ENDONUCLEASE TARGETING BLOOD COAGULATION FACTOR VIII GENE AND COMPOSITION FOR TREATING HEMOPHILIA COMPRISING SAME

20180055951 ยท 2018-03-01

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides a method for inducing an inversion of normal blood coagulation factor VIII (F8) gene, a method for correcting an inversion of blood coagulation factor VIII gene in which the inversion has occurred, and a Hemophilia A patient-derived induced pluripotent stem cell in which the inversion is corrected, constructed using the same. The method of the present invention effectively reproduces the inversion of intron 1 and intron 22 of the F8 gene, which is responsible for the majority of severe hemophilia A, and thereby may be effectively used for studying the development mechanism of hemophilia A and as a research tool for screening therapeutic agents. The inversion-corrected induced pluripotent stem cell constructed according the method of the present invention enables an efficient and fundamental treatment for hemophilia A by restoring a genotype in which mutation has occurred to a wild type-like state, without limitation via normal gene or protein delivery.

    Claims

    1.-33. (canceled)

    34. A composition comprising a polypeptide comprising the following or a nucleotide sequence encoding the polypeptide: (a) a pair of endonucleases; and (b) a pair of transcription activator-like (TAL) effector domains, each of which is linked to each of the endonucleases and comprises an amino acid sequence specifically recognizing an inverted region of the F8 gene.

    35. The composition of claim 34, wherein the inversion of the F8 gene is an inversion in intron 1 of the F8 gene; wherein the pair of transcription activator-like (TAL) effector domains specifically bind to nucleotide sequences at first and second locations, respectively, which are included in the nucleotide sequence of SEQ ID NO: 34, and wherein the nucleotide sequences at the first and second locations are separated from each other by a length of 10-20 bp while being 15- to 25-bp in length.

    36. The composition of claim 35, wherein the nucleotide sequences at the first and second locations are the nucleotide sequences of SEQ ID NO: 30 and SEQ ID NO: 31, respectively.

    37. The composition of claim 35, wherein the amino acid sequence specifically binding to the nucleotide sequence of SEQ ID NO: 30 includes the amino acid sequence of SEQ ID NO: 32.

    38. The composition of claim 35, wherein the amino acid sequence specifically binding to the nucleotide sequence of SEQ ID NO: 31 includes the amino acid sequence of SEQ ID NO: 33.

    39. The composition of claim 34, wherein the endonuclease is Fokl endonuclease.

    40. A method for correcting an inversion of the blood coagulation factor VIII (F8) gene, the method comprising: bringing somatic cells of a hemophilia A patient into contact with the composition of claim 34 or transfecting the somatic cells with a gene delivery system having the composition inserted thereinto.

    41. A method for preparing induced pluripotent stem cells having an inversion-corrected blood coagulation factor VIII (F8) gene, the method comprising: (a) reprogramming somatic cells isolated from a hemophilia A patient to obtain induced pluripotent stem cells; and (b) bringing the induced pluripotent stem cells into contact with the composition of claim 34 or transfecting the induced pluripotent stem cells with a gene delivery system having the composition inserted thereinto.

    42. The method of claim 41, wherein in step (a), the somatic cells isolated from the hemophilia A patient are transfected with at least one gene selected from the group consisting of OCT4, NANOG, SOX2, LIN28, KLF4, and c-MYC.

    43. A method for treating hemophilia A, the method comprising: administering a composition comprising the induced pluripotent stem cells prepared by the method of claim 41 as an active ingredient to a subject in need thereof.

    44. A composition comprising a polypeptide comprising the following or a nucleotide sequence encoding the polypeptide: (a) a pair of endonucleases; (b) a transcription activator-like (TAL) effector domain, which is linked to one of (a) and comprises an amino acid sequence specifically binding to a nucleotide sequence at a first location on the F8 gene; and (c) a transcription activator-like (TAL) effector domain, which is linked to one of (a) and comprises an amino acid sequence specifically binding to a nucleotide sequence at a second location on the F8 gene, or a nucleotide sequence encoding the effector domain, wherein the first and second locations are separated from each other by a length of 10-20 bp while being 15- to 25-bp in length.

    45. The composition of claim 44, wherein the nucleotide sequences at the first and second locations are included in the nucleotide sequence of SEQ ID NO: 34.

    46. The composition of claim 44, wherein the nucleotide sequences at the first and second locations have the nucleotide sequences of SEQ ID NO: 30 and SEQ ID NO: 31, respectively.

    47. The composition of claim 45, wherein an amino acid sequence specifically binding to the nucleotide sequence at the first location and an amino acid sequence specifically binding to the nucleotide sequence at the second location include the amino acid sequences of SEQ ID NO: 32 and SEQ ID NO: 33, respectively.

    48. A method for inducing an inversion of the blood coagulation factor VIII (F8) gene, the method comprising: introducing the composition of claim 44 into somatic cells separated from a normal person.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0108] FIGS. 1a to 1f are views showing correction results of the partially-inverted F8 gene in hemophilia A patient-derived iPSCs. FIG. 1a shows results in which genomic DNA was isolated from human dermal fibroblasts (WT) and hemophilia A patient-derived urine cells (Pa1, Pa2, and Pa3) and subjected to PCR analysis using appropriate primers (Bagnall et al., 2006) to detect intron 1 (left) or 22 (right) inversions. FIG. 1b is a schematic view showing intron 22 inversion and reversion. Three homolog regions are represented as int22h-1, int22h-2, and int22h-3, respectively. Blue arrowheads indicate PCR primers. Nuclease target sites near int22h-1 or int22h-3 are indicated by black (RGEN 02) or red (RGEN 03) lightning symbols. FIG. 1c shows results in which mutations at nuclease target sites in HeLa cells were confirmed by the T7E1 assay. FIG. 1d shows PCR products corresponding to the inversion of the 563-kbp chromosomal segment in HeLa cells. FIG. 1e shows PCR analysis results to confirm the inversion correction in iPSC clones. FIG. 1f shows DNA sequences of breakpoint junctions in the inversion-corrected iPSC clones. Each RGEN target sequence is underlined; the PAM sequence is shown in green; and dashes indicate deleted bases. Lowercase letters indicate inserted bases, and blue arrows indicate cleavage sites.

    [0109] FIGS. 2a to 2e are views showing results of characterization of inversion-corrected iPSC Clones. FIG. 2a shows quantitative real-time PCR (qPCR) results to detect endogenous OCT4, SOX2, LIN28, and NANOG mRNAs from parental and corrected cell lines. The expression level of each gene was normalized through GAPDH. FIG. 2b shows the in vitro differentiation of inversion-corrected lines. The expressions of the respective marker proteins represent the differentiation into the ectoderm (Nestin), mesoderm [-smooth muscle actin [-SMA]), and endoderm (-fetoprotein [AFP]). Scale bar, 50 mm. FIG. 2c shows results in which the expression of OCT4 and SSEA4, human-ESC-specific markers, was detected by immunocytochemistry. Scale bar, 100 mm. Karyotypes of the iPSC lines are shown together. FIG. 2d is a view showing the F8 gene expression in cells differentiated from intron 1 and 22 inversion-corrected iPSC lines. RT-PCR (upper) and qPCR (lower) was used to detect the expression of F8 and a mesoderm marker gene (Brachyury) in cells derived from wild type iPSCs (WT), patient iPSCs (Pa1, Pa2, and Pa3), and inversion-corrected Pa1- (Co-1 and Co-2), or Pa2-iPSCs (Co-1, Co-2, and Co-3). GAPDH expression was used as a loading control. FIG. 2e shows chromatograms illustrating correct splicing between exons 1 and 2 or exons 22 and 23 in inversion-corrected iPSC lines.

    [0110] FIGS. 3a to 3f are views showing correction of intron 1 inversion in hemophilia A patient-derived iPSCs. FIG. 3a is a schematic diagram showing a process in which the intron 1 inversion found in a severe hemophilia A patient is corrected. Blue arrowheads indicate PCR primers. FIG. 3b shows results in which the mutation frequency of RGEN 01 target sites in intro 1 of the F8 gene in HeLa cells. FIG. 3c is a view showing PCR products corresponding to the inversion genotype of HeLa cells. FIG. 3d is a diagram showing DNA sequences of two intron 1 homologs (named int1 homologs 1 and 2) and breakpoint junctions. Genome DNA was isolated from HeLa cells transfected with RGEN-encoding plasmids and inversion-specific PCR bands were separated, and then two breakpoint junctions were sequenced. RGEN target sequences are underlined; PAM sequences are shown in green; and dashes indicate deleted bases. Lowercase letters indicate inserted bases. FIG. 3e shows genome DNA PCR analysis results of four corrected clones (Co-1 to Co-4). Genomic DNA was isolated from urine-derived cells of an intron 1 inversion patient (Pa1-U) and wild-type iPSC (WT), which is a positive control for the inversion or normal genotype. FIG. 3f shows DNA sequences of two intron 1 homologs (named int1 homologs 1 and 2) and breakpoint junctions. Genomic DNA was isolated from iPSCs transfected with an RGEN-encoding plasmid. Reversion-specific PCR bands were separated, and two breakpoint junctions were sequenced. RGEN target sequences are underlined; PAM sequences are shown in green; and dashes indicate deleted bases.

    [0111] FIGS. 4a to 4c show targeted inversion and reversion in HeLa cells or patient iPCS. FIG. 4a shows DNA sequences of two breakpoint junctions for inversion in HeLa cells. RGEN target sequences are underlined; PAM sequences are shown in green; and dashes indicate deleted bases. Lowercase letters indicate inserted bases, and blue arrows indicate cleavage sites. FIGS. 4b and 4c shows DNA sequences of breakpoint junctions in intron 1 (4b) and intron 22 (4c) regions, respectively. RGEN RNP was delivered directly to intron 1 (Pa1-iPSCs) or intron 22 (Pa3-iPSCs) inverted cells through electroporation. Total DNA was isolated from iPSCs, and then sequenced. RGEN target sequences are underlined; PAM sequences are shown in green; and dashes indicate deleted bases. Lowercase letters indicate inserted bases, and two blue arrows indicate cleavage sites. The number detected is indicated by the number in parentheses when the sequence is detected at least one.

    [0112] FIGS. 5a to 5g show generation of iPSC clones from HDFs using episomal reprogramming vectors. (5a) Morphology of the expanded human iPSCs (clone Epi3). (Scale bar, 200 m.) (5b) Alkaline phosphatase staining of iPSCs (clone Epi3). (Scale bar, 500 m.) (5c) Detection of an episomal vector sequence (EBNA-1) that remained in established iPSC lines (Epi1-Epi8). The GAPDH gene was used as a quality control for isolated total DNA. Total DNA isolated from the cells before (nave) and after (day 6) electroporation was used as negative and positive controls for episomal vector DNA. A retrovirus-derived wild-type iPSC line (iPSC1) was also analyzed as a negative control. (5d) The expression of OCT4 and SSEA-4, which are human ESC-specific markers, was detected by immunocytochemistry. DAPI signals indicate the total cell presence in the image. (Scale bars, 100 m.) (5e) RT-PCR analysis to determine the transcriptional levels of OCT4, SOX2, LIN28, NANOG, and GAPDH using gene-specific primers (listed in Table S3). mRNA levels were measured in HDFs, human ES line (H9), a wild-type iPSC line (WT-iPSCEpi3), and inversion clones (Inv 1 and Inv 2) derived from the WT-iPSCEpi3 line (1, HDFs; 2, H9; 3, WT-iPSC; 4, Inv 1; 5, Inv 2). (5f) Quantification of OCT4, SOX2, and LIN28 mRNAs in the indicated cell lines as determined by qPCR and normalized to GAPDH expression. (5g) Expression of marker proteins representing ectoderm (Nestin), mesoderm (-smooth muscle actin; -SMA), and endoderm (-fetoprotein; AFP). (Scale bars, 50 m.)

    [0113] FIGS. 6a to 6b show TALEN-mediated inversion of the F8 gene in HEK 293T cells. (6a) Proposed mechanism of a chromosomal inversion found in patients with severe hemophilia A. Inversions of 140-kbp chromosomal segments spanning the F8 gene are associated with two homologous regions oriented in opposite directions: homolog 1 located in intron1 of the F8 gene and homolog 2 located in the 140-kbp upstream region. Colored triangles show TALEN target sites, and arrows indicate the primers designed to detect 140-kbp inversions. (6b) T7E1 assay results of the 11 TALEN pairs we designed. The predicted positions of DNA bands cleaved by T7E1 are indicated by asterisks.

    [0114] FIGS. 7a to 7b show TALEN-mediated inversion of the F8 locus in iPSCs. (7a) PCR analysis of genomic DNA from four inversion clones. Genomic DNA samples isolated from hemophilia A patient cells (Pa) or wild-type iPSCs (WT) served as positive controls for the inversion or normal genotypes, respectively. (7b) DNA sequences of breakpoint junctions in inversion clones. TALEN binding sites are shown in red (homolog 1) or blue (homolog 2).

    [0115] FIGS. 8a to 8c show reversions of the F8 gene inversion. (8a) PCR analysis is of genomic DNA from three reverted clones. Genomic DNAs isolated from hemophilia A patient cells (Pa) or wild-type iPSCs (WT) served as positive controls for inversion or normal genotypes, respectively. (8b) DNA sequences of breakpoint junctions in reverted clones. TALEN binding sites are shown in red (junction 1) or blue (junction 2). Dashes indicate deleted bases. (8c) The chromatograms show the sequences (of homolog 1 and 2, respectively) between two TALEN binding sites in reverted clones (clones 1 and 3).

    [0116] FIGS. 9a to 9b show characterization of inverted and reverted clones. (9a) F8 gene expression in cells derived from inverted and reverted clones. RT-PCR was used to detect expression of F8 and endoderm marker genes (FOXA2 and Sox17) in cells derived from wild-type iPSCs (WT), inversion clones (Inv 1 and 2), and reverted clones (Rev 1, 2, and 3). GAPDH served as a loading control. (9b) Expression of the F8 protein in endothelial cells differentiated from inverted and reverted clones. The differentiated cells were fixed and stained with the indicated antibodies. DAPI signals indicate the total cell presence in the image. FVIII, F8 protein; vWF, von Willebrand factor (a mature endothelial marker protein). (Scale bars, 100 m.)

    [0117] FIGS. 10a to 10c show characterization of human induced pluripotent stem cells (iPSCs) generated by episomal reprogramming vectors. (10a) Karyotype analyses were performed on chromosomes from WT-iPSC lines at passages 10 (Epi3) and 12 (Epi8). (10b) Expression of Nanog and TRA-1-60, which are human embryonic stem cell (ESC)-specific surface markers, was detected by immunocytochemistry. DAPI signals indicate the total cell presence in the image. (Scale bars, 100 m.) (10c) The expression of marker proteins representing ectoderm (Pax6), mesoderm (Brachyury), and endoderm [hepatocyte nuclear factor 3- (HNF3)]. (Scale bars, 50 m.)

    [0118] FIGS. 11a to 11b show frequencies of targeted inversions. (A) The frequency of targeted inversions was estimated by digital PCR. Genomic DNA samples isolated from cells transfected with transcription activator-like effector nuclease (TALEN)-encoding plasmids were serially diluted and subjected to digital PCR analysis. (11b) Estimated frequencies of targeted chromosomal inversions created via zinc-finger nucleases (ZFNs) or TALENs. Z10 is a ZFN pair targeting the intron1 homolog of the F8 gene. The frequency of 140-kbp inversion events was measured by digital PCR analysis. Upper and lower limits indicate 95% confidence intervals.

    [0119] FIG. 12 shows analysis of TALEN off-target effects. Potential off-target sites of TALENs designed for this study were searched in silico. The three potential off-target sites most similar to the TALEN target site were selected and subjected to T7E1 analysis to confirm the off-target cleavage activities at these sites.

    [0120] FIG. 13 shows expression of human ES markers from inverted and reverted clones. Oct4, Sox2, and Lin28 mRNA levels from wild-type iPSC line (WT-iPSCEpi3), inversion clone (Inv 1), and reverted clones (Rev 1, 2, and 3) were quantified by quantitative PCR (qPCR). GAPDH mRNA levels were used for normalization.

    [0121] FIG. 14 shows in vitro differentiation of inverted and reverted clones. The expression of marker proteins representing ectoderm (III-Tubulin), mesoderm [-smooth muscle actin (-SMA) and Brachyury], and endoderm [-fetoprotein (AFP) and HNF3] in inversion clone 1 (Upper) and reverted clone 1 (Lower). (Scale bars, 50 m.)

    MODE FOR CARRYING OUT THE INVENTION

    [0122] Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

    EXAMPLE 1

    RNA-Guided Engineered Nuclease (RGEN)

    [0123] Methods

    [0124] Analyses of urine-derived iPSCs from hemophilia A patients according to the present invention was made under the approval of the Yonsei University Institutional Review Board (IRB #4-2012-0028). All volunteers signed written informed consent forms before donating urine samples for human iPSC generation.

    [0125] Cell Culture and Transfection

    [0126] HeLa cells (ATCC, CCL-2) were cultured in Dulbecco's modified Eagle's medium (DEME) supplemented with 10% fetal bovine serum (FBS), 0.1 mM nonessential amino acids, and 1% antibiotics. To induce DSB, 110.sup.5 HeLa cells were co-transfected with Cas9-encoding plasmid and sgRNA-encoding plasmid (0.5 mg each) using a Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's protocol. Human ESC (hESC) lines (H9) obtained from WiCell Inc, human dermal fibroblast-derived wild-type iPSCs (WT-iPSC Epi3 line) (Park et al., 2014), and urine-derived iPSCs were maintained together with 4 ng/mL basic fibroblast growth factor (bFGF, PeproTech) in hESC medium [DMEM/F12 medium supplemented with 20% knockout serum replacement (Gibco), 1% nonessential amino acids, and 0.1 mM 2-mercaptoethanol (Sigma)]. To induce reversions in urine-derived iPSCs, 110.sup.6 cells were electroporated with 5 g Cas9-encoding plasmid and 5 g of sgRNA-encoding plasmid (5 g of each sgRNA plasmid for the intron 22 inversion) using a microporator system (Neon; Invitrogen).

    [0127] For direct delivery of Cas9 protein into the urine-derived iPSCs, transfection was performed by the previously reported method (Kim et al., 2014) with slight modifications. Cas9 protein (15 g) was mixed with 20 g of transcribed sgRNA (20 g of each sgRNA plasmid for the intron 22 inversion), and incubated for 10 min at room temperature to form RGEN ribonucleoproteins (RNPs). The RNPs were transfected into 210.sup.5 iPSCs by using a microporator system.

    [0128] Isolation and Expansion of Urine-Derived Cells from Severe Hemophilia A Patients

    [0129] Urine samples were collected from 11 patients diagnosed with severe hemophilia A, and this diagnose had been clinically confirmed by the Korea Hemophilia Foundation Clinic. Urine-derived cells were isolated by the previously reported method (Zhou et al., 2012). In brief, cells were collected from approximately 100 ml of midstream urine sample by centrifugation at 400 g for 10 min. After washing twice with PBS, the cells were cultured in DMEM/Ham's F12 (1:1) medium (Hyclone) supplemented with 10% (vol/vol) FBS, renal epithelial cell growth medium (REGM, obtained from the SingleQuot kit (Lonza)), and 1% antibiotics. After four days of culture under these conditions, the cells were cultured in REGM (Lonza) to expand the cells. The cells were split onto gelatin-coated culture dishes at 80-90% confluency. To confirm the F8 genotype, genomic DNA samples isolated from urine-derived patient cells were subjected to PCR analysis with primer sets recognizing appropriate regions near the intron 1 and 22 inversions of the F8 locus (Bagnall et al., 2006; Park et al., 2014.

    [0130] RGEN Composition

    [0131] Cas9-encoding plasmids were constructed by the previously reported method (Cho et al., 2013). Cas9 protein fused to the HA epitope and a nuclear localization signal (NLS) was expressed under the CMV promoter. The U6 promoter was used in sgRNA expression (Cho et al., 2014). Purified recombinant Cas9 protein was purchased from ToolGen, Inc. Guiding RNA was transcribed in vitro using the MEGAshortscript T7 kit (Ambion) by the previously reported method (Kim et al., 2014). Transcribed RNA was purified by phenol:chloroform extraction, and quantified using a spectrometer.

    [0132] T7E1 Assay and Determination of Targeted Inversion Frequencies

    [0133] The T7E1 assay was performed according to the previously reported method (Kim et al., 2009). In brief, PCR amplicons including the RGEN target sites were denatured by heating and annealed to form heteroduplex DNA fragments. The fragments were then treated with T7 endonuclease (New England Biolabs) for 20 min at 37 C. to allow cutting at mismatched sites, and the products were analyzed by agarose gel electrophoresis. The frequencies of targeted corrections at the F8 locus were estimated through digital PCR analysis by the previously reported method (Kim et al., 2010). Genomic DNA isolated from the cells were co-transfected with RGEN and sgRNA plasmids using the lipofectamine 2000 transfection reagent (Invitrogen) was serially diluted, and the diluted samples were subjected to PCR analysis. The fraction of positive bands at each dilution point was determined and the results were analyzed using the Extreme Limiting Dilution Analysis program (Hu and Smyth, 2009).

    [0134] Validation of RGEN-Mediated Inversion of the F8 Locus in HeLa Cells

    [0135] To validate the genome editing activities of the RGENs designed in the present invention, each RGEN was co-transfected with a sgRNA expression plasmid into HeLa cells. RGEN activity was measured using the T7E1 assay as described above.

    [0136] Targeted RGEN-Mediated Correction of the F8 Locus in Patient-Derived iPSCs

    [0137] iPSCs were cultured on a STO cell support layer and harvested by treating with collagenase type IV. After washing with PBS, the cells were dissociated into single cells by the previously reported method (Desbordes et al., 2008). These single cells were mixed with RGEN and sgRNA plasmids, and pulsed with a voltage of 850 for 30 ms. Cells were then seeded onto support cells and allowed to grow for 10 days. To detect genomic inversion occurring at the F8 locus, cells from individual colonies were lysed and subjected to PCR, and PCR products were analyzed. The used primers are as follows: 1-F1: 5-AAATCACCCAAGGAAGCACA-3 (SEQ ID NO: 5), 1-R1: 5-TGGCATTAACGTATTACTTGGAGA-3 (SEQ ID NO: 6); 1-F2: 5-GGCAGGGATCTTGTTGGTAAA-3 (SEQ ID NO: 7), 1-R2: 5-TGCTGAGCTAGCAGGTTTAATG-3 (SEQ ID NO: 8); 22-F1: 5-TGGGGCTGTGTAAATTTGCT-3 (SEQ ID NO: 9), 22-R2: 5-CAAACGTAGCATTACCTGATTGT-3 (SEQ ID NO: 10); 22-F2: 5-ACAACCAGAGCAGAAATCAATGA-3 (SEQ ID NO:11), 22-R2: 5-TTTCACCACATCCACGCCAA-3 (SEQ ID NO:12).

    [0138] Establishment and Characterization of Clonal Cell Populations

    [0139] To isolate clonal populations of corrected cells, each colony that had been identified by PCR as having desired genomic modifications (namely, correction of the inversion genotype) was dissociated into single cells, and re-seeded onto a new cell support layer. After 4 rounds of passage, several clones (4 clones for the intron 1 correction, 3 clones for the intron 22 correction) were chosen for sequencing and further experiments. For sequence analysis at the breakpoints, amplified PCR products were electrophoresed, and eluted from the agarose gel.

    [0140] RNA Isolation, RT-PCR, and qPCR

    [0141] Total RNAs were purified using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. cDNAs were synthesized from total RNAs (1 g) using the DiaStar cDNA synthesis kit (SolGent, Korea). To confirm the expression of Factor VIII, Brachyury, and GAPDH, PCR was performed with Ex-Taq (Takara) using the synthesized cDNAs as template. For qPCR, SYBRPremix Ex-Taq (Takara) was used according to the manufacturer's instructions. To amplify F8 mRNA from intron 1 or intron 22 corrected lines, respectively, a forward primer located in exon 1 (or exon 21 for intron 22 corrected lines) was used together with a reverse primer located in exon 3 (or exon 23 for intron 22 corrected lines). RT-PCR or qPCR was performed using the following primer sets: GAPDH-F: 5-CCCCTCAAGGGCATCCTGGGCTA-3 (SEQ ID NO: 13), GAPDH-R: 5-GAGGTCCACCACCCTGTTGCTGTA-3 (SEQ ID NO: 14); OCT4-F: 5-CCTCACTTCACTGCACTGTA-3 (SEQ ID NO: 15), OCT4-R: 5-CAGGTTTTCTTTCCCTAGCT-3 (SEQ ID NO: 16); LIN28-F: 5-AGCCATATGGTAGCCTCATGTCCGC-3 (SEQ ID NO. 17), LIN28-R: 5-TCAATTCTGTGCCTCCGGGAGCAGGGTAGG-3 (SEQ ID NO: 18); SOX2-F: 5-TTCACATGTCCCAGCACTACCAGA-3 (SEQ ID NO: 19), SOX2-R: 5-TCACATGTGTGAGAGGGGCAGTGTGC-3 (SEQ ID NO: 20); NANOG-F: 5-TGAACCTCAGCTACAAACAG-3 (SEQ ID NO: 21), NANOG-R: 5-TGGTGGTAGGAAGAGTAAAG-3 (SEQ ID NO: 22); F8-exon1-F: 5-CTGCTTTAGTGCCACCAGAAGA-3 (SEQ ID NO: 23), F8-exon3-R: 5-GACTGACAGGATGGGAAGCC-3 (SEQ ID NO: 24); F8-exon21-F: 5-CCGGATCAATCAATGCCTGGAG-3 (SEQ ID NO: 25), F8-exon23-R: 5-ATGAGTTGGGTGCAAACGGATG-3 (SEQ ID NO: 26); Brachyury-F: 5-ATCACAAAGAGATGATGGAGGAA-3 (SEQ ID NO: 27), Brachyury-R: 5-GGTGAGTTGTCAGAATAGGTTGG-3) (SEQ ID NO: 28).

    [0142] Generation and In Vitro Differentiation of Urine-Derived iPSCs

    [0143] After three or fewer passages, iPSCs were generated from urine-derived cells. Episomal reprogramming vectors or Sendai virus (Invitrogen) were used to prepare iPSCs using urine-derived cells according to the previously reported method (Okita et al., 2011). Seven iPSC colonies that looked similar to human ES cells were picked up by a mechanical device, and were further cultured for characterization. The iPSCs were differentiated into three germ layers In vitro by a known method (Sugii et al., 2010). iPSC colonies were partially dissociated through collagenase type IV (Invitrogen) to induce the formation of embryoid bodies (EBs). EBs were transferred to Petri dishes (SPL Lifesciences, Korea) and cultured for 10 days in hESC medium lacking bFGF but supplemented with 5% FBS. Spontaneous differentiation of EBs into cells representing the three germ layers was detected through immunostaining using appropriate antibodies. To induce differentiation of iPSCs into the mesoderm lineage, the previously reported method was used with slight modifications (Yoo et al., 2013). Briefly, EBs were transferred to Petri dishes and cultured in hESC medium lacking bFGF but supplemented with 20 ng/mL bone morphogenic protein-4 (BMP4, R&D Systems) and 10 ng/mL activin A (PeproTech). At day 3, EBs were plated onto Matrigel-coated dishes and cultured for an additional 3 days in the medium described above. At day 6, the cells that had differentiated into the mesoderm lineage were harvested to check the expression of F8 gene.

    [0144] Characterization of iPSCs

    [0145] Alkaline phosphatase activity was determined using a leukocyte alkaline phosphatase staining kit (Sigma) according to the manufacturer's instructions. To confirm that the iPSC lines were generated from the urine-derived cells, short tandem repeats (STRs) were analyzed. STR loci were amplified from genomic DNA samples isolated from iPSC lines and their parental cells using the AmpFISTR PCR reaction system (Applied Biosystems). PCR-based STR analysis was performed at Human Pass Inc. (Korea). For karyotype analysis, G-banding analysis of chromosomes from each iPSC line was performed at GenDix Inc. (Korea). Immunostaining of ES cell markers was carried out by the previously reported method (Park et al., 2014). DAPI (4,6-diamidino-2-phenylindole, Vector Laboratories) was used for nuclei visualization, and the images were captured and analyzed using an Olympus IX71 microscope or FSX system.

    [0146] Targeted Deep Sequencing

    [0147] Genomic DNA segments encompassing nuclease target sites were amplified using Phusion polymerase (New England Biolabs). An equal amount of PCR amplicons were subjected to paired-end read sequencing using Illumina MiSeq. I around the RGEN cleavage site (PAMen3bp upstream) was considered to be mutations induced by RGEN.

    [0148] Whole Genome Sequencing

    [0149] Genomic DNA was purified by the DNeasy Tissue kit (Qiagen) according to manufacturer's instructions. Genomic DNA (1 g) was fragmented using a Covaris system and blunt ends were generated using End Repair Mix. Fragmented DNA was ligated with adapters to make libraries. Libraries were subjected to sequencing using IlluminaHiSeq X Ten sequencer at Macrogen (Korea).

    [0150] Whole Genome Sequencing and Variant Information Extraction

    [0151] FASTQ files obtained from the IlluminaHiSeq X Ten Sequencer were analyzed through an Isaac workflow from Illumina, Inc (USA). In brief, FASTQ files read by paired ends were aligned using according to the genome reference (hg19) Isaac Genome Alignment software (Isaac Aligner). Thereafter, single nucleotide polymorphism (SNP) and indels were identified by Isaac Variant Caller. Among millions of variants, the present inventors focused on indels because RGENs rarely induce substitutions. The bioinformatics filters were applied to exclude the indels registered in the public database and the indels extracted from other genomes. Next, the RGEN target sites were compared with wild-type loci corresponding to the indel locations. 31-106 indel sites included 5-N(G/A)G-3PAM sequence, and showed at least 12 nucleotide matches with respective on-target sequences. Finally, targeted deep sequencing was performed on 10 indel sites after discarding sites with repeat sequence.

    [0152] Examination of Potential Off-Target Sites

    [0153] To examine whether there were nuclease-induced indels at a lot of potential off-target sites in each genome sequence, the Cas-OFFinder was used to identify all the potential off-target sites that differed from on-target sites by up to 8 nucleotides or that differed by up to 2 nucleotides with a DNA or RNA bulge of 5 bases in length (Bae et al., 2014). An inner computer program was used to make a consensus CIGAR string that constituted 20% of total CIGAR strings at each potential off-target site. Next, the consensus CIGAR strings of a lot of potential off-target sites were compared with the CIGAR strings of the reference sequence. As a result, 83 to 348 potential off-target sites were obtained. Finally, targeted deep sequencing was performed on 4 indel sites that were observed in the independent clones and had no repeat sequences around the target sites.

    [0154] Results

    [0155] First, the present inventors analyzed the genotypes of 11 unrelated, severe hemophilia A patients and identified one patient with the int1 inversion and two patients with the int22 inversion. Therefore, the one patient with the int1 inversion (termed Pa1) and two patients with the int22 inversion (termed Pa2 and Pa3) were chosen to carry out experiments (FIG. 1a). Respective iPSCs were established by introducing four Yamanaka factors into urinary epithelial cells via an episomal vector or Sendai virus, thereby obtaining fibroblasts from these patients with a bleeding disorder to avoid an invasive biopsy. Simultaneously, it was examined whether RGENs, which consisted of the Cas9 protein and small guide RNA (sgRNA), have activity to induce or revert their inversions in wild-type HeLa cells and patient iPSCs. RGEN 01 was designed to target a site in int1h (FIG. 3a). RGEN 01 was highly active, inducing small insertions and deletions (indels) at a frequency of 34% at the target site in int1h (FIG. 3b). In addition, RGEN 01 induced the inversion of the 140-kbp chromosomal segment in HeLa cells, as shown by inversion-specific PCR (FIG. 3c). The frequency of the inversion ranged from 2.2% to 3.1%, as measured by digital PCR (Kim et al., 2010; Lee et al., 2010).

    [0156] The present inventors, as a result of analyzing the DNA sequences of the inversion-specific PCR amplicons, found that indels were induced at the two inversion breakpoint junctions (FIG. 3d). Based on the high frequency, the present inventors co-transfected plasmids encoding the Cas9 protein and the sgRNA into Pa1-derived iPSCs (Pa1-iPSCs) and analyzed iPSC colonies using PCR. Eight colonies (not necessarily derived from single cells, 6.7%) out of 120 colonies produced positive PCR bands on an agarose gel.

    [0157] Four colonies were further cultured to obtain single-cell-derived clones. These clones produced PCR amplicons corresponding to the int1h-1 and int1h-2 regions, indicating that the inverted 140-kbp chromosomal segment in Pa1 cells was reverted (FIG. 3e).

    [0158] In contrast, no PCR amplicons were produced from Pa1 iPSCs or urinary cells. The present inventors observed that no indels were induced at the target site in three clones by sequencing the PCR amplicons. In the other clone, there was a 13-bp deletion at the target site (FIG. 3d).

    [0159] Then, the present inventors also focused on the other int22h inversion. To exclude the possibility that unwanted deletions or inversions involving two or three int22 homologs, rather than the desired reversion of the inverted 600-kbp segment, two RGENs that target sites outside of the homologs were used (FIG. 1b). This strategy also facilitates the detection of the reversion using appropriate PCR primers. The present inventors designed two RGENs (RGEN 02 and RGEN 03) to target sites near int22h-1 and int22h-3, and tested their nuclease activity in HeLa cells through the T7 endonuclease I (T7E1) assay. These RGENs were highly active, inducing indels at each target site with a frequency of 44% or 32% (FIG. 1c). Next, the inversion of the 563-kbp chromosomal segment between the two target sites was detected by PCR. Transfection of either RGEN 02 or RGEN 03 alone into HeLa cells did not produce inversion-specific PCR amplicons. In contrast, co-transfection of these RGEN plasmids gave rise to two inversion-specific PCR amplicons (FIG. 1d). The inversion frequency was in the range of 1.5% to 2.2% (Table 1).

    TABLE-US-00001 TABLE 1 Frequencies of targeted inversions in HeLa cells Amount of genomic DNA (Copy number per half genome) Frequency (%) 333 pg 100 pg 33 pg 10 pg Estimated Upper and p value 1 ng (100) (30) (10) (3) value Lower limits (Fit) Int1h1 16/16 16/16 10/16 3/16 0/16 3.1 (2.0-4.7) 0.04 Int1h2 16/16 15/16 7/16 3/16 0/16 2.2 (1.4-3.3) 0.24 Int22 16/16 13/16 8/16 6/16 0/16 2.2 (1.4-3.3) 0.43 (junction1) Int22 16/16 13/16 6/16 0/16 1.5 (1.0-2.3) 0.13 (junction3) * Upper and lower limits indicate 95% confidence intervals.

    [0160] As a result of determining the DNA sequences of the PCR amplicons, it was observed that most of indels accompanied the two inversion breakpoint junctions, indicating that two DSBs induced by the two RGENs were repaired by error-prone non-homologous end joining (NHEJ) (FIG. 4a). HeLa cells are wild type with respect to the F8 exon orientation. In Pa2 and Pa3 cells, F8 exons 1 to 22 are inverted. But still, the two RGEN target sites are conserved, enabling the reversion of the large chromosomal segment.

    [0161] Next, RGEN 02 and 03 were transfected into Pa2 iPSCs through electroporation, and 135 colonies were isolated and subjected to PCR analysis for genomic DNA thereof. Five colonies (3.7%) yielded PCR amplicons corresponding to inversion-correction (namely, reversion). Such PCR products were not obtained in Pa2 iPSCs or wild type iPSCs. These colonies were further expanded to enable the isolation of three independent single-cell-derived clones. To confirm whether the 563-kbp chromosomal segment between the two RGEN sites was reverted, the DNA sequences at the two inversion breakpoint junctions were examined (FIG. 1f). As a result, like in HeLa cells, indels, which correspond to the characteristic of error-prone NHEJ, were observed at the two breakpoint junctions in these inversion-corrected iPSCs.

    [0162] The present inventors investigated whether the inversion-corrected iPSCs retained pluripotency. First, as a result of investigating the expression of stem cell markers in inversion-corrected Pa1 (int1h inversion) and Pa2 (int22h inversion) iPSCs, it was found that OCT4, SOX2, LIN28, and NANOG, were actively transcribed (FIG. 2a). In addition, these inversion-corrected iPSCs were successfully differentiated into three primary germ layers (FIG. 2b), and furthermore, showed a normal karyotype (FIG. 2c). Taken together, it can be seen that th gross chromosomal reversions induced by RGENs do not negatively affect the pluripotency of patient-derived iPSCs.

    [0163] Endothelial cells derived from mesoderm are a major source of F8 gene expression (Shahani et al., 2010). The present inventors differentiated patient iPSCs and inversion-corrected patient iPSCs into mesoderm, and then measured the levels of F8 mRNA using RT-PCR. As expected, no PCR bands corresponding to F8 exons 1 and 2 were detected in cells differentiated from Pa1-iPSCs, indicating that F8 was not expressed in patient-derived cells (FIG. 2d). In contrast, PCR bands corresponding to these exons were detected in cells differentiated from the wild type iPSCs or the two inversion-corrected Pa1-iPSCs (Co-1 and Co-2). Likewise, PCR amplicons corresponding to F8 exons 22 and 23 were not detected in cells differentiated from Pa2- and Pa3-iPSCs, but were detected in cells differentiated from the three inversion-corrected iPSCs (FIG. 2d).

    [0164] It was confirmed through Sanger sequencing that exons 1 and 2 or exons 22 and 23 were correctly spliced in cells differentiated from the inversion-corrected iPSCs (FIG. 2e). These results prove that the F8 gene was corrected in patient iPSCs having intron 1 and 22 inversions.

    [0165] To prevent unwanted insertions of plasmid fragments at RGEN on-target and off-target sites, the recombinant Cas9 protein purified after expression in E. coli and the in vitro transcribed sgRNAs (RGEN ribonucleoproteins, or RNPs) were transduced into two patients (Pa1 and Pa3) iPSCs each having an intron 1 or 22 inversion.

    [0166] PCR and Sanger sequencing were used to confirm the reversion of the 140-kbp or 563-kbp chromosomal segments restoring the genetic functions of the F8 gene (FIGS. 4b and 4c). Since RNPs, unlike plasmids, cleave chromosomal target DNA immediately after transduction and are rapidly degraded in cells (Kim et al., 2014), off-target effects can be reduced without sacrificing genome correction activity at on-target sites through transduction of RGEN RNP.

    [0167] RGENs can induce off-target mutations, which are homologous in sequence with on-target sites (Cho et al., 2014; Cradick et al., 2013; Fu et al., 2013; Hsu et al., 2013; and Pattanayak et al., 2013). The present inventors investigated whether the RGENs used in the present invention left any secondary damage in addition to inversion corrections in patient iPSCs using targeted deep sequencing and whole-genome sequencing (WGS). First, the present inventors searched for potential off-target sites that differed from the three RGEN on-target sites by up to three nucleotides in the human genome using Cas-OFFinder, a webbased program accessible at (www.rgenome.net, Bae et al. 2014). A total of 12, 6, and 14 sites were found in RGEN 01, RGEN 02, and RGEN 03, respectively. To confirm that indels were not induced at these sites in the inversion-corrected iPSCs using targeted deep sequencing (FIG. 2).

    TABLE-US-00002 TABLE 2 Analysis of potential off-target sites Targeted deep sequencing of off-target sites allowing three mismatches RGEM RGEM01 RGEM02 RGEM03 Off-target sites 12 6 14 Confirmed by deep sequencing 0 0 0 WGS analysis and variant information extraction of off-target sites Clone Pal Pal_Co-1 Pal2 Pal2-Co-1 All variants 4,006,558 3,964,083 3,945,677 3,933,902 Raw indel calls 505,673 496,678 488,735 477,957 Indels not present in 56,586 52,832 51,105 48,614 the idel database KO clone-specific indels 13,707 10,914 11,578 9,848 Candidate indels at homologous sites (RGEN (RGEN (RGEN N/A 01) 52 N/A 02) 106 03) 31 Excluding repeat N/A 7 N/A 0 3 sequence Confirmed by deep N/A 0 N/A 0 0 sequencing Targeted deep sequencing of off-target sites allowing eight mismatches RGEN RGEN 01 RGEN 02 RGEN 03 Off-target sites 511,710 652,127 937,778 Potential candidates 88 348 163 Excluding repeat sequence 1 2 1 Confirmed by deep sequencing 0 0 0

    [0168] Next, genomic DNA isolated from patient (Pa1 and Pa2) iPSCs and respective inversion-corrected iPSCs were subjected to WGS. First, Isaac, which is a variant information extraction program, was used to identify indels relative to the hg19 reference genome. The bioinformatics filters were used to exclude the indels registered in the public database, the indels extracted from patient genomes having the int1h or int22h inversion and the other inversion-corrected genomes, and the indels occurring in the homo-polymer or repeat sequences due to sequencing errors. As a result, 9,848 to 13,707 indels that were unique in each inversion-corrected genome sequence were obtained. Next, the RGEN target sites were compared with wild-type loci corresponding to the indel locations. Only 31 to 106 indel sites had 5-N(G/A)G-3PAM sequence, and showed at least 12 nucleotide matches with respective on-target sequences (Table 2). Thereafter, the DNA sequences corresponding to these indels in the two inversion-corrected genomes were investigated. None of the indels were validated by targeted deep sequencing. Then, all the potential off-target sites that differed from on-target sites by up to eight nucleotides or that differed by up to two nucleotides with a DNA or RNA bulge of five nucleotides were identified through the Cas-OFFinder. Thereafter, as a result of comparing the sequence reads aligned around 10 of the thousands derived from potential off-target sites with the reference sequence (Table 2), no off-target indels were identified. These results show that the three RGENs used in the present invention did not induce off-target mutations in the inversion-corrected patient iPSCs. In brief, the present inventors used RGENs to repair two recurrent, large chromosomal inversions providing almost half of all severe hemophilia A cases in patient-derived iPSCs, and thus observed that the cells differentiated from the inversion-corrected iPSCs expressed the F8 genes. It was confirmed through targeted deep sequencing and WGS analysis that the off-target mutations were not induced in the inversion-corrected iPSCs. This is the first demonstration that large genomic rearrangements, such as chromosome inversion, can be corrected using RGEN or other gene scissors in patient iPSC. Chromosomal inversions are associated with other genetic diseases, such as Hunter syndrome (Bondeson et al., 1995) and cancer (Nikiforova et al., 2000). Targeted genomic rearrangements using RGENs in iPSCs enable genomic structural variations can be favorably used for units to study their functions and for gene and cell therapy for hemophilia A and other genetic diseases caused by large chromosomal rearrangements.

    EXAMPLE 2

    TALEN (Transcription Activator-Like Effector Nucleases)

    [0169] Methods

    [0170] Plasmids Encoding TALENs

    [0171] TALEN plasmids in this study were synthesized by using TAL effector array plasmids constructed for one-step Golden-Gate assembly as described (Kim Y, et al. (2013) A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31(3):251-258). Each TALEN plasmid encodes the N-terminal 135 amino acids of AvrBs3, an array of RVD modules, one of the four RVD halfrepeats, and the Sharkey Fokl domain (Guo J, Gaj T, Barbas C F, 3rd (2010) Directed evolution of an enhanced and highly efficient Fokl cleavage domain for zinc finger nucleases. J Mol Biol 400(1):96-107). TALEN sites were designed to target the intron 1 homolog of the F8 gene; potential off-target sites were identified as described(Kim Y, et al. (2013) A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31(3):251-258).

    [0172] Isolation of Genomic DNA from Hemophilia A Patient

    [0173] Seoul National University Institutional Review Board approval was obtained for the analysis of blood cells of a hemophilia A patient. The blood sample was provided by Korea Hemophilia Foundation Clinic, and genomic DNA was isolated as described (Lee H J, Kweon J, Kim E, Kim S, Kim J S (2012) Targeted chromosomal duplications and inversions in the human genome using zinc finger nucleases. Genome Res 22(3): 539-548).

    [0174] Measuring the Frequencies of Targeted Inversions. The Frequencies of Targeted

    [0175] inversions were estimated by digital PCR analysis as described (Kim S, Lee H J, Kim E, Kim J S (2010) Analysis of targeted chromosomal deletions induced by zinc finger nucleases. Cold Spring Harb Protoc 10.1101/pdb.prot5477). The genomic DNA samples isolated from cell transfected with TALEN plasmids were serially diluted, and the diluted samples were subjected to nested PCR by using appropriate primers (Table 3). The fraction of positive bands at each dilution point was counted, and the results were analyzed by using the Extreme Limiting Dilution Analysis program (Hu Y, Smyth G K (2009) ELDA: Extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J Immunol Methods 347(1-2):70-78).

    TABLE-US-00003 TABLE3 Primers Primername Sequence(5 to3) Usedfortheexperimentof homolog1-1F AAATCACCCAAGGAAGCACA InversionandReversion (SEQIDNO:5) homolog1-1R TGGCATTAACGTATTACTTGGAGA InversionandReversion (SEQIDNO:6) homolog2-2F GGCAGGGATCTTGTTGGTAAA InversionandReversion (SEQIDNO:7) homolog2-2R TGCTGAGCTAGCAGGTTTAATG InversionandReversion (SEQIDNO:8) GAPDH-F CCCCTCAAGGGCATCCTGGGCTA qPCRandRT-PCR (SEQIDNO:13) GAPDH-R GAGGTCCACCACCCTGTTGCTGTA qPCRandRT-PCR (SEQIDNO:14) Oct4-F CCTCACTTCACTGCACTGTA qPCR (SEQIDNO:15) Oct4-R CAGGTTTTCTTTCCCTAGCT qPCR (SEQIDNO:16) Sox2-F CCCAGCAGACTTCACATGT qPCR (SEQIDNO:32) Sox2-R CCTCCCATTTCCCTCGTTTT qPCR (SEQIDNO:33) Lin28-F AGCCAAGCCACTACATTC qPCR (SEQIDNO:34) Lin28-R AGATACGTCATTCGCACA qPCR (SEQIDNO:35) Nanog-F TGAACCTCAGCTACAAACAG qPCR (SEQIDNO:21) Nanog-R TGGTGGTAGGAAGAGTAAAG qPCR (SEQIDNO:22) F8-F CTGCTTTAGTGCCACCAGAAGA RT-PCR (SEQIDNO:23) F8-R GACTGACAGGATGGGAAGCC RT-PCR (SEQIDNO:24) FOXA2-F CTACGCCAACATGAACTCCA RT-PCR (SEQIDNO:36) FOXA2-R AAGGGGAAGAGGTCCATGAT RT-PCR (SEQIDNO:37) Sox17-F AGCGCCCTTCACGTGTACTA RT-PCR (SEQIDNO:38) Sox17-R CTTGCACACGAAGTGCAGAT RT-PCR (SEQIDNO:39) GAPDH-F GAACATCATCCCTGCCTCTACTG iPSgeneration(PCR) (SEQIDNO:40) GAPDH-R CAGGAAATGAGCTTGACAAAGTGG iPSgeneration(PCR) (SEQIDNO:41) EBNA-1-F ATGGACGAGGACGGGGAAGA iPSgeneration(PCR) (SEQIDNO:42) EBNA-1-R GCCAATGCAACTTGGACGTT iPSgeneration(PCR) (SEQIDNO:43) 293-F GAGCAGGGAGGCAAGAATTA TALENsactivityscreening (SEQIDNO:44) 293-R TGAGGGAAAACGCATCTAGG TALENsactivityscreening (SEQIDNO:45)

    [0176] Cell Cultures

    [0177] HEK 293T/17 (ATCC; CRL-11268) and adult HDFs (Invitrogen; C-004-5C) were cultured in DMEM supplemented with FBS (10% vol/vol) and antibiotics (1%). Human ESC (hESC) lines (H9) obtained from WiCell, retrovirus-derived wild-type iPSCs (iPSC1), and iPSCs generated in this study were maintained in hESC medium composed of DMEM/F12 medium supplemented with 20% (vol/vol) knockout serum replacement (Invitrogen), 4.5 g/L L-glutamine, 1% nonessential amino acids, 0.1 mM 2-mercaptoethanol, and 4 ng/mL basic FGF (PeproTech) as described (Kim D S, et al. (2010) Robust enhancement of neural differentiation from human ES and iPS cells regardless of their innate difference in differentiation propensity. Stem Cell Rev 6(2):270-281).

    [0178] Validation of TALENs Targeting the F8 Locus in HEK 293T Cells

    [0179] To validate the genome-editing activities of the TALENs designed for this study, each TALEN pair was transfected into HEK 293T cells, and their activities were measured by using the T7E1 assay (Kim H J, Lee H J, Kim H, Cho S W, Kim J S (2009) Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res 19(7): 1279-1288). To measure the frequency of targeted inversions induced by TALENs targeting the F8 locus, HEK 293T/17 cells were seeded at 80% confluency before transfection and transfected by using Lipofectamine 2000 (Invitrogen) with TALEN-encoding plasmids. Genomic DNA samples were isolated and subjected to PCR analysis to confirm chromosomal inversion as described (Kim S, Lee H J, Kim E, Kim J S (2010) Analysis of targeted chromosomal deletions induced by zinc finger nucleases. Cold Spring Harb Protoc 10.1101/pdb.prot5477).

    [0180] Generation of iPSCs and In Vitro Differentiation into Three Germ Layers

    [0181] Episomal vectors encoding defined reprogramming factors were used as reported (Okita K, et al. (2011) A more efficient method to generate integration-free human iPS cells. Nat Methods 8(5):409-412). In brief, HDFs grown in DMEM supplemented with 10% FBS were electroporated by using a microporator system (Neon; Invitrogen) with episomal vector mixtures (total 3 g) according to the manufacturer's instructions. After being pulsed three times with a voltage of 1,650 for 10 ms, the cells were grown further in DMEM (containing 10% FBS). Seven days after transfection, cells were transferred onto a feeder layer.

    [0182] iPSC colonies that looked similar to hESCs were picked up mechanically and further cultured for characterization. In vitro differentiation of the iPSCs into three germ layers was induced as described (Sugii S, et al. (2010) Human and mouse adipose-derived cells support feederindependent induction of pluripotent stem cells. Proc Natl Acad Sci USA 107(8): 3558-3563). Embryoid bodies (EBs), formed by partially dissociating iPSCs using collagenase type IV (Invitrogen), were transferred to ultralow attachment plates (Corning) and cultured in DMEM/F12 (1:1) medium supplemented with 20% knockout serum (Invitrogen), 4.5 g/L L-glutamine, 1% nonessential amino acids, 0.1 mM 2-mercaptoethanol, and 5% FBS. After a week of cultivation under these conditions, EBs were attached onto Matrigel-coated culture dishes and further cultured for 10 d. Spontaneous differentiation of EBs into cells representing the three germ layer lineages was detected by immunostaining with appropriate antibodies.

    [0183] Differentiation of iPSCs

    [0184] To induce differentiation of iPSCs into the endoderm lineage, we used a described method (Si-Tayeb K, et al. (2010) Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells. Hepatology 51(1):297-305). In brief, iPSC colonies were cultured in mTeSR-1 hESC growth medium (StemCell Technology) for feederfree culture. Undifferentiated iPSCs were incubated to obtain definitive endoderm cells in RPMI/B27 (RPMI-1640 from Sigma; B27 supplement from Invitrogen) medium supplemented with 100 ng/mL Activin A (PeproTech) and 5 M phosphatidylinositol 3-kinase inhibitor (LY-294002; Sigma) for 5 d. Cells that had differentiated into endoderm were harvested for isolation of total RNAs, which were used as template for cDNA synthesis.

    [0185] To induce differentiation of iPSCs into the endothelial cells, we used a described method (Yoo C H, et al. (2013) Endothelial progenitor cells from human dental pulp-derived iPS cells as a therapeutic target for ischemic vascular diseases. Biomaterials 34(33):8149-8160) with slight modifications. In brief, EBs were cultured in hESC medium supplemented with 20 ng/mL bone morphogenic protein 4 (R&D Systems) and 10 ng/mL Activin A (PeproTech). On day 3 of EB formation, the EBs were attached onto Matrigel-coated dishes and induced to differentiate into endothelial cells for up to 10 d in medium supplemented with 100 ng/mL VEGF (PeproTech) and 50 ng/mL basic FGF (R&D Systems).

    [0186] TALEN Transfections for Inducing Inversion and Reversion in iPSCs

    [0187] Cultured iPSCs were harvested by treating with collagenase type IV. After washing with PBS, the cells were further treated with Accutase (Invitrogen) to create single cell suspensions as described (Desbordes S C, et al. (2008) High-throughput screening assay for the identification of compounds regulating self-renewal and differentiation in human embryonic stem cells. Cell Stem Cell 2(6):602-612). These single cells were mixed with 10 g of TALEN-encoding plasm ids (5 g of each plasmid) and pulsed with a voltage of 850 for 30 ms. Cells were then seeded onto feeder cells and allowed to grow for 10 d. To detect genomic inversion or reversion events, cells from individual colonies were lysed in 20 L of lysis buffer [1 Ex-taq buffer (pH 8.0) containing proteinase K] at 56 C. for 3 h. After inactivation of proteinase K, 2 L of genomic DNA solution was subjected to PCR by using Ex-taq DNA polymerase (Takara) and specific primers. PCR products were analyzed by agarose gel electrophoresis. Specific primer sequences are shown in Table 5.

    [0188] Isolation of Clonal Populations of Cells, PCR Analysis, and DNA Sequencing of Breakpoints

    [0189] To isolate clonal populations of inverted (or reverted) cells, each colony that had been identified by PCR as containing the desired genomic event was dissociated into single cells by using collagenase and Accutase as described above and replated. After three rounds of passaging, several clones (six clones for inversion, four clones for reversion) were chosen for sequencing and further experiments. For sequence determination, amplified PCR products were electrophoresed, eluted from the agarose gel by using a Gel Extraction kit (SolGent), and cloned into the pGEM-T vector (Promega). Cloned PCR products were sequenced by using T7 primers.

    [0190] RNA Isolation, RT-PCR, and qPCR

    [0191] Total RNAs were purified from cells by using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. cDNAs were synthesized from total RNAs (1 g) by using the DiaStar cDNA synthesis kit (SolGent). To confirm the expression of Factor VIII, FOXA2, Sox17, and GAPDH, PCR was performed with Ex-Taq (Takara) by using the synthesized cDNAs as template. For qPCR, SYBR Premix Ex-Taq (Takara) was used according to the manufacturer's instructions. Specific primer sequences used for RT-PCR or qPCR are shown in Table 5.

    [0192] Alkaline Phosphatase Staining and Immunostaining

    [0193] Alkaline phosphatase activity was measured with the leukocyte alkaline phosphatase staining kit (Sigma) according to the manufacturer's instructions. For the immunostaining of pluripotent stem cell markers, cells were fixed in 4% paraformaldehyde solution and permeabilized with 0.2% Triton X-100. After washing with PBS, the cells were incubated with a PBS solution containing 5% normal goat serum and 2% BSA. The cells were then incubated with primary antibodies for 2 h at room temperature, washed with PBS, and incubated with fluorescence-conjugated secondary antibodies (Alexa Fluor 488 or 594; Invitrogen) for 1 h at room temperature. The cells were mounted with an antifade mounting medium containing DAPI (Vector Laboratories) for nuclei visualization. The images were captured and analyzed by using an Olympus IX71 microscope or FSX system.

    [0194] DNA Fingerprinting and Karyotype Analysis

    [0195] To confirm the dermal fibroblast origin of iPSC lines, PCR-based short tandem repeat (STR) analysis was carried out at the Gene-Analysis Institute of Human Pass Inc. In brief, STR loci were amplified from genomic DNA samples isolated from iPSC lines and their parental cells by using the AmpFISTR PCR system (Applied Biosystems). The amplified products were analyzed by using an ABI PRISM 3130XL genetic analyzer and Genemapper (Version 3.2; Applied Biosystems). For karyotype analysis, chromosomes were stained with Giemsa for G-banding analysis and analyzed by the Chromosome Image Processing System at GenDix.

    [0196] Statistical Analysis. Data are Presented as MeansSEs

    [0197] Student t test was used for statistical analysis. P<0.05 was considered statistically significant.

    [0198] Results

    [0199] Generation and Characterization of Human iPSCs

    [0200] We derived wildtype iPSCs from human dermal fibroblasts (HDFs) using episomal vectors that encode the four Yamanaka factors, which we introduced into cells by electroporation. Embryonic stem cell (ESC)-like colonies appeared 10 d after replating of transfected cells onto a feeder cell layer. We selected a total of eight colonies (termed Epi1-Epi8) exhibiting alkaline phosphatase activities (FIGS. 5a and 5b). To confirm the absence of episomal vectors in these clones after seven or eight passages, we used PCR with specific primers for the EBNA-1 sequence, which is encoded in the vectors. Only one clone (Epi1) contained the EBNA-1 sequence; this clone was excluded from further analyses (FIG. 5c). Next, we checked the karyotypes of two iPSC lines (Epi3 and Epi8). As shown in FIG. 10a, they had a normal karyotype. We also confirmed that these iPSC lines were derived from parental HDFs using DNA fingerprinting analysis (Table 4). After these initial characterizations, we chose the Epi3 line for further experiments.

    TABLE-US-00004 TABLE 4 Short tandem repeat (STR) analyses of iPS cell lines lines Locus HDF Epi3 Epi4 Epi8 D8S1179 11 15 11 15 11 15 11 15 D21S11 29 30 29 30 29 30 29 30 D7S82 10 11 10 11 10 11 10 11 CSF1PO 11 13 11 13 11 13 11 13 D3S1358 16 18 16 18 16 18 16 18 TH01 8 9 8 9 8 9 8 9 D13S317 8 10 8 10 8 10 8 10 D16S539 9 13 9 13 9 13 9 13 D2S1338 20 23 20 23 20 23 20 23 D19S433 13 14 13 14 13 14 13 14 vWA 14 18 14 18 14 18 14 18 TPOX 8 11 8 11 8 11 8 11 D18S51 14 24 14 24 14 24 14 24 D5S818 12 12 12 12 12 12 12 12 FGA 23 26 23 26 23 26 23 26

    [0201] This iPSC line expressed the typical ESC marker proteins such as OCT4, NANOG, SSEA-4, and TRA-1-60 (FIG. 5d and FIG. 10b). RT-PCR and quantitative PCR (qPCR) analyses showed that pluripotent marker genes were expressed at higher levels in this iPSC line than in the human ESC line H9 (FIGS. 5e and 5f). Next, we determined the differentiation potential of the Epi3 iPSC line. Embryonic bodies were derived and attached to gelatin-coated culture plates for spontaneous differentiation into three germ layers in vitro. As expected, marker proteins for ectoderm (Nestin and Pax6), mesoderm [-smooth muscle actin (-SMA) and Brachyury], and endoderm [-fetoprotein (AFP) and hepatocyte nuclear factor 3- (HNF3)] lineages were expressed in the differentiated cells (FIG. 5g and FIG. 10c). These data indicate that the Epi3 line derived from adult HDFs is pluripotent.

    [0202] Targeted Inversion of the F8 Locus in iPSCs using a TALEN Pair

    [0203] Structural variations (SVs) such as inversions are associated with genetic diseases including hemophilia A (Feuk L, Carson A R, Scherer S W (2006) Structural variation in the human genome. Nat Rev Genet 7(2):85-97). Almost half of all severe hemophilia A cases are caused by two different types of inversions that disrupt the integrity of the X-linked F8 gene. These inversions result from nonallelic HR (NAHR) that involves sequences present in intron 1 (1-4% of severe hemophilia A cases) or intron 22 (up to 50% of severe hemophilia A cases) and their corresponding homologous sequences located far upstream of the F8 gene (referred to as the intron 1 or 22 inversion, respectively) (Lakich D, Kazazian H H, Jr., Antonarakis S E, Gitschier J (1993) Inversions disrupting the factor VIII gene are a common cause of severe haemophilia A. Nat Genet 5(3):236-241). In this study, the inventors focused on the intron 1 inversion and constructed 11 pairs of TALENs that target the intron 1 homolog (FIG. 6a). The genome-editing activities of these TALENs were tested in HEK 293T cells by using T7 endonuclease I (T7E1) assays (Kim H J, Lee H J, Kim H, Cho S W, Kim J S (2009) Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res 19(7): 1279-1288) (FIG. 6b). We chose the most active TALEN pair (termed TALEN 01) that induced mutations with a frequency of 33% at the target site. Importantly, this TALEN induced the 140-kb inversion that involves the intron 1 homolog in HEK 293T cells at a frequency of 1.9% (FIG. 11). Next, we tested whether this TALEN had off-target effects at highly homologous sites. No off-target mutations were detected at these sites by using T7E1 assays (FIG. 12 and Table 5).

    TABLE-US-00005 TABLE5 Potentialoff-targetsitesofTALEN01 Chromo- Gene Left-halfsite Spacer Right-halfsite someno. name (5to3) (bp) (5 to3) chr.9 N/A TATAGATTtGCCAtTtTCTC 13 TAAAaTATAAaGAAAAgTtT chr.14 PRKD1 TgTAGATTGGtCAGTgTCTC 12 aAAAGcAaAcTcAAAACTGT chr.4 N/A TtTtGATTGGCCAGcCTCTC 12 aAAAGaAaAcTGAAAACaGa

    [0204] Then the inventors used the same TALEN pair to induce the 140-kb inversion in iPSCs and to create a hemophilia model cell line. Wild-type iPSCs were electroporated with the TALEN plasmids and cultured for 10 d to form colonies. Genomic DNA samples isolated from each colony were subjected to PCR by using specific primer sets that detect the inversion event. Six colonies of 432 (1.4%, comparable to that in HEK 293 cells) showed positive PCR bands for the two inversion breakpoint junctions. Four colonies were then further cultured to derive single cell clones. These clones produced PCR bands that are diagnostic of the 140-kb inversion but, importantly, did not produce PCR bands that correspond to the wild-type genotype (FIG. 7a). Next, we cloned these PCR products and determined their DNA sequences to confirm the inversion genotype. No indels were found at the TALEN target sites (FIG. 7b). This result suggests that a single DSB that was induced by the TALEN in either the intron 1 homolog 1 or homolog 2 triggered DNA inversion via error-free NAHR. However, we cannot rule out the possibility that the TALEN produced two concurrent DSBsone in the intron homolog 1 and the other in homolog 2and that these DSBs were joined seamlessly by NHEJ without leaving secondary mutations.

    [0205] Targeted Reversion of the Inverted Segment in the iPSC System

    [0206] In our previous study, we induced the targeted chromosomal inversion that involves the intron 1 homolog in the HEK 293 cell line using a ZFN pair and isolated heterozygous clones that harbor the inversion (Lee H J, Kweon J, Kim E, Kim S, Kim J S (2012) Targeted chromosomal duplications and inversions in the human genome using zinc finger nucleases. Genome Res 22(3): 539-548). However, HEK 293 cells do not express the F8 gene and cannot be used in cell therapy. Furthermore, HEK 293 cells carry three copies of the X chromosome. These limitations hampered our efforts to revert the inverted region back to the normal orientation to restore expression of the F8 gene, a demonstration required for therapeutic applications.

    [0207] In this application, we investigated whether the inverted 140-kbp segment in the hemophilia model iPSC line could be corrected by reversion using the same TALEN pair. (Note that the TALEN site remains intact in the model cell line.) The TALEN plasmids were transfected into two iPSC clones containing the inversion (referred to here as inversion clones), and then genomic DNA samples isolated from several colonies were subjected to PCR to identify reverted cells. We obtained two reverted clones from each of the iPSC clones after screening a total of 300 colonies. Thus, the reversion frequency was 1.3% (4 of 300), on par with the inversion frequency. PCR analysis revealed that the genotype of these reverted clones was consistent with a reversion to wild type: No inversion-specific PCR bands were detected in the samples from these clones (FIG. 8a). We then cloned and sequenced these PCR products containing homolog 1 or 2. Two clones had no additional mutations, but the other two clones had 2-bp deletions at the two TALEN sites in both homologs 1 and 2 (FIG. 8b). These results show that the inversion genotype found in severe hemophilia A can be corrected by using the same TALEN pair that was used to generate the disease model.

    [0208] In addition, we investigated whether both the inversion clones and reverted clones remained pluripotent by checking their expression of human ES marker genes and their ability to undergo differentiation into the three primary germ layers. These clones expressed stem cell marker genes at levels comparable with those in wild-type iPSCs (FIG. 5f) and differentiated into three germ layers in vitro (FIG. 14). These results show that TALEN-mediated genome engineering does not negatively affect iPSC pluripotency.

    [0209] F8 Gene Expression in Cells Differentiated from Reverted iPSCs. The F8 gene is expressed in hepatocytes and endothelial cells (Zelechowska M G, van Mourik J A, Brodniewicz-Proba T (1985) Ultrastructural localization of factor VIII procoagulant antigen in human liver hepatocytes. Nature 317(6039):729-730; Hollestelle M J, et al. (2001) Tissue distribution of factor VIII gene expression in vivo; Shahani T, et al. (2010) Activation of human endothelial cells from specific vascular beds induces the release of a FVIII storage pool. Blood 115(23):4902-4909), which are derived from endoderm and mesoderm, respectively. First, we examined whether the F8 gene could be expressed in endodermal cells derived from the wild-type and reverted iPSC clones. We differentiated iPSCs into endoderm and performed an RT-PCR analysis to detect the F8 mRNA. As expected, the F8 mRNA was detected in cells differentiated from the wild-type and reverted iPSC clones (FIG. 9a). By contrast, no F8 mRNA was detected in cells derived from the iPSCs with the inversion, although these cells could differentiate into endoderm as efficiently as wild-type and reverted iPSCs. Next, we examined the expression of the F8 protein in endothelial cells, which are the main source of production of the F8 protein (Shahani T, et al. (2010) Activation of human endothelial cells from specific vascular beds induces the release of a FVIII storage pool. Blood 115(23):4902-4909). We differentiated iPSCs into endothelial cells and performed immunostaining to detect the F8 protein. As expected, the cells differentiated from wild-type and reverted iPSC clones expressed the F8 protein (FIG. 9b). However, the F8 protein was not detected in the cells differentiated from the inversion clone, although this iPSC clone differentiated successfully into endothelial cells as shown by the expression of von Willebrand factor, a mature endothelial cell marker protein. These results prove that the integrity of the F8 gene is restored in reverted iPSCs, which supports expression of the F8 gene in endodermal cells and mesoderm-derived endothelial cells.

    [0210] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.