: SPAC343.01c
(1279) MGR: MGG_05812
(1280) ANI: AN2311.2
(1281) AFM: AFUA_5G10680
(1282) AOR: AO090010000471
(1283) CNE: CNM00100
(1284) UMA: UM00760.1
(1285) DDI: DDBDRAFT_0184512
(1286) TBR: Tb09.160.3690
(1287) TCR: 507913.20 508277.140
(1288) LMA: LmjF15.1460
(1289) MXA: MXAN_5017
(1290) OIH: OB0227
(1291) SAU: SA0549(mvaK2)
(1292) SAV: SAV0592(mvaK2)
(1293) SAM: MW0547(mvaK2)
(1294) SAR: SAR0598(mvaK2)
(1295) SAS: SAS0551
(1296) SAC: SACOL0638
(1297) SAB: SAB0542(mvaK2)
(1298) SAA: SAUSA300_0574
(1299) SAO: SAOUHSC_00579
(1300) SAJ: SaurJH9_0615
(1301) SEP: SE0363
(1302) SER: SERP0240
(1303) SHA: SH2400(mvaK2)
(1304) SSP: SSP2120
(1305) LMO: lmo0012
(1306) LMF: LMOf2365_0013
(1307) LIN: lin0012
(1308) LWE: lwe0013
(1309) LLA: L10014(yebA)
(1310) LLC: LACR_0456
(1311) LLM: llmg_0427
(1312) SPY: SPy_0878(mvaK2)
(1313) SPZ: M5005_Spy_0684(mvaK2)
(1314) SPM: spyM18_0939
(1315) SPG: SpyM3_0597(mvaK2)
(1316) SPS: SPs1256
(1317) SPH: MGAS10270_Spy0742(mvaK2)
(1318) SPI: MGAS10750_Spy0776(mvaK2)
(1319) SPJ: MGAS2096_Spy0755(mvaK2)
(1320) SPK: MGAS9429_Spy0739(mvaK2)
(1321) SPF: SpyM51124(mvaK2)
(1322) SPA: M6_Spy0701
(1323) SPB: M28_Spy0664(mvaK2)
(1324) SPN: SP_0383
(1325) SPR: spr0340(mvaK2)
(1326) SPD: SPD_0348(mvaK2)
(1327) SAG: SAG1324
(1328) SAN: gbs1394
(1329) SAK: SAK_1355
(1330) SMU: SMU.938
(1331) STC: str0561(mvaK2)
(1332) STL: stu0561(mvaK2)
(1333) STE: STER_0600
(1334) SSA: SSA_0335(mvaK2)
(1335) SSU: SSU05_0291
(1336) SSV: SSU98_0287
(1337) SGO: SGO_0241
(1338) LPL: lp_1733(mvaK2)
(1339) LJO: LJ1207
(1340) LAC: LBA1169
(1341) LSA: LSA0906(mvaK2)
(1342) LSL: LSL_0683
(1343) LDB: Ldb0997(mvaK)
(1344) LBU: LBUL_0904
(1345) LBR: LVIS_0860
(1346) LCA: LSEI_1092
(1347) LGA: LGAS_1035
(1348) LRE: Lreu_0913
(1349) PPE: PEPE_0925
(1350) EFA: EF0902
(1351) NFA: nfa22090
(1352) BGA: BG0710
(1353) BAF: BAPKO_0731
(1354) NPH: NP2852A
(1355) SSO: SS02988
(1356) STO: ST0978
(1357) SAI: Saci_1244
Exemplary Diphosphomevalonate Decarboxylase Nucleic Acids and Polypeptides
(1358) HSA: 4597(MVD)
(1359) PTR: 468069(MVD)
(1360) MCC: 696865(MVD)
(1361) MMU: 192156(Mvd)
(1362) RNO: 81726(Mvd)
(1363) CFA: 489663(MVD)
(1364) GGA: 425359(MVD)
(1365) DME: Dmel_CG8239
(1366) SCE: YNR043W(MVD1)
(1367) AGO: AGOS_AGL232C
(1368) PIC: PICST_90752
(1369) CGR: CAGLOC03630g
(1370) SPO: SPAC24C9.03
(1371) MGR: MGG_09750
(1372) ANI: AN4414.2
(1373) AFM: AFUA_4G07130
(1374) AOR: AO090023000862
(1375) CNE: CNL04950
(1376) UMA: UM05179.1
(1377) DDI: DDBDRAFT_0218058
(1378) TET: TTHERM_00849200
(1379) TBR: Tbl0.05.0010 Tb10.61.2745
(1380) TCR: 507993.330 511281.40
(1381) LMA: LmjF18.0020
(1382) CBU: CBU_0607(mvaD)
(1383) CBD: COXBU7E912_0619(mvaD)
(1384) LPN: lpg2040
(1385) LPF: lpl2018
(1386) LPP: lpp2023
(1387) TCX: Tcr_1734
(1388) DNO: DNO_0504(mvaD)
(1389) BBA: Bd1629
(1390) MXA: MXAN_5018(mvaD)
(1391) OIH: OB0226
(1392) SAU: SA0548(mvaD)
(1393) SAV: SAV0591(mvaD)
(1394) SAM: MW0546(mvaD)
(1395) SAR: SAR0597(mvaD)
(1396) SAS: SAS0550
(1397) SAC: SACOL0637(mvaD)
(1398) SAB: SAB0541(mvaD)
(1399) SAA: SAUSA300_0573(mvaD)
(1400) SAO: SAOUHSC_00578
(1401) SAJ: SaurJH9_0614
(1402) SAH: SaurJH1_0629
(1403) SEP: SE0362
(1404) SER: SERP0239(mvaD)
(1405) SHA: SH2401(mvaD)
(1406) SSP: SSP2121
(1407) LMO: lmo0011
(1408) LMF: LMOf2365_0012(mvaD)
(1409) LIN: lin0011
(1410) LWE: lwe0012(mvaD)
(1411) LLA: L9089(yeaH)
(1412) LLC: LACR_0455
(1413) LLM: llmg_0426(mvaD)
(1414) SPY: SPy_0877(mvaD)
(1415) SPZ: M5005_Spy_0683(mvaD)
(1416) SPM: spyM18_0938(mvd)
(1417) SPG: SpyM3_0596(mvaD)
(1418) SPS: SPs1257
(1419) SPH: MGAS10270_Spy0741(mvaD)
(1420) SPI: MGAS10750_Spy0775(mvaD)
(1421) SPJ: MGAS2096_Spy0754(mvaD)
(1422) SPK: MGAS9429_Spy0738(mvaD)
(1423) SPF: SpyM51125(mvaD)
(1424) SPA: M6_Spy0700
(1425) SPB: M28_Spy0663(mvaD)
(1426) SPN: SP_0382
(1427) SPR: spr0339(mvdl)
(1428) SPD: SPD_0347(mvaD)
(1429) SAG: SAG1325(mvaD)
(1430) SAN: gbs1395
(1431) SAK: SAK_1356(mvaD)
(1432) SMU: SMU.937
(1433) STC: str0560(mvaD)
(1434) STL: stu0560(mvaD)
(1435) STE: STER_0599
(1436) SSA: SSA_0334(mvaD)
(1437) SSU: SSU05_0290
(1438) SSV: SSU98_0286
(1439) SGO: SGO_0240(mvaD)
(1440) LPL: lp_1734(mvaD)
(1441) LJO: LJ1206
(1442) LAC: LBA1168(mvaD)
(1443) LSA: LSA0907(mvaD)
(1444) LSL: LSL_0684
(1445) LDB: Ldb0998(mvaD)
(1446) LBU: LBUL_0905
(1447) LBR: LVIS_0859
(1448) LCA: LSEI_1492
(1449) LGA: LGAS_1034
(1450) LRE: Lreu_0914
(1451) PPE: PEPE_0926
(1452) EFA: EF0903(mvaD)
(1453) LME: LEUM_1386
(1454) NFA: nfa22080
(1455) BBU: BB0686
(1456) BGA: BG0709
(1457) BAF: BAPKO_0730
(1458) GFO: GFO 3632
(1459) FPS: FP0310(mvaD)
(1460) HAU: Haur_1612
(1461) HAL: VNG0593G(dmd)
(1462) HMA: rrnAC1489(dmd)
(1463) HWA: HQ1525A(mvaD)
(1464) NPH: NP1580A(mvaD)
(1465) PTO: PT00478 PT01356
(1466) SSO: SS02989
(1467) STO: ST0977
(1468) SAI: Saci_1245(mvd)
(1469) MSE: Msed_1576
Exemplary Isopentenyl Phosphate Kinases (IPK) Nucleic Acids and Polypeptides
(1470) Methanobacterium thermoautotrophicum gi|2621082
(1471) Methanococcus jannaschii DSM2661 gi|1590842;
(1472) Methanocaldococcus jannaschii gi|1590842
(1473) Methanothermobacter thermautotrophicus gi|2621082
(1474) Picrophilus torridus DSM9790 (IG-57) gi|48477569
(1475) Pyrococcus abyssi gi|14520758
(1476) Pyrococcus horikoshii OT3 gi|3258052
(1477) Archaeoglobus fulgidus DSM4304 gi|2648231
Exemplary Isopentenyl-Diphosphate Delta-Isomerase (IDI) Nucleic Acids and Polypeptides
(1478) HSA: 3422(IDI1) 91734(IDI2)
(1479) PTR: 450262(IDI2) 450263(IDI1)
(1480) MCC: 710052(LOC710052) 721730(LOC721730)
(1481) MMU: 319554(Idi1)
(1482) RNO: 89784(Idi1)
(1483) GGA: 420459(IDI1)
(1484) XLA: 494671(LOC494671)
(1485) XTR: 496783(idi2)
(1486) SPU: 586184(LOC586184)
(1487) CEL: K06H7.9(idi-1)
(1488) ATH: AT3G02780(IPP2)
(1489) OSA: 4338791 4343523
(1490) CME: CMB062C
(1491) SCE: YPL117C(IDI1)
(1492) AGO: AGOS_ADL268C
(1493) PIC: PICST_68990(IDI1)
(1494) CGR: CAGLOJ06952g
(1495) SPO: SPBC106.15(idi1)
(1496) ANI: AN0579.2
(1497) AFM: AFUA_6G11160
(1498) AOR: AO090023000500
(1499) CNE: CNA02550
(1500) UMA: UM04838.1
(1501) ECU: ECU02_0230
(1502) DDI: DDB_0191342(ipi)
(1503) TET: TTHERM 00237280 TTHERM 00438860
(1504) TBR: Tb09.211.0700
(1505) TCR: 408799.19 510431.10
(1506) LMA: LmjF35.5330
(1507) EHI: 46.t00025
(1508) ECO: b2889(idi)
(1509) ECJ: JW2857(idi)
(1510) ECE: Z4227
(1511) ECS: ECs3761
(1512) ECC: c3467
(1513) ECI: UTI89_C3274
(1514) ECP: ECP_2882
(1515) ECV: APECO1_3638
(1516) ECW: EcE24377A_3215(idi)
(1517) ECX: EcHS_A3048
(1518) STY: STY3195
(1519) STT: t2957
(1520) SPT: SPA2907(idi)
(1521) SEC: SC2979(idi)
(1522) STM: STM3039(idi)
(1523) SFL: SF2875(idi)
(1524) SFX: S3074
(1525) SFV: SFV_2937
(1526) SSN: SSON_3042 SSON_3489(yhfK)
(1527) SBO: SBO_3103
(1528) SDY: SDY_3193
(1529) ECA: ECA2789
(1530) PLU: plu3987
(1531) ENT: Ent638_3307
(1532) SPE: Spro_2201
(1533) VPA: VPA0278
(1534) VFI: VF0403
(1535) PPR: PBPRA0469(mvaD)
(1536) PEN: PSEEN4850
(1537) CBU: CBU_0607(mvaD)
(1538) CBD: COXBU7E912_0619(mvaD)
(1539) LPN: lpg2051
(1540) LPF: lp12029
(1541) LPP: lpp2034
(1542) TCX: Tcr_1718
(1543) HHA: Hhal_1623
(1544) DNO: DNO_0798
(1545) EBA: ebA5678 p2A143
(1546) DVU: DVU1679(idi)
(1547) DDE: Dde_1991
(1548) LIP: LI1134
(1549) BBA: Bd1626
(1550) AFW: Anae109_4082
(1551) MXA: MXAN_5021(fni)
(1552) RPR: RP452
(1553) RTY: RT0439(idi)
(1554) RCO: RC0744
(1555) RFE: RF_0785(fni)
(1556) RBE: RBE_0731(fni)
(1557) RAK: A1C_04190
(1558) RBO: A1I_04755
(1559) RCM: A1E_02555
(1560) RRI: A1G_04195
(1561) MLO: mlr6371
(1562) RET: RHE_PD00245(ypd00046)
(1563) XAU: Xaut_4134
(1564) SIL: SPO0131
(1565) SIT: TM1040_3442
(1566) RSP: RSP_0276
(1567) RSH: Rsph17029_1919
(1568) RSQ: Rsph17025_1019
(1569) JAN: Jann_0168
(1570) RDE: RD1_0147(idi)
(1571) DSH: Dshi_3527
(1572) BSU: BG11440(ypgA)
(1573) BAN: BA1520
(1574) BAR: GBAA1520
(1575) BAA: BA_2041
(1576) BAT: BAS1409
(1577) BCE: BC1499
(1578) BCA: BCE_1626
(1579) BCZ: BCZK1380(fni)
(1580) BCY: Bcer98_1222
(1581) BTK: BT9727_1381(fni)
(1582) BTL: BALH 1354
(1583) BLI: BL02217(fni)
(1584) BLD: BLi02426
(1585) BAY: RBAM_021020(fni)
(1586) BPU: BPUM_2020(fni)
(1587) OIH: OB0537
(1588) SAU: SA2136(fni)
(1589) SAV: SAV2346(fni)
(1590) SAM: MW2267(fni)
(1591) SAR: SAR2431(fni)
(1592) SAS: SAS2237
(1593) SAC: SACOL2341(fni)
(1594) SAB: SAB2225c(fni)
(1595) SAA: SAUSA300_2292(fni)
(1596) SAO: SAOUHSC_02623
(1597) SEP: SE1925
(1598) SER: SERP1937(fni-2)
(1599) SHA: SH0712(fni)
(1600) SSP: SSP0556
(1601) LMO: lmo1383
(1602) LMF: LMOf2365_1402(fni)
(1603) LIN: lin1420
(1604) LWE: lwe1399(fni)
(1605) LLA: L11083(yebB)
(1606) LLC: LACR_0457
(1607) LLM: llmg_0428(fni)
(1608) SPY: SPy_0879
(1609) SPZ: M5005_Spy_0685
(1610) SPM: spyM18_0940
(1611) SPG: SpyM3_0598
(1612) SPS: SPs1255
(1613) SPH: MGAS10270_Spy0743
(1614) SPI: MGAS10750_Spy0777
(1615) SPJ: MGAS2096_Spy0756
(1616) SPK: MGAS9429_Spy0740
(1617) SPF: SpyM51123(fni)
(1618) SPA: M6_Spy0702
(1619) SPB: M28_Spy0665
(1620) SPN: SP_0384
(1621) SPR: spr0341(fni)
(1622) SPD: SPD_0349(fni)
(1623) SAG: SAG1323
(1624) SAN: gbs1393
(1625) SAK: SAK_1354(fni)
(1626) SMU: SMU.939
(1627) STC: str0562(idi)
(1628) STL: stu0562(idi)
(1629) STE: STER_0601
(1630) SSA: SSA 0336
(1631) SGO: SGO 0242
(1632) LPL: lp_1732(idi1)
(1633) LJO: LJ1208
(1634) LAC: LBA1171
(1635) LSA: LSA0905(idi)
(1636) LSL: LSL_0682
(1637) LDB: Ldb0996(fni)
(1638) LBU: LBUL_0903
(1639) LBR: LVIS_0861
(1640) LCA: LSEI_1493
(1641) LGA: LGAS_1036
(1642) LRE: Lreu_0912
(1643) EFA: EF0901
(1644) OOE: OEOE_1103
(1645) STH: STH1674
(1646) CBE: Cbei_3081
(1647) DRM: Dred_0474
(1648) SWO: Swol_1341
(1649) MTA: Moth_1328
(1650) MTU: Rv1745c(idi)
(1651) MTC: MT1787(idi)
(1652) MBO: Mb1774c(idi)
(1653) MBB: BCG_1784c(idi)
(1654) MPA: MAP3079c
(1655) MAV: MAV_3894(fni)
(1656) MSM: MSMEG_1057(fni) MSMEG_2337(fni)
(1657) MUL: MUL_0380(idi2)
(1658) MVA: Mvan_1582 Mvan_2176
(1659) MGI: Mflv_1842 Mflv_4187
(1660) MMC: Mmcs_1954
(1661) MKM: Mkms_2000
(1662) MJL: Mjls_1934
(1663) CGL: NCg12223(cg12305)
(1664) CGB: cg2531(idi)
(1665) CEF: CE2207
(1666) CDI: DIP1730(idi)
(1667) NFA: nfa19790 nfa22100
(1668) RHA: RHA1_ro00239
(1669) SCO: SC06750(SC5F2A.33c)
(1670) SMA: SAV1663(idi)
(1671) LXX: Lxx23810(idi)
(1672) CMI: CMM_2889(idiA)
(1673) AAU: AAur_0321(idi)
(1674) PAC: PPA2115
(1675) FRA: Francci3_4188
(1676) FRE: Franean1_5570
(1677) FAL: FRAAL6504(idi)
(1678) KRA: Krad_3991
(1679) SEN: SACE_2627(idiB_2) SACE_5210(idi)
(1680) STP: Strop_4438
(1681) SAQ: Sare_4564 Sare_4928
(1682) RXY: Rxyl_0400
(1683) BBU: BB0684
(1684) BGA: BG0707
(1685) SYN: s111556
(1686) SYC: syc2161_c
(1687) SYF: Synpcc7942_1933
(1688) CYA: CYA_2395(fni)
(1689) CYB: CYB_2691(fni)
(1690) TEL: t111403
(1691) ANA: a114591
(1692) AVA: Ava_2461 Ava_B0346
(1693) TER: Tery_1589
(1694) SRU: SRU_1900(idi)
(1695) CHU: CHU_0674(idi)
(1696) GFO: GFO_2363(idi)
(1697) FJO: Fjoh_0269
(1698) FPS: FP1792(idi)
(1699) CTE: CT0257
(1700) CCH: Cag_1445
(1701) CPH: Cpha266_0385
(1702) PVI: Cvib 1545
(1703) PLT: Plut 1764
(1704) RRS: RoseRS_2437
(1705) RCA: Rcas_2215
(1706) HAU: Haur 4687
(1707) DRA: DR_1087
(1708) DGE: Dgeo_1381
(1709) TTH: TT_P0067
(1710) TTJ: TTHB110
(1711) MJA: MJ0862
(1712) MMP: MMP0043
(1713) MMQ: MmarC5_1637
(1714) MMX: MmarC6_0906
(1715) MMZ: MmarC7_1040
(1716) MAE: Maeo_1184
(1717) MVN: Mevan_1058
(1718) MAC: MA0604(idi)
(1719) MBA: Mbar_A1419
(1720) MMA: MM_1764
(1721) MBU: Mbur_2397
(1722) MTP: Mthe_0474
(1723) MHU: Mhun_2888
(1724) MLA: Mlab_1665
(1725) MEM: Memar_1814
(1726) MBN: Mboo_2211
(1727) MTH: MTH48
(1728) MST: Msp_0856(fni)
(1729) MSI: Msm_1441
(1730) MKA: MK0776(lldD)
(1731) AFU: AF2287
(1732) HAL: VNG1818G(idi) VNG6081G(crt_1) VNG6445G(crt_2) VNG7060 VNG7149
(1733) HMA: rrnAC3484(idi)
(1734) HWA: HQ2772A(idiA) HQ2847A(idiB)
(1735) NPH: NP0360A(idiB_1) NP4826A(idiA) NP5124A(idiB_2)
(1736) TAC: Ta0102
(1737) TVO: TVN0179
(1738) PTO: PTO0496
(1739) PHO: PH1202
(1740) PAB: PAB1662
(1741) PFU: PF0856
(1742) TKO: TK1470
(1743) RCI: LRC397(fni)
(1744) APE: APE_1765.1
(1745) SMR: Smar_0822
(1746) IHO: Igni_0804
(1747) HBU: Hbut_0539
(1748) SSO: SSO0063
(1749) STO: ST2059
(1750) SAI: Saci_0091
(1751) MSE: Msed_2136
(1752) PAI: PAE0801
(1753) PIS: Pisl_1093
(1754) PCL: Pcal_0017
(1755) PAS: Pars_0051
(1756) TPE: Tpen_0272
Exemplary Isoprene Synthase Nucleic Acids and Polypeptides
(1757) Genbank Accession Nos.
(1758) AY341431
(1759) AY316691
(1760) AY279379
(1761) AJ457070
(1762) AY182241