Abstract
The present invention relates to a CD4.sup.+ T cell that produces high levels of IL-10 for use in the treatment and/or prevention of a tumor that expresses CD13, HLA-class I and CD54 and/or for use in inducing Graft versus tumour (GvT). The present invention relates also to a composition comprising said cell and to a method to select a subject to be treated with said cell.
Claims
1. A method of treatment and/or prevention of a tumor in a patient, wherein said tumor expresses CD13, HLA-class I and CD54, comprising administering an amount of CD4+ T cells that produces high levels of IL-10 to said patient.
2. The method according to claim 1 wherein said cells are modified to produce high levels of IL-10.
3. The method according to claim 1 wherein said cells are genetically modified to produce IL-10.
4. The method according to claim 1 wherein said cells express CD18 and/or CD2 and/or CD226.
5. The method according to claim 1 wherein said cells prevent GvHD.
6. The method according to claim 1 wherein said cells induce Graft versus Tumour (GvT) and/or induces Graft versus leukemia (GvL).
7. The method according to claim 1 wherein said cells are autologous, heterologous, polyclonal or allo-specific.
8. The method according to claim 1 wherein said tumor further expresses at least one marker selected from the group consisting of: CD112, and CD58.
9. The method according to claim 1 wherein said tumor further expresses CD155.
10. The method according to claim 1 wherein the tumor is a solid or hematological tumor.
11. The method according to claim 9 wherein said tumor is leukemic or a myeloid tumor.
12. The method according to claim 10 wherein the tumor is mediated by a cell selected from the group consisting of: macrophage, monocyte, granulocyte, erythrocyte, thrombocyte, mast cell, B cell, T cell, NK cell, dendritic cell, Kupffer cell, microglial cell and plasma cell.
13. The method according to claim 11 wherein the solid tumor or the hematological tumor is selected from a cell of the group consisting of: Adrenal Cancer, Anal Cancer, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain/CNS Tumors In Adults, Brain/CNS Tumors In Children, Breast Cancer, Breast Cancer In Men, Cancer of Unknown Primary, Castleman Disease, Cervical Cancer, Colon/Rectum Cancer, Endometrial Cancer, Esophagus Cancer, Ewing Family Of Tumors, Eye Cancer, Gallbladder Cancer, Gastrointestinal Carcinoid Tumors, Gastrointestinal Stromal Tumor (GIST), Gestational Trophoblastic Disease, Hodgkin Disease, Kaposi Sarcoma, Kidney Cancer, Laryngeal and Hypopharyngeal Cancer, Leukemia, Acute Lymphocytic (ALL), Acute Myeloid (AML, including myeloid sarcoma and leukemia cutis), Chronic Lymphocytic (CLL), Chronic Myeloid (CML) Leukemia, Chronic Myelomonocytic (CMML), Leukemia in Children, Liver Cancer, Lung Cancer, Lung Cancer with Non-Small Cell, Lung Cancer with Small Cell, Lung Carcinoid Tumor, Lymphoma, Lymphoma of the Skin, Malignant Mesothelioma, Multiple Myeloma, Myelodysplastic Syndrome, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin Lymphoma, Non-Hodgkin Lymphoma In Children, Oral Cavity and Oropharyngeal Cancer, Osteosarcoma, Ovarian Cancer, Pancreatic Cancer, Penile Cancer, Pituitary Tumors, Prostate Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, SarcomaAdult Soft Tissue Cancer, Skin Cancer, Skin CancerBasal and Squamous Cell, Skin CancerMelanoma, Skin CancerMerkel Cell, Small Intestine Cancer, Stomach Cancer, Testicular Cancer, Thymus Cancer, Thyroid Cancer, Uterine Sarcoma, Vaginal Cancer, Vulvar Cancer, Waldenstrom Macroglobulinemia, and Wilms Tumor.
14. The method according to claim 1 wherein the tumor is refractory to a therapeutic intervention.
15. The method according to claim 1 wherein said cell is used in combination with a therapeutic intervention.
16. The method according to claim 15 wherein the therapeutic intervention is selected from the group consisting of: chemotherapy, radiotherapy, allo-HSCT, blood transfusion, and blood marrow transplant.
17. The method of claim 13, wherein the condition treated is leukemia relapse.
18. A method to induce Graft versus tumour (GvT) in a patient, comprising administering an amount of CD4+ T cells that produces high levels of IL-10 to said patient.
19. The method according to claim 18 wherein said cells are modified to produce high levels of IL-10.
20. The method according to claim 18 wherein said cells are genetically modified to produce IL-10.
21. (canceled)
22. (canceled)
23. A method to select a subject to be treated with a CD4+ T cell that produces high level of IL-10 comprising detecting the presence of a cell that expresses CD13, HLA-class I and CD54 in a biological sample obtained from the subject, wherein if the presence of the cell that expresses CD13, HLA-class I and CD54 is detected, the subject is selected to be treated with said CD4+ T cell.
24. The method according to claim 23 wherein the cell further expresses CD112 and/or CD58.
25. The method according to claim 23 wherein the cell further expresses CD155.
26. A kit for use in the method according to claim 23 comprising means to detect the presence of a cell that expresses at least CD13, HLA-class I and CD54 in a biological sample.
Description
[0057] The present invention will be illustrated by means of non-limiting examples referring to the following figures.
[0058] FIG. 1. CD4.sup.IL-10 cells are phenotypically and functionally super-imposable to Tr1 cells. A. Scheme of the LV-IL-10/NGFR and LV-GFP/NGFR vectors. The presence of the bidirectional promoter (mCMV/PGK) allows the co-regulated expression of NGFR and human IL-10 or GFP genes. , encapsidation signal including the 5 portion of GAG gene (GA); RRE, Rev-responsive element; cPPT, central poly-purine tract; polyA, poly-adenylation site from the Simian Virus 40; CTE, constitutive transport element; WPRE, woodchuck hepatitis virus post-transcription regulatory element. B. CD4.sup.IL-10 ) and CD4.sup.GFP cells were stimulated with immobilized anti-CD3 and soluble anti-CD28 mAbs for 48 hours and IL-10, IL-4, IFN-, and IL-17 levels were measured by ELISA in culture supernatants. All samples were tested in duplicate-triplicate. MeanSEM of n=35 for IL-10 and IL-4, n=29 for IFN-, and n=7 for IL-17 of CD4.sup.IL-10 cells and of n=19 for IL-10 and IL-4, n=16 for IFN-, and n=12 for IL-17 of CD4.sup.GFP cells are presented. ** P0.01; **** P0.0001, Mann Whitney t-test. C. CD4.sup.IL-10 cells suppress T cell proliferation in vitro. Allogeneic PBMC cells were labeled with CSFE and stimulated with immobilized anti-CD3 and anti-CD28 mAbs alone (filled light grey histogram) or in the presence of CD4.sup.IL-10 cells (red solid line) or CD4.sup.GFP cells (black solid line) at 1:1 ratio. After 4 days of culture, the percentage of proliferating PBMC was determined by CSFE dilution. One representative donor out of six tested is shown. The suppression mediated by CD4.sup.IL-10 cells or CD4.sup.GFP cells was calculated as follows: ([proliferation responder-proliferation transduced)/proliferation responder]100). D. The expression of CD18, CD2 and CD226 on freshly isolated CD4.sup.+ T, CD4.sup.IL-10, and CD4.sup.GFP cells was evaluated by FACS. Un-stained CD4.sup.IL-10 cells (filled light gray histogram, isotype control), freshly isolated CD4.sup.+ T cells (dashed black line histogram), CD4.sup.GFP cells (black line histogram), CD4.sup.IL-10 cells (red solid line histogram). Numbers indicate the MFI on CD4.sup.+ gated cells. One representative donor out of 5 tested is shown.
[0059] FIG. 2. CD4.sup.IL-10 cells specifically lyse myeloid cell lines in HLA-class and I-GzB-dependent manner. A. CD4.sup.IL-10 and CD4.sup.GFP cells were co-cultured with CD3, CD14, U937, BV-173, Daudi, K562 and ALL-CM target cell lines at 5:1 (E:T) ratio. After 6 hours, degranulation of CD4.sup.IL-10 and CD4.sup.GFP cells was measured by the co-expression of CD107a and Granzyme (GzB). Numbers in quadrants indicate percentage of positive cells, one representative donor is depicted. B. Cytotoxicity of CD4.sup.IL-10 and CD4.sup.GFP cells against U937, BV-173, Daudi, K562, and ALL-CM cells was determined by .sup.51Cr-release assay. MeanSEM of cytotoxicity performed in duplicated is reported; meanSEM of n=6 and of n=4 independent donors for CD4.sup.IL-10 and CD4.sup.GFP cells against ALL-CM and U937 cells, and of n=4 and of n=2 for CD4.sup.IL-10 and CD4.sup.GFP cells against BV-173, Daudi, and K562 cells. *P<0.05, Mann Whitney t-test. C. CD4.sup.IL-10 and CD4.sup.GFP cells were co-cultured with CD14, U937, BV-173, K562, THP-1, and ALL-CM cells at 1:1 ratio. After 3 days, residual leukemic cell lines (CD45.sup.lowCD3.sup.) were analyzed and counted by FACS. Cytolysis mediated by CD4.sup.IL-10 cells was measured as elimination index (see Material and Methods) for each target cells. Analysis was performed at least in three independent experiments. Dots represent the elimination index of CD4.sup.IL-10 cells generated from different healthy donors. Lines represent mean values of the elimination index. Rectangular box indicates the threshold of cytotoxicity. D. CD4.sup.IL-10 and CD4.sup.GFP cells were co-cultured with ALL-CM or U937 target cell line at 1:1 (E:T) ratio in the presence of 10 g/ml of anti-HLA class I or isotype control mAbs. After 3 days, residual leukemic cell lines (CD45.sup.lowCD3.sup.) were analyzed and counted by FACS. Cytolytic effect by CD4.sup.IL-10 cells was measured as elimination index for each target cells. Dots represent CD4.sup.IL-10 cells generated from different healthy donors. Lines represent mean values of the elimination index. *P<0.05, Mann Whitney t-test. E. CD4.sup.IL-10 cells were pre-incubated with Z-AAD-CMK at the indicated concentrations and co-cultured with ALL-CM and U937 target cell at 50:1 (E:T) ratio, and cytotoxicity was determined by .sup.51Cr release. MeanSEM of n=3 independent donors performed in triplicates is reported.
[0060] FIG. 3. CD4.sup.IL-10 cells specifically degranulate when co-cultures with myeloid cells. CD4.sup.IL-10 and CD4.sup.GFP cells were co-cultured with CD3, CD14, U937, BV-173, Daudi, K562 and ALL-CM target cell lines at 5:1 (E:T) ratio. After 6 hours, degranulation of CD4.sup.IL-10 and CD4.sup.GFP cells was measured by the co-expression of CD107a and Granzyme (GzB). MeanSEM of n=15 for CD4.sup.IL-10 cells, and n=12 for CD4.sup.GFP cells cultured alone or with ALL-CM or U937 cells, n=5 for CD4.sup.IL-10 cells and n=2 for CD4.sup.GFP cells co-cultured with CD3 cells, n=10 for CD4.sup.IL-10 cells and n=8 for CD4.sup.GFP cells co-cultured with CD14 cells, n=5 for CD4.sup.IL-10 cells and n=6 for CD4.sup.GFP cells co-cultured with BV-173 cells, n=4 for CD4.sup.IL-10 cells and n=6 for CD4.sup.GFP cells co-cultured with Daudi cells, and n=11 or CD4.sup.IL-10 cells and n=9 for CD4.sup.GFP cells co-cultured with K562 cells is reported. *** P0.001; **** P0.0001, Mann Whitney t-test.
[0061] FIG. 4. CD4.sup.IL-10 cells specifically kill in vitro primary blasts expressing CD13, CD54, and CD112. A. The expression of the CD13, CD54, HLA-class I, CD58, CD155, and CD112 on freshly isolated CD14 cells, U937, BV-173, K562, Daudi, THP-1, and ALL-CM cell lines was analyzed by FACS. Numbers indicate the percentages of positive cells (black solid line) according to isotype control (filled light gray histogram). B. CD4.sup.IL-10 and CD4.sup.GFP cells were co-cultured with primary blast at 1:1 (E:T) ratio. After 3 days, residual leukemic blasts (CD45.sup.lowCD3.sup.) were analyzed and counted by FACS. Cytolytic effect of CD4.sup.IL-10 cells was measured as elimination index (see Material and Methods) for each target cells. Dots represent each primary blast co-cultured with CD4.sup.IL-10 cells. Rectangular box indicates the threshold of cytotoxicity. C. Correlation between cytotoxicity and expression of specific markers on primary blasts. Plots represent percentages of CD13, CD54, HLA-class I, CD58, CD155, and CD112 positive primary blasts versus elimination index of CD4.sup.IL-10 cells for each primary blast tested in a co-culture assay (meanSEM). The line represents the linear regression. The P value of the correlation and the coefficient of determination (R2) are reported (two-tailed test).
[0062] FIG. 5. CD13 expression defines the killing specificity of CD4.sup.IL-10 cells. A. The expression of the CD13, CD54, HLA-class I, CD58, CD155, and CD112 on U266, and MM1S cell lines was analyzed by FACS. Numbers indicate the percentages of positive cells (black solid line) according to isotype control (filled light gray histogram). B. CD4.sup.IL-10 and CD4.sup.GFP cells were co-cultured with ALL-CM, K562, MM1S, and U266 cells at 1:1 ratio. After 3 days, residual leukemic cell lines (CD45.sup.lowCD3.sup.) were analyzed and counted by FACS. Cytolysis mediated by CD4.sup.IL-10 cells was measured as elimination index (see Material and Methods) for each target cells. Analysis was performed at least in three independent experiments. Dots represent the elimination index of CD4.sup.IL-10 cells generated from different healthy donors. Lines represent mean values of the elimination index. Rectangular box indicates the threshold of cytotoxicity.
[0063] FIG. 6. The molecular mechanism underlying the lytic activity of CD4.sup.IL-10 cells is comparable to that of bona fide Tr1 cells. This mechanism requires stable adhesion between CD4.sup.IL-10 cells and CD13.sup.+ blasts mediated by LFA-1/CD54 interaction, activation of CD4.sup.IL-10 cells via HLA class I (Signal 1), via CD2 (Signal 2), and via CD226 (Signal 3), leading to GzB release and killing of leukemic blasts.
[0064] FIG. 7. The in vivo localization of CD4.sup.IL-10 cells influences their anti-leukemic activity. A. CD4.sup.IL-10 cells delayed the subcutaneous ALL-CM tumor growth. NSG mice were sub-cutaneously injected with ALL-CM (210.sup.6 cells/mouse). Three days later mice received allogeneic PBMC (210.sup.6 cells/mouse), or CD4.sup.IL-10 cells, or CD4.sup.GFP cells (110.sup.6 cells/mouse). Tumor growth was measured at the indicated time points after ALL-CM injection. Statistical analysis were perform by comparing CD4.sup.IL-10 cells treated mice (ALL-CM+CD4.sup.IL-10) versus un-treated control mice (ALL-CM): *P<0.05, **P0.01; *** P0.001; two-way ANOVA plus Bonferroni post test. B. CD4.sup.IL-10 cells do not mediate GvL effect in the ALL-CM leukemia model of T-cell therapy. NSG mice were intravenously injected with ALL-CM (510.sup.6 cells/mouse) alone or, on day three, with allogeneic PBMC (510.sup.6 cells/mouse), CD4.sup.IL-10 cells, or CD4.sup.GFP cells (2.510.sup.6 cells/mouse). Leukemia free survival (presence of more than 50% of circulating human blast hCD45.sup.+hCD3.sup. in peripheral blood) was followed over time after cell injection. Data obtained from four independent experiments are presented. C. In vivo localization of CD4.sup.IL-10 cells. NSG mice were intravenously injected with ALL-CM (510.sup.6 cells/mouse) alone or, on day three, with allogeneic PBMC (510.sup.6 cells/mouse), CD4.sup.IL-10 cells, or CD4.sup.GFP cells (2.510.sup.6 cells/mouse). On day 7 and 14 the percentages of human T cells (hCD45.sup.+hCD3.sup.+) in peripheral blood, bone marrow, spleen, lung, and liver were evaluated by FACS. MeanSD of n=6 mice for ALL-CM+PBMC and for ALL-CM+CD4.sup.GFP cells, and n=7 mice for ALL-CM+CD4.sup.IL-10 cells in the peripheral blood on day 7, and meanSD n=3 mice for ALL-CM+PBMC and ALL-CM+CD4.sup.GFP cells, and n=4 mice for ALL-CM+CD4.sup.IL-10 cells, on day 7 in other organs (upper panel). MeanSD of n=3 mice per group on day 14 (lower panel). D. CD4.sup.IL-10 cells mediate anti-leukemic effect in a model of extramedullary tumors. NSG mice were intravenously injected with THP-1 leukemia cells (210.sup.6 cells/mouse). Three days later mice received allogeneic PBMC (210.sup.6 cells/mouse), or fourteen days later mice were injected with CD4.sup.IL-10 cells, or CD4.sup.GFP cells (110.sup.6 cells/mouse). Tumor growth was analyzed by measuring the weights of THP-1-infiltrated livers. MeanSEM of n=6 mice for THP-1, n=5 mice THP-1+PBMC, n=4 mice for THP-1+CD4.sup.IL-10 cells, and n=2 mice for THP-1+CD4.sup.GFP cells are presented.
[0065] FIG. 8. CD4.sup.IL-10 cells do not express CXCR4. CD4.sup.IL-10 cells, ALL-CM, and PBMC were analyzed for the expression of CXCR4 and of CD62L by FACS. Numbers indicate the percentage of positive cells (black solid line) according to isotype control (filled light gray histogram). One representative out of three tested is shown.
[0066] FIG. 9. Adoptive transfer of CD4.sup.IL-10 cells prevents GvHD while spearing the Graft-versus-Leukemia of allogeneic T cells. A. In vivo localization of CD4.sup.IL-10 cells in conditioned mice. NSG mice were sub-lethally irradiated and intravenously injected with ALL-CM (510.sup.6 cells/mouse). Three days later mice day 7 and 14 the percentages of human T cells (hCD45.sup.+hCD3.sup.+) and ALL-CM (hCD45.sup.+hCD3.sup.) in bone marrow and peripheral blood were evaluated by FACS. MeanSEM of n=9 mice for ALL-CM+PBMC, and for ALL-CM+CD4.sup.IL-10 cells, and n=7 for ALL-CM+CD4.sup.GFP cells on day 7, and n=14 for ALL-CM+PBMC, n=11 for ALL-CM+CD4.sup.IL-10 cells, and n=7 for ALL-CM+CD4.sup.GFP cells on day 14 in the bone. MeanSEM of n=17 mice for ALL-CM+PBMC and for ALL-CM+CD4.sup.IL-10 cells, and n=10 for ALL-CM+CD4.sup.GFP cells on day 7, and n=16 for ALL-CM+PBMC, n=14 for ALL-CM+CD4.sup.IL-10 cells, and n=8 for ALL-CM+CD4.sup.GFP cells on day 14 in the peripheral blood. Data were obtained from two to five independent experiments. B. Adoptive transfer of CD4.sup.IL-10 cells prevents xeno-GvHD while sparing GvL mediated by human allogeneic PBMC. NSG mice were sub-lethally irradiated and intravenously injected with ALL-CM (510.sup.6 cells/mouse). Three days later mice received allogeneic PBMC (510.sup.6 cells/mouse) alone or in combination with CD4.sup.IL-10 cells (2.510.sup.6 cells/mouse). As control mice were injected with CD4.sup.IL-10 cells or CD4.sup.GFP cells (2.510.sup.6 cells/mouse) alone. Leukemia free survival (presence of more than 50% of circulating human blast hCD45.sup.+hCD3.sup. in peripheral blood) and xeno-GvHD free survival (presence of more than 50% of circulating human T lymphocytes hCD45.sup.+hCD3.sup.+ in peripheral blood with a loss of weight higher than 20%) was followed over time after cell injection. Statistical analysis were perform by comparing treated mice versus un-treated control mice (ALL-CM): *P<0.05, **** P0.0001; two-way ANOVA plus Bonferroni post-test.
[0067] FIG. 10. CD4.sup.IL-10 cells express TIGIT (T cell immunoreceptor with Ig and ITIM domains). CD4.sup.GFP and CD4.sup.IL-10 cells were analyzed for the expression of TIGIT by FACS. Numbers indicate the percentage of positive cells (CD4.sup.GFP cells, black solid line, CD4.sup.IL-10 cells, red solid line) according to isotype control (filled light gray histogram). One representative out of three tested is shown.
[0068] FIG. 11. Enriched allo-specific CD4.sup.+ T cells are efficiently transduced with LV-IL-10. A. Protocol to generate and characterize allo-CD4.sup.IL-10 cells. Enriched allo-specific CD4.sup.+ T cells were transduced with LV-IL-10 or LV-GFP during a secondary stimulation with the same allo-mDC used for priming (see also Material and Methods). Human CD4.sup.+ T cells were stimulated with allo-mDC for 14 days. After culture, CD4.sup.+ T cells were re-stimulated with allo-mDC 24 hours before transduction with LV-IL-10 or LV-GFP at MOI of 20. B. Analysis of the transduced cells analyzed by FACS at day 6 after the transduction. The frequencies of NGFR.sup.+ cells are indicated. Collective results from individual donors are presented. Each dot represent a single donor tested, lines indicate the meanSEM of the percentage of transduction.
[0069] FIG. 12. Enforced IL-10 expression in allo-specific CD4.sup.+ T cells promotes their conversion into Tr1-like cells with the ability to kill myeloid cells. A. The proliferative responses were evaluated 3 or 5 days after culture of allo-CD4.sup.IL-10 and allo-CD4.sup.NGFR cells with allogeneic (allo-mDC) or third party mDC, respectively, by .sup.3HThy incorporation for additional 16 hours. Bars represent mean value with SEM of n=19 for allogeneic stimulation and n=16 for third party stimulation tested in more than 5 independent experiments. All samples were tested in duplicate-triplicate, *** p<0.001, Wilcoxon matched-pairs signed rank test. B. Allo-CD4.sup.IL-10 or allo-CD4.sup.NGFR cells were left inactivated or stimulated with the same allo-mDC used for priming or a third party mDC (ratio 10:1), and IL-10 production was determined by ELISA 48 hours after activation. Bars represent the mean value with SEM of n=12-26 donors tested in 5 independent experiments. All samples were tested in duplicate-triplicate, *** p<0.001, **** p<0.0001 Wilcoxon matched-pairs signed rank test. C. Allo-CD4.sup.IL-10 or allo-CD4.sup.NGFR cells were tested for their ability to suppress proliferation of autologous CD4.sup.+ T cells primed with allo-mDC. Autologous primed CD4.sup.+ T cells (Responders) were labeled with eFluor dye and stimulated with allo-mDC (ratio 10:1) alone or in the presence of allo-CD4.sup.IL-10 or allo-CD4.sup.NGFR cells at 1:1 ratio. After 3 days of culture the suppressive ability was determined by analyzing the eFluor dye dilution. One representative donor out of four tested is shown in the left panel. The suppression mediated by allo-CD4.sup.IL-10 cells or allo-CD4.sup.NGFR cells was calculated as follows: ([proliferation responder-proliferation transduced)/proliferation responder]100). On the right panel, dots represent the suppression of allo-CD4.sup.IL-10 cells or allo-CD4.sup.NGFR cells generated from different healthy donors. Lines represent mean valueSEM of % of suppression. D. CD4.sup.IL-10 and CD4.sup.NGFR cells were co-cultured with ALL-CM, U937, K562, mDC allo or mDC third party as target cells at 1:1 ratio. After 3 days, residual leukemic cell lines (CD45.sup.lowCD3.sup.) were analyzed and counted by FACS. Cytolysis mediated by CD4.sup.IL-10 cells was measured as elimination index (see Material and Methods) for each target cells. Analysis was performed in two independent experiments. Dots represent the elimination index of CD4.sup.IL-10 cells generated from different healthy donors co-cultured with n=5 ALL-CM cells, n=6 U937 cells, n=6 K562 cells, n=4 mDC allo, and n=4 mDC third party. Lines represent mean values of the elimination index. Rectangular box indicates the threshold of cytotoxicity.
[0070] FIG. 13. HLA-class I expression is abolished by 2 microglobulin gene disruption. The expression of the CD54, HLA-class I, CD58, CD155, and CD112 on 2m.sup./ ALL-CM and 2m.sup./ U937 cell lines was analyzed by FACS. Numbers indicate the percentages of positive cells (black solid line) according to isotype control (filled light gray histogram). Data representative of at least three independent experiments are shown.
[0071] FIG. 14. CD4.sup.IL-10 cell-mediated killing of myeloid cell lines is HLA-class I-dependent. A. CD4.sup.IL-10 and CD4.sup.NGFR cells were co-cultured with ALL-CM, 2m.sup./ ALL-CM, U937 or 2m.sup./ U937 target cell line at 1:1 (E:T) ratio. After 3 days, residual leukemic cell lines (CD45.sup.lowCD3.sup.) were analyzed and counted by FACS. Cytolytic effect by CD4.sup.IL-10 cells was measured as elimination index for each target cells. Dots represent CD4.sup.IL-10 generated from n=8 different healthy donors co-cultured with ALL-CM and 2m.sup./ ALL-CM, n=5 different healthy donors co-cultured with U937 and 2m.sup./ U937 tested in two independent experiments. * P<0.05, ** P<0.001 two-sided Wilcoxon matched-pairs signed rank test. B. CD4.sup.IL-10 and CD4.sup.NGFR cells were co-cultured with ALL-CM or U937 target cell line at 5:1 (E:T) ratio in the presence of 10 g/ml of anti-HLA class I or isotype control mAbs. After 6 hours, degranulation of CD4.sup.IL-10 and CD4.sup.NGFR cells was measured by the co-expression of CD107a and Granzyme (GzB). A MeanSEM of GzB.sup.+CD107a.sup.+ CD4.sup.IL-10 cell, generated from eight different healthy donors tested in two independent experiments, is reported. * P<0.05, two-sided Wilcoxon matched-pairs signed rank test.
[0072] FIG. 15. CD4.sup.IL-10 cell-mediated killing of myeloid cell lines is TCR-independent. CD4.sup.IL-10 and CD4.sup.NGFR cells were co-cultured with ALL-CM or U937 target cell line at 5:1 (E:T) ratio in the presence of 10 g/ml of anti-HLA class II or isotype control mAbs. After 6 hours, degranulation of CD4.sup.IL-10 and CD4.sup.NGFR cells was measured by the co-expression of CD107a and Granzyme (GzB). A MeanSEM of GzB.sup.+CD107a.sup.+ CD4.sup.IL-10 cell, generated from four different healthy donors tested in two independent experiments, is reported.
DETAILED DESCRIPTION OF THE INVENTION
[0073] Material and Methods
[0074] Plasmid construction. The coding sequence of human IL-10 was excised from pH15C (ATCC n 68192). The resulting 549 bp fragment was cloned into the multiple cloning site of pBluKSM (Invitrogen) to obtain pBluKSM-hIL-10. A fragment of 555 bp was obtained by excision of hIL-10 from pBluKSM-hIL-10 and ligation to 1074.1071.hPGK.GFP.WPRE.mhCMV.dNGFR.SV40PA (here named LV-NGFR), to obtain LV-IL-10/NGFR. The presence of the bidirectional promoter (human PGK promoter plus minimal core element of the CMV promoter in opposite direction) allows co-expression of the two transgenes. The sequence of LV-IL-10/NGFR was verified by pyrosequencing (Primm).
[0075] Vector production and titration. VSV-G-pseudotyped third generation LVs were produced by Ca.sub.3PO.sub.4 transient four-plasmid co-transfection into 293T cells and concentrated by ultracentrifugation as described .sup.19 with a small modification: 1 M sodium butyrate was added to the cultures for vector collection. Titer was estimated on 293T cells by limiting dilution, and vector particles were measured by HIV-1 Gag p24 antigen immune capture (NEN Life Science Products; Waltham, Mass.). Vector infectivity was calculated as the ratio between titer and particle. For concentrated vectors, titers ranged from 510.sup.8 to 610.sup.9 transducing units/ml, and infectivity from 510.sup.4 to 10.sup.5 transducing units/ng of p24.
[0076] Patients and donors. All protocols were approved by the Institutional Review Board and samples collected under written informed consent according to the Declaration of Helsinki. Patient characteristics are listed in Table 1.
TABLE-US-00001 TABLE 1 Patients' characteristics. Blasts Leu # Sex/age .sup.1FAB .sup.2WHO Cytogenetics Molecular Markers Source (%) #1 AML #61 F/71 M0 AML N.A. Flt3 ITD+/NPMI+ PB 92% #2 AML #63 F/83 M0 AML with minimal maturation del7, t(1;7), t(4;12) Flt3 ITD+/NPMI+ PB 98% #3 AML #39 F/47 M1 AML without maturation 46, XX Flt3 ITD/NPMI BM 79% #4 AML #60 F/64 M1 AML 46, XX Flt3 ITD+/NPMI BM 78% #5 AML #1 F/50 M1 AML without maturation N.A. Flt3 ITD/NPMI+ PB 98% #6 AML #64 M/60 M2 AML with t(8;21)RUNX1-RUNKX1T1 del9, t(8;21) Flt3 ITD+/NPMI+ PB 26% #7 AML #37 F/59 M2 AML with maturation 46, XX Flt3 ITD/NPMI+ BM 54% #8 AML #5 F/66 M2 AML with maturation dup8 Flt3 ITD+/NPMI+ PB 65% #9 ALL 57 M/38 ALL ALL-T N.A. N.A. PB 46% #10 ALL #48 F/22 ALL ALL N.A. N.A. BM 85% #11 ALL 62 F/76 ALL ALL-B L2 N.A. Flt3 ITD+/NPMI+ PB 91% .sup.1AML and ALL subtypes according to the French-American-British (FAB) classification. .sup.2AML and ALL chategories according to the World Health Organization (WHO) classification. N.A. Not Applicable; Flt3 ITD, Flt3 internal-tandem duplication; NPM1, nucleophosmin; BM, bone marrow, PB, peripheral b
[0077] Peripheral blood mononuclear cells (PBMC) were prepared by centrifugation over Ficoll-Hypaque gradients. CD4.sup.+ T cells were purified by negative selection with the CD4 T cell isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany) with a resulting purity of >95%. CD14.sup.+ and CD3.sup.+ T cells were purified by positive selection with CD14.sup.+ and CD3.sup.+ Microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) with a resulting purity of >95%. U937 (monocytic cell line), K562 (erythroleukemic cell line), BV-173 (a pre-B lymphoblastic leukemia .sup.20, Daudi (B lymphoblastic cell line), THP1 (myelomonocytic leukemia) cell lines were obtained from the ATCC. ALL-CM cell line derived from a CML patient suffering from a Philadelphia chromosome-positive lymphoid blast crisis is described in Bondanza et al..sup.41. To generate 2m-deficient ALL-CM and U937 cell lines, cells were nucleofected by Amaxa 4D Nucleofector System with X-unit (LONZA group ltd, CH) using EP100 program. Briefly, 310.sup.5 cells were re-suspended in a solution containing 20 l of SF solution (LONZA) and 3 l of pre-mixed Cas9 plasmid (500 ng) and the specific B2M guide #18 CRISPR plasmid (GAGTAGCGCGAGCACAGCTA (SEQ ID No. 1) cut in B2M exon1, 250 ng). After nucleofection, cells were expanded in culture. All cell lines were routinely tested for mycoplasma contamination.
[0078] Transduction of human CD4.sup.+ T cells. CD4.sup.+ purified T cells were activated for 48 hours with soluble anti-CD3 monoclonal antibody (mAb, 30 ng/ml, OKT3, Miltenyi Biotec, Bergisch Gladbach, Germany), anti-CD28 mAb (1 g/ml, BD, Biosciences) and rhIL-2 (50 U/ml, Chiron, Italy) and transduced with LV-GFP/NGFR (CD4.sup.GFP), LV-IL-10/NGFR)(CD4.sup.IL-10) with MOI of 20 as previously described .sup.18. Transduced CD4.sup.+NGFR.sup.+ T cells were purified 14 days after transduction by FACS-sorting or using CD271.sup.+ Microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and expanded in X-VIVO 15 medium supplemented with 5% human serum (BioWhittaker-Lonza, Washington, D.C.), 100 U/ml penicillin-streptomycin (BioWhittaker), and 50 U/ml rhIL-2. CD4.sup.GFP and CD4.sup.IL-10 cells were stimulated every two weeks in the presence of an allogeneic feeder mixture containing 10.sup.6 PBMC (irradiated at 6,000 rad) per ml, 10.sup.5 JY cells (an Epstein-Barr virus-transformed lymphoblastoid cell line expressing high levels of human leukocyte antigen and co-stimulatory molecules, irradiated at 10,000 rad) per ml, and soluble anti-CD3 mAb (1 g/ml). Cultures were maintained in 50-100 U/ml rhIL-2 (PROLEUKIN, Novartis, Italy). All FACS phenotypic analysis, in vitro and in vivo experiments were performed in cells from at least 12 days after feeder addition, in resting state.
[0079] To generate alloantigen-specific transduced cells, nave CD4.sup.+ T cells (10.sup.6/well) were stimulated with allogeneic mature dendritic cells (mDC) (10.sup.5/well) in a final volume of 1 mL in 24-well plates. At day 7 and 10, half of the medium was replaced by fresh medium supplemented with 25 U/ml of rhIL-2, and at day 14, cells were collected, washed and transduced with LV-GFP/NGFR (CD4.sup.NGFR) or LV-IL-10/NGFR (CD4.sup.IL-10) with MOI of 20 after 24 hours of secondary stimulation with the same allo-mDC used for priming. Transduced CD4.sup.+NGFR.sup.+ T cells were purified and expanded as above.
[0080] Cytokine determination. To measure cytokine production, CD4.sup.GFP and CD.sup.IL-10 cells were stimulated with immobilized anti-CD3 (10 g/ml) and soluble anti-CD28 (1 g/ml) mAbs in a final volume of 200 l of medium (96 well round-bottom plates, 210.sup.5/well). Culture supernatants were harvested after 48 hours of culture and levels of IL-4, IL-10, IFN- and IL-17, were determined by ELISA according to the manufacturer's instructions (BD Biosciences).
[0081] Suppression assays. To test the suppressive capacity of CD4.sup.GFP and CD4.sup.IL-10 cells, allogeneic PBMC were labeled with CFSE (Molecular Probes) or eFluor670 (Invitrogen) before stimulation with immobilized anti-CD3 (10 g/ml) and soluble anti-CD28 (1 g/ml) mAbs. Suppressor cells were added at 1:1 ratio. After 4-6 days of culture, proliferation of CFSE/eFluor670-labeled responder cells was determined by flow cytometry.
[0082] Cytotoxicity assays. T-cell degranulation was evaluated in a CD107a flow cytometric assay, according to the protocol described in .sup.6. In some experiments anti-HLA-class I (clone W6/32, Biolegend, USA) and isotype control (IgG2a,k, BD Pharmigen, USA) mAbs were added at the indicated concentrations. The cytotoxic activity of CD4.sup.GFP and CD.sup.IL-10 cells was analyzed in a standard .sup.51Cr-release assay as described in detail elsewhere. Briefly, 10.sup.3 51-Cr-labeled (NEN Dupont, Milan, Italy) target ALL-CM, BV-173, Daudi, U937 or K562 cells were incubated for 4 hours with CD4.sup.GFP and CD4.sup.IL-10 cells at various effector-target cell ratios, plated in duplicate. Subsequently, the supernatant was removed and counted on a counter. Percentage of specific lysis was calculated according to the formula: 100(.sup.51Cr experimental releasespontaneous release)/(maximum releasespontaneous release). In some experiments Z-AAD-CMK (Sigma, CA, USA) was added at the indicated concentrations. Alternatively, cytotoxicity of CD4.sup.GFP and CD4.sup.IL-10 cells was analysed in co-culture experiments. Briefly, target and effector cells (CD4.sup.GFP and CD4.sup.IL-10 cells) were plated in a ratio 1:1 for 3 days. At the end of co-culture, cells were harvested and surviving cells were counted and analysed by FACS. Elimination index (EI) was calculated as 1(number of target remained in the co-culture with CD4.sup.IL-10/number of target remained in the co-culture with CD4.sup.GFP). In some experiments anti-HLA-class I (clone W6/32, Biolegend, USA) and isotype control (IgG2a,k, BD Pharmigen, USA) mAb were added at the indicated concentrations.
[0083] Flow cytometry analysis. For the detection of cell surface antigens CD4.sup.IL-10 and CD4.sup.GFP cells were stained with anti-CD4 (BD Pharmingen, USA), anti-CD226 (Biolegend, USA), anti-CD2, anti-CD18, anti-CXCR4 (BD Pharmingen, USA) mAbs after a 2.4G2 blocking step. For the detection of cell surface antigens on target cells, leukemic cell lines and primary blasts were stained with anti-CD45, anti-HLA-class I, anti-CD112, anti-CD155 (Biolegend, USA), anti-CD13, anti-CD54, anti-CD58 (BD Pharmigen, USA). Cells were incubated with the aforementioned mAbs for 30 min at 4 C. in PBS 2% FBS, washed twice and fixed with 0.25% formaldehyde. To evaluate human chimerism in peripheral blood of treated NSG mice, cells were co-stained with anti-human CD45 (Biolegend), anti-human CD3 (BD Bioscience), anti-human CD33 (Miltenyi Biotech), anti-CD271 (Miltenyi Biotech) and anti-murine CD45 (BD Bioscience) mAbs.
[0084] Samples were acquired using a FACS Canto II flow cytometer (Becton Dickinson, USA), and data were analyzed with FCS express (De Novo Software, CA, USA). The inventors set quadrant markers to unstained controls.
[0085] Graft-versus-Leukemia model, ALL-CM leukemia model: 6- to 8-week-old female NSG mice were obtained from Charles-River Italia (Calco, Italy). The experimental protocol was approved by the internal committee for animal studies of the inventors institution (Institutional Animal Care and Use Committee [IACUC #488]). On day 0 mice were infused with ALL-CM leukemia (510.sup.6) and three days after with either allogeneic PBMC (510.sup.6) or CD4.sup.IL-10 or CD4.sup.GFP cells (2.510.sup.6). Cells were re-suspended in 250 l of PBS and infused intravenously. Survival and weight loss was monitored at least 3 times per week as previously described .sup.20 and moribund mice were humanely killed for ethical reasons. At weekly intervals, mice were bled and human chimerism was determined by calculating the frequency on human CD45.sup.+ cells within the total lymphocyte population. In some experiments mice were euthanized at day 7 and 14 after ALL-CM injection to analyse human cells distribution in different organs.
[0086] Graft-versus-Leukemia model, THP-1 leukemia model: 6- to 8-week-old female NSG mice were obtained from Charles-River Italia (Calco, Italy). The experimental protocol was approved by the internal committee for animal studies of the inventors institution (Institutional Animal Care and Use Committee [IACUC #488]). On day 0 mice were infused with THP-1 leukemia (210.sup.6) and three days after with allogeneic PBMC (210.sup.6) or fourteen days after with CD4.sup.IL-10 or CD4.sup.GFP cells (110.sup.6). Cells were re-suspended in 250 l of PBS and infused intravenously. Survival and weight loss was monitored at least 3 times per week as previously described .sup.20 and moribund mice were humanely killed for ethical reasons. Mice were euthanized at week 5 after THP1 injection to analyse human cells in the liver.
[0087] Subcutaneous ALL-CM tumor model: 6- to 8-week-old female NSG mice were used. The experimental protocol was approved by the internal committee for animal studies of San Raffaele Scientific Institute (Institutional Animal Care and Use Committee [IACUC #488]). On day 0 mice were infused with ALL-CM (210.sup.6) cells and three days later with allogeneic PBMC (210.sup.6) or with CD4.sup.IL-10 cells (110.sup.6) or CD4.sup.GFP cells (110.sup.6). Cells were re-suspended in 1 ml of PBS and infused sub-cutaneously. Sarcoma growth was monitored by measurements at least 3 times per week and moribund mice were humanely killed for ethical reasons.
[0088] Graft-versus-Leukemia and Graft-versus Host Disease model: 6- to 8-week-old female NSG mice were used. The experimental protocol was approved by the internal committee for animal studies of San Raffaele Scientific Institute (Institutional Animal Care and Use Committee [IACUC #488]). At day 0, mice received total body irradiation with a single dose of 175-200 cG irradiation from a linear accelerator according to the weight of mice, and were immediately infused with ALL-CM (510.sup.6). On day 3 mice were then injected with allogeneic PBMC (510.sup.6) alone or in the presence of with CD.sup.GFP and CD4.sup.IL-10 cells (2.510.sup.6). Cells were re-suspended in 250 l of PBS and infused intravenously. Survival and weight loss was monitored at least 3 times per week as previously described .sup.20 and moribund mice were humanely killed for ethical reasons. At weekly intervals, mice were bled and human chimerism was determined by calculating the frequency on human CD45.sup.+ cells within the total lymphocyte population. In some experiments mice were euthanized at day 7 and 14 after ALL-CM injection to analyse human cells distribution in different organs.
[0089] Statistical Analysis. Statistical analyses on the functional data were performed using a Mann-Whitney U test for non-parametric data and using a two-way analysis of variance test. ANOVA tests and Bonferroni's multiple comparisons were used to analyze the data from the in vivo experiments. P values less than 0.05 were considered significant. Statistic calculations were performed with the Prism program 5.0 (GraphPad Software).
[0090] Results
[0091] CD4.sup.IL-10 cells kill myeloid cells in HLA-class I- and GzB-dependent manner. The inventors generated CD4.sup.IL-10 cells by transducing CD4.sup.+ T cells with a novel bidirectional LV co-encoding human IL-10 and NGFR, as clinical grade marker gene (FIG. 1A). As control, T cells were transduced with a bidirectional LV co-encoding for GFP (in IL-10 position) and NGFR (FIG. 1A). As previously described .sup.18, enforced expression of human IL-10 into CD4.sup.+ T cells allows the generation of cells (CD4.sup.IL-10 cells) superimposable to Tr1 cells. CD4.sup.IL-10 cells, in contrast to control LV-transduced CD4.sup.GFP cells, secreted significantly higher levels of IL-10 (p0.0001). Significantly higher levels of IFN- (p0.01) and comparable low amounts of IL-4 and IL-17 (FIG. 1B) were observed. It is believed that the properties, characteristics and biological activities of CD4.sup.IL-10 cells are due to the high level of IL-10 produced. CD4.sup.IL-10 cells, but not CD4.sup.GFP cells, suppressed T-cell responses in vitro (FIG. 1C). CD4.sup.IL-10 cells expressed CD18, which in association with CD11a forms LFA-1, CD2 and CD226 at levels higher than those detected on memory freshly isolated CD4.sup.4+ T cells and on CD4.sup.GFP cells (FIG. 1D).
[0092] To evaluate the ability of CD4.sup.IL-10 cells to kill transformed myeloid cells, the inventors tested a panel of leukemic cell lines. Freshly isolated T lymphocytes (CD3) and monocytes (CD14) were used as negative and positive control, respectively. The inventors first evaluated the degranulation of CD4.sup.IL-10 and CD4.sup.GFP cells by the co-expression of GzB and the lysosomal-associated membrane protein1 (LAMP-1 or CD107a), a marker of cytotoxic degranulation in NK cells and cytotoxic T lymphocytes. When CD4.sup.IL-10 cells were co-cultured with CD14, U937, a monocytic cell lines, and ALL-CM, a cell line derived from a patient suffering from a lymphoblastic crisis of chronic myelogenous leukemia .sup.20,21, a significantly higher proportion of GzB.sup.+CD107a.sup.+ cells was detected (a minimum of nine donors were tested, CD4.sup.IL-10 versus CD4.sup.GFP, p0.001 and p0.0001, respectively, FIGS. 2A and 3). The frequency of GzB.sup.+CD107a.sup.+ cells generated in co-culture with U937 and ALL-CM cells was also significantly higher compared to the spontaneous degranulation of CD4.sup.IL-10 cells (p0.001 and p0.0001, paired T-test, respectively). Conversely, CD4.sup.IL-10 cells did not degranulate when co-cultured with CD3, BV-173, a pre-B lymphoblastic leukemia .sup.22, Daudi, a B lymphoblastic cell line, or K562, an erythroleukemic cell line (FIGS. 2A and 3). Consistent with the activation and the release of GzB, CD4.sup.IL-10 cells lysed at 100:1 (T.sup.eff:target) ratio U937 and ALL-CM cells at significantly higher levels as compared to CD4.sup.GFP cells (p<0.05). Conversely, CD4.sup.IL-10 cells did not lyse BV-173, Daudi, or K562 cells (FIG. 2B). Similarly, in co-culture experiments CD4.sup.IL-10 cells eliminated CD14, U932, ALL-CM, and THP-1, a prototypic monocytic cell line, but not BV-173 or K562 cells (FIG. 2C).
[0093] Addition of a pan anti-HLA-class I (clone W6/32) mAb inhibited the degranulation of CD4.sup.IL-10 cells (data not shown), and significantly prevented the killing of ALL-CM and U937 cells (p<0.05) (FIG. 2D). Moreover, CD4.sup.IL-10-mediated killing of ALL-CM and U937 cells was GzB-dependent, since addition of the GzB inhibitor Z-AAD-CMK inhibited the lysis in a dose-dependent manner (FIG. 2E). Overall, these data showed that CD4.sup.IL-10 cells lysed myeloid cell lines, but not pre-B lymphoblastic or erythroblastic cell lines, via a mechanism that requires HLA class I-mediated activation and is GzB-dependent.
[0094] CD4.sup.IL-10 cells specifically kill CD13.sup.+ leukemic blasts that express CD54 and CD112 in vitro. The inventors next investigated the phenotype of leukemic cell lines. Results indicated that U937, THP-1, and ALL-CM cells target of CD4.sup.IL-10-mediated lysis were CD13.sup.+ and expressed CD54, HLA-class I, CD58, CD155, and CD112 (FIG. 4A). Although CD13.sup.+, BV-173 cells that were not killed by CD4.sup.IL-10 cells, were HLA-class I.sup.+CD58.sup.+ but expressed CD54 and CD112 at low levels. According to the role of HLA-class I in promoting CD4.sup.IL-10 cell-activation, although expressing CD54, CD58, CD155 or CD112, HLA-class I.sup.neg K562 and Daudi cells were not killed (FIG. 4A).
[0095] The inventors next determined whether CD4.sup.IL-10 cells can eliminate primary AML blasts (Table 1). As negative controls the inventors used primary ALL blasts. CD4.sup.IL-10 cells, generated from four different healthy donors, killed four out of eight primary AML blasts tested (FIG. 4B). We performed correlation studies to define whether CD4.sup.IL-10-mediated killing of primary AML blasts was associated with the expression of specific markers. Results showed that CD4.sup.IL-10-mediated lysis correlated with the expression of CD13, of CD54, and of CD112 on AML blasts, but not with CD58 or CD155 (FIG. 4C). Notably, CD4.sup.IL-10 cells did not eliminate Leu#7 that was CD13.sup.+CD54.sup.+ but CD112.sup.neg (FIG. 4C). Surprisingly, CD4.sup.IL-10 cells efficiently eliminate Leu#10 a primary ALL blasts that was CD13.sup.+ CD54.sup.+CD112.sup.+ (FIG. 4B). The expression of CD13 is determinant for the anti-leukemic activity of CD4.sup.IL-10 cells, since two human multiple myeloma cell lines U266 and MM1S that were CD54.sup.+CD112.sup.+ but did not express CD13 were not killed ((FIG. 5A-B). Based on these data, we conclude that CD4.sup.IL-10 cells eliminate CD13.sup.+ leukemic cells and optimal CD4.sup.IL-10-mediated killing requires stable CD54/LFA-1-mediated adhesion and CD112/CD226-mediated activation (FIG. 6). CD13, CD54, and CD112 can be used as biomarkers for the identification of target of anti-leukemic effect of CD4.sup.IL-10 cells.
[0096] CD4.sup.IL-10 cells mediate anti-leukemic effects in vivo. To test the anti-leukemic activity of CD4.sup.IL-10 cells in vivo, we used four different clinically-relevant humanized models: the subcutaneous myeloid sarcoma, the ALL-CM leukemia model .sup.20,21, the extramedullary myeloid tumor .sup.24, and the GvL/xeno-GvHD model of T-cell immunotherapy. The inventors developed the humanized model of subcutaneous myeloid sarcoma: NSG mice were sub-cutaneously injected with ALL-CM cells and three weeks later developed subcutaneous myeloid sarcoma (13.91.16 mm, meanSEM, n=9, FIG. 7A). In this model, PBMC, CD4.sup.IL-10 or CD4.sup.GFP cells were injected within the tumor at day three after ALL-CM infusion. Treatment with CD4.sup.IL-10 cells significantly delayed myeloid sarcoma growth (FIG. 7A). Notably, in CD4.sup.IL-10-injected mice no signs of tumor development were observed within the first 14 days, and on day 21 the tumor size in CD4.sup.IL-10-treated mice was significantly lower than that of un-treated mice (7.60.9 mm, meanSEM, n=8; p0.001; FIG. 7A). As expected, mice injected with CD4.sup.GFP cells developed myeloid sarcoma similarly to control untreated mice, whereas injection of allogeneic PBMC completely prevented tumor growth (FIG. 7A).
[0097] The inventors next evaluated whether CD4.sup.IL-10 cells mediate anti-leukemic effects in vivo using the ALL-CM leukemia model of T-cell therapy in unconditioned NSG mice .sup.21,22. After ALL-CM cell infusion, NSG mice developed leukemia in four weeks (FIG. 7B). In this system, injection of allogeneic PBMC, three days after ALL-CM challenge, delayed leukemia progression (FIG. 7B), and after four weeks we detected a significantly lower proportion of circulating human blasts (on average 4.8%, p0.01) as compared to that control untreated mice (data not shown). Adoptive transfer of CD4.sup.IL-10 cells or CD4.sup.GFP cells at day three after ALL-CM infusion did not delay leukemia development (FIG. 7B), and at week four the percentage of circulating blasts was comparable to that observed in control untreated mice (data not shown).
[0098] Overall, we showed that CD4.sup.IL-10 cells delayed the subcutaneous myeloid sarcoma development, while they do not inhibit the leukemia growth. We postulated that in the model of ALL-CM leukemia CD4.sup.IL-10 cells do not co-localize with leukemic cells in the bone marrow. To test this hypothesis, we first investigated the expression of CXCR4 known to regulate the homing of human hematopoietic stem cells and myeloid leukemia in the bone marrow of humanized mice .sup.25-27. In contrast to ALL-CM cells and PBMC, resting CD4.sup.IL-10 cells do not express significant levels of CXCR4 (FIG. 8). We next investigated the in vivo localization of CD4.sup.IL-10 cells in NSG mice injected with ALL-CM and three days later with PBMC, CD4.sup.IL-10 or CD4.sup.GFP cells. The frequency of circulating CD4.sup.IL-10 cells at day seven after transfer was on average 16.3% (15.7%, meanSTD, n=7), and declined to 6.7% (2.2%, meanSTD, n=3) at day fourteen (FIG. 7C). Similar results were obtained in mice injected with CD4.sup.GFP cells. In the bone marrow, CD4.sup.IL-10 cells were detected at very low frequency at day seven (0.40.5% meanSTD, n=7), and disappeared at day fourteen (FIG. 7C). Moreover, at day seven, CD4.sup.IL-10 and CD4.sup.GFP cells localized in the spleen and lung and their frequencies declined on day fourteen (FIG. 7C). Finally, although at low frequency, CD4.sup.IL-10 cells were also identified in the liver at both time points analyzed (FIG. 7C). In peripheral blood of mice treated with PBMC more than 70% and 30% of human T cells were found at day seven and fourteen, respectively (FIG. 7C). T cells were also identified in the spleen, lung, liver, and in bone marrow of PBMC-injected mice at both time points (FIG. 7C).
[0099] Since CD4.sup.IL-10 cells localize in the liver, we tested the anti-leukemic activity of CD4.sup.IL-10 cells in a model of THP-1 myeloid tumor .sup.24 (FIG. 7D). In this model, PBMC were injected in NSG mice at day three after THP-1 cell infusion, whereas CD4.sup.IL-10 or CD4.sup.GFP cells were infused two weeks after tumor injection, time in which the presence of THP-1 cells was evident in the liver (data not shown). Results demonstrated that adoptive transfer of CD4.sup.IL-10 cells and of PBMC inhibited in a comparable manner the ability of THP-1 cells to form liver nodules, whereas no difference in tumor development were observed between CD4.sup.GFP-injected and control untreated mice (FIG. 7D). These findings indicate that despite the limited in vivo lifespan, CD4.sup.IL-10 cells mediate potent and specific anti-leukemic effects in peripheral tissues in different humanized models.
[0100] Adoptive transfer of CD4.sup.IL-10 cells prevents xeno-GvHD while spearing the GvL of allogeneic T cells. The inventors next investigated the effects of CD4.sup.IL-10 cells on both GvL and xeno-GvHD mediated by allogeneic human T cells in vivo. To this end, we developed a humanized model of GvL/xeno-GvHD: NSG mice were sub-lethally irradiated, injected with ALL-CM cells, and three days later received allogeneic PBMC alone or in combination with CD4.sup.IL-10 cells (FIGS. 9A and B). Since conditioning causes an increase in SDF-1 expression and secretion by stromal cells within murine bone marrow .sup.28, we analyzed the in vivo localization of CD4.sup.IL-10 cells in sub-lethally irradiated NSG mice injected with ALL-CM and three days later with PBMC, CD4.sup.IL-10 or CD4.sup.GFP cells. The frequency of CD4.sup.IL-10 cells in the bone marrow at day seven after transfer resulted on average 22.3% (9.6%, meanSEM, n=9), and then declined to 0.3% (0.2%, meanSEM, n=11) at day fourteen (FIG. 9A). The peripheral blood tested in parallel showed comparable results, with up to 34.3% (8.2%, meanSEM, n=17) of circulating CD4.sup.IL-10 cells at day seven, that then declined to 3.0% (1.6%, meanSEM, n=14) at day fourteen. Similar results were obtained in mice injected with CD4.sup.GFP cells (FIG. 9A). In the bone marrow of PBMC-injected mice 39.4% (7.0%, meanSEM, n=8) and 23.5% (5.0%, meanSEM, n=14) of human T cells were detected at day seven and fourteen, respectively. In the peripheral blood of PBMC-injected mice, human T cells were detected at both time points analyzed (FIG. 9A). These data indicate that in conditioned NSG mice CD4.sup.IL-10 cells migrate in the bone marrow.
[0101] The inventors then tested the ability of CD4.sup.IL-10 cells to mediate anti-leukemic effect in conditioned NSG mice. Results showed that adoptive transfer of CD4.sup.IL-10 cells at day three after ALL-CM injection significantly delayed leukemia progression (P<0.05), whereas, treatment with CD4.sup.GFP cells did not (FIG. 9B). It should be noted that leukemia progression in CD4.sup.IL-10-injected mice was not significantly different to that observed with PBMC-injected mice (P0.0001, FIG. 9B). However, PBMC-treated mice developed severe xeno-GvHD and died within twenty days (FIG. 9B). Remarkably, co-transfer of CD4.sup.IL-10 cells and PBMC significantly delayed leukemia progression (P<0.05), with no sign of xeno-GvHD (FIG. 9B). Overall, these findings demonstrate that adoptive transfer of CD4.sup.IL-10 cells prevents xeno-GvHD, while spearing the GvL mediated by allogeneic T cells.
[0102] Further, using the LV-IL-10 platform the inventors generated alloantigen-specific CD4.sup.IL-10 cells that kill myeloid leukemic cell lines in vitro in an antigen-independent manner. Alloantigen-specific LV-10 transduced T cells (allo)CD4.sup.IL-10 were generated by stimulation of nave CD4.sup.+ T cells stimulated with allogeneic mature dendritic cells (allo-mDC) and transduction upon secondary stimulation (FIG. 11A). Transduction efficiency of nive CD4.sup.+ cells was on average 55% (FIG. 11B). Allo-CD4.sup.IL-10 cells proliferated significantly less (p0.001, FIG. 12A) and produced significantly higher levels of IL-10 upon restimulation with allo-mDC, compared to allo-CD4.sup.NGFR cells (p0.0001, FIG. 12B). Conversely, allo-CD4.sup.IL-10 and allo-CD4.sup.NGFR cells showed similar low proliferative capacity in response to third party antigens, (FIG. 12A), although allo-CD4.sup.IL-10 produced significantly higher levels of IL-10 (p0.001, FIG. 12B). Allo-CD4.sup.IL-10 but not allo-CD4.sup.NGFR cells efficiently suppressed the proliferation of allo-specific T cell lines activated with allo-mDC, but not with a third party mDC (FIG. 12C). Allo-CD4.sup.IL-10 cells killed ALL-CM and U937, but not K562 leukemic cell lines, similar to what we observed with polyclonal CD4.sup.IL-10 cells (FIG. 12D). These results show that enforced IL-10 expression in allo-specific CD4.sup.+ T cells promotes their conversion into Tr1-like cells able to kill myeloid cell lines.
[0103] To determine the role of HLA-class I expression on target cells in CD4.sup.IL-10-mediated killing, we selectively deleted HLA-class I expression on ALL-CM and U937 cell lines by disrupting the .sub.2-microglobulin encoding gene. 2m-deficient (2m.sup./) ALL-CM and U937 cell lines (FIG. 13), were killed by CD4.sup.IL-10 cells at significantly lower levels compared to 2 m positive ALL-CM (p<0.001) and U937 (p<0.05) cell lines (FIG. 14A). Moreover, we showed that the addition of a pan anti-HLA-class I (clone W6/32) mAb not inhibited CD4.sup.IL-10-mediated killing of ALL-CM and U937 cell lines (p<0.05; FIG. 2D patent), and prevented the degranulation of CD4.sup.IL-10 cells as shown by the significantly (p<0.05) lower frequency of GzB.sup.+CD107a.sup.+ cells in co-cultured of CD4.sup.IL-10 cells and ALL-CM or U937 cell lines in the presence of the W6/32 mAb (FIG. 14B). Interestingly, addition of a pan anti-HLA class II mAb does not inhibit the degranulation of CD4.sup.IL-10 cells co-cultures with either ALL-CM or U937 cell lines, indicating that CD4.sup.IL-10 cells do not require TCR-mediated activation to expert their cytolitic effects against myeloid target cells (FIG. 15).
[0104] Discussion
[0105] The Inventors previously showed that enforced expression of IL-10 confers a Tr1-like phenotype and function to human CD4.sup.+ T cells, including killing of myeloid cells .sup.19. They now generate CD4.sup.IL-10 cells using a novel bidirectional LV encoding for human IL-10 and NGFR, as clinical grade marker gene. The inventors show that CD4.sup.IL-10 cells acquired the expression of CD18, CD2, and CD226, and the ability to secrete GzB. They provide evidences that CD4.sup.IL-10 cells kill leukemic cell lines in vitro and in vivo, and that this killing is specific for target cells, preferably myeloid cells. For the first time we establish that CD4.sup.IL-10 cells eliminate primary leukemic blasts. We demonstrate that the expression of HLA-class I on target myeloid cells is necessary but not sufficient for promoting CD4.sup.IL-10-mediated cytotoxicity, which also requires stable CD54-mediated adhesion, and activation via CD226. CD13, CD54, and CD112 are biomarkers of CD4.sup.IL-10-mediated killing of primary blasts. In humanized mouse models, CD4.sup.IL-10 cells mediate potent anti-leukemic effects and prevent xeno-GvHD without compromising the GvL mediated by allogeneic T cells.
[0106] Correlation between the expression of the marker CD13 and the ability of CD4.sup.IL-10 cells to eliminate primary blasts (FIG. 4) indicates that CD13 expression determines the target specificity of CD4.sup.IL-10 cells. Furthermore, killing of primary blasts by CD4.sup.IL-10 cells correlates with CD54 expression (FIG. 4), revealing the importance of stable adhesion between target and CD4.sup.IL-10 cells for effective cytolysis, as it was previously shown for Tr1 cells .sup.6. CD54 on myeloid blasts allows stable and prolonged interaction with LFA-1 (CD18-CD11a) on CD4.sup.IL-10 cells, which is required for achieving the signaling threshold necessary to activate effector function that culminate with the secretion of lytic granules containing GzB. Nonetheless, the expression of CD54 is not sufficient to render CD13.sup.+ blasts target of CD4.sup.IL-10-mediated lysis. The expression of CD112, one of the ligand of CD226 involved in Tr1-mediated cytolysis .sup.6, is also required (FIG. 4). The interaction between CD112 on myeloid leukemic blasts and CD226 on CD4.sup.IL-10 cells leads to their activation, resembling the mechanism previously described for NK-mediated lysis of AML blasts .sup.29. Being the downstream signaling of CD226 dependent on its association with LFA-1 .sup.30, we can conclude that CD112/CD226 interaction promotes the stabilization of CD4.sup.IL-10-target cell conjugate that triggers CD4.sup.IL-10 cell degranulation. CD226-mediated activation of T cells can be inhibited by TIGIT .sup.31, another receptor for CD112 and CD155 .sup.32. TIGIT binds to CD155 with higher affinity that CD226 and inhibits the cytotoxicity and IFN- production of NK cells .sup.33,34. Of note, CD4.sup.IL-10 cells express TIGIT (FIG. 10); nevertheless, the finding that CD155 is less express than CD112 on primary blasts .sup.29,35 and that CD4.sup.IL-10-mediated lysis does not correlate with the expression of CD155, suggests that activation of CD4.sup.IL-10 cells via CD226/CD112 interaction is dominant on the inhibition mediated by TIGIT/CD155. Based on our findings we find that the selective expression of CD13, CD54 and CD112 on leukemic blasts could be used as biomarker of anti-leukemic effect mediated by CD4.sup.IL-10 cells.
[0107] The inhibition of HLA class I recognition by neutralizing mAbs, or lack of HLA class I expression on target blasts prevents the lytic activity mediated by CD4.sup.IL-10 cells (FIG. 2), as shown for Tr1 cells .sup.6. In addition to CD226-mediated activation, CD4.sup.IL-10 cells need to be triggered via HLA-class I to release GzB and kill target cells. The ability of CD4.sup.IL-10 cells to eliminate myeloid leukemia in an alloAg-independent but HLA class I-dependent manner renders them an interesting tool to limit, and possibly to overcome, leukemia relapse caused by the lost of shared HLA alleles after haploidentical-HSCT, or matched unrelated HSCT .sup.36-38.
[0108] CD4.sup.IL-10 cells mediate anti-leukemic effect in humanized murine models of myeloid tumors. This anti-tumor effect is strictly related to the co-localization of CD4.sup.IL-10 and leukemic cells. We show that CD4.sup.IL-10 cells display an effective anti-tumor activity when either locally injected within the myeloid sarcoma, or systemically injected in mice with liver-bearing myeloid tumors (FIG. 7). Moreover, CD4.sup.IL-10 cell immunotherapy prevents leukemia development in conditioned humanized mice, in which a significant frequency of CD4.sup.IL-10 cells is present in the bone marrow as soon as seven days post-infusion (FIG. 9). The anti-leukemic effect exerted within the bone marrow by CD4.sup.IL-10 cells is not achieved in unconditioned humanized mice (FIG. 7). In the latter setting, CD4.sup.IL-10 cells are present in limited numbers and for a short period of time in the bone marrow, and therefore they do not control leukemia progression, which occurs at later time points. It should be noted that the limited lifespan of CD4.sup.IL-10 cells could be beneficial in case of immunotherapy, as it could avoid the risk of general immunosuppression. This is one of the important aspects to be considered in case of Treg-cell based immunotherapy.
[0109] CD4.sup.IL-10 cell immunotherapy prevents xeno-GvHD without hampering the anti-leukemic effect of allogeneic PBMC (FIG. 9). Similarly, co-infusion of in vitro expanded or freshly isolated human CD4.sup.+CD25.sup.+ Tregs with allogeneic PBMC .sup.39 or conventional donor T cells .sup.17 rescued humanized mice from leukemia and survived without xeno-GvHD. In the first study, human CD4.sup.+CD25.sup.+ Tregs have been show to migrate into the bone marrow, where they are converted into IL-17-producing T cells and lose the ability to suppress anti-tumor activity of human T cells .sup.39. Conversely, Martelli et al. .sup.17 proposed that the failure of human CD4.sup.+CD25.sup.+ Tregs to home to the bone allows allogeneic T cells to control leukemia development. Our data support the hypothesis that CD4.sup.IL-10 cells behave differently from human CD4.sup.+CD25.sup.+ Tregs since they migrate in the bone marrow where they eliminate myeloid leukemia without limiting the GvL mediated by allogeneic PBMC.
[0110] Overall, the present data support the hypothesis that immunotherapy with CD4.sup.IL-10 cells can: i) mediate anti-leukemic effects, GvL; ii) mediate anti-tumor effect, GvT, iii) allow to maintain the GvL effect of allogeneic T cells; and ivi) maintain the ability to inhibit GvHD.
[0111] Moreover, the inventors showed that LV-hIL-10 can be used to convert allo-specific CD4+ T cells into allo-specific Tr1-like cells (allo-CD4.sup.IL-10 cells), which specifically kill myeloid target cells and suppress allo-specific T cell responses in vitro. Interestingly, the lack of HLA-class I on target cells, or the inhibition of HLA class I recognition by neutralizing mAbs, abrogate the CD4.sup.IL-10-mediated killing in vitro and in vivo, suggesting that activation of CD4.sup.IL-10 cells through receptor/HLA class I interaction is necessary for GzB release and killing of target cells. Conversely, inhibition of HLA-class II does not impair CD4.sup.IL-10 cell activation and the elimination of target myeloid cells.
[0112] The present invention provides evidence for the use of CD4.sup.IL-10 cell immunotherapy after allo-HSCT for hematological malignancies aimed at inhibiting GvHD while allowing to maintain GvL. The expression of CD13, CD54 and HLA-I and optionally CD112 on tumor cells, in particular myeloid blasts allows patient selection and to design ad hoc therapeutic protocol.
[0113] Moreover the present invention provides evidences for the use of polyclonal CD4.sup.IL-10 cell or allo-specific immunotherapy for mediating GvT and providing GvL in the contest of tumor or allo-HSCT, respectively. Moreover, the finding that CD4.sup.IL-10 cells eliminate myeloid leukemia in a TCR-independent but HLA class I-dependent manner suggests their possible use to limit, and possibly to overcome, leukemia relapse caused by the loss of not-shared HLA alleles after allo-HSCT.
REFERENCES
[0114] 1. Sakaguchi, S., Sakaguchi, N., Asano, M., Itoh, M. & Toda, M. J Immunol 155, 1151-1164 (1995). [0115] 2. Groux, H., et al. Nature 389, 737-742 (1997). [0116] 3. Gagliani, N., et al. Nat Med (2013). [0117] 4. Bacchetta, R., et al. J Exp Med 179, 493-502 (1994). [0118] 5. Roncarolo, M. G., et al. Immunol Rev 212, 28-50 (2006). [0119] 6. Magnani, C. F., et al. Eur J Immunol April 6. (2011). [0120] 7. Bacchetta, R., et al. Haematologica (2010). [0121] 8. Gregori, S., et al. Blood 116, 935-944 (2010). [0122] 9. Hoffmann, P., et al. J Exp Med 196, 389-399 (2002). [0123] 10. Edinger, M., et al. Nat Med 9, 1144-1150 (2003). [0124] 11. Cohen, J. L., et al. J Exp Med 196, 401-406 (2002). [0125] 12. Gregori, S., Goudy, K. S. & Roncarolo, M. G. Front Immunol 3, 30 (2012). [0126] 13. Trzonkowski, P., et al. Clin Immunol 133, 22-26 (2009). [0127] 14. Edinger, M. & Hoffmann, P. Curr Opin Immunol 23, 679-684 (2011). [0128] 15. Di Ianni, M., et al. Blood 117, 3921-3928 (2011). [0129] 16. Brunstein, C. G., et al. Blood (2010). [0130] 17. Martelli, M. F., et al. Blood (2014). [0131] 18. Bacchetta, R., et al. Front Immunol 5, 16 (2014). [0132] 19. Andolfi, G., et al. Mol Ther 20, 1778-1790 (2012). [0133] 20. De Palma, M. & Naldini, L. Methods Enzymol 346, 514-529 (2002). [0134] 21. Bondanza, A., et al. Blood 107, 1828-1836 (2006). [0135] 22. Hambach, L., et al. Leukemia 20, 371-374 (2006). [0136] 23. Pegoraro, L., et al. J Natl Cancer Inst 70, 447-453 (1983). [0137] 24. Casucci, M., et al. Blood 122, 3461-3472 (2013). [0138] 25. Dar, A., Kollet, O. & Lapidot, T. Exp Hematol 34, 967-975 (2006). [0139] 26. Tavor, S., et al. Cancer Res 64, 2817-2824 (2004). [0140] 27. Kollet, O., et al. Blood 97, 3283-3291 (2001). [0141] 28. Ponomaryov, T., et al. J Clin Invest 106, 1331-1339 (2000). [0142] 29. Pende, D., et al. Blood 105, 2066-2073 (2005). [0143] 30. Shibuya, K., et al. Immunity 11, 615-623 (1999). [0144] 31. Lozano, E., Dominguez-Villar, M., Kuchroo, V. & Hafler, D. A. J Immunol 188, 3869-3875 (2012). [0145] 32. Yu, X., et al. Nat Immunol 10, 48-57 (2009). [0146] 33. Georgiev, H., et al. Eur J Immunol 44, 307-308 (2014). [0147] 34. Stanietsky, N., et al. Eur J Immunol 43, 2138-2150 (2013). [0148] 35. Sanchez-Correa, B., et al. Immunol Cell Biol 90, 109-115 (2012). [0149] 36. Vago, L., et al. N Engl J Med 361, 478-488 (2009). [0150] 37. Villalobos, I. B., et al. Blood 115, 3158-3161 (2010). [0151] 38. Toffalori, C., et al. Blood 119, 4813-4815 (2012). [0152] 39. Guichelaar, T., et al. Clin Cancer Res 19, 1467-1475 (2013). [0153] 40. Bacchetta, R., et al. Blood, 45 (ASH Annual Meeting Abstract) (2009). [0154] 41. Bondanza A, et al. Blood.; 117:6469-78 (2011).