Complex chromosome engineering for production of human antibodies in transgenic animals
09902970 ยท 2018-02-27
Assignee
Inventors
- Yoshimi Kuroiwa (La Jolla, CA, US)
- Hiroaki Matsushita (Sioux Falls, SD, US)
- Akiko Sano (Kanagawa pref, JP)
Cpc classification
C07K16/462
CHEMISTRY; METALLURGY
A01K2267/01
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
A01K67/0278
HUMAN NECESSITIES
A01K2217/072
HUMAN NECESSITIES
International classification
Abstract
The invention relates to large-scale production of human antibodies by transgenic animals with high production of fully human IgG up to >10 g/L in sera with human IgG1 subclass dominancy. This invention also supports a feasibility of complex chromosome engineering for complicated genetic studies in non-murine mammalian species.
Claims
1. A human artificial chromosome (HAC) vector comprising one or more human immunoglobulin heavy and light chain loci that are capable of undergoing rearrangement and expression in B-cells to produce a human immunoglobulin in response to exposure to one or more antigens, wherein said immunoglobulin loci comprise: (a) a gene encoding one or more human antibody heavy chains comprising at least a human IgG heavy chain, a human IgA heavy chain or both human IgG and IgA heavy chains, wherein each gene encoding an antibody heavy chain is operatively linked to its own class switch regulatory element upstream of the human antibody heavy chain; (b) a gene encoding one or more human antibody light chains; and (c) a gene encoding a human-ungulate chimeric IgM heavy chain constant region encoding constant heavy (CH) domains CH1, CH2, CH3 and CH4, and transmembrane domains (TM) TM1 and TM2, wherein the encoded CH1, CH2, and CH3 domains are human, and the encoded CH4, TM1 and TM2 domains are ungulate; wherein at least one class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate class switch regulatory element selected from the group consisting of Imu-Smu (I-S), Igamma-Sgamma (I-S), Ialpha-Salpha (I-S), and Iepsilon-Sepsilon (I-S) ungulate class switch regulatory elements.
2. The HAC of claim 1, wherein the gene encoding the one or more human antibody heavy chains is a human IgG antibody heavy chain.
3. The HAC vector of claim 2, wherein the IgG heavy chain is an IgG1 antibody heavy chain.
4. The HAC vector of claim 1, wherein the gene encoding the one or more human antibody heavy chains is a human IgA antibody heavy chain.
5. The HAC vector of claim 1, wherein the gene encoding the one or more human antibody heavy chains further comprises a human IgM antibody heavy chain.
6. The HAC vector of claim 1, wherein the one or more human antibody heavy chains is selected from the group consisting of IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2.
7. The HAC vector of claim 1, wherein the gene encoding the human-ungulate chimeric IgM heavy chain constant region is further modified so that: (a) the encoded CH1 domain is a human-ungulate chimeric CH1 domain, and the encoded CH2, CH3, CH4, and TM1 and TM2 domains are ungulate; or (b) the encoded CH1 domain is human, the encoded CH2 domain is a human-ungulate chimeric CH2 domain, and the encoded CH3, CH4, and TM1 and TM2 domains are ungulate.
8. The HAC vector of claim 7, wherein the encoded CH2, CH3, CH4, and TM1 and TM2 ungulate domains are bovine, the human-ungulate chimeric CH1 domain is a human-bovine chimeric CH1 domain and the human-ungulate chimeric CH2 domain is a human-bovine chimeric CH2 domain.
9. The HAC of claim 1, wherein the one or more human antibody heavy chains comprises a human IgG antibody heavy chain, wherein a transmembrane domain and an intracellular domain of a constant region of the human IgG heavy antibody chain are replaced with a transmembrane domain and an intracellular domain of an ungulate IgG antibody heavy chain constant region.
10. The HAC vector of claim 9, wherein the human IgG antibody heavy chain is a human IgG1 antibody heavy chain.
11. The HAC vector of claim 9, wherein the ungulate IgG antibody heavy chain constant region is a bovine IgG antibody heavy chain constant region.
12. The HAC vector of claim 1, wherein the ungulate class switch regulatory element is an Igamma-Sgamma (I-S) class switch regulatory element.
13. The HAC vector of claim 12, wherein the I-S class switch regulatory element is an Igamma1-Sgamma1 (I.sub.1-S.sub.1).
14. The HAC vector of claim 1, wherein each class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate class switch regulatory element.
15. The HAC vector of claim 1, wherein the ungulate class switch regulatory element(s) are bovine class switch regulatory elements.
16. The HAC vector of claim 1, wherein the HAC vector comprises one or more genes encoding a human antibody surrogate light chain selected from the group consisting of pre-B lymphocyte 1 (VpreB1), pre-B lymphocyte 3(VpreB3) and lambda 5 (5) human antibody surrogate light chains.
17. The HAC vector of claim 1, further comprising an ungulate enhancer operatively linked to one or more genes encoding the one or more human antibody heavy chains.
18. The HAC vector of claim 17, wherein the enhancer is a 3enhancer alpha (3Ea enhancer).
19. A transgenic ungulate comprising the HAC vector of claim 1.
20. The transgenic ungulate of claim 19, wherein the transgenic ungulate is a transgenic bovine.
21. The HAC vector of claim 1, wherein the gene encoding the one or more human antibody light chains encodes at least a human kappa () light chain, a human lambda () light chain or both human kappa and lambda light chains.
22. The HAC vector of claim 6, further comprising one or more human antibody IgE and IgD human antibody heavy chains.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
DETAILED DESCRIPTION OF THE INVENTION
(32) All references cited are herein incorporated by reference in their entirety. Within this application, unless otherwise stated, the techniques utilized may be found in any of several well-known references such as: Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.), Guide to Protein Purification in Methods in Enzymology (M. P. Deutshcer, ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), Culture of Animal Cells: A Manual of Basic Technique, 2.sup.nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion 1998 Catalog (Ambion, Austin, Tex.).
(33) As used herein, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise. And as used herein is interchangeably used with or unless expressly stated otherwise.
(34) All embodiments of any aspect of the invention can be used in combination, unless the context clearly dictates otherwise.
(35) Unless the context clearly requires otherwise, throughout the description and the claims, the words comprise, comprising, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of including, but not limited to. Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words herein, above, below, and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application.
(36) The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize.
(37) In a first aspect, the invention provides a human artificial chromosome (HAC) vector comprising genes encoding:
(38) (a) one or more human antibody heavy chains, wherein each gene encoding an antibody heavy chain is operatively linked to a class switch regulatory element;
(39) (b) one or more human antibody light chains; and
(40) (c) one or more human antibody surrogate light chains, and/or an ungulate-derived IgM heavy chain constant region;
(41) wherein at least one class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate-derived class switch regulatory element.
(42) The HAC vectors of the invention can be used, for example, for large-scale production of fully human antibodies by transgenic animals, as described for the methods of the invention. As shown in the examples that follow, the HAC vectors can be used to produce unexpectedly high levels of antigen-specific polyclonal antibodies in ungulates, relative to previous HACs.
(43) In the present invention, the term HAC vector means a vector which comprises at least a human chromosome-derived centromere sequence, a telomere sequence, and a replication origin, and may contain any other sequences as desired for a given application. When present in a host cell, the HAC vector exists independently from a host cell chromosome the nucleus. Any suitable methods can be used to prepare HAC vectors and to insert nucleic acids of interest into the HAC, including but not limited to those described in the examples that follow. The HAC vector is a double stranded DNA vector, as is known to those of skill in the art.
(44) The HAC vector of the present invention comprises one or more genes encoding a human antibody heavy chain. Any human antibody heavy chain or combinations of human antibody heavy chains in combination may be encoded by one or more nucleic acids on the HAC. In various embodiments, 1, 2, 3, 4, 5, 6, 7, 8, or all 9 of human antibody heavy chains IgM, IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgE and IgD may be encoded on the HAC in one or more copies. In one embodiment, the HAC comprises a human IgM antibody heavy chain encoding gene, alone or in combinations with 1, 2, 3, 4, 5, 6, 7, or the other 8 human antibody chain encoding genes. In one preferred embodiment, the HAC comprises a gene encoding at least a human IgG1 antibody heavy chain; in this embodiment, it is further preferred that the HAC comprises a gene encoding a human IgM antibody heavy chain or a gene encoding a human IgM antibody heavy chain that has been chimerized to encode an ungulate-derived IgM heavy chain constant region (such as a bovine heavy chain constant region). In another embodiment, the HAC comprises a gene encoding at least a human IgA antibody heavy chain; in this embodiment, it is further preferred that the HAC comprises a gene encoding a human IgM antibody heavy chain or a gene encoding a human IgM antibody heavy chain that has been chimerized to encode an ungulate-derived IgM heavy chain constant region (such as a bovine heavy chain constant region). In another preferred embodiment, the HAC comprises genes encoding all 9 antibody heavy chains, and more preferably where the gene encoding a human IgM antibody heavy chain has been chimerized to encode an ungulate-derived IgM heavy chain constant region. In another embodiment, the HAC may comprise a portion of human chromosome 14 that encodes the human antibody heavy chains. The variable region genes and the constant region genes of the human antibody heavy chain form a cluster and the human heavy chain locus is positioned at 14q32 on human chromosome 14. In one embodiment, the region of human chromosome 14 inserted in the HAC comprises the variable region and the constant region of the human antibody heavy chains from the 14q32 region of human chromosome 14.
(45) In the HAC vectors of the present invention, at least one class switch regulatory element of the human antibody heavy chain encoding nucleic acid is replaced with an ungulate-derived class switch regulatory element. The class switch regulatory element refers to nucleic acid which is 5 to an antibody heavy chain constant region. Each heavy chain constant region gene is operatively linked with (i.e.: under control of) its own switch region, which is also associated with its own I-exons. Class switch regulatory elements regulate class switch recombination and determine Ig heavy chain isotype. Germline transcription of each heavy chain isotype is driven by the promoter/enhancer elements located just 5 of the I-exons and those elements are cytokine or other activator-responsive. In a simple model of class switch, the specific activators and/or cytokines induce each heavy chain isotype germline transcription from its class switch regulatory element (i.e., activator/cytokine-responsive promoter and/or enhancer). Class switch is preceded by transcription of I-exons from each Ig heavy (IGH) locus-associated switch region. As each heavy chain constant region gene is linked with its own switch region.
(46) Any suitable ungulate-derived class switch regulatory element can be used. As used herein, ungulates may be any suitable ungulate, including but not limited to bovine, pig, horse, donkey, zebra, deer, oxen, goats, sheep, and antelope. For example, the human heavy chain gene isotypes listed below has the following class switch regulatory elements:
(47) IgM: I-S,
(48) IgG1: I1-S1,
(49) IgG2: I2-S2,
(50) IgG3: I3-S3,
(51) IgG4: I4-S4,
(52) IgA1: I1-S1,
(53) IgA2: I2-S2, and
(54) IgE: I-S.
(55) In various embodiments, 1, more than 1, or all of the human antibody heavy chain genes on the HAC have their class switch regulatory element replaced with an ungulate-derived class switch regulatory element, including but not limited to ungulate I-S, I-S, I-S, or I-S, class switch regulatory elements. In one embodiment, an I1-S1 human class switch regulatory element for human IgG1 heavy chain encoding nucleic acid on the HAC (such as that in SEQ ID NO: 183) is replaced with an ungulate I1-S1 class switch regulatory element. Exemplary ungulate I1-S1 class regulatory switch elements include a bovine IgG1 I1-S1 class switch regulatory element (SEQ ID NO: 182), a horse I1-S1 class switch regulatory element (SEQ ID NO: 185), and a pig I1-S1 class switch regulatory element (SEQ ID: 186). However, it is not necessary to replace the human class switch regulatory element with an ungulate class switch regulatory element from the corresponding heavy chain isotype. Thus, for example, an I3-S.sub.3 human class switch regulatory element for human IgG3 heavy chain encoding nucleic acid on the HAC can be replaced with an ungulate I1-S1 class switch regulatory element. As will be apparent to those of skill in the art based on the teachings herein, any such combination can be used in the HACs of the invention.
(56) In another embodiment, the HAC comprises at least one ungulate enhancer element to replace an enhancer element associated with one or more human antibody heavy chain constant region encoding nucleic acids on the HAC. There are two 3 enhancer regions (Alpha 1 and Alpha 2) associated with human antibody heavy chain genes. Enhancer elements are 3 to the heavy chain constant region and also help regulate class switch. Any suitable ungulate enhancer can be used, including but not limited to 3E enhancers. Non-limiting examples of 3 E enhancers that can be used include 3E, 3E1, and 3E2. Exemplary 3E enhancer elements from bovine that can be used in the HACs and replace the human enhancer include, but are not limited to bovine HS3 enhancer (SEQ ID NO: 190), bovine HS12 enhancer (SEQ ID NO: 191), and bovine enhancer HS4. This embodiment is particularly preferred in embodiments wherein the HAC comprises the variable region and the constant region of the human antibody heavy chains from the 14q32 region of human chromosome 14.
(57) The HAC vectors of the present invention may comprise one or more genes encoding a human antibody light chain. Any suitable human antibody light chain-encoding genes can be used in the HAC vectors of the invention. The human antibody light chain includes two types of genes, i.e., the kappa/K chain gene and the lambda/chain gene. In one embodiment, the HAC comprises genes encoding both kappa and lambda, in one or more copies. The variable region and constant region of the kappa chain are positioned at 2p11.2-2p12 of the human chromosome 2, and the lambda chain forms a cluster positioned at 22q11.2 of the human chromosome 22. Therefore, in one embodiment, the HAC vectors of the invention comprise a human chromosome 2 fragment containing the kappa chain gene cluster of the 2p11.2-2p12 region. In another embodiment, the HAC vectors of the present invention comprise a human chromosome 22 fragment containing the lambda chain gene cluster of the 22q11.2 region.
(58) In another embodiment, the HAC vector comprises at least one gene encoding a human antibody surrogate light chain. The gene encoding a human antibody surrogate light chain refers to a gene encoding an imaginary antibody light chain which is associated with an antibody heavy chain produced by a gene reconstitution in the human pro-B cell to constitute the pre-B cell receptor (preBCR). Any suitable human antibody surrogate light chain encoding gene can be used, including but not limited to the VpreB1 (SEQ ID NO: 154), VpreB3 (SEQ ID NO: 178) and 5 (also known as IgLL1, SEQ ID NO: 157) human antibody surrogate light chains, and combinations thereof. The VpreB gene and the 5 gene are positioned within the human antibody lambda chain gene locus at 22q11.2 of the human chromosome 22. Therefore, in one embodiment the HAC may comprise the 22q11.2 region of human chromosome 22 containing the VpreB gene and the 5 gene. The human VpreB gene of the present invention provides either or both of the VpreB1 gene (SEQ ID NO: 154) and the VpreB3 (SEQ ID NO: 178) gene and in one embodiment provides both of the VpreB1 gene and the VpreB3 gene.
(59) In yet another embodiment, the HAC vector comprises a gene encoding an ungulate-derived IgM heavy chain constant region. In this embodiment, the IgM heavy chain constant region is expressed as a chimera with the human IgM antibody heavy chain variable region. Any suitable ungulate IgM heavy chain antibody constant region encoding nucleic acid can be used, including but not limited to bovine IgM, (SEQ ID NO: 152), horse IgM, (SEQ ID NO: 176), sheep IgM, (SEQ ID NO: 174), and pig IgM, (SEQ ID NO: 175). In one embodiment, the chimeric IgM comprises the sequence in SEQ ID NO: 200. Pre-BCR/BCR signaling through the IgM heavy chain molecule promotes proliferation and development of the B cell by interacting with the B cell membrane molecule Ig-alpha/Ig-beta to cause a signal transduction in cells. Transmembrane region and/or other constant region of IgM are considered to have important roles in the interaction with Ig-alpha/Ig-beta for signal transduction. Examples of the IgM heavy chain constant regions include nucleic acids encoding constant region domains such as CH1, CH2, CH3, and CH4, and the B-cell transmembrane and cytoplasmic domains such as TM1 and TM2. The nucleic acid encoding an ungulate-derived IgM heavy chain constant region which is comprised in the human artificial chromosome vector of the invention is not particularly limited so long as the region is in a range which may sufficiently induce the signal of the B-cell receptor or B-cell proliferation/development in the above-described IgM heavy chain constant region. In one embodiment, the nucleic acid encoding an ungulate-derived IgM heavy chain constant region provides a transmembrane and cytoplasmic TM1 domain and TM2 domain derived from an ungulate, and in other embodiments encodes the ungulate-derived CH2 domain, CH3 domain, CH4 domain, TM1 domain, and TM2 domain or the ungulate-derived CH1 domain, CH2 domain, CH3 domain, CH4 domain, TM1 domain, and TM2 domain.
(60) In one embodiment, the gene encoding the IgM heavy chain constant region of the bovine is a gene encoding a bovine IgM heavy chain constant region which is included in an IGHM region at which a bovine endogenous IgM heavy chain gene is positioned (derived from IGHM) or a gene encoding a bovine IgM heavy chain constant region in an IGHML1 region (derived from IGHML1). In another embodiment, the gene encoding a bovine IgM heavy chain constant region is included in the IGHM region.
(61) In a further embodiment, the HAC comprises a gene encoding a human antibody heavy chain comprises a gene encoding a human heavy chain (for example, a human IgG heavy chain, such as an IgG1 heavy chain), and wherein a transmembrane domain and an intracellular domain of a constant region of the human heavy chain gene are replaced with a transmembrane domain and an intracellular domain of an ungulate-derived heavy chain (for example, an ungulate IgG heavy chain, such as an IgG1 heavy chain), constant region gene. In one embodiment, gene encoding the transmembrane domain and the intracellular domain of an ungulate-derived (such as bovine) IgG (such as IgG1) heavy chain constant region are used to replace the corresponding regions of the human IgG heavy chain gene. In another embodiment, the gene encoding the TM1 and TM2 domains of an ungulate-derived (such as bovine) IgG (such as IgG1) heavy chain constant region are used to replace the corresponding regions of the human IgG heavy chain gene. In another embodiment, the gene encoding the one or more of the CH1-CH4 domains and/or the TM1 and TM2 domains of an ungulate-derived (such as bovine) IgG (such as IgG1) heavy chain constant region are used to replace the corresponding regions of the human IgG heavy chain gene.
(62) In a second aspect, the invention provides transgenic ungulates comprising a HAC vector according to any embodiment or combination of embodiments of the first aspect of the invention. The transgenic ungulate comprising the HAC vector of the present invention refers to an animal into which the human artificial chromosome vector of the present invention is introduced. The transgenic ungulate having the HAC of the present invention is not particularly limited so long as the animal is a transgenic ungulate in which the human artificial chromosome fragment may be introduced into a cell thereof, and any non-human animals, for example, ungulates such as cows, horses, goats, sheep, and pigs; and the like may be used. In one aspect, the transgenic ungulate is a bovine. A transgenic ungulate having the HAC vector of the present invention may be constructed, for example, by introducing the HAC vector of the present invention into an oocyte of a host animal using any suitable technique, such as those described herein. The HAC vector of the present invention may, for example, be introduced into a somatic cell derived from a host ungulate by a microcell fusion method. Thereafter, the animal having the HAC vector may be constructed by transplanting a nucleus or chromatin agglomerate of the cell into an oocyte and transplanting the oocyte or an embryo to be formed from the oocyte into the uterus of a host animal to give birth. It may be confirmed by a method of Kuroiwa et al. (Kuroiwa et al., Nature Biotechnology, 18, 1086-1090, 2000 and Kuroiwa et al., Nature Biotechnology, 20, 889-894) whether an animal constructed by the above method has the human artificial chromosome vector of the present invention.
(63) In a third aspect, the invention provides transgenic ungulates comprising genes integrated into its genome encoding: (a) one or more human antibody heavy chains, wherein each gene encoding an antibody heavy chain is operatively linked to a class switch regulatory element; (b) one or more human antibody light chains; and (c) one or more human antibody surrogate light chains, and/or an ungulate-derived IgM heavy chain constant region;
(64) wherein at least one class switch regulatory element of the genes encoding the one or more human antibody heavy chains is replaced with an ungulate-derived class switch regulatory element.
(65) In this third aspect, the transgenic ungulate may comprise any embodiment or combination of embodiments of the nucleic acids as described herein for the HAC, but rather than being present in a HAC, they are integrated into a chromosome of the ungulate.
(66) In a fourth aspect, the invention provides a method of producing a human antibody, comprising: (a) administering a target antigen to the transgenic ungulate of any embodiment or combination of embodiments of the invention to produce and accumulate human antibody specific to the target antigen in the serum or plasma of the ungulate; and (b) recovering the human antibody specific to the target antigen from the serum or plasma of the ungulate. In one embodiment, recovering the antibody comprises: (i) isolating lymphocytes from the transgenic ungulate; (ii) generating a human monoclonal antibody producing hybridoma from the lymphocytes; and (iii) recovering human monoclonal antibody specific to the target antigen from the hybridoma. In another embodiment, the lymphocytes from the transgenic ungulate are isolated from lymph nodes of the transgenic ungulate. In a further embodiment the transgenic ungulate is hyperimmunized with the target antigen.
(67) A target antigen-specific human antibody may be produced by immunizing the transgenic ungulate having the HAC vector of the present invention with a desired target antigen to produce the target antigen-specific human antibody in the serum of the transgenic ungulate and recovering the target antigen-specific human antibody from the serum of the transgenic ungulate. The target antigens for immunizing the transgenic ungulate having the HAC vector of the present invention are not particularly limited and examples include a tumor-associated antigen, an antigen associated with allergy or inflammation, an antigen associated with cardiovascular disease, an antigen associated with autoimmune disease, an antigen associated with neurodegenerative disease, and an antigen associated with viral or bacterial infections.
(68) Examples of tumor-associated antigens include CD1a, CD2, CD3, CD4, CD5, CD6, CD7, CD9, CD10, CD13, CD19, CD20, CD21, CD22, CD25, CD28, CD30, CD32, CD33, CD38, CD40, CD40 ligand (CD40L), CD44, CD45, CD46, CD47, CD52, CD54, CD55, CD55, CD59, CD63, CD64, CD66b, CD69, CD70, CD74, CD80, CD89, CD95, CD98, CD105, CD134, CD137, CD138, CD147, CD158, CD160, CD162, CD164, CD200, CD227, adrenomedullin, angiopoietin related protein 4 (ARP4), aurora, B7-H1, B7-DC, integlin, bone marrow stromal antigen 2 (BST2), CA125, CA19.9, carbonic anhydrase 9 (CA9), cadherin, cc-chemokine receptor (CCR) 4, CCR7, carcinoembryonic antigen (CEA), cysteine-rich fibroblast growth factor receptor-1 (CFR-1), c-Met, c-Myc, collagen, CTA, connective tissue growth factor (CTGF), CTLA-4, cytokeratin-18, DF3, E-catherin, epidermal growth facter receptor (EGFR), EGFRvIII, EGFR2 (HER2), EGFR3 (HERS), EGFR4 (HER4), endoglin, epithelial cell adhesion molecule (EpCAM), endothelial protein C receptor (EPCR), ephrin, ephrin receptor (Eph), EphA2, endotheliase-2 (ET2), FAM3D, fibroblast activating protein (FAP), Fc receptor homolog 1 (FcRH1), ferritin, fibroblast growth factor-8 (FGF-8), FGF8 receptor, basic FGF (bFGF), bFGF receptor, FGF receptor (FGFR)3, FGFR4, FLT1, FLT3, folate receptor, Frizzled homologue 10 (FZD10), frizzled receptor 4 (FZD-4), G250, G-CSF receptor, ganglioside (GD2, GD3, GM2, GM3, and the like), globo H, gp75, gp88, GPR-9-6, heparanase I, hepatocyte growth factor (HGF), HGF receptor, HLA antigen (HLA-DR, and the like), HM1.24, human milk fat globule (HMFG), hRS7, heat shock protein 90 (hsp90), idiotype epitope, insulin-like growth factor (IGF), IGF receptor (IGFR), interleukin (IL-6, IL-15, and the like), interleukin receptor (IL-6R, IL-15R, and the like), integrin, immune receptor translocation associated-4 (IRTA-4), kallikrein 1, KDR, KIR2DL1, KIR2DL2/3, KS1/4, lamp-1, lamp-2, laminin-5, Lewis y, sialyl Lewis x, lymphotoxin-beta receptor (LTBR), LUNX, melanoma-associated chondroitin sulfate proteoglycan (MCSP), mesothelin, MICA, Mullerian inhibiting substance type II receptor (MISIIR), mucin, neural cell adhesion molecule (NCAM), Nec1-5, Notch1, osteopontin, platelet-derived growth factor (PDGF), PDGF receptor, platelet factor-4 (PF-4), phosphatidylserine, Prostate Specific Antigen (PSA), prostate stem cell antigen (PSCA), prostate specific membrane antigen (PSMA), Parathyroid hormone related protein/peptide (PTHrP), receptor activator of NF-kappaB ligand (RANKL), receptor for hyaluronic acid mediated motility (RHAMM), ROBO1, SART3, semaphorin 4B (SEMA4B), secretory leukocyte protease inhibitor (SLPI), SM5-1, sphingosine-1-phosphate, tumor-associated glycoprotein-72 (TAG-72), transferrin receptor (TfR), TGF-beta, Thy-1, Tie-1, Tie2 receptor, T cell immunoglobulin domain and mucin domain 1 (TIM-1), human tissue factor (hTF), Tn antigen, tumor necrosis factor (TNF), Thomsen-Friedenreich antigen (TF antigen), TNF receptor, tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), TRAIL receptor (DR4, DRS, and the like), system ASC amino acid transporter 2 (ASCT2), trkC, TROP-2, TWEAK receptor Fn14, type IV collagenase, urokinase receptor, vascular endothelial growth factor (VEGF), VEGF receptor (VEGFR1, VEGFR2, VEGFR3, and the like), vimentin, VLA-4, and the like.
(69) Examples of antigens associated with allergy or flare include IL-6, IL-6R, IL-5, IL-5R, IL-4, IL-4R, TNF, TNF receptor, CCR4, chemokine, chemokine receptor, and the like. Examples of antigens associated with cardiovascular disease include GPIIb/IIIa, PDGF, PDGF receptor, blood coagulation factor, IgE, and the like. Examples of antigens associated with viral or bacterial infections include gp120, CD4, CCR5, a verotoxin, an anthrax protective antigen, a methicillin-resistant Staphylococcus aureus (MRSA) antigen, a hepatitis type B virus (HBV) antigen, a cytomegalovirus (CMV) antigen, a Rabies antigen, a Varicella zoster antigen, and the like. Other examples thereof include a T cell surface membrane protein mixtures, a Rh (D) antigen, crotalid venom, digoxin, and the like.
(70) The immunization is carried out by administering the target antigen with, for example, a complete Freund's adjuvant or an appropriate adjuvant such as an aluminum hydroxide gel, and pertussis bacteria vaccine, subcutaneously, intravenously, or intraperitoneally into a transgenic ungulate. In one embodiment, the immunization comprises hyper-immunization, which refers to immunization that goes beyond just giving the animals protective titers to an antigen. For example, if a protective titer is 1:120, we may hyperimmunize an animal to 1:10,240 so that these titers may be diluted in the production of a biotherapeutic in order to give protective titers in a passive transfer of immunity. Examples of the form of administering the target antigen into an transgenic ungulate having the HAC vector of the present invention include peptides, protein, bacteria, viruses, cells, biological tissue pieces, and the like. When the target antigen is a partial peptide, a conjugate is produced with a carrier protein such as bovine serum albumin (BSA), keyhole Limpet hemocyanin (KLH) or the like, and is used as the immunogen. The target antigen is administered once to 10 times every 1 to 4 weeks after the first administration. After 1 to 14 days from each administration, blood is collected from the animal to measure the antibody value of the serum.
(71) Examples of the method for detecting and measuring the target antigen-specific human antibody included in the serum include a binding assay by an enzyme-linked immunosorbent assay, and the like. The binding amount of a human antibody in the serum may be measured by incubating the serum comprising the human antibody with antigen expressing cells, and then using an antibody specifically recognizing a human antibody.
(72) Further, in addition to these methods, the antibody may be selected by identifying a target antigen of the antibody according to a method known in the art. Examples of the method for recovering human antibodies from the serum include a method of purifying by adsorbing the human antibody on a protein A carrier, a protein G carrier, or a carrier on which the human immunoglobulin specific antibody is supported. Methods used in purification of proteins, such as gel filtration, ion exchange chromatography, and ultrafiltration, may be combined.
(73) A human antibody produced by the above method may be a polyclonal antibody or a monoclonal antibody. Methods of preparing and utilizing various types of antibodies are well-known to those of skill in the art and would be suitable in practicing the present invention (see, for example, Harlow, et al. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; Kohler and Milstein, Nature, 256:495 (1975)). An example of a preparation method for hybridomas comprises the following steps of: (1) immunizing a transgenic ungulate with a target antigen; (2) collecting antibody-producing cells from the transgenic ungulate (i.e. from lymph nodes); (3) fusing the antibody-producing cells with myeloma cells; (4) selecting hybridomas that produce a monoclonal antibody reacting target antigen from the fused cells obtained in the above step; and (5) selecting a hybridoma that produces a monoclonal antibody reacting with target antigen from the selected hybridomas.
EXAMPLES
Methods
(74) All animal procedures were performed in compliance with Hematech's guidelines, and protocols were approved by the Institutional Animal Care and Use Committee.
(75) Genomic Library.
(76) Genomic DNA was extracted either from CHO cells containing the HAC vector (C1-1) or the bovine fibroblast cell lines, 6939 and 3427, to construct the HAC or bovine genomic libraries, respectively. Each phage-based genomic library was constructed using FIX II vector through a custom library construction service (Lofstrand Labs Ltd.). Library screening and phage DNA extraction/purification was done as described previously.sup.5. The bovine genomic BAC library (CHORI-240) was purchased from Children's Hospital Oakland Research Institute and screening was performed, according to their instruction.
(77) Construction of Targeting Vectors.
(78) Each vector construction was performed as previously described.sup.5, 12, 20, 21 with some modification as described below. pTELhisDpuro.sup.lox2272F9R9; a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, kD-F9 and kD-R9, in 40 cycles of 98 C. for 10 s and 68 C. for 9 min. This PCR product was subcloned into Bam HI site of a plasmid pTELhisDpuro.sup.lox2272, which was constructed as follows. The modified lox2272-containing oligo DNAs (Oligo DNA pair 1; see Table 1 below) were, after annealing, cloned into Hin dIII site of a plasmid pPUR (BD Bioscience Clontech), generating a plasmid pPUR.sup.lox2272. On the other hand, another plasmid pTELhisDPm was constructed by modifying the previous plasmid pTELpuro, where the puro gene was replaced with hisD gene, Eco RI site was replaced with Srf I and Spe I site was converted to Pme I site. The Bam HI fragment from the pPUR.sup.lox2272 was then cloned, after blunting, to Pme I site of the pTELhisDPm, which generated pTELhisDpuro.sup.lox2272F9R9.
(79) pTELCAGzeoSLF2R2;
(80) the plasmid pTELpuro was further modified by converting the Eco RI site to Srf I and then to Pme I and by replacing the puro gene to CAGzeo gene {pTELCAGzeo(Sr)Pm}. On the other hand, a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, SL-F2 and SL-R2, in 40 cycles of 98 C. for 10 s and 68 C. for 9 min. This PCR product was subcloned into Bam HI site of the plasmid pTELCAGzeo(Sr)Pm, which generated pTELCAGzeoSLF2R2.
(81) p553CAG.sup.lox2272BsrDT;
(82) The previous targeting vector pHCF2loxPHyg was modified where the homology arm sequence of the HCF2 gene was replaced with that of the AP000553, which was amplified by using a PCR primer pair, 553-F3 and 553-R3, in 40 cycles of 98 C. for 10 seconds and 68 C. for 15 min, generating p553loxPHyg(F). This plasmid was Not I-digested and self-ligated, followed by cloning of DT-A fragment into Srf I site. On the other hand, pDRIVE-CAG (InvivoGen) was modified as below. The lacZ fragment (Bsr GI-Eco RI) was replaced with the loxP-containing oligo DNAs (Oligo DNA pair 2; see Table 1 below) after annealing and then Sda I-Swa I fragment was cloned into Pst I/Sma I-digested pBluescript SK(Stratagene), generating pCAG.sup.loxP. The loxP sequence was further replaced with the lox2272-containing sequence that was generated after annealing two oligo DNAs (Oligo DNA pair 3; see Table 1 below). And then, the bsr gene was added to Spe I site, generating pcAG.sup.loxP2272bsr. Finally, the Not I-Kpn I fragment (CAG-lox2272-polyA-bsr) was cloned into the Not I site to complete p553CAG.sup.lox2272BsrDT.
(83) pSC355CAG.sup.lox511hisDDT; a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, SC355-F3 and SC355-R3, in 40 cycles of 98 C. for 10 seconds and 68 C. for 15 min. This PCR product was subcloned into Spe I site of a plasmid pBluescript where the Kpn I site was converted to Srf I site, generating pSC355F3R3. The pCAG.sup.loxP plasmid was similarly modified where the loxP sequence was further replaced with the lox511-containing sequence that was generated after annealing two oligo DNAs (Oligo DNA pair 4; see Table 1 below). And then, the hisD gene was added to Spe I site, generating pCAG.sup.lox511hisD. The Not I-Kpn I fragment (CAG-lox511-polyA-hisD) was cloned into the Eco RV site of pSC355F3R3. Finally, the DT-A cassette was subcloned into Not I to complete pSC355CAG.sup.lox511hisDDT.
(84) p14CEN(FR)hygpuro.sup.lox511DT;
(85) a genomic DNA fragment for a homologous arm was amplified by using a PCR primer pair, 14CEN-F and 14CEN-R, in 40 cycles of 98 C. for 10 seconds and 68 C. for 15 min. This PCR product was subcloned into Bam HI site of a plasmid pBluescript where the Kpn I site was converted to Pme I site, generating p14CEN(FR). The modified lox511-containing oligoDNAs (Oligo DNA pair 5; see Table 1 below) were, after annealing, cloned into Hind III site of a plasmid pPUR (BD Bioscience Clontech), generating a plasmid pPUR.sup.lox511. The Bam HI fragment from the pPUR.sup.lox511 was cloned to Bam HI site of pBluescript SK (Stratagene), followed by cloning of the hyg gene to Eco RV, generating pHygPuro.sup.lox511. The Not I-Kpn I fragment (puro-lox511-hyg) was cloned into the Hpa I site of p14CEN(FR). Finally, the DT-A cassette was subcloned into Pme I to complete p14CEN(FR)hygpuro.sup.lox511DT.
(86) pRNR2.sup.loxPbsrDT;
(87) the previous vector pRNR2.sup.loxPbsr (Ref 20) was modified to construct the pRNR2.sup.loxPbsrDT by simply adding the DT-A cassette.
(88) pCH1CAGzeo(R)DT(F);
(89) a genomic phage library was constructed from CHO cells containing the HAC using FIX II vector through a custom library construction service (Lofstrand). The genomic library was screened for hIGHM constant region by using a probe that was a PCR product by amplified a PCR pair, hC-FR, and then clones #1, #4 and #7 were isolated. From the clone #4, 1.7 kb of Pml I fragment was subcloned into Sma I site of pBluescript, generating pCH1S (F). 1 kb of Sac I-Pml I fragment from the plasmid pBCAY37-95 where Sal I-bovine IGHM genomic fragment was cloned into pBluescript was subcloned into Pst I site of the pCH1S (F), generating pCH1SSP (F). 7.4 kb of the Sma I-Eco RI fragment from the above clone #1 was cloned into Eco RV/Eco RI-digested pCH1SSP (F), generating pCH1SL. On the other hand, from the plasmid pBCAY37-95, 3.5 kb of Sac I fragment was subcloned into pBluescript and then the Xho I fragment of floxed CAGzeo {CAGzeo fragment was subcloned into Eco RV site of pBS246 (Gibco)} was cloned into Van91 I site, generating pmAYSazeo (F). The Sac I fragment from the pmAYSazeo (F) was further subcloned into blunted Eco RI site of pCH1SL, generating pCH1zeo (F). As a final step, the DT-A cassette was subcloned into Not I site of the pCH1zeo (F) to complete the pCH1CAGzeo(R)DT(F).
(90) pCH2CAGzeoDT;
(91) an annealed oligo DNA pair, SeSp, was cloned into blunted Pst I site of pBluescript. From the pBCAY37-95, 2 kb of Sph I-Bam HI fragment was subcloned into Sph I-Bam HI site, generating pmAYSpB. Similarly, 2 kb of Bam HI-Pml I fragment from the pBCAY37-95 was subcloned into Bam HI-Pme I site (converting the original Spe I site), generating pmAYSpBPml. 0.6 kb of Eco RI-Sex AI fragment from the above clone #1 was subcloned into Eco RI-Sex AI site of the pmAYSpBPml, generating pRISe. Then, the floxed CAGzeo was subcloned into Van91 I site of the pRISe, generating pRISeCAGzeo (R), of which Not I site was converted to Eco RI site, generating pRISeCAGzeoE. Meanwhile, 1.7 kb of Pml I fragment from the above clone #4 was subcloned into Sma I site of pBluescript of which Eco RV site was converted to Mlu I site, generating pCH2S (F). 6.6 kb of Mlu I-Eco RI fragment from the above clone #1 was cloned into Mlu I-Eco RI of the pCH2S (F), generating pCH2LS. Then, the Eco RI fragment from the pRISeCAGzeoE was subcloned into Eco RI site of the pCH2LS, generating pCH2CAGzeo (F). As a final step, the DT-A cassette was subcloned into Not I site of the pCH2CAGzeo (F) to complete the pCH2CAGzeoDT.
(92) pCC1BAC-isHAC;
(93) the genomic phage library constructed from CHO cells containing the HAC was screened to isolate genomic DNA fragments covering the human I.sub.1-S.sub.1 region followed by the hIGHG1 constant region by using a probe that was a PCR product by amplified with a PCR pair, g1(g2)-FR, and then we identified clones #h10 and #h18/h20. From the clone #h10, 2 kb of Afe I-Bam HI fragment was rescued to be used as a short arm while 10.5 kb of Apa I-Hpa I fragment was obtained from the clone #h18/h20 for a long arm. On the other hand, a bovine genomic phage library was screened to isolate genomic DNA fragments covering the bovine I.sub.1-S.sub.1 region followed by the bIGHG1 constant region by using a probe that was a PCR product by amplified with a PCR pair, bIgG1-FR, and then we identified a clone #b42, from which a 9.7 kb fragment (5 end through Bsu36 I) was assembled to replace a 6.8 kb of the human I.sub.1-S.sub.1 region. A Bsu36 I-Apa I linker was used to join 3 end of the bovine I.sub.1-S.sub.1 region and 5 end of the hIGHG1 constant region. The neo gene flanked by FRT and DT-A gene were inserted as shown in
(94) phI.sub.1FRTCAGattPhisDDT;
(95) 11.4 kb of Kpn I-Not I genomic fragment from clone h10 was isolated from the clone #h10 and subcloned into pBluescript SK() vector. Then, the FRT-CAG promoter-attP-polyA-hisD cassette was inserted into the 5 Bam HI site which is 1.8 kb downstream from the Kpn I site. Finally, DT-A gene was cloned into Not I site.
(96) ph.sub.1TMNoeattPDT;
(97) 7.5 kb of Sac II genomic fragment from clone h20 was subcloned into pBluescript SK () vector. Next, the neo-attP cassette was inserted into Hin dill site, followed by cloning of DT-A gene into Not I site.
(98) pBAC-istHAC;
(99) 7.3 kb of Bmg BI-Sph I bovine genomic fragment containing the bovine TM1/TM2 domain was obtained from the clone #b66, of which 5 part was joined with 3 part of the 9.5 kb of the bovine I.sub.1-S.sub.1 fragment (from #b42) and 1.6 kb of hIGHG1 gene (from #h10) from the isHAC by a linker, pNsiI-bG1-hG1-BmgBI. The attB-DsRed-FRT cassette was inserted at 5 side of the 9.5 kb of the bovine I.sub.1-S.sub.1 fragment (from #b42) and another attB sequence was placed at 3 side of 7.3 kb of Bmg BI-Sph I bovine genomic fragment containing the bovine TM1/TM2 domain that was obtained from the clone #b66. All the above assembles were done on a BAC-based backbone vector pCC1BAC (EPICENTRE).
(100) pC.sub.1CAGzeoPuro.sup.loxPDT;
(101) a probe amplified by a primer pair, bCLR-FR, identified several phage clones covering the 5 side of the IGLJ1-IGLC1 gene. The 13 kb Nde I-Hin dIII genomic fragment was subcloned into pBluescript SK() vector and the CAGzeo/loxP/promoter-less puro cassette was inserted at Afe I site present in the genomic fragment. Finally, DT-A gene was inserted at Not I site. This vector was constructed from the alleles A and B.
(102) pC.sub.5CAG.sup.loxPneoDT;
(103) a probe amplified by a primer pair, bCLL-FR, identified several phage clones covering the 3 side of the IGLJ5-IGLC5 gene. The 10 kb Sac II-Nsi I genomic fragment was subcloned into pBluescript SK() vector and the CAG promoter/loxP/poly A/neo cassette was inserted at Hin dIII site present in the genomic fragment. Finally, DT-A gene was inserted at Not I site. This vector was constructed from the alleles A and B.
(104) Modification of the Human Chromosome 14 Fragments in Chicken DT40 Cells.
(105) For the purpose of using structure-defined hChr14 vector and of removing as many irrelevant human genes as possible, the intact hChr14 was modified, followed by the IgM bovinization (
(106) I355-2 was further transfected with the targeting vector p14CEN(FR)hygpuro.sup.lox511DT to integrate another lox511 and the promoter-less puro gene at the locus AL391156, which is about the 85 Mb centromeric to the AL512355. Colonies were selected with hygromycin B and subjected to PCR screening to confirm the occurrence of the homologous recombination with primers, 14CENKO-F3/R3(see Table 1 below), as a positive PCR and also with primers, 14CEN(N)-F2/R2 (see Table 1 below), as a negative PCR (
(107) I156-10 was transfected with the Cre expression plasmid to mediate site-specific recombination between the two lox511 sites, one on the locus AL512355 and another on the AL391156, to delete about 85 Mb of sequence between them to shorten the hChr14 from 106 Mb down to about 21 Mb. Cells where the big deletion took place were selected with puromycin as puromycin resistance is conferred by the CAG promoter-lox511-puro cassette reconstituted at the recombination site. This cassette reconstitution was confirmed by PCR with primers, CAGpuro-F3/R3 (see Table 1 below), as described in the bIGL cluster deletion section. Also, histidinol and hygromycin B sensitivity was confirmed as both hisD and hyg cassettes are to be removed as a result of this 85 Mb deletion (
(108) Clone 14D1 was finally bovinized with the targeting vector pCH1CAGzeo(R)DT(F) to replace the CH1 domain through the TM2 domain of the hIGHM gene with that of bovine to generate the cIgM (CH1) protein. Colonies were selected with zeocin and subjected to genomic PCR screening to confirm the occurrence of the homologous recombination with primers (see Table 1 below), cHAC-F3/R3, as a positive PCR and also with primers, CH1 5-F/R and cHAC 3-F/R, to make sure that the junction sequences between human and bovine are accurate (
(109) Modification of the Human Chromosome 2 Fragments in Chicken DT40 Cells.
(110) TL1 is a DT40 clone containing the hChr2 fragment covering the hIGK locus. This cell line was transfected with the vector pTELCAGzeoCD8A to simply replace the PGKpuro cassette with the CAGzeo because zeocin selection usually works better in bovine fibroblasts at later steps. After zeocin selection, genomic PCR, CD8AKO-F2R2 (
(111) On the other hand, the TL1 was also electroporated with the targeting vector pTELhisDpuro.sup.lox2272F9R9 to both truncate the hChr2 fragment and integrate the lox2272 and the promoter-less puro gene at the locus AC104134, which is about 300 kb telomeric to the hIGK constant region C gene, IGKC. Colonies were selected with histidinol, and then puromycin sensitivity was confirmed since the successful truncation results in the loss of the puro cassette at the CD8A locus. Genomic DNA was extracted from puromycin sensitive colonies and subjected to PCR screening with primers, FABP1-F, which amplifies the FABP1 locus present in TL1 but absent in the targeted clones (
(112) Modification of the Human Chromosome 22 Fragment in Chicken DT40 Cells.
(113) The outline is depicted in
(114) ST13 was modified with the targeting vector p553CAG.sup.lox2272bsrDT to integrate the lox2272 and the CAG promoter at the locus AP000553. Colonies were selected with blasticidin S and subjected to PCR screening to confirm the occurrence of homologous recombination with primers, 553KO-FR, as a positive PCR and also with primers, 553-F4R4, as a negative PCR (
(115) Translocation of the Human Chromosome 22 Fragment to the Human Chromosome 2 Fragment to Generate the SLKH Fragment in Chicken DT40 Cells.
(116) The SLKH fragment was constructed in DT40 hybrid cells using the chromosome cloning system (
(117) The SLKH fragment was transferred from DT40 hybrid cell line SLKH6 to plain DT40 cells by MMCT. Selection was done with puromycin and then colonies were investigated for blasticidin S sensitivity as the successful transfer of the SLKH fragment into DT40 cells should result in the loss of the bsr cassette (
(118) Construction of cKSL-HAC and KcHAC Vectors in Chicken DT40 Cells.
(119) The cKSL-HAC vector was constructed in DT40 hybrid cells as outlined in
(120) cKSLD22 was electroporated with the Cre expression plasmid to mediate site-specific recombination between the two loxP sites, one at the cos138 locus on the SLKH fragment and another at the RNR2 locus on the CH2D fragment, and also to delete the floxed CAG promoter-zeo cassette within the cIgM (CH2) domain. Recombinants were enriched by sorting of GFP positive cells as GFP expression is conferred by reconstitution of the PGK promoter-loxP-GFP cassette at the translocation site. Sorting was conducted twice which resulted in two distinct GFP positive populations with different expression levels. The lower GFP population contained the successfully translocated cKSL-HAC determined by PCR primers (see Table 1 below), PGK2GFP2, and PCR primers, CreCAGzeo-F3/R3, confirmed the CAG promoter-zeo cassette deletion in the cIgM (CH2) site. The higher GFP population contained an inverted CH2D fragment between the loxP at the RNR2 locus and the lox511 at the locus AL512355/AL391156 by a leaky Cre-mediated recombination which was confirmed by PCR primers (see Table 1 below), CAGpuro-F3GFP2 and STOPpuro-F2STOPpuro-R, followed by direct sequencing (
(121) Construction of the isHAC and isKcHAC Vectors in Chicken DT40 Cells.
(122) Outline of the isHAC (isKcHAC) construction is depicted in
(123) Construction of the istHAC Vector in Chicken DT40 Cells.
(124) A scheme of construction of the istHAC is depicted in
(125) The two clones, istH5-S16 and istH21H-S10, were finally transfected with the FLP-expression vector. As shown in
(126) Transfection of Chicken DT40 Cells for HAC Vector Construction.
(127) HAC vector construction was carried out as previously described.sup.5, 20, 21. Briefly, DT40 cells containing each hChr fragment were electroporated (550 V, 25 F) with 25 g of each targeting vector. Colonies were selected by each drug; G418 (2 mg/ml), puromycin (0.5 g/ml), hygromycin B (1.5 mg/ml), blasticidin S (15 g/ml), histidinol (0.5 mg/ml) or zeocin (1 mg/ml) for two weeks and their DNAs were subjected to PCR screening as indicated.
(128) Transfection of Bovine Fibroblasts for the Bovine IGLJ-IGLC Gene Cluster Deletion and Microcell-Mediated Chromosome Transfer (MMCT).
(129) Bovine fetal fibroblasts were cultured and transfected as previously described.sup.5, 12, 21. Briefly, fibroblasts were electroporated with 30 pg of each targeting vector at 550 V and 50 F. After 48 hours, the cells were selected under an appropriate drug; zeocin (0.4 mg/ml) or puromycin (1 g/ml) for two weeks and resistant colonies were picked up and transferred to replica plates; one was for genomic DNA extraction and the other was for embryonic cloning. MMCT was done with each HAC vector as described previously.sup.5, 20, 21.
(130) Genomic PCR and RT-PCR Analyses.
(131) These analyses were implemented as previously described.sup.5, 12, 20, 21. All the PCR products were run on 0.8% agarose gels. Primer sequences are available in Table 1 below.
(132) TABLE-US-00001 TABLE1 Primersequences. Nameofoligo SEQID DNA Sequence(5 .fwdarw. 3) NO kD-F9 TCGAGGATCCGCCAGGGAGACAGATGCCAAGTACGGTTTAG 1 kD-R9 TCGAGGATCCAGGATCTTTGGGGGACTGAATGGGGTGTGCT 2 OligoDNApair AGCTTGGATCCATAACTTCGTATAGGATACTTTATACGAAGTTATA 3 1-F OligoDNApair AGCTTATAACTTCGTATAAAGTATCCTATACGAAGTTATGGATCCA 4 1-R SL-F2 TCGAGGATCCGGCCTCCCAAAGGATTATAGACGTGAGCCACTGT 5 SL-R2 TCGAGGATCCAAAGAAGGGGCCCGCCTCTGCCTCTAAATCCTGAC 6 553-F3 TGTAGCTGACTTTAGCCACCCACAAGTAC 7 553-R3 CTTGCTGATTATACCTCATCTCCTTCCCTC 8 OligoDNApair GTACAATAACTTCGTATAGCATACATTATACGAAGTTATAGATCTG 9 2-F OligoDNApair AATTCAGATCTATAACTTCGTATAATGTATGCTATACGAAGTTATT 10 2-R OligoDNApair GATCTATAACTTCGTATAGGATACTTTATACGAAGTTATG 11 3-F OligoDNApair CTAGCATAACTTCGTATAAAGTATCCTATACGAAGTTATA 12 3-R SC355-F3 GTACAATCTTGGATCACTACAACCTCTGCCTACCA 13 SC355-R3 TGCTGTGTCTAATCAGGTGTTGAACCCATCTACTA 14 OligoDNApair GATCTATAACTTCGTATAGTATACATTATACGAAGTTATG 15 4-F OligoDNApair CTAGCATAACTTCGTATAATGTATACTATACGAAGTTATA 16 4-R 14CEN-F TCGAGGATCCTTCGCCACCCCAAAGATGATTACAGATTAC 17 14CEN-R TCGAGGATCCTACACTAGAAGCACAAACCCCACCATTACACAT 18 OligoDNApair AGCTTGGATCCATAACTTCGTATAGTATACATTATACGAAGTTATA 19 5-F OligoDNApair AGCTTATAACTTCGTATAATGTATACTATACGAAGTTATGGATCCA 20 5-R hCm-F CAGTCCCCGGCAGATTCAGGTGTCC 21 hCm-R GAAAGTGGCATTGGGGTGGCTCTCG 22 SeSp-F GGACCAGGTGGAGACTGTGCAGTCCTCACCCATAACTTTCAGGGCCTA 23 CAGCATGCTG SeSp-R CAGCATGCTGTAGGCCCTGAAAGTTATGGGTGAGGACTGCACAGTCTC 24 CACCTGGTCC g1(g2)-F ACCCCAAAGGCCAAACTCTCCACTC 25 g1(g2)-R CACTTGTACTCCTTGCCATTCAGC 26 bIgG1-F TCAACAGCACCTACCGCGTGGTCAG 27 bIgG1-R GCGGGGTCGTGCCGTACTTGTCCTC 28 pNsiI-bG1-hG1- ATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTCTCCCTG 29 BmgBI-F TCTCCGGGTAAATGAGCCTCACGTC pNsiI-bGl-hG1- GACGTGAGGCTCATTTACCCGGAGACAGGGAGAGGCTCTTCTGTGTGT 30 BmgBI-R AGTGGTTGTGCAGAGCCTCATGCAT bCLR-F TCTGTCTGTCCAACAGTGGC 31 bCLR-R ATTATGGGATGAGTCCAGGC 32 bCLL-F TTAACTGCGGTACAAGGTGC 33 bCLL-R CAACCTCTCCAGGATTCTGG 34 R-F2 GACAAGCGTGCTAGGGTCATG 35 R-R1 GGGATGGGACCTTGTTAGACTTG 36 CL1puro-F2 CGCGCATGGCCGAGTTGAGCGGTTCC 37 CL1puro-R2 CAGGCTCCCGGCTGGCGCTGGTAAGTCC 38 CL5CAG-F2 GCCCGGCCCCAGATGGAACCCGAGACAGG 39 CL5CAG-R2 ATGCCAGGCGGGCCATTTACCGTCATTGA 40 CAGpuro-F3 GCGGCGCCGGCAGGAAGGAAATG 41 CAGpuro-R3 CGAGGCGCACCGTGGGCTTGTA 42 L001-F1 ACCCTCGGTCACCCTGTT 43 L002-R2 TGAGAAGGTCTTTATTCAGGAG 44 BCm-f2 TCTCTGGTGACGGCAATAG 45 BCm-r2 CTTCGTGAGGAAGATGTCGG 46 BCmKO-F14 CCACAAAGGAAAAAGCTGCACTGCTATAC 47 BCmKO-R14 TGTGGGATCAGGAGGTCAGATAGACATC 48 bIgL-Ld-F1 GTGGGGCCACAGAAGGCAGGAC 49 bIgL-C-R ACCCGGGTAGAAGTCGCTGATGAGA 50 L003-F2 CCCTCGGTCACCCTGTTCCC 51 L004-R2 CTGGTGTGAGGCGACCTGGG 52 bIgk-F CAGCTCCTGGGGCTCCTCCTG 53 bIgk-R TGCAATAGGGGTTGATCTGTGGACA 54 335N-F GGGCAACATAGCAAGACACCATTC 55 335N-R TCCTCTCACCTCAGCCTCCATAGTA 56 SC335KO-F2 ACGGCGTGAGGACCAAGGAGCGAAACC 57 SC335KO-R2 TGAGCGACGAATTAAAACAGGCGATGAC 58 14CEN(N)-F2 AACAGTTGAATTTATGGGGAGTC 59 14CEN(N)-R2 TCAGGCTTTAAACACAGTATCACAG 60 14CENKO-F3 ACTGAAATATTTTAAATGTTTGCCCTTCCCACTCC 61 14CENKO-R3 AGACCTCCGCGCCCCGCAACCTCCCCTTCTAC 62 cHAC3-F CAAGCATGGAGCCCGCAGTAATAG 63 cHAC3-R AAGGTGACCCGGGCAGTTGTAGG 64 CH15-F CCGACAGGCAGGGCACGAGGAG 65 CH15-R TGCGAGGCGGGACAAAGACAC 66 cHAC-F3 TGCAGGTGAAGTGACGGCCAGCCAAGAACA 67 cHAC-R3 TGGCAGCAGGGTGACAGGGAAGGCAGGGAAAAG 68 CH25-F CAGCACCCCAACGGCAACAAAGAAA 69 CH25-R CCCCAGGGCTGCACTCACCAACAT 70 CD8AKO-F2 AAGGCCCCCAAGCTGATTTCCGTGAGACTAAG 71 CD8AKO-R2 GCCTGGACGAGCTGTACGCCGAGTGGT 72 553-F4 GCTAAGGCACTTCGGTTCTCTTTGTGTTC 73 553-R4 GGTTGTCTTTAAAAGCAGGGATAAGGATG 74 553KO-F GTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTA 75 553KO-R AGGGCTGGGTTAGATGGCACCAAATGAAAGGAGAA 76 STOPpuro-F2 ACTCCACACAGGCATAGAGTGTC 77 STOPpuro-R GTGGGCTTGTACTCGGTCAT 78 GFP2 TGAAGGTAGTGACCAGTGTTGG 79 350P-F ACCAGCGCGTCATCATCAAG 80 350P-R ATCGCCAGCCTCACCATTTC 81 hVpreB3-F CACTGCCTGCCCGCTGCTGGTA 82 hVpreB3-R GGGCGGGGAAGTGGGGGAGAG 83 h15-F AGCCCCAAGAACCCAGCCGATGTGA 84 h15-R GGCAGAGGGAGTGTGGGGTGTTGTG 85 344-F ATCATCTGCTCGCTCTCTCC 86 344-R CACATCTGTAGTGGCTGTGG 87 IgL-F GGAGACCACCAAACCCTCCAAA 88 IgL-R GAGAGTTGCAGAAGGGGTGACT 89 hVpreB1-F TGTCCTGGGCTCCTGTCCTGCTCAT 90 hVpreB1-R GGCGGCGGCTCCACCCTCTT 91 553P-F AGATCTCTTGAGCCCAGCAGTTTGA 92 553P-R TGAAGTTAGCCGGGGATACAGACG 93 FABP1-F TATCAAGGGGGTGTCGGAAATCGTG 94 FABP1-R ACTGGGCCTGGGAGAACCTGAGACT 95 EIF2AK3-F AGGTGCTGCTGGGTGGTCAAGT 96 EIF2AK3-R GCTCCTGCAAATGTCTCCTGTCA 97 RPIA-F CTTACCCAGGCTCCAGGCTCTATT 98 RPIA-R CTCTACCTCCCTACCCCATCATCAC 99 IGKC-F TGGAAGGTGGATAACGCCCT 100 IGKC-R TCATTCTCCTCCAACATTAGCA 101 IGKV-F AGTCAGGGCATTAGCAGTGC 102 IGKV-R GCTGCTGATGGTGAGAGTGA 103 cos138KO-F TCTTTCTCTCACCTAATTGTCCTGGC 104 cos138KO-R AGGACTGGCACTCTTGTCGATACC 105 SC355F3R3KO- GCCATTGTCGAGCAGGTAGT 106 F2 SC355F3R3KO- TCCCTCATCAGCCATCCTAA 107 R2 MTA1-F3 AGCACTTTACGCATCCCAGCATGT 108 MTA1-R3 CCAAGAGAGTAGTCGTGCCCCTCA 109 ELK2P2-F CCCACTTTACCGTGCTCATT 110 ELK2P2-R ATGAAGGTCCGTGACTTTGG 111 CreCAGzeo-F3 GCCCTCACCTTGCAGACCACCTCCATCAT 112 CreCAGzeo-R3 CCTCTCCTGCTCAGTCCCCTTCCTTCCATC 113 VH3-F AGTGAGATAAGCAGTGGATG 114 VH3-R CTTGTGCTACTCCCATCACT 115 iscont1-F1 TTGCAAAGGGGCCTGGTGGAATA 116 hIgG1-R10 GCAGGGAACGGGATGAGGATAGAGG 117 bNeo5-R GGGAGAGTGAAGCAGAACGT 118 bIgG1-5-seq-R6 TTGCTGACAAAGGTCCGTCTA 119 iscont1-R1 GCTTGGCGGCGAATGGGCTGAC 120 isHAC-TM-dig- AGAGAAGATGGGGCCCAAGAGCGCAGCTGTCCAGA 121 F3 isHAC-TM-dig- GTTCACGCTGTTCTCCTGCCGCACTCCCCGTATGG 122 R2 isHAC-Sw-dig- TTTCTCAGGAGGCAGTTAATGTGGTCTGGTATTCC 123 F5 isHAC-Sw-dig- GCAGGGCTGCCAGGGGTTAGTGCCGTGGGGGTAGAT 124 R3 hIgG1-F10 CCAGGGCCACAGTTAACGGATACGA 125 bIgG1-5-Seq- GGGTCACTTTCTCGGTCCTGGTCT 126 R10 iscont1-F3 GGCCCCTCCATTTGTACTTTCTAT 127 iscont1-R6 GGGGCAGGAGGAGAAGGGGACGAC 128 hIgG1-F25 CCTGGTCCTCACATGGCCATACCTC 129 hIgG1-R23 GGTCCGGGCTCTGGGGATTTCAT 130 hg1TMneg-F3 CCTCCCTGGTCCTCACATGGCCATA 131 hg1TMneg-R3 CATGGCACGGCAGGGTCCGGGC 132 hIgG1TM-dig-F1 CTCTGCAGAGCCCAAATCTTGTGACAAAACTCA 133 hIgG1TM-dig-R2 CCCCCGGGCTGCAGGAATTCGATATCAAGCTTAGGAC 134 hg1TMneoattP- AAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTG 135 F1 hg1TMneoattP- GGAGCCCGGCACCGTCCTGGGTTTCCTTTCCTTAT 136 R1 hg1FRTCAGattP ATGGACGGGATGACCTGGGAGATCGTGGCAAGTTT 137 hisD-F1 hg1FRTCAGattP GGGGGCCCGGTACCGAAGTTCCTATTCCGAAGTTC 138 hisD-R1 bIgG1-3-SeqF3 CACTGGTCAGTGAGAAGGAC 139 attPpuro-R3 CACCCCAGGCTTTACACTTTATGCTTCC 140 hIgG1-R15 GCTCCCCCTACCACCTCCCTTTAC 141 CAGDsRed-F2 GGCGGGGTTCGGCTTCTGGCGTGTGAC 142 CAGDsRed-R2 CTTGGCCATGTAGATTGACTTGAACTCC 143 bIgG1-dig-F1 GGCGCCGCTTAAACCACCCCACCAACCCACAA 144 hIgG1-dig-R1 ACCTGGGCACGGTGGGCATGTGTGAGTTTTGTC 145 bIgG1TM-R4 AGACAGCAAAGAGAAAGAACAGGCCCCCACATTAG 146
(133) CGH Analysis.
(134) Array probes for CGH analysis were designed by Roche NimbleGen, based on estimated sequence of the cKSL-HAC vector (see
(135) FISH Analysis.
(136) Human COT-1 FISH and hChr-specific multi-color FISH were performed as previously described.sup.5, 20, 21. To specifically stain the hIGH, hIGK and hIGL loci, probes were synthesized from DNA derived from BAC clones RP11-417P24, RP11-316G9 and RP11-22M5, respectively.
(137) Flow Cytometry Analysis.
(138) Flow cytometry analysis on B cell development in newborn transgenic (Tc) calves were performed as previously described.sup.5 with the following modifications. To detect surface hIgG on Tc bovine B cells, goat anti-hIgG (Life Technologies) directly labeled with AF 488 was used. To label surface hIg or hIg on Tc bovine B cells, mouse anti-hIg antibody directly labeled with PE (Biolegend) or mouse anti-hIg antibody directly labeled with PE (Southern Biotech) was used. To label surface bIg or bIg on the B cells, mouse monoclonal anti-bIg (in-house clone 132D7) or mouse monoclonal anti-bIg (in-house clone 132B10) followed by Zenon mouse IgG1PE labeling (Life Technologies) were used. Staining was done by a standard protocol and then analyzed by FACSARIA flow cytometer (BD Biosciences).
(139) ELISA.
(140) Total hIgG ELISA assay was performed as previously described.sup.5. For fully hIgG/hIg or hIgG/hIg detection, goat anti-hIg affinity-purified or goat anti-hIg affinity-purified (Bethyl) as a capture and goat anti-hIgG Fc-HRP (Bethyl) as a detection antibody were used. For hIgG/bIg detection, mouse monoclonal anti-bIg (in-house clone 132B10) as a capture and mouse anti-hIgG Fc-HRP (Jackson) as a detection antibody were used. For detection of hIgG1 or hIgG2, mouse anti-hIgG1 Fc or mouse anti-hIgG2 Fc (Hybridoma Reagent Laboratory) as a capture and mouse anti-hIgG HRP (Southern Biotech) as a detection antibody were used.
(141) Immunization of Human Oral Squamous Cell Carcinoma to the HAC/TKO and HAC/DKO Calves.
(142) The HAC/TKO and HAC/DKO calves were immunized with X-ray-irradiated human oral squamous cell carcinoma (DSMZ) antigen at 210.sup.8 cells/dose formulated with Montanide ISA 25 adjuvant (Seppic) as water-in-oil emulsion plus Quil A (Accurate Chemical & Scientific Corp) as immune stimulant. The Tc calves were immunized two times at 3-week intervals (primary immunization followed by the booster after 3 weeks). Vaccine was administered by intramuscular injection in the neck region. Serum samples were collected as previously described.sup.5 before each immunization (V1 and V2) and 10 days and 14 days after each immunization for antibody titer analysis. Anti-human oral squamous cell carcinoma antibody titers were determined by flow cytometry analysis.
(143) Measurement of Anti-Human Carcinoma Cell hIgG/hIg Titer in Tc Animal Sera by Flow Cytometry.
(144) Sera collected from Tc calves immunized with human carcinoma cells were used as the primary antibody to stain the human carcinoma cells. Pre-immune Tc calf serum (V1D0) was used as the negative controls. AF488-conjugated goat anti-hIgG Fc (Invitrogen) at 1:80 dilution and PE-conjugated mouse anti-hIg (BioLegend) at 1:8 dilution were used to detect bound hIgG/hIg antibody. The assay was performed in PBS supplemented with 4% horse serum, 0.1% sodium azide and 2 mM EDTA. The results were expressed as % of the human carcinoma cells stained and mean fluorescence intensity (MFI) as measured by FACSARIA flow cytometer (BD Biosciences).
(145) Somatic Cell Nuclear Transfer.
(146) Cloned fetuses and calves were produced using chromatin transfer procedure as described previously.sup.5, 12, 20, 21.
Results
Example 1. Bovine IGL Gene Cluster Deletion
(147) One hypothesis is that inactivation of the bovine Ig light chain, in addition to the bIgH disruption, would support high productivity of fully human IgG in cattle. Because, unlike the human and mouse, cattle predominantly express Ig light chain over Ig, the bIGL gene was inactivated. However, there was little information published about the bIGL gene structure in the bovine genome when the inventors started this study, thus the bIGL gene sequence including its surrounding region was determined. For that purpose, a bovine BAC (bacterial artificial chromosome) genomic library was screened and then one BAC clone was subjected to full sequencing by a shotgun approach. A gene cluster composed of the five IGLJ-IGLC genes (IGLJ1-IGLC1 through IGLJ5-IGLC5) was identified, three of which (IGLJ2-IGLC2 through IGLJ4-IGLC4) appeared to be functional, judged from its deduced amino acid sequence (
(148) Since the bIGL gene forms the gene cluster, instead of a single gene structure, the strategy was to develop a novel system in somatic cells for deleting the entire IGLJ-IGLC gene cluster by using Cre/loxP-mediated site-specific recombination (
Example 2. Establishment of Male and Female Bovine IGHM/IGHML1/IGL/ Cell Lines
(149) Multiple rounds of genetic modifications followed by SCNT in somatic cells could compromise animal development due to potentially accumulated, irreversible epigenetic errors. In order to reduce the round number of SCNT, sequential gene targeting was combined with animal breeding, as summarized in
(150) It was previously reported that the IGHML1 locus mapped to the bChr11, the data here indicated that both the IGHM and IGHML1 loci are unexpectedly located on the bovine Chr21 (
(151) The male cell line J481 (IGHM.sup./IGHML1.sup./+), in which the inventors designated the bIGL alleles as A and D, was transfected with the pC.sub.1(A)CAGzeoPuro.sup.loxPDT vector specific to the allele A, selected under zeocin and then screened for the occurrence of homologous recombination by a genomic PCR using a primer pair, CL1puro-F2R2, as shown in
(152) Subsequently, the cell line K655-1 was co-transfected with the pC.sub.5(A)CAG.sup.loxPneoDT vector specific to the allele A and the Cre-expression plasmid to bring about the cluster deletion, which was selected by puromycin. Twenty-one puromycin-resistant colonies were obtained and subjected to two kinds of genomic PCRs, CL5CAG-F2R2 and CAGpuro-F3R3, as shown in
Example 3. cKSL-HAC and KcHAC Vector Construction
(153) It is possible that there could be some species-incompatibilities between human and bovine that could hamper high production of fully hIgG in the bovine. As one of such species-incompatibilities, the IgM-based pre-BCR/BCR function was addressed. Among immunoglobulin heavy (IgH) chain classes, the IgM heavy chain is the first to be expressed, and is important for B cell development to eventually lead to secretion of IgG. In the Tc bovine condition, hIgM is expressed on the bovine B cell surface to interact with bovine surrogate light chain, followed by orthodox bovine light chain, and with bovine Ig-/Ig- molecules for the pre-BCR/BCR-mediated signaling, which is crucial for the subsequent B cell development. There may be species-incompatibilities in the hIgM protein interacting with bovine surrogate light chain, orthodox light chain and Ig-/Ig- molecules, due to the species-specific sequence differences (
(154) As a starting HAC vector onto which a defined human chromosome region can be cloned (chromosome cloning) by means of site-specific chromosome translocation, the hChr14 fragment SC20 was used. SC20 was a naturally occurring fragment during microcell-mediated chromosome transfer (MMCT), thus its structure was not defined. For the purpose of using a structure-defined hChr14 vector and of removing as many irrelevant human genes as possible, the intact hChr14 was modified, followed by the IgM bovinizations, which generated new hChr14-based vectors, CH1D2 and CH2D4, for the KcHAC and cKSL-HAC vector construction, respectively.
(155) The cKSL-HAC vector was constructed in chicken DT40 cells as outlined in
(156) The KcHAC vector was similarly constructed in DT40 cells as outlined in
Example 4. Human IgG Production in a Series of HAC/IGHM/IGHML1/ (DKO) Cattle
(157) The cKSL-HAC, KcHAC and KcHAC vectors were transferred to Chinese hamster ovary (CHO) cells by means of MMCT to establish CHO-based master cell banks, cKSLDC6, 15, 23, KCDC15 and CKF4, respectively, which were confirmed by the extensive genomic PCR and CGH (
(158) Around 5-6 months of age, concentrations of serum total hIgG, pairing either with hIg/ or bIg/, and fully hIgG/hIg were measured (
(159) These data suggest potential species-incompatibilities in the IgM pre-BCR/BCR function, leading to the considerable differences in the B cell development and hIgG production profile between the differently bovinized cIgM (CH1) and cIgM (CH2) proteins without or with human surrogate light chain. This is novel evidence of the species-incompatibility in IgM pre-BCR/BCR function that eventually affects fully hIgG production profile.
Example 5. isHAC, istHAC and isKcHAC Vector Construction
(160) The next strategy was to directly alter the efficiency of class switch to hIgG, especially to hIgG1, by direct bovinization of the hIGHG1 gene class switch regulatory element on the cKSL-HAC and KcHAC vectors. The transmembrane and cytoplasmic domains of the hIGHG1 gene were also bovinized for potentially better hIgG1 BCR-mediated signaling under the bovine environment.
(161) The determination on IgG subclass class switch recombination is preceded by transcription from each immunoglobulin heavy chain (IGH) locus-associated switch region (S.sub.H), called germline transcript. Each IGH constant region (C.sub.H) gene is linked with its own S.sub.H region which is also associated with its own I.sub.H exons. The germline transcript I.sub.H-S.sub.H-C.sub.H (eventually spliced to mature I.sub.H-C.sub.H) is driven by the promoter/enhancer elements located just 5 of the I.sub.H exons and those elements are cytokine or other activator-responsive. In a simple model of class switch, the specific activators and/or cytokines induce the germline transcript from its activator/cytokine-responsive I.sub.H promoter/enhancer. The 3E.sub. element further enhances the transcription of I.sub.H-S.sub.H-C.sub.H sequence. This transcription causes the switch region to be relaxed so that it can be targeted by the enzyme, activation-induced cytidine deaminase (AID), which causes fusion with another S.sub.H region, leading to class switch. A hypothesis was that, for example, the hI.sub.1-hS.sub.1 regulatory element (from human IgG1) linked with the hIGHG1 gene was somehow incompatible with such bovine activators/cytokines-induced proteins to efficiently induce class switch to hIgG1, due to the species-specific sequence differences (
(162) Based on the above hypothesis, the hI.sub.1-hS.sub.1 class switch regulatory element was bovinized with the class switch regulatory element of the bIGHG1 gene to construct the isHAC vector having the bI.sub.1-bS.sub.1 sequence upstream of the hC.sub.1 (human heavy chain IgG1) region on the cKSL-HAC vector (
Example 6. Human IgG Production in a Series of HAC/IGHM/IGHML1/IGL/ (TKO) Cattle
(163) The isHAC, istHAC, isKcHAC, KcHAC and cKSL-HAC vectors were transferred from the CHO master cell banks to the IGHM.sup./IGHML1.sup./IGL.sup./ (TKO) cell lines by MMCT to generate a series of HAC/TKO calves. Calving efficiency at 270 days of gestation was around 7% out of recipients implanted, 60-70% of which survived at least up to 5-6 months after birth (Table 2). First of all, the lack of the bIGL expression was confirmed by RT-PCR at newborn stage (
(164) TABLE-US-00002 TABLE 2 Production of cloned calves from genetically modified fibroblast cell lines TKO Calves survived cell line Pregnant at (%).sup.a up to 5-6 months ID Genotype Recipients 40 d 120 d 180 d 270 d (%).sup.a E024A-2 KcHAC/ 85 36 (42) 17 (20) 17 (20) 6 (7) 5 (6) A596A- TKO 85 22 (26) 11 (13) 10 (12) 5 (6) 1 (1) 1 A332A 80 28 (35) 9 (11) 9 (11) 4 (5) 2 (3) Subtotal 250 86 (34) 37 (15) 36 (14) 15 (6) 8 (3.2) E024A-2 cKSL- 139 52 (37) 27 (19) 25 (18) 13 (9) 8 (6) HAC/TKO E024A-2 isHAC/TKO 81 19 (23) 4 (5) 4 (5) 3 (4) 3 (4) A596A- 80 24 (30) 10 (13) 9 (11) 3 (4) 2 (3) 1 A332A 68 21 (31) 13 (19) 12 (18) 6 (9) 6 (9) A114A 48 18 (38) 8 (17) 7 (15) 2 (4) 1 (2) Subtotal 277 82 (30) 35 (13) 32 (12) 14 12 (4.3) (5.1) E024A-2 istHAC/TKO 80 29 (36) 18 (23) 16 (20) 8 (10) 5 (6) C970 46 20 (43) 11 (24) 9 (20) 3 (7) 3 (7) Subtotal 126 49 (39) 29 (23) 25 (20) 11 8 (6.3) (8.7) E024A-2 isKcHAC/ 80 33 (41) 24 (30) 24 (30) 11 (14) 9 (11) A596A- TKO 80 41 (51) 21 (26) 19 (24) 6 (8) 3 (4) 1 Subtotal 160 74 (46) 45 (28) 43 (27) 17 (11) 12 (7.5) Total 952 343 173 161 70 48 (5) (36) (18) (17) (7.4) .sup.aPercentages were calculated by dividing the number of fetuses or calves by that of recipients implanted.
(165) TABLE-US-00003 TABLE 3 p values for the comparison in serum concentration of total hlgG among the genotypes A B C D E F G H A 0.8096 0.1742 0.5559 0.9495 0.9818 0.0832 0.0205* B 0.6456 <0.001* 1.0000 0.0013* <0.001* <0.001* C <0.001* 0.8141 0.0018* <0.001* <0.001* D 0.0328* 0.0039* <0.001* <0.001* E 0.2741 0.0018* <0.001* F <0.001* <0.001* G 0.1111 A, cKSL-HAC/TKO (n = 8); B, isHAC/TKO (n = 12); C, istHAC/TKO (n = 8); D, KcHAC/TKO (n = 8); E, isKcHAC/TKO (n = 12); F, cKSL-HAC/DKO (n = 33); G, KcHAC/DKO (n = 12); H, HAC/DKO (n = 8) *shows a significant difference (p < 0.05).
(166) TABLE-US-00004 TABLE 4 p values for the comparison in serum concentration of fully hlgG/hlg among the genotypes A B C D E F G H A 0.5011 0.0369* 0.9092 0.2341 0.0438* 0.0241* 0.0170* B 0.4092 <0.001* 0.9202 <0.001* <0.001* <0.001* C <0.001* 0.9974 <0.001* <0.001* <0.001* D 0.0055* <0.001* <0.001* <0.001* E <0.001* <0.001* <0.001* F 0.0039* <0.001* G 0.5162 A, cKSL-HAC/TKO (n = 8); B, isHAC/TKO (n = 12); C, istHAC/TKO (n = 8); D, KcHAC/TKO (n = 8); E, isKcHAC/TKO (n = 12); F, cKSL-HAC/DKO (n = 33); G, KcHAC/DKO (n = 12); H, HAC/DKO (n = 8) *shows a significant difference (p < 0.05).
(167) TABLE-US-00005 TABLE 5 p values for the comparison in serum fully hlgG/hlg (%)/total hlgG among the genotypes A B C D E F G A 0.5344 0.0914 <0.001* <0.001* <0.001* <0.001* B 0.9248 0.0074* <0.001* <0.001* <0.001* C 0.2155 <0.001* <0.001* <0.001* D <0.0938* <0.001* <0.001* E <0.001* <0.001* F <0.001* A, cKSL-HAC/TKO (n = 8); B, isHAC/TKO (n = 12); C, istHAC/TKO (n = 8); D, KcHAC/TKO (n = 8); E, isKcHAC/TKO (n = 12); F, cKSL-HAC/DKO (n = 33); G, KcHAC/DKO (n = 12) *shows a significant difference (p < 0.05).
(168) Since the rationale for the isHAC, istHAC and isKcHAC vector construction was to directly alter the efficiency of class switch to hIgG, especially to hIgG1, under the bovine physiological condition, by bovinizing the hIGHG1 gene class switch regulatory element, serum concentrations of fully hIgG/hIg and hIgG subclass distribution were measured around 5-6 months of age in a series of HAC/TKO calves (
(169) These data demonstrated that the I1-S1 class switch regulatory element is controlled in a species-specific manner. The effect of the bovinized I.sub.1-S.sub.1 sequence is of a particular interest. It is reported that virtually all transcription factor-binding locations, landmarks of transcription initiation, and the resulting gene expression observed from the hChr21 in the human hepatocytes were recapitulated across the entire hChr21 in the mouse hepatocyte nucleus. This implies that the human-specific gene expression profile could be simply provided by the human DNA primary sequence even under the non-human species environment. Applying this view to the Tc bovine situation, the non-bovinized HAC would have been sufficient for providing the human-like hIgG expression profile, such as hIgG1-dominancy, in the bovine condition, which, however, was not the case. Thus, the finding that bovinization of the hI.sub.1-hS.sub.1 sequence surprisingly caused the sufficient switch from hIgG2-dominancy to hIgG1-dominancy in the Tc bovine condition strongly suggests the species-incompatibility in IgG1 class switch regulation between the two species. Since immunoglobulin gene organization and diversification including class switch are thought to be evolved distinctly among species, addressing such species-incompatibilities will be generally useful to express human antibodies in non-human species. The species-specific effect on fully hIgG serum concentration seems to be different between the differently bovinized cIgM proteins {cIgM (CH1) vs. cIgM (CH2)}; the bovinization of the I1-S1 element in the cIgM (CH1) background significantly improved it (i.e. isKcHAC vs KcHAC) while it did not in the cIgM (CH2) background (i.e. isHAC vs cKSL-HAC). In the cIgM (CH2) background, the bovinization of IgG1 transmembrane/cytoplasmic domains was additionally necessary to significantly improve fully hIgG/hIg production (i.e. istHAC vs cKSL-HAC). Both in the cIgM (CH1) and cIgM (CH2) backgrounds, the bovinized I1-S1 sequence drastically altered hIgG1 subclass-dominancy.
(170) Finally, to show that the HAC/TKO calves that underwent such complex chromosome engineering functionally generate fully hIgG/hIg polyclonal antibodies in response to antigen immunization, several HAC/TKO animals were hyperimmunized with human oral squamous cell carcinoma to see antigen-specific fully hIgG/hIg immune response in comparison with the HAC/DKO genotype, cKSL-HAC/DKO. All the HAC/TKO calves immunized mounted robust anti-human carcinoma fully hIgG/hIg response (28.45-80.36% positive for both hIgG and hIg), whereas the two cKSL-HAC/DKO animals had only 0.73-1.54% positive for both hIgG and hIg, and only showed hIgG-response (
(171) The invention is capable of producing a large quantity of fully hIgG/hIg (>5 g/1 on average/median in the novel genotypes, i.e. isHAC/TKO, istHAC/TKO and isKcHAC/TKO) in sera of a large farm animal species. This serum concentration of fully hIgG/hIg is, to the inventors' knowledge, the highest of any other transgenic mouse systems producing fully hIgG (typically around 0.5 g/l) and is the closest to that in healthy humans. Moreover, hIgG subclass produced in the isHAC/TKO, istHAC/TKO and isKcHAC/TKO calves can be controlled to be hIgG I-dominant, which is the major subclass in healthy humans and is also that of therapeutic hIgG recombinant antibodies in development and on the market. Importantly, all the HAC/TKO calves tested functionally generated fully hIgG/hIg polyclonal antibodies against human-origin antigens immunized, which would be difficult to achieve by conventional human plasma-derived WIG, due to immune tolerance in humans. This was accomplished using a novel strategy of addressing potential species-incompatibilities in some key components (pre-BCR/BCR machinery and I.sub.1S.sub.1 regulatory element) through complex human chromosome engineering, as well as endogenous bovine chromosome engineering (a site-specific, big DNA deletion). This new concept of species-incompatibilities may be also taken into consideration for high expression of complicatedly regulated human genes in transgenic animals if DNA sequences of some regulatory elements are considerably different from humans. Significantly, this complex chromosome engineering was done in somatic cells to alleviate a necessity of using ES cells.
REFERENCES
(172) 1. Lemieux, R., Bazin, R. and Neron, S. Therapeutic intravenous immunoglobulins. Mol Immunol. 42, 839-848 (2005). 2. Jolles, S., Sewell, W. A. C. and Misbah, S. A. Clinical uses of intravenous immunoglobulin. Clini Exp Immunol. 142, 1-11 (2005). 3. Newcombe, C. and Newcombe, A. R. Antibody production: polyclonal-derived biotherapeutics. J Chromatogr B Analyt Technol Biomed Life Sci. 848, 2-7 (2007). 4. Farrugia, A. & Poulis, P. Intravenous immunoglobulin: regulatory perspectives on use and supply. Transfus. Med. 11, 63-74 (2001). 5. Kuroiwa, Y. et al. Antigen-specific human polyclonal antibodies from hyperimmunized cattle. Nat Biotechnol. 27, 173-181 (2009). 6. Echelard, Y. Year of the ox. Nat Biotechnol. 27, 146-147 (2009). 7. Lonberg, N. Human antibodies from transgenic animals. Nat Biotechnol. 23, 1117-1125 (2005). 8. Aitken, R. et al. Structure and diversification of the bovine immunoglobulin repertoire. Veterinary Immunol. Immunopathol. 72, 21-29 (1999). 9. Chen, L. et al. Characterization of the bovine immunoglobulin lambda light chain constant IGLC genes. Veterinary Immunol. Immunopathol. 124, 284-294 (2008). 10. Ekman, A., Niku, M., Liljavirta, J. & Iivanainen, A. Bos taurus genome sequence reveals the assortment of immunoglobulin and surrogate light chain genes in domestic cattle. BMC Immunol. 10:22, (2009). 11. Hosseini, A., Campbell, G., Prorocic, M. and Aitken, R. Duplicated copies of the bovine J.sub.H locus contribute to the Ig repertoire. Intern. Immunol. 16, 843-852 (2004). 12. Kuroiwa, Y. et al. Sequential targeting of the genes encoding immunoglobulin- and prion protein in cattle. Nat Genet. 36, 775-780 (2004). 13. Kitamura, D., Roes, J., Kuhn, R. & Rajewsky, K. A. B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin chain gene. Nature 350, 423-426 (1991). 14. Tomizuka, K. et al. Double trans-chromosomic mice: Maintenance of two individual human chromosome fragments containing Ig heavy and K loci and expression of fully human antibodies. Proc. Natl. Acad. Sci. USA 97, 722-727 (2000). 15. Yel, L et al. Mutations in the mu heavy chain gene in patients with agammaglobulinemia. New Engl J Med 335, 1486-1493 (1996). 16. Kitamura, D. et al. A critical role of 25 protein in B cell development. Cell 69, 823-831 (1992). 17. Mundt, C., Licence, S., Shimizu, T., Melchers, F. & Martensson, I-L. Loss of Precursor B Cell Expansion but Not Allelic Exclusion in VpreB1/VpreB2 double-deficient mice. J Exp Med 193, 435-445 (2001). 18. Zou, X. et al. Block in development at the pre-B-II to immature B cell stage in mice without IgK and Ig light chain. J Immunol 170, 1354-1361 (2003). 19. Pelanda, R., Braun, U., Hobeika, E., Nussenzweig, M. C. & Reth, M. B cell progenitors are arrested in maturation but have intact VDJ recombination in the absence of Ig- and Ig-. J Immunol 169, 865-872 (2002). 20. Kuroiwa, Y. et al. Manipulation of human minichromosomes to carry greater than megabase-sized chromosome inserts. Nat Biotechnol 18, 1086-1090 (2000). 21. Kuroiwa, Y. et al. Cloned transchromosomic calves producing human immunoglobulin. Nat Biotechnol. 20, 889-894 (2002). 22. Chaudhuri, J. & Alt, F. W. Class switch recombination: interplay of transcription, DNA deamination and DNA repair. Nat Review Immunol 4, 541-552 (2004). 23. Tomizuka, K. et al. Double trans-chromosomic mice: Maintenance of two individual human chromosome fragments containing Ig heavy and loci and expression of fully human antibodies. Proc. Natl. Acad. Sci. USA 97, 722-727 (2000). 24. Stoop, J. W., Zegers, B. J. M., Sander, P. C. and Ballieux, R. E. Serum immunoglobulin levels in healthy children and adults. Clin Exp Immunol. 4, 101-112 (1969). 25. Kaisho, T., Schwenk, F. & Rajewsky, K. The roles of 1 heavy chain membrane expression and cytoplasmic tail in IgG1 responses. Science 276, 412-415 (1997). 26. Wilson, M. D. et al. Species-specific transcription in mice carrying human chromosome 21. Science 322, 434-438 (2008). 27. Flajnik, M. F. Comparative analyses of immunoglobulin genes: surprises and portents. Nat Rev Immunol 2, 688-698 (2002). 28. Kawano, Y., Yoshikawa, S., Minegishi, Y. & Karasuyama, H. Pre-B Cell receptor assesses the quality of IgH chains and tunes the Pre-B cell repertoire by delivering differential signals. J Immunol 177, 2242-2249 (2006). 29. Casola, S. et al. B cell receptor signal strength determines B cell fate. Nat Immunol 5, 317-327 (2004). 30. Keenan, R. A. et al. Censoring of autoreactive B cell development by the pre-B cell receptor. Science 321, 696-699 (2008). 31. Martin, F. & Kearney, J. F. Marginal-zone B cells. Nat Review Immunol 2, 323-335 (2002). 32. Siber, G. R. et al. Correlation between serum IgG2 concentrations and the antibody response to bacterial polysaccharide antigens. New Engl J Med 303,178 (1990). 33. Shackelford, P. G. et al. Correlation of serum immunoglobulin subclass concentrations with antibody responses of children to immunization with Haemophilus influenzae type b polysaccharide-pertussis vaccine. J Clin Immunol 5, 390-395 (1985).