Vector comprising gene fragment for enhancement of recombinant protein expression and use thereof
09902969 ยท 2018-02-27
Assignee
Inventors
- Eun Gyo LEE (Daejeon, KR)
- Hong-Weon LEE (Daejeon, KR)
- Shin Young KANG (Daejeon, KR)
- Yeon-Gu KIM (Daejeon, KR)
- Joon Ki JUNG (Daejeon, KR)
- Jungoh AHN (Daejeon, KR)
- Seung Hee KANG (Daejeon, KR)
- Chun Sug KIM (Daejeon, KR)
- Hyeok Won LEE (Daejeon, KR)
- Jin Gyeom LEE (Daejeon, KR)
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
C07K2317/14
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
International classification
C07K16/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a new gene fragment derived from Chinese hamster ovary (CHO) cell for enhancement of recombinant protein expression in animal cells and a use thereof. It has been found that using the vector comprising a gene fragment of the present invention enhances the expression of a target protein in animal cells. Accordingly, the vector comprising a gene fragment of the present invention could be usefully used in the production of biopharmaceuticals such as therapeutic antibodies, etc.
Claims
1. A recombinant vector for increasing expression of a target gene, comprising a gene fragment consisting of a base sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.
2. The recombinant vector for increasing an expression of a target gene of claim 1, wherein the gene fragment is inserted upstream of the target gene, downstream of the target gene, or upstream and downstream of the target gene at the same time.
3. The recombinant vector for increasing an expression of a target gene of claim 1, further comprising a promoter originated from a virus or a mammal.
4. An animal cell transformed with the recombinant vector of claim 1.
5. A method for producing a target protein, comprising: 1) producing a recombinant vector of claim 1; 2) transforming an animal cell with the recombinant vector; and 3) culturing the animal cell transformed with the recombinant vector to obtain the protein produced.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
BEST MODE FOR CARRYING OUT THE INVENTION
(6) Hereinafter, the present invention will be explained in detail.
(7) The present invention provides a recombinant vector for increasing an expression of a target gene, comprising a gene fragment consisting of any one of base sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.
(8) The term vector as used herein refers to a DNA construct including a foreign DNA sequence operably connected to a suitable regulatory sequence capable of expressing DNA in a suitable host. The vector according to the present invention may typically be constructed as a vector for an expression. Preferably, the vector according to the present invention is a vector for expressing a recombinant peptide or protein. Additionally, the vector according to the present invention may be constructed, having a prokaryotic cell or an eukaryotic cell as the host cell. The recombinant expression vector according to the present invention may, for example, be a bacteriophage vector, a cosmid vector, a yeast artificial chromosome (YAC) vector, etc. Considering the purpose of the present invention, it is preferable to use a plasmid vector. A typical plasmid vector which can be used for this purpose has a structure including (a) a replication origin allowing replication to be efficiently made so as to include hundreds of plasmid vectors per host cell, (b) antibiotic resistance gene so that the host cell transformed with the plasmid vector could be screened, and (c) a restriction site into which the foreign DNA fragment can be inserted. Even if a suitable restriction site does not exist, the vector and foreign DNA could be easily ligated by using a synthetic oligonucleotide adaptor or a linker. The vector used in the present invention may be constructed by various methods known in the related field. Additionally, a detailed method therefor is disclosed in Sambrook et al. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press (2001), and this publication is included as a reference in the specification of the present invention.
(9) It is preferable that the gene fragment is inserted into the front of the target gene, the back of the target gene, or the front and back of the target gene at the same time, but is not limited thereto.
(10) According to a specific embodiment of the present invention, the gene fragment consisting of any one of base sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is inserted into the front of the target gene, the back of the target gene, or the front and back of the target gene at the same time.
(11) It is preferable that the polynucleotide is originated from the Chinese Hamster Ovary (CHO)-K1 cell, but is not limited thereto.
(12) It is preferable that a promoter of the recombinant vector is a promoter originated from a virus or a mammal. Specifically, it is more preferable that the promoter is a cytomegalovirus (CMV) promoter, but is not limited thereto.
(13) It is preferable that the vector includes a target gene, an internal ribosome entry site (IRES) and a screened gene. It is more preferable that the screened gene is a zeocin resistance gene (ZeoR), but is not limited thereto.
(14) The gene fragment consisting of any one of base sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is screened by a method below, but is not limited thereto:
(15) 1) obtaining a gene fragment derived from CHO-K1 cell line to constitute a vector library;
(16) 2) transducing CHO-K1 cell line with the vector library, culturing the CHO-K1 cell line transduced with the vector library in a selective medium, and then classifying cells with a higher expression rate of a fluorescent protein than the control group into which a vector without inserting the gene fragment is introduced;
(17) 3) culturing the cells classified in the step 2) as a single clone and finding the gene fragment introduced; and
(18) 4) analyzing a sequence of the gene fragment found.
(19) Additionally, the present invention provides a method for producing a target gene by using the recombinant vector, specifically a method for producing a target gene, comprising the steps of:
(20) 1) producing a recombinant vector for increasing an expression of target gene;
(21) 2) transforming an animal cell with the recombinant vector; and
(22) 3) culturing the animal cell transformed with the recombinant vector to obtain a protein produced.
(23) Hereinafter, examples are provided to explain the present invention more specifically. According to the summary of the invention, it would be obvious to a skilled person in the art to which the present invention belongs that the scope of the present invention would not be limited by these examples.
Example 1: Production of Vector Library into which Cho Cell Gene Fragment is Inserted
(24) In order to achieve the purpose of the present invention, a method for constructing a green fluorescent protein expression vector and inserting a gene fragment of CHO-K1 cell line (ATCC CCL-61) thereinto to obtain the library was conducted. First, a genome of CHO-K1 cell line was obtained from CHO-K1 cell by using a DNeasy blood & tissue kit (Qiagen). The extracted genome DNA was made as a fragment followed by treatment under various conditions with different concentrations, temperatures and times for treating restriction enzyme Sau3AI (NEB). The Sau3AI restriction enzyme diluted twice up to 10 times from 2 unit per DNA 1 g was reacted, the reaction was conducted per time at each temperature of 37 C., 25 C., 16 C. and 4 C., and DNA whose reaction was terminated was subjected to electrophoresis in agarose gel. DNA was extracted per size by using a gel extraction kit (Qiagen) from agarose gel where electrophoresis was performed, and DNA was used as a gene fragment to be inserted into the vector.
(25) The green fluorescent protein expression vector, with an animal cell expression vector pcDNA3.1/Zeo (Invitrogen) as a basic vector, was constructed by inserting eGFP into NheI and XbaI restriction enzyme positions of a multicloning site. For the insertion of the gene fragment treated with Sau3AI, BamHI restriction enzyme sequence was generated at a position where the CMV promoter starts and was named GFP/pcDNAZeo. The BamHI restriction enzyme and CIAP were treated to the constructed vector to ligate the prepared gene fragment, and the vector comprising the gene fragment was introduced into E. coli DH5. The E. coli into which the vector was introduced was plated into solid medium plates including ampicillin and was cultured for one night at 37 C. The number of colonies grown on the plates was checked, the plates were classified according to the size of the inserted gene fragment, and the colonies were collected in LB medium flask. The colony collected in one flask was cultured for about 3 hours and then the vector was obtained by using a DNA plasmid midi kit (Qiagen). Each sample obtained was called a DNA pool and was used as the vector library.
Example 2: Transduction and Cell Classification
(26) The vector library produced in Example 1 was transduced into the CHO-K1 cell line, a cell group which expresses the green fluorescent protein in a various way through culturing in the selective medium was obtained, and cells with a higher fluorescence value than the control group were classified through a fluorescence-activated cell sorter (FACS).
(27) Specifically, the CHO-K1 cell line was cultured in the RPMI1640 (Gibco) medium which includes 10% of FBS (fetal bovine serum, Gibco), and transduction was performed by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 48 hours of transduction, the cells were separated by treating trypsin, moved to the selective medium including zeocin (Invitrogen) to be 10% v/v, and cultured for 2 weeks. A cell group into which the GFP/pcDNAZeo vector without inserting the gene fragment was introduced also was generated through the same process, and the cell group was used as the control group when classifying a high expression group of cells using the fluorescence-activated cell sorter (FACSAria, BD) (
(28) As a result, it was confirmed that a rate of cells with higher fluorescent protein expression than the control group is from about 0.1 to 0.2%, and the cells were separated to obtain cells.
Example 3: Formation of Single Cell Line and Gene Fragment Analysis
(29) The cells classified in Example 2 were cultured as a single cell line and the gene fragment which the vector introduced into each cell has was identified.
(30) Specifically, the classified cells were placed into 96 well plates with 1 cell/well in order to obtain single cell lines thereof, cultured for about 2-3 weeks, and measured the GFP of degree of fluorescence by the microplate reader (Bioteck). Through this, about 100 single cell lines with a high degree of fluorescence were screened, and the screened cells were cultured in T25 flask until it reaches confluent state. Afterwards, each cell was separated from the flask, a GFP mean value was obtained by using a flow cytometry, and the expression of each cell line was compared therethrough. In order to confirm which gene fragment inserted into the vector the cell lines with high expression level have, a genome DNA was extracted from each cell and used as a template, and PCR was performed by using primers in Table 1 below. The primer was produced by taking front and back sequences based on BamHI restriction enzyme in front of the CMV promoter of the vector. In order to confirm the inserted gene sequence, a total of 30 PCR reactions were carried out for amplification under conditions of 1 min at 95 C., 1 min at 60 C., and 4 mins at 72 C. by using a cae-seq-F primer (SEQ ID NO: 8) and a cae-sea-R primer (SEQ ID NO: 9). As to the genes of clones for which a proper PCR amplification was not performed properly, a cae-CM-R primer (SEQ ID NO: 7) corresponding to a middle portion of the CMV promoter was used as a reverse primer. In this case, the ones which brought the PCR product of about 300 bp were classified as the clone with the vector into which the gene fragment is not inserted and is generated by self-ligation.
(31) TABLE-US-00001 TABLE1 PrimersequencesforconfirmingtheinsertionofCHO-K1gene fragmentandthecloningthereof SEQID NO. SEQName Primerdirection Sequence(5.fwdarw.3) 5 gDNA-F Forwarddirection GGGCCAGATATACGCGGATC 6 gDNA-R Reversedirection ATAATCAATGTCAACGGATC 7 cae-CM-R Reversedirection CCGTCATTGACGTCAATAGG 8 cae-seq-F Forwarddirection CAATTGCATGAAGAATCTGC 9 cae-seq-R Reversedirection CTATGAACTAATGACCCCGT
(32) As a result, it was confirmed that most sequences with a high fluorescence value had a gene fragment with a size of about 3 kb. As a result of sequence analysis of these PCR products, it could be confirmed that they had similar sequences. The PCR was performed for the gene of cell line No. 77 with a highest fluorescence value by using gDNA-F primer (SEQ ID NO: 5) and gDNA-R primer (SEQ ID NO: 6). The PCR product was inserted into the BamHI site of the GFP/pcDNAZeo vector constructed in Example 1 by using an In-fusion HD cloning kit (clontech). Thereafter, an entire sequence was analyzed. The E77 sequence was called SEQ ID NO: 1, and a result of the entire sequence analysis was inputted in Blast of NCBI and CHOgenome websites and then analyzed. As a result of analysis, it was confirmed that E77 is DNA with a size of 2895 bp, and two fragments among the CHO-K1 gene are linked. It was confirmed that the front sequence had 95% homology with the sequence of AFTD01141246 4170-5698bp, and this sequence was called E77-t1 (SEQ ID NO: 2). It was confirmed that the back sequence has 99% homology with the sequence of AFTD01082471 13582-15021 bp, and this sequence was called E77-t2 (SEQ ID NO: 3).
Example 4: Analysis for Effect of E77 Using Green Fluorescent Protein
(33) In order to verify the effect of E77 (SEQ ID NO: 1) obtained in Example 3, the transduction was performed on the CHO-K1 cell line by using the control vector GFP/pcDNAZeo (
(34) Specifically, after 48 hours of transduction of each vector, the cells with concentration of 110.sup.4 cells/ml in the zeocin selective media were put in each flask and cultured for about 2-3 weeks, thereby forming stable cell groups. Additionally, after 48 hours of transduction, the cells were put into 96 well plates with 50 cells/well by using a limited dilution method, about 100 single clones were obtained for each cell group, and the fluorescence value for each cell was measured.
(35) As a result, when forming the entire cell as a stable cell group, the rate of cell expressing GFP is 27.3% compared to the control group. In comparison, in the case of cell group into which the vector comprising E77 is introduced, the expression rate was 42% (
Example 5: Analysis for E77 Effect According to Direction and Position in Vector
(36) It is known that the effects of some elements in the cis-regulatory element could be improved according to the direction in which the vector is inserted or the positional relation with the target gene. Accordingly, in the case of E77, it was checked whether E77 had directional properties of being inserted into the vector and effects according to the position. When forming cell groups and comparing the degree of fluorescence shown by the cell groups, there were many cells which did not express GFP when the selective marker was expressed by a promoter separated from the CMV promoter. Thus, in order to reduce an error resulting therefrom, the vector was constructed to be expressed in the form of GFP-IRES-ZeoR by using the IRES so as to be expressed green fluorescent protein which intends to express and zeocin resistance gene (ZeoR), which is the selective marker, as one transcription unit. The IRES was obtained from pIRES vector (clontech). After the PCR was performed on each gene of GFP, IRES and ZeoR, the IRES and ZeoR PCR products were used as templates for performing the second PCR. Then, the IRES-ZeoR PCR product and the GFP PCR product were used as templates for performing the third PCR, thereby obtaining GFP-IRES-ZeoR gene. The pcDNA3.1/Zeo vector was treated with PvuII restriction enzyme and was self-spliced to constitute the vector where zeocin resistance gene was removed. The GFP-IRES-ZeoR gene was inserted into its multi-cloning site to constitute the vector. This vector was called pGIZ. E77 (SEQ ID NO: 1) was inserted into the 5 portion of the CMV promoter in the constructed vector, and 77E insertion vector which puts the same in a reverse order was also constructed. Additionally, the vector which puts E77 at the 3 portion of GFP-IRES-ZeoR gene and the vector which puts the same at both the positions of 5 and 3 were also constructed (
Example 6: Analysis for Effect of Modified E77
(37) As mentioned in Example 3, E77 consists of two gene fragments. Accordingly, the analysis was conducted as to whether the same effect as E77 could be shown only when each of the two gene fragments exists, and whether the sequence extending the gene portion to which the front gene fragment belongs to the front and back also has the effect.
(38) Specifically, the front portion of the gene fragment constituting E77 (SEQ ID NO: 1) was called E77-t1 (SEQ ID NO; 2), and the back portion thereof was called E77-t2 (SEQ ID NO: 3). The sequence extending the gene to which E77-t1 fragment belongs was called Ex77 (SEQ ID NO: 4). Ex77 corresponds to 2639-7786 bp of AFTD01141246 obtained through the homology search of CHO-K1[ATCC]_genbank_contig nucleotide database among CHO genome database at www.chogenome.org. AFTD01141246 gene is a gene fragment (contig) belonging to a part of NW_003615552 gene (homology analysis of CHO-K1[ATCC]_refseq_scaffold database), and since the role of the gene has not been clarified yet, the gene fragment inserted into the corresponding vector was obtained as below. The vector including E77 was used as a template, the gene fragment obtained by performing PCR using the primers E77-F (SEQ ID NO: 10) and E77-t1-R (SEQ ID NO: 11) was called E77-t1 (SEQ ID NO: 2), and the gene fragment obtained by performing PCR using the primers E77-t2-F (SEQ ID NO: 12) and E77-R (SEQ ID NO: 13) was called E77-t2 (SEQ ID NO: 3). Ex77 (SEQ ID NO: 4) was obtained by performing the PCR using CHO-K1 genome DNA as a template, and using primers Ex77-F (SEQ ID NO: 14) and Ex77-R (SEQ ID NO: 15). The gene fragment obtained through the PCR was inserted into the BamHI position where the CMV promoter of pGIZ vector starts by using the In-fusion HD cloning kit. The primers used for PCR and In-fusion are as shown in Table 2 below.
(39) The cells transduced with the pGIZ vector into which the gene fragment is inserted forms a stable cell group through the selective medium culture, and the degree of fluorescence of each cell group was compared by using flow cytometry (Guava, Millipore).
(40) TABLE-US-00002 TABLE2 Primersequencesforgenefragmentinsertion SEQID Sequence Primer NO. name direction Sequence(5.fwdarw.3) 10 E77-F Forward TACGGGCCAGATATACGCGGATCATTG direction AGTGTACATTC 11 E77-t1-R Reverse GTCAATAATCAATGTCAACGATCAACT direction TTCATAGAACAG 12 E77-t2-F Forward TACGGGCCAGATATACGCGATCTCTAC direction TTGGAAGGTATAG 13 E77-R Reverse GTCAATAATCAATGTCAACGGATCCCA direction AGGGCTAAGACC 14 Ex77-F Forward GGGCCAGATATACGCGGATCGGAGTCT direction TTACACCCATAGATC 15 Ex77-R Reverse ATAATCAATGTCAACGGATCGGTTCTT direction
(41) As a result of comparing fluorescence values between each cell group, it was confirmed that about 30 to 50% of cells had a higher expression level than the control group (
Example 7: Analysis for Yield of Antibody of Vector Using E77
(42) In order to confirm whether E77 (SEQ ID NO: 1) and Ex77 (SEQ ID NO: 4) affect the expression rate of a protein other than the fluorescent protein, the antibody production vector into which E77 (SEQ ID NO: 1) and Ex77 (SEQ ID NO: 4) are inserted was constructed and introduced into animal cells to measure the yield of the antibody.
(43) Specifically, the antibody production vector was constructed to express from the CMV promoter as starting to the genes encoding the antibody heavy chain and light chain connected through IRES (Internal Ribosome Entry Site) in one transcription unit. In the same manner as the above experiment, E77 and Ex77 were inserted into the BamHI position in front of the CMV promoter. Since zeocin resistance gene is expressed by another promoter, IRES-GFP was connected to zeocin gene for constructing the internal control group so that green fluorescent protein could be expressed together. After transducing CHO-K1 cell line (ATCC CCL-61) with the constructed vector and forming a stable cell group in the selective medium, the staining was performed with the antibody to which PE, a fluorescent material, is coupled, and the cells showing top 5% of expression rate were classified by using a cell sorter. In order to measure the yield of antibody of the classified cells, cells were cultured on the plates with the concentration of 110.sup.5 cells/ml, the culture medium was removed after 4 days of culture, and the number of cells was measured. The culture medium was subjected to centrifugation, supernatant was stored at 20 C., and the amount of antibody was measured later through an enzyme-linked immunosorbent assay. The enzyme-linked immunosorbent assay was performed by using IgG ELISA kit (Bethyl lab) and performed according to the manufacturer's instructions. The antibody fluorescence staining for the cells was performed again together with quantitative analysis to conduct qualitative analysis through the flow cytometry.
(44) As a result of confirmation after the culture for 4 days, it was confirmed that the cell group into which the vector inserting E77 (SEQ ID NO: 1) was introduced showed the yield of antibody increased by three times and the yield increased about 5 times per unit cell compared to the control group. Additionally, the cell group into which the vector inserting Ex77 (SEQ ID NO: 4) was introduced showed the yield increased about 3 times per unit cell compared to the control group (