BIPHASIC CERAMIC BONE SUBSTITUTE

Abstract

The present invention shows a biphasic ceramic bone substitute comprising a resorbable calcium sulphate phase and a stable calcium phosphate phase acting as a bone graft and excellent carrier for a combination of bone active proteins (e.g. BMP) and anti-catabolic agents (e.g. bisphosphonates) giving enhanced bone regeneration

Claims

1. A biphasic ceramic bone substitute comprising: a. a calcium sulphate phase; b. a calcium phosphate phase; c. at least one bone active protein, and d. at least one anti-catabolic agent.

2. A biphasic ceramic bone substitute according to claim 1, wherein the calcium sulphate is calcium sulphate dihydrate.

3. A biphasic ceramic bone substitute according to claim 1 or claim 2, wherein the calcium phosphate is selected from the group consisting of -tricalcium phosphate, hydroxyapatite, tetracalcium phosphate and -tricalcium phosphate.

4. A biphasic ceramic bone substitute according to claim 3, wherein the calcium phosphate phase is composed of hydroxyapatite, preferably crystalline hydroxyapatite particles.

5. A biphasic ceramic bone substitute according to any one of claims 1-4, wherein the bone active protein is selected from the group comprising bone morphogenic proteins (BMPs), insulin-like growth factors (IGFs), transforming growth factor-s (TGFs), parathyroid hormone (PTH), sclerostine, cell factory derived bone active proteins and extracellular matrix (ECM) proteins.

6. A biphasic ceramic bone substitute according to claim 5, wherein the bone active protein is a bone morphogenic protein (BMP), such as BMP-2, preferably rhBMP-2, and/or BMP-7, preferably rhBMP-7.

7. A biphasic ceramic bone substitute according to any one of claims 1-6, wherein the anti-catabolic agent is an agent which inhibits bone resorption.

8. A biphasic ceramic bone substitute according to claim 7, wherein the anti-catabolic agent is a bisphosphonic acid, a bisphosphonate, a selective estrogen receptor modulator (SERM), denosumab or a statin.

9. A biphasic ceramic bone substitute according to claim 8, wherein the anti-catabolic agent is a bisphosphonate selected from the group comprising etidronate, clodronate and tiludronate, or the group comprising pamidronate, neridronate, olpadronate, alendronate, ibandronate, risedronate and zoledronate.

10. A biphasic ceramic bone substitute according to any one of claims 1-9 comprising at least one further bioactive agent selected from antibiotics, bone healing promotors, chemotherapeutics, cytostatics, vitamins, hormones, bone marrow aspirate, platelet rich plasma and demineralized bone.

11. A biphasic ceramic bone substitute according to claim 10 comprising at least one antibiotic selected from gentamicin, vancomycin, tobramycin, cefazolin, rifampicin, clindamycin and the antifungal drug is selected from the group comprising nystatin, griseofulvin, amphotericin B, ketoconazole and miconazole.

12. A biphasic ceramic bone substitute according to any one of claims 1-11 further comprising an X-ray contrast agent selected from water soluble non-ionic X-ray contrast agents and/or biodegradable X-ray contrast agents.

13. A biphasic ceramic bone substitute according to claim 12, wherein the water soluble non-ionic X-ray contrast agent is selected from iohexol, iodixanol, ioversol, iopamidol, iotrolane, metrizamid, iodecimol, ioglucol, ioglucamide, ioglunide, iogulamide, iomeprol, iopentol, iopromide, iosarcol, iosimide, iotusal, ioxilane, iofrotal, and iodecol.

14. A biphasic ceramic bone substitute according to any one of claims 1-13, wherein the calcium sulphate to calcium phosphate ratio (w/w) is from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40.

15. A hardenable ceramic bone substitute powder comprising: a. a calcium sulphate hemihydrate powder; b. a calcium phosphate powder, where the calcium phosphate is selected from -tricalcium phosphate, hydroxyapatite, tetracalcium phosphate and -tricalcium phosphate; c. a bone active agent; d. an anti-catabolic agent; e. optionally an accelerator for setting of calcium sulphate in an aqueous solution, preferably selected from calcium sulphate dihydrate and an inorganic salt, such as NaCl; and f. optionally an accelerator for setting of calcium phosphate in an aqueous solution, preferably particulate calcium phosphate and/or a phosphate salt, such as Na.sub.2HPO.sub.4.

16. A hardenable ceramic bone substitute powder according to claim 15, wherein the calcium phosphate is hydroxyapatite powder, preferable comprised of amorphous and/or crystalline hydroxyapatite particles.

17. A hardenable ceramic bone substitute powder according to claim 15 or claim 16, wherein the amorphous and/or crystalline calcium phosphate (e.g. hydroxyapatite) particles have a size <200 m, <100 m, <50 m, <35 m, or <20 m.

18. A hardenable ceramic bone substitute powder according to any one of claims 15-17, wherein the anti-catabolic agent is pre-mixed with and bound to the calcium phosphate particles in the powder.

19. A hardenable ceramic bone substitute powder according to any one of claims 16-18, wherein the calcium phosphate particles are crystalline hydroxyapatite particles.

20. A hardenable ceramic bone substitute powder according to any one of claim 15-19, wherein the anti-catabolic agent is an agent which inhibits bone resorption and selected from bisphosphonic acids, bisphosphonates, selective estrogen receptor modulators (SERM), denosumab and statins.

21. A hardenable ceramic bone substitute powder according to claim 20, wherein the anti-catabolic agent is a bisphosphonate selected from the group comprising etidronate, clodronate and tiludronate, or the group comprising pamidronate, neridronate, olpadronate, alendronate, ibandronate, risedronate and zoledronate.

22. A hardenable ceramic bone substitute powder according to any one of claims 15-21, wherein the bone active agent is a bone active protein selected from the group comprising bone morphogenic proteins (BMPs), insulin-like growth factors (IGFs), transforming growth factor-s (TGFs), parathyroid hormone (PTH), sclerostine, cell factory derived proteins and ECM proteins.

23. A hardenable ceramic bone substitute powder according to claim 22, wherein the bone active protein is a bone morphogenic protein (BMP) selected from BMP-2, BMP-7, rhBMP-2 and rhBMP-7.

24. A hardenable ceramic bone substitute powder according to any one of claims 15-23, further comprising a bioactive agent selected from antibiotics, bone healing promotors, chemotherapeutics, cytostatics, vitamins, hormones, bone marrow aspirate, platelet rich plasma and demineralized bone.

25. A hardenable ceramic bone substitute powder according to claim 24 comprising at least one antibiotic selected from gentamicin, vancomycin, tobramycin, cefazolin, rifampicin, clindamycin and the antifungal drug is selected from the group comprising nystatin, griseofulvin, amphotericin B, ketoconazole and miconazole.

26. A hardenable ceramic bone substitute powder according to any one of claims 15-25 further comprising an X-ray contrast agent selected from water soluble non-ionic X-ray contrast agents and/or biodegradable X-ray contrast agents.

27. A hardenable ceramic bone substitute powder according to claim 26, wherein the water soluble non-ionic X-ray contrast agent is selected from iohexol, iodixanol, ioversol, iopamidol, iotrolane, metrizamid, iodecimol, ioglucol, ioglucamide, ioglunide, iogulamide, iomeprol, iopentol, iopromide, iosarcol, iosimide, iotusal, ioxilane, iofrotal, and iodecol.

28. A hardenable ceramic bone substitute powder according to any one of claims 15-27, wherein the calcium sulphate to calcium phosphate ratio (w/w) is from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40.

29. A hardenable ceramic bone substitute paste comprising a hardenable ceramic bone substitute powder according to any one of claims 15-28 and an aqueous liquid.

30. A hardenable ceramic bone substitute paste according to claim 29, wherein the paste is injectable.

31. A hardenable ceramic bone substitute paste according to claim 29 or claim 30, wherein the calcium sulphate to calcium phosphate ratio (w/w) is from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40; and the liquid to dry powder ratio is from 0.2 to 0.8, preferably from 0.3 to 0.6.

32. A kit for producing a hardenable ceramic bone substitute paste according to any one of claims 29-31, or a biphasic ceramic bone substitute according to any one of claims 1-14, comprising the following components: i) a calcium sulphate hemihydrate powder; ii) a calcium phosphate powder as defined in claim 3 or claim 4; iii) a bone active protein as defined in claim 5 or claim 6; iv) an anti-catabolic agent which inhibits bone resorption as defined in any one of claims 7-9; v) optionally at least one further bioactive agent as defined in claim 10 or claim 11; vi) optionally an X-ray contrast agent as defined in claim 12 or claim 13; vii) optionally an accelerator for setting of the calcium sulphate, preferably calcium sulphate dihydrate or an inorganic salt, such as NaCl; viii) optionally an accelerator for setting of the calcium phosphate, preferable particulate calcium phosphate and/or a calcium phosphate salt, such as Na.sub.2HPO.sub.4; and ix) optionally an aqueous liquid, such as water.

33. A kit according to claim 32, wherein the components are present in different containers.

34. Kit according to claim 32, wherein two or more of the components are pre-mixed in two or more containers.

35. Kit according to any one of claims 32-34, further comprising: a. a mixing and/or injection device(s), and/or b. instructions for use.

36. Kit according to any one of claims 32-35, further comprising a biodegradable synthetic membrane or a collagen membrane.

37. Kit according to any one of claims 32-36, for use in the treatment of a disorder of supportive tissue in a human or non-human subject by generating lost bone tissue.

38. A biphasic ceramic bone substitute according to any one of claims 1-14, a ceramic bone substitute powder according to any one of claims 15-28, biphasic ceramic bone substitute paste according to any one of claims 29-31 and kit according to any one of claims 32-37, wherein one or more of the additive is/are provided as encapsulated individually or in any combination(s) in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like.

39. Method of treating a patient with a bone defect, such as loss of bone due to, i.a. trauma, eradication of infection, resection of tumor lesions, delayed or nonunions and in primary or revision arthroplasties, comprising inserting one or more biphasic ceramic bone substitutes (grafts) according to any one of 1-14 or a hardenable biphasic ceramic bone substitute paste according to any one of 29-31 at the place of removed bone.

Description

DRAWINGS

[0040] FIG. 1: in-vitro immunogenicity analysis of Cerament. RAW 264.7 cells were seeded on Cerament BVF and the release of various pro inflammatory cytokines IL-16 (Panel A), IL-2 (Panel B), IL-6 (Panel C) and TNF- (Panel D) was analyzed and compared to LPS as an immunogen.

[0041] FIG. 2: Cell-material interactions via electron microscopy. Panels A and B represent Cerament BVF and Cerament G, respectively. Panels C and D represent attachment of C2C12 cells on the surface of both materials (BVF/G) while panels E and F represent nuclear staining of C2C12 cells (using DAPI) to show homogenous distribution of cells all across the surface of the two materials (BVF/G).

[0042] FIG. 3: Cell culture study on Cerament BVF materials using C2C12 cells via MTT and ALP analysis. Panel A represents the proliferation pattern of C2C12 muscle myoblasts on Cerament BVF and Cerament G biomaterials over a period of 5-weeks post-seeding. Cellular proliferation was assessed via MTT assay with 2D-polystyrene plates as a control for proliferation. Panel B represents alkaline phosphatase assay showing the level of ALP activity of C2C12 muscle myoblasts seeded on Cerament BVF and Cerament G compared with tissue culture plate over a period of 35 days.

[0043] FIG. 4: Immunocytochemical and RT-PCR analysis of C2C12 muscle myoblasts seeded on Cerament. C2C12 cells seeded on Cerament BVF were analyzed using immunocytochemistry to visualize osteogenic differentiation. Cells were stained after a period of 7 and 21-days post seeding. Cells stained positive for osteogenic markers like RunX-2 (A-C) at day 7, Col I (D-F), OCN (G-I) and OPN (J-L), respectively after 21-days post seeding. Images in the left panel (A, D, G and J) indicates nuclear staining using DAPI while images in middle panels (B, E, H and K) indicate antibody based detection of respective target proteins while right panels (C, F, I and L) depict respective merged images.

[0044] FIG. 5: Early onset of osteogenic differentiation was confirmed by the presence of RunX-2 gene in C2C12 cells seeded on Cerament BVF after 7-days (Panel M). Osteoblastic maturation (21 days post seeding) of muscle cells was confirmed by the presence of osteoblastic genes coding for Col I (Panel N, Lane 1), OCN (Panel N, Lane 2), BSP (Panel N, Lane 3), housekeeping gene GAPDH (Panel N, Lane 4) with control ladder in Panel N, lane 5.

[0045] FIG. 6: Morphological and phenotypical changes in skeletal muscle cells L6 after treatment with cell factory bone active proteins. Panels A-D show the expression of Col I, OCN, OPN and BSP, respectively 12-days post seeding in the experimental group. Cells stained positive for most prominent osteoblastic markers COLI (Panel A), OCN (Panel B), OPN (Panel C) and BSP (Panel D). Panels E&F indicate myotube formation in the control groups while cell factory treated group shows uni-nuclear morphology (Panels G&H). Panel I indicates cell proliferation in both groups while panel 3 shows myotube numbers for both groups.

[0046] FIG. 7: In-vitro release profile of BMP-2 from Cerament discs.

[0047] FIG. 8: In-vitro release profile of ZA from Cerament discs over time.

[0048] FIG. 9: Cytotoxicity induced by released ZA from Cerament discs on A549 tumor cells.

[0049] FIG. 10: Radiographs showing Cerament BVF discs implanted in the abdominal muscle pouch for 4-weeks. Panel A shows Cerament BVF, B shows Cerament BVF+rhBMP-2 and C shows Cerament BVF+rhBMP-2+ZA.

[0050] FIG. 11: Micro-CT & Histology of Cerament BVF discs implanted in the abdominal muscle pouch for 4-weeks. Panels A-C represent 3D micro-CT reconstructions of Cerament BVF, Cerament BVF+rhBMP-2 and Cerament BVF+rhBMP-2+ZA, respectively. Panels D-F represents histology (H&E) of Cerament BVF, Cerament BVF+rhBMP-2 and Cerament BVF+rhBMP-2+ZA, respectively after 4-weeks of in-vivo implantation.

[0051] FIG. 12: Mineralized tissue volume in Cerament BVF, Cerament BVF+rhBMP-2 and Cerament BVF+rhBMP-2+ZA, respectively after 4-weeks of in-vivo implantation.

[0052] FIG. 13: Micro-CT & Histology of Cerament BVF discs implanted in the abdominal muscle pouch for 4-weeks. Panels from A-C (first row) represent 3D micro-CT reconstructions of Cerament BVF, Cerament BVF+rhBMP-2 and Cerament BVF+rhBMP-2+ZA, respectively. Area taken for histology and EM indicated. The second row shows EM for Cerament BVF with no bone cells (D); Cerament BVF+rhBMP-2 with bone in the periphery only (E); and Cerament BVF+rhBMP-2+ZA with trabecular bone bridging over the central part (F). The third row (G-I) shows the same as the second row above at a lower magnification.

DETAILED DESCRIPTION OF THE INVENTION

[0053] The present invention concerns new biphasic ceramic bone substitute for use in the treatment of disorders of supportive tissue such as regeneration of bone defects, in particular serious bone defects where a graft is needed. The two phases in the ceramic bone substitute consists of a relatively fast resorbable calcium sulphate phase and a very slowly resorbable calcium phosphate phase. The biphasic ceramic bone substitute further comprises at least one bone active protein that served as an osteoinductive factor for regeneration of new bone, and at least one anti-catabolic agent that inhibits bone resorption. The combination of bone active proteins, specific inhibitors of bone resorption and a biphasic ceramic bone substitute carrier comprising a microporous and relatively fast resorbable phase and a very slow resorbable phase has proven to be surprisingly beneficial.

[0054] The calcium sulphate phase of the biphasic ceramic bone substitute essentially consists of calcium sulphate dihydrate that is formed in a setting process where calcium sulphate hemihydrate is reacted with water, whereby calcium sulphate dihydrate crystals are formed over time and interlock with each other to for a microporous matrix. The setting reaction may be accelerated by addition of 0.1-10, such as 0.2-5 weight % calcium sulphate dihydrate or a suitable salt, e.g. in the form of a solution, for example saline (NaCl-solution). During the setting process, calcium phosphate particles in the calcium phosphate phase (e.g. hydroxyapatite particles) are embedded in the voids of microporous calcium sulphate dihydrate matrix (the calcium sulphate phase). The calcium sulfate phase provides an initial mechanically solid property to the bone substitute. The microporosity and the relatively fast resorption of the calcium sulphate phase in the body liberates additive present in the calcium sulphate phase at an initial high rate and the artificial material is transformed into a very porous skeleton along with the resorption of calcium sulphate resulting in an increased access of body fluids and cells to the calcium phosphate particles in the calcium phosphate phase. This has shown to be highly beneficial in (fast) bone cell ingrowth. In an in-vitro assay it is shown that BMP-2 is released from solid Cerament bone support at a constant rate over a period of 7-days with nearly 90% of BMP-2 released after 7-days.

[0055] The calcium phosphate phase of the biphasic ceramic bone substitute essentially consists of calcium phosphate particles selected from the group consisting of -tricalcium phosphate, hydroxyapatite, tetracalcium phosphate and -tricalcium phosphate. The calcium phosphate component may be added as preset particles or added as hardenable precursors (powder) for a setting process within the biphasic material upon addition of water. Accelerators of such setting processes, e.g. particulate calcium phosphate particles and phosphate salts, are known in the art and may be added in the process. The calcium phosphate particles may be amorphous or crystalline in structure. A desired structure may be obtained by e.g. heat-treatment, re-crystallization and/or dissolution processes known in the art. EP 1 301 219, EP 1 465 678 and EP 1 601 387 disclose calcium phosphates, their preparation and their use in ceramic bone substitutes.

[0056] In a preferred embodiment of the invention, the calcium phosphate phase is essentially composed of hydroxyapatite, in particular crystalline hydroxyapatite particles. Anti-catabolic agents such as bisphosphonate have a strong affinity to calcium phosphates, such as hydroxyapatite, which constitutes the calcium phosphate phase in the commercially available Cerament products.

[0057] WO 2014/128217 discloses passivated crystalline hydroxyapatite particles and their use in ceramic bone substitutes. Crystalline hydroxyapatite powder is heated after being sintered and grinded or milled, which surprisingly leads to passivation (inactivation) of the crystalline hydroxyapatite particles that otherwise may interfere with the setting process of the calcium sulphate phase, especially when the bone substitute powder comprises additives such as an antibiotic agent. Passivated crystalline hydroxyapatite particles may advantageously be used in the present invention.

Bone Active Proteins

[0058] Bone active proteins included as an additive in the biphasic ceramic bone substitute are preferably selected from bone growth proteins such as from the group comprising bone morphogenic proteins (BMPs), insulin-like growth factors (IGFs), transforming growth factor-s (TGFs), parathyroid hormone (PTH), sclerostine, and the like. Alternatively, one or more bone active proteins can be provides as a composition of cell factory derived bone active proteins and/or extracellular matrix proteins (ECM). More alternatively, strontium may be used in addition to or substitute the bone active proteins. In one embodiment, the bone active proteins are mixed with the calcium sulphate hemihydrate powder before mixing the sulphate hemihydrate and calcium phosphate powders. Alternatively, the bone active proteins are mixed with the mixed sulphate hemihydrate and calcium phosphate powder or the aqueous liquid or added to the paste. The bone active proteins may be provided as encapsulated in water-soluble and/or biodegradable polymer(s).

[0059] In one embodiment the bone active protein is the bone growth protein, preferably a bone morphogenic protein (BMP). Preferably the BMP is BMP-2 or BMP-7. In a specific embodiment the BMP is a recombinant BMP, preferably recombinant human BMP, such as rhBMP-2 or rhBMP-7. BMP is used in a concentration of 0.2 to 500 g/g dry powder, more preferably 1.0-250, or 2--200, or 5-1500, or 10-120 g BMP/g dry powder. Other bone active proteins may be used in a similar or corresponding concentration or a concentration necessary for obtaining the desired effect.

[0060] The bone active proteins are incorporated into the bone substitute by addition to and mixing with either the bone substitute powder or the aqueous liquid. Alternatively, the bone active proteins may be added to the paste before casting. In a preferred embodiment, the bone active proteins are pre-mixed with the calcium sulphate powder before mixing with the calcium phosphate powder.

[0061] Bone active proteins may be provided as such and added to any of the powders, the aqueous liquid or the paste. Alternatively, the bone active proteins may be encapsulated in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like before use.

The Anti-Catabolic Agent

[0062] One or more anti-catabolic agent(s) for inclusion in the biphasic ceramic bone substitute of the present invention is/are preferably selected from either bisphosphonates; selective estrogen receptor modulators (SERM) (e.g. raloxifene, tamoxifen, lasofoxifene or bazedoxifene), denosumab (a monoclonal antibody against RANKL developed by Amgen); or statins or any combination of two or more of these anti-catabolic agents. Preferably the anti-catabolic agent is one or more bisphosphonates.

[0063] Bisphosphonates are divided into non-nitrogenous (or simple) bisphosphonates and N-containing bisphosphonates. The N-containing bisphosphonates are more potent than the simple bisphosphonates.

[0064] The simple bisphosphonates are metabolized in the cell to compounds that replace the terminal pyrophosphate moiety of ATP, forming a nonfunctional molecule that competes with adenosine triphosphate (ATP) in the cellular energy metabolism. The osteoclast initiates apoptosis and dies, leading to an overall decrease in the breakdown of bone. Examples of simple bisphosphonates are etidronate, clodronate and tiludronate. Clodronate and tiludronate are 10 times as potent as etidronate.

[0065] Nitrogenous bisphosphonates act on bone metabolism by binding and blocking the enzyme farnesyl diphosphate synthase (FPPS) in the HMG-CoA reductase pathway (also known as the mevalonate pathway). Examples of N-containing bisphosphonates are (potency relative to etidronate are given in parenthesis): pamidronate (100), neridronate (100), olpadronate (500), alendronate (500), ibandronate (1000), risedronate (2000) and zoledronate (10000).

[0066] The bisphosphonates may be added in solution to the calcium phosphate particles/powder (e.g. hydroxyapatite) where it strongly binds to calcium phosphate prior to mixing with the calcium sulphate powder. The amount/concentration of bisphosphonates necessary for obtaining a desired effect depends, i.a. on the potency of the bisphosphonate selected. The concentration of bisphosphonate in doped calcium phosphate particles may be controlled by selecting the bisphosphonate concentration in the solution and/or the time the particles are placed in the bisphosphonate solution. Alternatively, the amount/concentration of bisphosphonates in the powders and the paste may be controlled by using a mixture of calcium phosphate particles (e.g. hydroxyapatite) doped with a known (high) amount/concentration of bisphosphonate and un-doped calcium phosphate particles in a desired ratio.

[0067] In a preferred embodiment, the selected bisphosphonate is zoledronate/zoledronic acid (ZA).

[0068] ZA is used in a concentration of 0.2 to 500 g/g dry powder, more preferably 1-300 g/g, or 10-200 g/g, or 10-120 g/g. Other bisphosphonates may be used in a similar or corresponding concentration or a concentration necessary for obtaining the desired effect. The dosages of BMP used in local application in accordance with the present invention may be as low as 20% of what is needed in systemic infusion or even lower. Too high dosages of bisphosphonates (e.g. ZA) are toxic and will alone lead to an inflammatory reaction and also not only kill osteoclast but also impair the osteoblasts. In addition high dosages of BMP alone can lead to a strong reaction and a too extensive bone formation.

[0069] Bone active proteins may be provided as a powder or a solution and added to any of the powders, the aqueous liquid or the paste. Alternatively, the bone active proteins may be encapsulated in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like before use.

[0070] Discs for use in an in-vitro ZA release assay were prepared by mixing ZA with a ceramic powder (Cerament BVF), a liquid and cast in molds. Saline was added to the discs and at different time points, a sample of the medium was harvested and analysis. The release of ZA from each Cerament BVF discs can be calculated in the harvested supernatants by adding lung cancer cells (cell line A549) wherein ZA is known to induce apoptosis. After a period of 7-days, the amount of ZA released from Cerament BVF was about 10% of the total ZA loaded.

[0071] Selective estrogen receptor modulators (SERM), e.g. raloxifene, tamoxifen, lasofoxifene and bazedoxifene have proven to have an effect on postmenopausal osteoporosis and may therefore be selected as an anti-catabolic agent for use in the present invention.

[0072] Denosumab is fully human monoclonal antibody designed to inhibit RANKL (RANK ligand), a protein that acts as the primary signal for bone removal. In many bone loss conditions, RANKL overwhelms the body's natural defenses against bone destruction. Denosumab was developed by the biotechnology company Amgen and is used in treatment of osteoporosis, treatment-induced bone loss, bone metastases, multiple myeloma, and giant cell tumor of bone.

[0073] Statins are another class of drugs that inhibit the HMG-CoA reductase pathway. Unlike bisphosphonates, statins do not bind to bone surfaces with high affinity, and thus are not specific for bone. Nevertheless, some studies have reported a decreased rate of fracture (an indicator of osteoporosis) and/or an increased bone mineral density in statin users.

Additional Bioactive Agents

[0074] The biphasic ceramic bone substitute according to the invention may also comprise at least one further bioactive agent. Such bioactive agents are selected from antibiotics (including antifungal drugs), bone healing promotors, chemotherapeutics, cytostatics, vitamins, hormones, bone marrow aspirate, platelet rich plasma and demineralized bone.

[0075] An antibiotic agent is preferably selected from gentamicin, vancomycin, tobramycin, cefazolin, rifampicin, clindamycin and the antifungal drug is preferably selected from the group comprising nystatin, griseofulvin, amphotericin B, ketoconazole and miconazole. The ceramic powder product CERAMENT IG marketed for use in bone substitution comprises gentamicin. A new ceramic powder product, CERAMENT IV, for use in bone substitution comprises vancomycin.

[0076] Concentrations in additional bioactive agent depend on the agent and desired effect. For the antibiotics gentamicin and vancomycin, they are used in an amount of 0.5 to 10 weight % of the ceramic powder, preferably between 1 and 6 weight %.

[0077] If it is desired to have further bioactive agents in the bone substitute (in addition to bone active protein and anti-catabolic agent), these may be added to and comprised in the powder or in the aqueous liquid. Alternatively, one or more of additional bioactive agents may be added to the paste before setting.

[0078] Additional bioactive agents may be provided as such and added to any of the powders, the aqueous liquid or the paste. Alternatively, the bioactive agents may be encapsulated in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like before use.

X-Ray Contrast Agents

[0079] In implantation situation, it is often important for the surgeon to be able to follow the placement of the biphasic ceramic bone substitute in the patient during and after the surgery. It may also be helpful to be able to follow ingrowth of new bone or failures that need to be corrected. In one embodiment of the present invention an X-ray contrast agent selected from water soluble non-ionic X-ray contrast agents and/or biodegradable X-ray contrast agents may be incorporated into the bone substitute. EP 1 465 678 and WO 2014/128217 disclose incorporation of x-ray contrast agents into ceramic bone support. The X-ray contrast agents may be added to constitute 1-25 weight % of the total powder ingredients, preferable 10-25 weight %.

[0080] In a preferred embodiment the water soluble non-ionic X-ray contrast agent is selected from iohexol, iodixanol, ioversol, iopamidol, iotrolane, metrizamid, iodecimol, ioglucol, ioglucamide, ioglunide, iogulamide, iomeprol, iopentol, iopromide, iosarcol, iosimide, iotusal, ioxilane, iofrotal, and iodecol. In another embodiment, biodegradable X-ray contrast agents which may provide additional pores may be used.

[0081] The X-ray contrast agent may be provided as such and added to any of the powders, the aqueous liquid or the paste. Alternatively, the X-ray contrast agent may be encapsulated in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like before use.

Ceramic Bone Substitute Powder

[0082] In a further embodiment, the present invention concerns a hardenable ceramic bone substitute powder comprising: [0083] a. calcium sulphate hemihydrate powder; [0084] b. calcium phosphate powder, where the calcium phosphate is selected from one or more of the group consisting of -tricalcium phosphate, hydroxyapatite, tetracalcium phosphate and -tricalcium phosphate; [0085] c. a bone active protein; [0086] d. an anti-catabolic agent; [0087] e. optionally an accelerator for setting of calcium sulphate preferably selected from calcium sulphate dihydrate and a salt (e.g. NaCl); and [0088] f. optionally an accelerator for setting of calcium phosphate preferably particulate calcium phosphate and/or a phosphate salts (e.g. Na.sub.2HPO.sub.4).

[0089] Hardenable ceramic bone substitute powder means that calcium sulphate hemihydrate powder and optionally the calcium phosphate powder will set as a solid material after contact with a liquid.

[0090] The biphasic ceramic bone substitute powder (basis powder with or without additives) according to the present invention comprises a calcium sulphate hemihydrate to calcium phosphate ratio (w/w) from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40. Ceraments on the market comprises 59.6 weight % calcium sulphate hemihydrate and 40 weight % hydroxyapatite.

[0091] In a preferred embodiment, the calcium phosphate powder is a preset hydroxyapatite powder, preferable comprised of amorphous and/or crystalline hydroxyapatite particles.

[0092] Calcium phosphate particles (e.g. crystalline hydroxyapatite) for use as preset calcium phosphate powder have a particle size of D(v,0.99)<200 m, preferably <100 m and more preferably <50 m, such as less than 35 m. The specific surface area of the powder should preferable be below 20 m.sup.2/g, and more preferably below 10 m.sup.2/g, when measured according to the BET (Brunauer, Emmett and Teller) method, which is a method for the determination of the total surface area of a powder expressed in units of area per mass of sample (m.sup.2/g) by measurement of the volume of gas (usually N.sub.2) adsorbed on the surface of a known weight of the powder sample. Other ways of determining the surface area may be applied in the alternative.

[0093] In one embodiment, the anti-catabolic agent is a bisphosphonate that is pre-mixed with (and bound to) the calcium phosphate particles prior to mixing with the calcium sulphate powder. In a further embodiment, the calcium phosphate particles are crystalline hydroxyapatite particles. Alternatively, the anti-catabolic agent is added to and mixed with a pre-mixed calcium sulphate/calcium phosphate powder (a basis powder, e.g. a Cerament product).

[0094] In one other embodiment, bone active protein present in the powder is selected from the group comprising bone morphogenic proteins (BMPs), insulin-like growth factors (IGFs), transforming growth factor-s (TGFs), parathyroid hormone (PTH), strontium, sclerostine, cell factory derived proteins and ECM proteins. The bone active protein may be pre-mixed with the calcium sulphate hemihydrate powder, with the calcium phosphate powder or the basis powder.

[0095] The calcium sulphate powder, the calcium phosphate powder or the basis powder may also comprise one or more bioactive agents selected from antibiotics (including antifungal drugs), bone healing promotors, chemotherapeutics, cytostatics, vitamins, hormones, bone marrow aspirate, platelet rich plasma and demineralized bone. The at least one antibiotic agent may be selected from gentamicin, vancomycin, tobramycin, cefazolin, rifampicin, clindamycin and the antifungal drug is selected from the group comprising nystatin, griseofulvin, amphotericin B, ketoconazole and miconazole.

[0096] The calcium sulphate powder, the calcium phosphate powder or the basis powder may further comprising an X-ray contrast agent selected from water soluble non-ionic X-ray contrast agents and/or biodegradable X-ray contrast agents. The water soluble non-ionic X-ray contrast agent may be selected from iohexol, iodixanol, ioversol, iopamidol, iotrolane, metrizamid, iodecimol, ioglucol, ioglucamide, ioglunide, iogulamide, iomeprol, iopentol, iopromide, iosarcol, iosimide, iotusal, ioxilane, iofrotal, and iodecol.

[0097] Any of the additional bioactive agents/X-ray agents may be provided as powders or solutions and optionally added to any of the powders. Alternatively, the additional bioactive agents/X-ray agents may be encapsulated in synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like before being mixed with any of the powders.

Hardenable Ceramic Bone Substitute Paste

[0098] The present invention further concerns a hardenable ceramic bone substitute paste comprising a hardenable ceramic bone substitute powder as defined above and an aqueous liquid. The aqueous liquid may comprise any of the additives, including the bone active proteins and/or anti-catalytic agents (e.g. bisphosphonates) discussed above. X-ray contrast agents and bioactive agents such as antibiotics are preferably dissolved in the aqueous liquid before mixing with the ceramic bone substitute powder. Alternatively, the additives, including the bone active proteins and/or anti-catalytic agents (e.g. bisphosphonates) may be added to and mixed with the paste by delayed mixing as disclosed above. If one or more of the additives are interfering with the setting of the hardenable paste, such additives can advantageously be added to the paste by delayed mixing.

[0099] The liquid to dry powder ratio (L/P) in preparing the paste is in the range of 0.2 to 0.8 ml/g, such as 0.3 to 0.6 ml/g and preferably 0.4 to 0.5 ml/g.

[0100] In a preferred embodiment of the present invention, the hardenable ceramic bone substitute paste is prepared by mixed the powder(s), additives and liquid in a suitable bowl or in specially designed mixing devise (e.g. a Mixing and Injection Device (CERAMENT ICMI) available from BONESUPPORT AB, Sweden or other mixing devices such as Optipac from Biomet, US, used with or without vacuum) to be made ready for injection through a syringe (e.g. a specific injection device available from BONESUPPORT AB, Sweden). The additives may be part of the powder(s) or liquid or self-contained and added to together with the powder(s) and liquid. In a particular embodiment, one or more additives is/are added to the paste after the initial mixing of powder(s) and liquid in a delayed mixing process. It is important that addition and mixing of the additive(s) is/are performed before any setting reactions have started. Preferably, addition of additive(s) to the paste is performed within 2 to 4 minutes after initial mixing.

Kit

[0101] The present invention also concerns kits for delivering all or some of the ingredients for use in the biphasic ceramic bone substitute according to the present invention. Such kits comprise: [0102] i) a calcium sulphate hemihydrate powder; [0103] ii) a calcium phosphate powder as defined in claim 3 or claim 4; [0104] iii) a bone active protein as defined in any one of claims 5-7; [0105] iv) an anti-catabolic agent which inhibits bone resorption as defined in any one of claims 9-11; [0106] and optionally one or more of the following: [0107] v) at least one further bioactive agent as defined above; [0108] vi) a X-ray contrast agent as defined above; [0109] vii) an accelerator for setting of the calcium sulphate, preferably calcium sulphate dihydrate or a salt such as NaCl; [0110] viii) an accelerator for setting of the calcium phosphate, preferable particulate calcium phosphate particles and/or a phosphate salt such as disodium hydrogen phosphate (Na.sub.2HPO.sub.4); [0111] ix) optionally an aqueous liquid.

[0112] The aqueous liquid may be distilled water, optionally comprising a salt and/or a buffer.

[0113] In one embodiment, the kit comprises a basis powder (x) comprising calcium sulphate hemihydrate powder (i) pre-mixed with the calcium phosphate powder (ii).

[0114] In another embodiment of the kit, the anti-catabolic agent (iv) is pre-mixed with at least a part of the calcium phosphate powder (ii), at least a part of the calcium sulphate hemihydrate powder (i), the basis powder (x), or the aqueous liquid (ix).

[0115] In yet another embodiment of the kit the bone active protein (iii) is pre-mixed with at least a part of the calcium sulphate hemihydrate powder (i), at least a part of the calcium phosphate powder (ii)), the basis powder (x), or the aqueous liquid ii).

[0116] In a further embodiment of the kit, the at least one further bioactive agent (v) as defined above is pre-mixed with the calcium phosphate powder (ii), the calcium sulphate hemihydrate powder (i), the basis powder (x), or the aqueous liquid (ix).

[0117] In yet a further embodiment of the kit the X-ray contrast agent (vi) as defined above is pre-mixed with the calcium phosphate powder (ii), the calcium sulphate hemihydrate powder (i), the basis powder (x), or the aqueous liquid (ix).

[0118] In another embodiment of the kit an accelerator for setting of the calcium sulphate (vii) as defined above is premixed with the calcium sulphate hemihydrate powder (i), the basis powder (x), or the aqueous liquid (ix).

[0119] In yet another embodiment of the kit an accelerator for setting of the calcium phosphate (viii) as defined above is pre-mixed with the calcium phosphate powder (ii), the calcium sulphate hemihydrate powder (i), the basis powder (x), or the aqueous liquid (ix).

[0120] Any of the additional bioactive agents/X-ray agents may be provided as such or in any of the powders or the liquid. Alternatively, the additional bioactive agents/X-ray agents may be encapsulated individually or in any suitable combination in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles and/or dihydrate nidation particles, or the like, and optionally mixed with any of the powders or the liquid.

[0121] According to the invention, the kit may further comprise mixing and injection devices, optionally including a syringe for injection. The kit may also comprise instructions for use.

[0122] In a further embodiment of the present invention, the kit further comprises a lining membrane for enclosing the synthetic grafts or closing the grafts to the outside, e.g. a biodegradable synthetic membrane or a collagen membrane as for example disclosed in WO2013185173. The synthetic graft may also be sealed with a protein in a solution that could be applied, i.a. as a spray, and thus support a surface healing. The covering protein may add additional benefits in preventing surface bacterial adherence and biofilm production.

[0123] In another aspect the present invention also concerns a method of treating patients with bone defects such as loss of bone due to, i.a. trauma, eradication of infection, resection of tumor lesions, delayed or nonunions and in primary or revision arthroplasties. In one embodiment, the method includes an insertion of one or more biphasic ceramic bone substitutes (grafts) according to the present invention into the bone lesion to be treated. In another embodiment, the method includes application of a paste of a hardenable biphasic ceramic bone substitute according to the present invention to the bone lesion to be treated. All bones in the animal or human body, including the spinal cord, bones of the hands, fingers, arms, feet, toes, lower or upper leg, knee, hip, ankle, elbow, wrist, shoulder, skull, jaw and teeth. The insertion of a biphasic ceramic bone substitute, for example in the form of a hardenable paste, may follow removal of bone, e.g. removal of broken bone, a bone tumor or infected bone tissue. In the case the substitute needs to be contained in the tissue around the graft or to prevent leakage to the surroundings or to cover an open wound, it may be beneficial or necessary to apply an artificial, e.g. polymeric, membrane. Such a membrane may be porous allowing body liquids and cells to flow to and from the porous graft and/or partially or fully sealed to the outside. After insertion of a biphasic ceramic bone substitute or the paste has hardened, the muscle tissue and skin may be repositioned or grafted over the artificial bone substitute.

In Vitro Tests

In-Vitro Immunogenicity

[0124] To see whether the Cerament products are immunogenic per se, a test involving RAW 264.7 macrophages, which are known to activate and secrete large amounts of cytokines when in contact with immunogenic materials, were selected. Ceramic discs prepared from Cerament products were seeded with murine macrophage cells RAW 264.7 and secretion of pro inflammatory cytokines like interleukin (IL)-1, IL-2, IL-6 and tumor necrosis factor (TNF)- was assessed over a period of 7-days using ELISA. The secretion of all cytokines (IL-1, IL-2, IL-6 and TNF-) is comparative with negative controls, and significantly lower than LPS (lipopolysaccharide)-treated positive controls. Application of Cerament in patients thus appears to give a very low if any immunological activity.

In Vitro Osteoinductive Effect

[0125] In some clinical cases extensive bone formation have been observed in the overlaying muscle covering surgically created bone defects treated with the hydroxyapatite/sulphate injectable mixture, CERAMENT IBVF.

[0126] An in vitro model was designed to investigate the osteoinductive potential at the interface between muscle and bone substitute. Skeletal muscle cells were seeded on discs prepared from Cerament BVF and from Cerament G. Upon physiochemically characterizing Cerament using SEM, the porous structure was verified (FIGS. 2A and B). Porous Cerament scaffold provides sufficient surface area for cellular attachment and also an efficient environment for exchange of nutrients, gases and other signaling molecules. Cells were uniformly distributed across the surface of the scaffold as observed from SEM and DAPI analysis (FIG. 2C-F). On both materials, skeletal muscle cellline C2Cl2 differentiated into osteoblast like cells with expression of bone markers like runt-related transcription factor-2 (RUNX-2), collagen type 1 (COLI), osteocalcin (OCN), osteopontin (OPN) and bone sialoprotein (BSP). The cellular proliferation was similar on both the scaffolds with and without gentamycin indicating the addition of gentamycin to the scaffold in the model does not incur any negative effects on the cells (FIG. 3A). The scaffolds exhibited a gradual but suppressed proliferation of C2CI2 muscle myoblasts when compared with tissue culture plates. However, this difference in the proliferation behavior of cells on Cerament and 2D tissue culture plate might be due to differentiation of myoblast C2CI2 cells to osteoblast lineage. ALP is an important osteogenic marker and an 8-fold increase in the ALP activity (FIG. 3B) in the cells seeded on Cerament clearly demonstrated the osteoinductive behavior of the material irrespective of whether gentamycin was added or not. This was caused by the C2CI2 cells that differentiated to osteoblasts started going into maturation phase. It is known that ALP may acts as osteogenic cell formation predictor. RUNX2 is known to be an osteoblast specific transcription factor and a regulator of differentiation of osteoblast. The presence of other markers of mature osteoblast like COLI, OPN and OCN were detected by the 21.sup.st day of cell seeding.

[0127] To mimic surgical conditions with leakage of extracellular matrix (ECM) proteins and growth factors from artificial grafts, bone cells ROS17/2.8 were cultured in a bioreactor and the secreted growth factors and ECM proteins were harvested. Harvested cell culture produced bone active proteins were measured using ELISA and bone morphogenic protein-2 (BMP-2, 8.40.8 ng/mg) and BMP-7 (50.62.2 ng/mg) were found. In vitro, the harvested bone active proteins induced differentiation of skeletal muscle cells L6 towards an osteogenic lineage, which stained positive for bone markers.

[0128] Based on the above results, it was found that bone formation can be synergistically enhanced by release of growth factors and/or ECM proteins capable of inducing osteoblast differentiation from and present in biphasic ceramic bone substitute.

In-Vitro BMP-2 Release

[0129] A Cerament BVF-rhBMP-2 paste was prepared by mixing, transferred to a syringe and solid discs were prepared in a mold. Each disc containing 2 g rhBMP-2 was immersed in 1 mL saline and placed in an incubator at 37 C. At different time point over a period of 7-days, 50 l of saline from the supernatant was collected and analysed and the protein concentration calculated. A constant release of BMP-2 from Cerament BVF was observed over a period of 7-days with nearly 90% of rhBMP-2 released after 7-days.

In-Vitro ZA Release

[0130] Release of bisphosphonate (zoledronic acid (ZA) was used as an example) from a biphasic ceramic bone substitute was investigated in Cerament with and without gentamicin. Cerament BVF-ZA paste and Cerament G-ZA paste were prepared by mixing each of the Cerament powders with ZA and a liquid. The discs were produced by transferred the pastes to a mold using a syringe and the solid discs were left to set. Saline was added to the discs and they were incubated at physiological conditions. At different time point over a period of 7-days, a sample of the medium was collected and analysed. To assess the release of ZA from each Cerament+ZA disc at different time points, the collected supernatants were added to A549 cells and cell viability was calculated after an incubation of 48 h using MTT assay. The concentration of ZA was calculated from a standard curve.

[0131] After a period of 7-days, the amount of ZA released from solid Cerament discs was nearly 10% of the total ZA loaded. No difference in ZA-release was seen between Cerament with and without gentamicin. The cytotoxic effect of ZA released from Cerament BVF and Cerament G discs on A549 cells indicated a decrease in cell viability at increasing time points.

In Vivo Testing (Ectopic (Muscle) Bone Model)

[0132] Discs were produced from Cerament products mixed with recombinant human (rh) BMP-2 alone or with rhBMP-2 together with ZA and implanted in 7 week old rats. In a modified ectopic bone model, the implants were inserted in the abdominal muscle by performing a single blunt dissection of the abdominal muscle The modified ectopic bone model is unique in using the unstressed abdominal muscle, which results in an increased resorption of bone cells by osteoclasts compared to an earlier study, where the grafts are placed next to an existing bone in the hip joint on the dorsal side, and thus more likely is influenced by local release and stimulation from the underlying bone which will affect the level bone being built and the tested anti-catabolic agents such as bisphosphonates as well as the growth hormones (WO 2012/094708). In one group the test animals received two discs of only Cerament BVF in the left side of the abdominal midline per animal while the right side of the midline was used to implant two discs of Cerament BVF+rhBMP-2 per animal. In another group, the animals received two discs of only Cerament BVF and two discs of Cerament BVF+rhBMP-2+ZA in a similar manner. The scaffolds emerging over time from the discs were left in the animals for 4 weeks. Analysis for bone formation was done using X-ray followed by three-dimensional analysis of mineralized tissue volume using micro computed tomography (micro-CT) and electron microscopy. The type of cells within the scaffold was analyzed using histology (Hematoxylin and eosin (H&E)).

[0133] Examination of the animals sacrificed after 4 weeks showed that the scaffolds from Cerament BVF discs loaded with rhBMP-2 and ZA are denser than the scaffolds from Cerament BVF discs loaded with rhBMP-2 only and scaffolds from Cerament BVF discs. Micro-CT results show that the mineralized tissue volume was significantly higher in the Cerament BVF disc group loaded with a combination of rhBMP-2 and ZA than in the group loaded with rhBMP-2 and the group with Cerament BVF discs. The group loaded with a combination of rhBMP-2 and ZA had significantly higher mineral volume than the Cerament BVF+rhBMP-2 group. Histologically, the samples that were loaded with rhBMP-2+ZA had developed a cortical shell around the scaffold with islands of trabecular bone already visible within the scaffold, while the Cerament BVF+rhBMP-2 group showed signs of osteoclastic resorption with visible fatty marrow. This is clearly visualized by the electronmicroscopy.

EXAMPLES

[0134] The content of Cerament compositions used in the examples is given in Table 1.

[0135] In all of the examples saline means a NaCl solution containing 9 mg NaCl/mL water unless stated otherwise.

Example 1

In-Vitro Immunogenicity

[0136] Cerament BVF paste was prepared according to the manufacturer's instruction and used to prepare discs (diameter: 8 mm; height: 2 mm) which sat before 20 minutes. The discs were seeded with a total of 110.sup.5 murine macrophage cells RAW 264.7 and secretion of pro inflammatory cytokines like interleukin (IL)-1, IL-2, IL-6 and tumor necrosis factor (TNF)- was assessed over a period of 7-days using ELISA. As positive control, RAW 264.7 cells were treated with immunogenic lipopolysaccharide (LPS).

[0137] The secretion of all cytokines (IL-1, IL-2, IL-6 and TNF-) was comparable with the negative control (2D-TCP) and significantly lower than the LPS treated positive control (2D-TCP+LPS) with p-values <0.0001 in all cases (FIG. 1A-D).

Example 2

In Vitro Osteoinduction

Material Preparations for the In Vitro Experiments

[0138] Two types of bone substitute products, CERAMENT IBVF and CERAMENT IG, were mixed as per supplier's guidelines (Bone Support AB, Lund, Sweden) to form a homogenous paste. The paste was poured in a disc shape mold with 8 mm diameter and 2 mm height and allowed to set for 30 min.

[0139] 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MU), Sigmafast pNPP, Dulbecco's Modified Eagle's Medium-High glucose (DMEM-HG), Fetal bovine serum (FBS), antibiotic cocktail, Trizol reagent and primers for real time polymerase chain reaction (RT-PCR) was purchased from Sigma Aldrich, MA, USA. Mouse COLI, OCN, RUNX-2, OPN were purchased from Santa Cruz Biotechnology, Inc., CA, USA and Sigma Chemical company, MA, USA. Rat COLI, OCN, OPN and bone sialoprotein (BSP) antibodies, DRAQ5, alexa flour 488 (AF-488) were procured from Abcam, Cambridge, U.K. RT-PCR reagents were purchased from Thermo scientific, USA. Rat BMP-2 and BMP-7 ELISA kits were purchased from Abnova Inc., Taiwan and Qayee Bio, China respectively. All other reagents were of high purity purchased from recognized suppliers.

Cell Culture

[0140] Mouse myoblast C2Cl2 cells were cultured in the Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) and antibiotics. Cells were kept in an incubator having 95% air and 5% C02. For the proliferation and functionality experiments, 110.sup.5 cells were seeded onto the Cerament discs while for immunofluorescence staining and reverse transcription polymerase chain reaction (RT-PCR), 110.sup.6 cells were seeded onto the Cerament discs. Rat skeletal muscle myoblast cellline L6 was cultured in DMEM with high glucose with 10% (v/v) FBS and 1% (v/v) antibiotic cocktail consisting of penicillin-streptomycin. Cells were passaged at 80% confluence and were used at 2.sup.nd passage after revival. Cell viability before experiments was evaluated using the trypan blue exclusion method.

[0141] In order to mimic in vivo conditions that lead to bone formation in the muscle tissue, osteoblast cell factory derived proteins were harvested from an expanded cell culture of ROS 17/2.8 osteoblastic cells. Cells were allowed to proliferate in culture flasks supplemented with complete medium and 5% (v/v) serum for a period of 3 days. The secreted bone active proteins in the medium were collected while the cells were passaged again to repeat the procedure.

[0142] In order to ensure transdifferentiation of muscle cells into osteoblast like cells, the rat muscle cell line L6 was used. The cells were allowed to grow to 80% confluence after which they were either supplied with low serum (5% v/v) complete medium or a mixture of complete medium (low serum) and harvested osteoblast cell factory medium in an equal ratio by volume. The cells were allowed to grow for a period of 10 or 12 days and were analyzed using different techniques to confirm a shift in their phenotype.

Statistical Analysis

[0143] Data from the MTT and ALP assay were analyzed using unpaired t-test. p<0.05 was considered to be significant. Data from MTT assay and myotube numbers for cell factory experiments were analyzed using non-parametric, multiple t-test and p<0.05 was considered statistically significant. Data is represented in triplicates with mean and standard deviation.

Microscopic Analysis

[0144] Surface morphology of the materials and adherence of the C2C12 cells on the surface of Cerament discs were analyzed using scanning electron microscopy. Materials were dehydrated by gradient ethanol treatment. Further, samples were vacuum dried overnight. For analyzing the cell adherence on the Cerament surface, cells were seeded on both the materials i.e., with gentamicin and without gentamicin. The cells were allowed to grow for three days. Thereafter, glutaraldehyde (2.5%) was used to fix all the cells on the surface. Steps following fixation were the same as were used for sample preparation for surface morphology analysis. Furthermore, attachment of cells on the Cerament discs were analysed using 4, 6-diamidino-2-phenylindole (DAPI) staining.

[0145] The surface morphology of both Cerament discs with and without gentamycin showed porous structure with size of the pores at the material surface in the range of 1-10 m (FIGS. 2A and B). Cells were present on the surface of the Cerament discs after 3 days of seeding (FIGS. 2C and D). The cells were attached and homogenously distributed on both discs, with and without gentamicin (FIGS. 2E and F). This was further confirmed by staining of the cells with DAPI that revealed similar type of distribution pattern where cells seeded were adhered and evenly distributed on the surface of material.

Cell Proliferation Assay

[0146] Cell proliferation on both the materials was evaluated using MTT assay at regular time intervals. Briefly, the DMEM media in the wells was removed, and cell seeded inorganic discs were washed using phosphate buffer saline (PBS). Thereafter, DMEM media, without FBS, containing MTT (0.5 mg/ml) was added in the wells and incubation of 5 h was done. Further, this solution was removed and dimethyl sulfoxide (DMSO) was added. The samples were incubated for 20 min at 37 C. The colored solution formed was collected and absorbance was measured spectrophotometrically at 570 nm. Cell proliferation analysis in the cell factory experiments using L6 cells was done in a similar manner and a cell density of 510.sup.4 cells/well was used. The proliferation of myotubes was analyzed by microscopy and multinucleated and elongated cells were considered to be myotubes.

[0147] Similar results were observed in both Cerament materials with or without gentamicin (FIG. 3A). After the initial increase in the cell population until the 7.sup.th day, the cell proliferation was suppressed and a decrease in cell population was observed at the later time points. On the other hand, in case of two-dimensional polystyrene tissue culture plates, taken as a control, increase in cell proliferation was observed till the 14.sup.th day, thereafter proliferation starts declining. Cells seeded on both the materials showed similar profile of cell proliferation. No statistically significant difference in cell proliferation was reported (p>0.05). However, better cell proliferation was reported in the polystyrene tissue culture plate compared to the Cerament discs.

Alkaline Phosphatase Assay

[0148] Sigma fast para-Nitrophenylphosphate (pNPP) tablets were used to prepare pNPP substrate solution, using protocol provided by the manufacturer. The media was removed from the wells and samples were washed using PBS buffer. The samples were then incubated with para-nitrophenylphosphate (pNPP) substrate solution for 2 h in the CO.sub.2 incubator at 37 C. and absorbance was measured at 405 nm.

[0149] The material with and without gentamycin showed increase in ALP amounts by the 14.sup.th day of cell seeding (FIG. 3B). Thereafter, values of ALP start decreasing with time. Within a time period of 14 days, cells seeded on both the Cerament materials showed an eight-fold increase in ALP level when compared to polystyrene controls (p<0.05). There was no statistically significant difference in the level of ALP shown by both the materials (p>0.05). On the other hand, the level of ALP by the cells seeded on the polystyrene plate was less as compared to ALP level of cells seeded on Cerament materials.

Immunofluorescence Staining for Osteogenic Markers

[0150] The differentiation potential of the materials were observed using immunofluorescence staining. The cells were stained to detect the presence of different markers like runx2, osteopontin, osteocalcin and collagen type I (COLI) over the period of 21 days.

[0151] Immunofluorescence staining showed the presence of Runx2 by the 7.sup.th day of cell seeding on the Cerament disc (FIG. 4A-C). The presence of other markers of mature osteoblasts like COLI (FIG. 4D-F), OCN (FIG. 4G-I) and OPN (FIG. 43-L) were detected by the 21.sup.st day of cell seeding.

[0152] To confirm the transdifferentiation of L6 muscle cells into osteoblast like cells, cells in both groups were immunostained for various osteoblastic markers like collagen type I (COLI), osteocalcin (OCN), osteopontin (OPN) and bone sialoprotein (BSP). Cells were allowed to grow in culture flasks for a period of 10 days in complete medium with osteoblast harvested bone active proteins or low serum. The cells were trypsinized and seeded on 4-well chamber slides and allowed to proliferate with same medium further for 48 h. At the day of staining, cells were fixed using 4% formaldehyde for 10 min followed by membrane permeabilization using 0.1% (v/v) triton X-100 for 5 minutes. Later cells were blocked using 5% goat serum for 1 h and incubated with respective primary antibodies for 2 h at room temperature. Slides were washed with PBST five times followed by incubation in secondary antibody (AF-488 labeled) for 1 h. The slides were counterstained using DRAQ5 for 5 min and washed twice for 5 min each. The slides were eventually cleared, mounted and allowed to dry overnight before analysis. The cells were analyzed on Zeiss confocal microscope at different magnifications.

[0153] FIG. 6 shows the immuno positive and transdifferentiated muscle cells transformed into osteoblast like cells. The cells in the treated groups expressed osteogenic proteins like COLI, OCN, OPN and BSP at day 12 (FIG. 6A-D). The cells in the control group fused together to form myotubes and did not express osteogenic proteins.

RNA Extraction and RT-PCR

[0154] The discs of Cerament with and without gentamicin were seeded with C2C 12 cells at a concentration of 110.sup.6 cells/disc. The RNA was extracted using Trizol reagent, after in vitro culturing of cell seeded discs for the time period of 7 and 21 days. Cell seeded discs were transferred from multiwell plate to microtubes after adding 1 ml of Trizol reagent. Thereafter, RNA was isolated by following the protocol supplied by the manufacturer. Complimentary DNA (cDNA) was synthesized by incubating isolated RNA (20 l) with 1 l of oligodT at 75 C. for 5 min followed by incubation on ice for 5 min. To this, cDNA mix having 4 l of buff RT, 1 l of RTase, 0.5 l of RI (RNase inhibitor) and 2 l of dNTP mix was added. RT-PCR was conducted to evaluate the expression of various genes of the osteogenic lineage such as RUNX2, COLI, BSP and OCN. The primer sequences of the genes are obtained from previous work and listed in Table 2. As an endogenous control, expression of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was determined. Consecutive thermal cycle was used for DNA amplification. Products of RT-PCR were resolved on a 2.0% agarose gel stained using ethidium bromide

TABLE-US-00002 TABLE2 Primer Sequences 1. RUNX2 F:TTTAGGGCGCATTCCTCATC R:TGTCCTTGTGGATTAAAAGGACTTG 2. BSP F:CACCCCAAGCACAGACTTTT R:GTTCCTTCTGCACCTGCTTC 3. COLI F:GAGGCATAAAGGGTCATCGTGG R:CATTAGGCGCAGGAAGGTCAG 4. OCN F:GAACAGACTCCGGCGCTA R:AGGGAGGATCAAGTCCCG 5. GAPDH F:TCCACTCACGGCAAATTCAACG R:TAGACTCCACGACATACTCAGC

[0155] Results showed presence of RUNX2 by the 7.sup.th day (FIG. 5M) and presence of other osteoblastic marker such as COLI, BSP and OCN by the 21.sup.st day of cell seeding (FIG. 5N).

Morphological Changes Using Light Microscopy and Hematoxylin and Eosin Staining

[0156] The transdifferentiation of muscle cells with the addition of osteoblast harvested bone active proteins was analyzed over a period of several days. Morphological analysis was performed using both light microscopy and H&E staining. Culture flasks were directly monitored using a light microscope at different magnifications. In order to perform H&E staining, cells were grown in 4-well chamber slides and were fixed with 4% (w/v) formaldehyde for 10 min. Cells were hydrated with reducing ethanol gradient and stained with Hematoxylin for 5 min. Excessive stain was washed using running water followed by counterstaining with Eosin for 2 min. The slides were cleared in xylene for 5 min, mounted and dried overnight before imaging.

[0157] A time course morphological differences were observed in cells treated with bone active proteins and the control groups. The cells in the control groups can be seen as elongated from as early as day 1 until the end of the experiment (FIGS. 6E and F) when compared with cells in the treated groups (not shown). Hematoxylin and eosin staining clearly depicts the structural differences between the cells with and without treatment of growth factors (FIGS. 6F and H). In case of controls, muscle cells differentiate into fused myotubes possessing a number of nuclei while the cells in the group treated with growth factors remain uninucleated throughout the experiment (FIGS. 6F and H). Moreover the size of the cells is much smaller and possesses osteoblast like morphology in case of treated cells.

Cell Viability and Myotube Number

[0158] No significant difference in proliferation profile of cells was observed (FIG. 61). On the contrary, cells in the control groups fused to form myotubes with multiple nuclei. The number of myotubes that could be observed over a period of 7 days was also analyzed. The number of myotubes in the control group kept increasing over time (p<0.05), however in the treated group very few myotubes were observed on day 1 and the number reached zero after day 3 indicating complete suppression of myotube formation (FIG. 63).

Osteoblast Cell Factory Composition

[0159] With an attempt to detect various pro-osteoblastic proteins in the ROS 17/2.8 cell factory the harvested cell factory proteins were dialyzed against ultrapure water for a period of 48 hr. using a 8 kDa dialysis membrane. After dialyzing, the proteins were concentrated using freeze-drying for a period of 48 hr. The dried protein fraction so obtained was later analyzed using ELISA for the detection and measurement of two important bone active molecules BMP-2 and BMP-7.

[0160] The presence of the two most common osteoinductive proteins, BMP-2 and BMP-7 responsible for osteogenic differentiation of various mesenchymal cells into osteoblastic lineages were confirmed. The detection of osteogenic proteins was performed using ELISA and the respective concentrations of BMP-2 and BMP-7 in the cell factory were 8.40.8 ng/mg and 50.62.2 ng/mg of the harvested protein fraction.

Example 3

In-Vitro BMP-2 Release

[0161] 1 g of Cerament BVF was mixed with 0.406 ml CERAMENT IC-TRU. The Cerament BVF paste was mixed rigorously for 30 seconds followed by waiting for 30 seconds and this was continued until 2.5 minutes. A stock solution of rhBMP-2 (Medtronic) containing 40 g rhBMP-2 was prepared by dissolving it in 40 L saline (9 mg NaCl/mL). At 2.5 minutes 24 l of this rhBMP/saline stock solution was rigorously mixed into the pre-mixed Cerament BVF paste. After complete mixing of the rhBMP-2 solution into the Cerament BVF paste, the rhBMP/Cerament BVF paste was transferred to a syringe and 12 discs were made (diameter: 50.1 mm; height: 1.50.05 mm). All discs were set before 20 min. The weight of the discs was 463.2 mg and each disc contained 2 g rhBMP-2.

[0162] Each disc was immersed in 1 mL saline and placed in an incubator at 37 C. At each time point (Day 1, 3, 5 and 7) 50 l of the supernatant was collected for analysis and 50 l of fresh saline was added. The protein concentration was calculated using ELISA over a period of 7-days. FIG. 7 shows that a constant release of BMP-2 from solid Cerament BVF was observed over a period of 7-days with nearly 90% of rhBMP-2 released after 7-days.

Example 4

In-Vitro ZA Release

[0163] For the in-vitro zoledronic acid (ZA) release test a total of 12 discs were prepared; 6 discs were prepared from Cerament BVF powder and 6 discs were prepared from Cerament G powder:

[0164] 500 mg of Cerament BVF was mixed with 148.64 l CERAMENT IC-TRU. The sample was mixed rigorously for 30 seconds followed by waiting for 30 seconds and this was continued until 2.5 minutes. At 2.5 minutes 67.5 l zoledronic acid solution (54 g ZA, Zometa (4 mg/5 ml), Novartis) was added to the Cerament BVF paste. The Cerament BVF+ZA paste was mixed for 30 more seconds and 6 discs were prepared (diameter: 50.1 mm; height: 1.50.05 mm; 9 g ZA). All discs were set before 20 min.

[0165] 500 mg of Cerament G powder was mixed with 148.64 l saline containing 6.6 mg gentamicin. The sample was mixed rigorously for 30 seconds followed by waiting for 30 seconds and this was continued until 3.5 minutes. At 3.5 minutes 67.5 l zoledronic acid solutions (54 g ZA, Zometa, Novartis) was added to the Cerament G paste. The Cerament G+ZA paste was mixed for 30 more seconds and 6 discs were prepared (diameter: 50.1 mm; height: 1.50.05 mm; 9 g ZA). All discs were set before 20 min.

[0166] Saline was added to the discs and they were incubated at physiological conditions. At each time point, a sample of the medium was collected and stored for further analysis. To assess the release of ZA from each Cerament BVF/G+ZA disc at different time points, the collected supernatants were added to A549 cells and cell viability was calculated after an incubation of 48 hours using MTT assay. The concentration of ZA was then calculated from the obtained standard curve.

[0167] In-vitro statistical analysis was performed using multiple t-test (Prism 6) with data represented in triplicates with mean and standard deviation.

[0168] After a period of 7-days, the amount of ZA released from the Cerament BVF and Cerament G discs was nearly 10% of the total ZA loaded (FIG. 8; BVF and G groups taken together, as no difference was seen between the Cerament BVF and Cerament G discs). The cytotoxic effect of ZA released from Cerament discs on A549 cells indicates a decrease in cell viability at increasing time points (FIG. 9; BVF and G groups taken together, as no difference was seen between the Cerament BVF and Cerament G discs).

Example 5

In-Vivo Muscle Pouch Model

[0169] The study was approved by the local authority for use of laboratory animals (permit M 124-14). Discs of Cerament BVF, Cerament BVF+rhBMP-2 and Cerament BVF+rhBMP-2 and ZA were produced as follows:

The Cerament BVF Discs:

[0170] 1 g of Cerament BVF was mixed with 0.43 mL of a iohexol-solution comprising 162 l saline and 268 l CERAMENT IC-TRU and rigorously mixed for 30 seconds followed by waiting for 30 seconds and this was repeated until 2.5 min. The total liquid used was 430 l for 1 g Cerament powder, which gives 480 l paste with a liquid/powder ratio of 0.43 ml/g. The paste was used to prepare 12 cylindrically discs (diameter: 5 mm; height: 2 mm; weight: 47.63 mg) in a sterile mold (40 l paste/cylinder). Each disc which contained 83.33 mg Cerament BVF, 22.33 l CERAMENT IC-TRU and 13.5 l saline and sat before 20 minutes.

The Cerament BVF+BMP Discs:

[0171] In the Cerament BVF+BMP group a stock solution of BMP was initially prepared by dissolving 120 g of rhBMP-2 (Medtronic) in 162 l of saline. 1 g of the Cerament BVF was mixed with 268 l CERAMENT IC-TRU and rigorously mixed for 30 seconds followed by waiting for 30 seconds and repeated mixing and pausing until 2.5 minutes to obtain a paste. At 2.5 minutes, the 162 l BMP/saline solution (containing 120 g rhBMP-2) was added to the paste and rigorously mixed for another 30 seconds. The total liquid used was 430 l for 1 g Cerament BVF powder, which gives a liquid/powder ratio of 0.43 ml/g. A final volume of 480 l paste was obtained containing 120 g rhBMP-2 and used to prepare 12 discs of the same size as above, each with a volume of 40 l BMP/Cerament BVF paste. Each disc contained 83.33 mg Cerament BVF, 22.33 l CERAMENT IC-TRU, 13.5 l saline and 10 g rhBMP-2. The discs sat before 20 minutes.

The Cerament BVF+BMP+ZA Discs:

[0172] A solution of rhBMP-2 was prepared by dissolving 120 g rhBMP-2 (Medtronic) in 12 l of saline. 150 l of a ZA-solution (120 g ZA, Novartis) was added and mixed with the rhBMP-2 solution. A total volume of 162 l of ZA (120 g) and rhBMP-2 (120 g) in saline was achieved. 1 g of Cerament BVF was mixed with 268 l CERAMENT IC-TRU and the paste was rigorously mixed for 30 seconds followed by waiting for 30 seconds and mixing and pausing were repeated until 2.5 minutes to prepare a paste. At 2.5 minutes the 162 l ZA+rhBMP-2 solution was added to the paste and mixed for 30 seconds more to homogenize the contents. A final volume of 480 l was obtained and used to produce 12 discs as described above, each with a volume of 40 l ZA/BMP/Cerament paste. Each disc contained 83.33 mg Cerament BVF, 22.33 l CERAMENT IC-TRU, 13.5 l saline, 10 g rhBMP-2 and 10 g ZA. The discs sat before 20 minutes.

[0173] Discs comprising Cerament BVF, Cerament BVF+rh-BMP-2 and Cerament BVF+rh-BMP-2+ZA prepared as described above were implanted in 7 week old Sprague Dawley rats. The implants were inserted in the abdominal muscle by performing a single blunt dissection of the abdominal muscle. In one group, five animals received two discs containing only Cerament BVF in the left side of the abdominal midline per animal while the right side of the midline was used to implant two discs containing Cerament BVF+BMP-2 per animal. In a second group, 5 animals received two discs containing Cerament BVF and two discs containing Cerament BVF+BMP-2+ZA in a similar manner. The scaffolds emerging over time from the discs were left in the animals for 4 weeks. Analysis for bone formation was done using X-ray followed by three-dimensional analysis of mineralized tissue volume using micro computed tomography (micro-CT). The type of cells within the scaffold was analyzed using histology (H&E).

[0174] In-vivo statistical analysis was performed using student t-test with n=5 (mean and SD). P-value <0.05 was considered to be significant.

[0175] As seen in FIG. 10, radiographic examination of the animals after 4 weeks showed that the scaffolds from Cerament BVF discs loaded with rhBMP-2 and ZA are denser than the scaffolds from Cerament BVF discs loaded with rhBMP-2 only. Scaffolds from Cerament BVF discs loaded with rhBMP-2 are denser than scaffolds from Cerament BVF discs. Micro-CT results show that the mineralized tissue volume was significantly higher in the Cerament BVF disc group loaded with a combination of rhBMP-2 and ZA and in the group loaded with rhBMP-2 when compared to the group of only Cerament BVF discs (p<0.01) (FIGS. 11-13). The group loaded with a combination of rhBMP-2 and ZA had significantly higher mineral volume than the Cerament BVF+BMP-2 group (p<0.01). Histologically, the samples that were loaded with rhBMP-2+ZA had developed a cortical shell around the scaffold with islands of bridging trabecular bone already visible within the scaffold, while the Cerament BVF+BMP-2 group showed signs of osteoclastic resorption with visible fatty marrow (FIG. 11).

Specific Embodiments of the Present Invention

[0176] 1. Biphasic ceramic bone substitute comprising: [0177] a. a calcium sulphate phase; [0178] b. a calcium phosphate phase; [0179] c. at least one bone active protein, and [0180] d. at least one anti-catabolic agent. [0181] 2. Biphasic ceramic bone substitute according to 1, wherein the calcium sulphate is calcium sulphate dihydrate. [0182] 3. Biphasic ceramic bone substitute according to 1 or 2, wherein the calcium phosphate is selected from the group consisting of -tricalcium phosphate, hydroxyapatite, tetracalcium phosphate and -tricalcium phosphate. [0183] 4. Biphasic ceramic bone substitute according to 3, wherein the calcium phosphate phase is composed of hydroxyapatite, preferably crystalline hydroxyapatite particles. [0184] 5. Biphasic ceramic bone substitute according to any one of 1-4, wherein the bone active protein is selected from the group comprising bone morphogenic proteins (BMPs), insulin-like growth factors (IGFs), transforming growth factor-s (TGFs), parathyroid hormone (PTH), sclerostine, cell factory derived bone active proteins and ECM proteins or is strontium. [0185] 6. Biphasic ceramic bone substitute according to 5, wherein the bone active protein is a bone morphogenic protein (BMP). [0186] 7. Biphasic ceramic bone substitute according to 6, wherein the bone growth protein is BMP-2, preferably rhBMP-2, and/or BMP-7, preferably rhBMP-7. [0187] 8. Biphasic ceramic bone substitute according to any one of 1-7, wherein the anti-catabolic agent is an agent which inhibits bone resorption. [0188] 9. Biphasic ceramic bone substitute according to 8, wherein the anti-catabolic agent is a bisphosphonate, a selective estrogen receptor modulator (SERM), denosumab or a statin. [0189] 10. Biphasic ceramic bone substitute according to 9, wherein the anti-catabolic agent is a bisphosphonate selected from the group comprising etidronate, clodronate and tiludronate, or the group comprising pamidronate, neridronate, olpadronate, alendronate, ibandronate, risedronate and zoledronate. [0190] 11. Biphasic ceramic bone substitute according to 10, wherein the bisphosphonate is zoledronate (zoledronic acid). [0191] 12. Biphasic ceramic bone substitute according to any one of 1-11 comprising at least one further bioactive agent selected from antibiotics (including antifungal drugs), bone healing promotors, chemotherapeutics, cytostatics, vitamins, hormones, bone marrow aspirate, platelet rich plasma and demineralized bone. [0192] 13. Biphasic ceramic bone substitute according to 12 comprising at least one antibiotic selected from gentamicin, vancomycin, tobramycin, cefazolin, rifampicin, clindamycin and the antifungal drug is selected from the group comprising nystatin, griseofulvin, amphotericin B, ketoconazole and miconazole. [0193] 14. Biphasic ceramic bone substitute according to any one of 1-13 further comprising an X-ray contrast agent selected from water soluble non-ionic X-ray contrast agents and/or biodegradable X-ray contrast agents. [0194] 15. Biphasic ceramic bone substitute according to 14, wherein the water soluble non-ionic X-ray contrast agent is selected from iohexol, iodixanol, ioversol, iopamidol, iotrolane, metrizamid, iodecimol, ioglucol, ioglucamide, ioglunide, iogulamide, iomeprol, iopentol, iopromide, iosarcol, iosimide, iotusal, ioxilane, iofrotal, and iodecol. [0195] 16. Biphasic ceramic bone substitute according to any one of 13-15, wherein the calcium sulphate to calcium phosphate ratio (w/w) is from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40. [0196] 17. Hardenable ceramic bone substitute powder comprising: [0197] a. calcium sulphate hemihydrate powder; [0198] b. calcium phosphate powder, where the calcium phosphate is selected from one or more of the group consisting of -tricalcium phosphate, hydroxyapatite, tetracalcium phosphate and -tricalcium phosphate; [0199] c. optionally a bone active protein; [0200] d. an anti-catabolic agent; [0201] e. optionally an accelerator for setting of calcium sulphate preferably selected from calcium sulphate dihydrate and a salt (e.g. NaCl); and [0202] f. optionally an accelerator for setting of calcium phosphate preferably particulate calcium phosphate and/or a phosphate salt (e.g. Na.sub.2HPO.sub.4). [0203] 18. Hardenable ceramic bone substitute powder according to 17, wherein the calcium phosphate is hydroxyapatite powder, preferable comprised of amorphous and/or crystalline hydroxyapatite particles. [0204] 19. Hardenable ceramic bone substitute powder according to 17 or 18, wherein the amorphous and/or crystalline calcium phosphate (e.g. hydroxyapatite) particles have a size <200 m, <100 m, <50 m, <35 m, or <20 m. [0205] 20. Hardenable ceramic bone substitute powder according to any one of 17-19, wherein the anti-catabolic agent is pre-mixed with (and optionally bound to) the calcium phosphate particles in the powder. [0206] 21. Hardenable ceramic bone substitute powder according to 20, wherein the calcium phosphate particles are crystalline hydroxyapatite particles. [0207] 22. Hardenable ceramic bone substitute powder according to any one of 17-21, wherein the anti-catabolic agent is selected from is an agent which inhibits bone resorption. [0208] 23. Hardenable ceramic bone substitute powder according to 22, wherein the anti-catabolic agent is a bisphosphonate, a selective estrogen receptor modulator (SERM), denosumab or a statin. [0209] 24. Hardenable ceramic bone substitute powder according to 23, wherein the anti-catabolic agent is a bisphosphonate selected from the group comprising etidronate, clodronate and tiludronate, or the group comprising pamidronate, neridronate, olpadronate, alendronate, ibandronate, risedronate and zoledronate. [0210] 25. Hardenable ceramic bone substitute powder according to 24, wherein the bisphosphonate is zoledronate (zoledronic acid). [0211] 26. Hardenable ceramic bone substitute powder according to any one of 17-25 comprising a bone active protein. [0212] 27. Hardenable ceramic bone substitute powder according to 26, wherein the bone active protein is a bone growth protein selected from the group comprising bone morphogenic proteins (BMPs), insulin-like growth factors (IGFs), transforming growth factor-s (TGFs), parathyroid hormone (PTH), sclerostine, cell factory derived proteins and ECM proteins or is strontium. [0213] 28. Hardenable ceramic bone substitute powder according to 27, wherein the bone active protein is a bone morphogenic protein (BMP) selected from BMP-2, BMP-7, rhBMP-2 and rhBMP-7. [0214] 29. Hardenable ceramic bone substitute powder according to any one of 26-28, wherein the bone active protein is pre-mixed with the calcium sulphate hemihydrate powder. [0215] 30. Hardenable ceramic bone substitute powder according to any one of 17-29, further comprising a bioactive agent selected from antibiotics (including antifungal drugs), bone healing promotors, chemotherapeutics, cytostatics, vitamins, hormones, bone marrow aspirate, platelet rich plasma and demineralized bone. [0216] 31. Hardenable ceramic bone substitute powder according to 30 comprising at least one antibiotic selected from gentamicin, vancomycin, tobramycin, cefazolin, rifampicin, clindamycin and the antifungal drug is selected from the group comprising nystatin, griseofulvin, amphotericin B, ketoconazole and miconazole. [0217] 32. Hardenable ceramic bone substitute powder according to any one of 17-31 further comprising an X-ray contrast agent selected from water soluble non-ionic X-ray contrast agents and/or biodegradable X-ray contrast agents. [0218] 33. Hardenable ceramic bone substitute powder according to 32, wherein the water soluble non-ionic X-ray contrast agent is selected from iohexol, iodixanol, ioversol, iopamidol, iotrolane, metrizamid, iodecimol, ioglucol, ioglucamide, ioglunide, iogulamide, iomeprol, iopentol, iopromide, iosarcol, iosimide, iotusal, ioxilane, iofrotal, and iodecol. [0219] 34. Hardenable ceramic bone substitute powder according to any one of 17-33, wherein the calcium sulphate to calcium phosphate ratio (w/w) is from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40. [0220] 35. Hardenable ceramic bone substitute paste comprising a hardenable ceramic bone substitute powder according to any one of 16-34 and an aqueous liquid. [0221] 36. Hardenable ceramic bone substitute paste according to 35, wherein the paste is injectable. [0222] 37. Hardenable ceramic bone substitute paste according to 35 or 36, for use in the treatment of a disorder of supportive tissue in a human or non-human subject by generating lost bone tissue. [0223] 38. Hardenable ceramic bone substitute paste according to any one of 35-37, wherein the calcium sulphate to calcium phosphate ratio (w/w) is from 5:95 to 95:5, from 10:90 to 90:10, from 20:80 to 80:20, from 30:70 to 70:30, or from 40:60 to 60:40. [0224] 39. Kit for producing a hardenable ceramic bone substitute paste according to any one of 35-38, or a biphasic ceramic bone substitute according to any one of 1-16, comprising: [0225] i) a calcium sulphate hemihydrate powder; [0226] ii) a calcium phosphate powder as defined in 3 or 4; [0227] iii) a bone active protein as defined in any one of 5-7; [0228] iv) an anti-catabolic agent which inhibits bone resorption as defined in any one of 9-11; [0229] v) optionally at least one further bioactive agent as defined in 12 or 13; [0230] vi) optionally an X-ray contrast agent as defined in 14 or 15; [0231] vii) optionally an accelerator for setting of the calcium sulphate, preferably calcium sulphate dihydrate or a salt such as NaCl; [0232] viii) optionally an accelerator for setting of the calcium phosphate, preferable particulate calcium phosphate and/or a calcium phosphate salt (e.g. Na2HPO4); and [0233] ix) optionally an aqueous liquid, e.g. water. [0234] 40. Kit according to 39, wherein the calcium sulphate hemihydrate powder (i) is pre-mixed with the calcium phosphate powder (ii) to form a basis powder (x). [0235] 41. Kit according to 40, wherein the anti-catabolic agent (iv) is pre-mixed with at least a part of the calcium phosphate powder (ii), at least a part of the calcium sulphate hemihydrate powder (i), the basis powder (x), one or more of the active additives (iii) and (v)-(viii), or the aqueous liquid (ix). [0236] 42. Kit according to any one of 39-41, wherein the bone active protein (iii) is pre-mixed with at least a part of the calcium sulphate hemihydrate powder (i), at least a part of the calcium phosphate powder (ii)), the basis powder (x), one or more of the active additives (iv)-(viii), or the aqueous liquid (ii). [0237] 43. Kit according to any one of 39-42, wherein the at least one further bioactive agent (v) is pre-mixed with the calcium phosphate powder (ii), 2) the calcium sulphate hemihydrate powder (i), the basis powder (x), one or more of the active additives (iv) and (vi)-(viii), or the aqueous liquid (ix). [0238] 44. Kit according to any one of 39-43, wherein the X-ray contrast agent (vi) is pre-mixed with the calcium phosphate powder (ii), the calcium sulphate hemihydrate powder (i), the basis powder (x), one or more of the active additives (iv), (v), (vii) and (viii), or the aqueous liquid (ix). [0239] 45. Kit according to any one of 39-44, wherein an accelerator for setting of the calcium sulphate (vii) is premixed with the calcium sulphate hemihydrate powder (i), the basis powder (x), one or more of the active additives (iv)-(vi) and (viii), or the aqueous liquid (ix). [0240] 46. Kit according to any one of 39-45, wherein an accelerator for setting of the calcium phosphate (viii) is pre-mixed with the calcium phosphate powder (ii), the calcium sulphate hemihydrate powder (i), the basis powder (x), one or more of the active additives (iv)-(vii), or the aqueous liquid (ix). [0241] 47. Kit according to any one of 39-46, further comprising: [0242] a. mixing and/or injection devices, and/or [0243] b. instructions for use. [0244] 48. Kit according to any one of 39-47, further comprising a biodegradable synthetic membrane or a collagen membrane. [0245] 49. Kit according to any one of 39-48, for use in the treatment of a disorder of supportive tissue in a human or non-human subject by generating lost bone tissue. [0246] 50. Biphasic ceramic bone substitute according to any one of 1-16, biphasic ceramic bone substitute powder according to any one of 17-34, biphasic ceramic bone substitute paste according to any one of 35-38 and kit according to any one of 39-49, wherein one or more of the additive is/are provided as encapsulated individually or in any combination(s) in water-soluble and/or biodegradable synthetic polymeric microcapsules, bovine collagen particles, starch particles, dihydrate nidation particles, or the like. [0247] 51. Method of treating a patient with a bone defect, such as loss of bone due to, i.a. trauma, eradication of infection, resection of tumor lesions, delayed or nonunions and in primary or revision arthroplasties, comprising inserting one or more biphasic ceramic bone substitutes (grafts) according to any one of 1-16 or a hardenable biphasic ceramic bone substitute paste according to any one of 35-38 at the place of removed bone. [0248] 52. Method according to 51, wherein the bone is selected from bones of the animal or human body, including the spinal cord, bones of the hands, fingers, arms, feet, toes, lower or upper leg, knee, hip, ankle, elbow, wrist, shoulder, skull, jaw and teeth. [0249] 53. Method according to 51 or 52, wherein the insertion of a biphasic ceramic bone substitute (e.g. paste) follows after removal of bone, e.g. removal of broken bone, bone tumor or infected bone tissue. [0250] 54. Method according to any one of 51-53, wherein the insertion of a biphasic ceramic bone substitute or paste (which has hardened in vivo) is followed by a repositioning or grafting of muscle and/or skin tissue. [0251] 55. Method according to any one of 51-54, wherein the insertion of a biphasic ceramic bone substitute (e.g. paste) is delimited to the neighboring tissue and/or to the surroundings outside the body in an open wound by use of an artificial, porous or semi-porous, polymeric membrane.