NEUROPILIN-1 SPECIFIC BINDING PEPTIDE, FUSION PROTEIN FUSED WITH SAME, AND USE THEREOF

20180051064 ยท 2018-02-22

Assignee

Inventors

Cpc classification

International classification

Abstract

A peptide that binds specifically to neuropilin-1 (NRP1) without binding to neuropilin-2 (NRP2) is provided. A fusion protein, a fusion antibody, small-molecule drug, a nanoparticle, or a liposome, which comprises the peptide, and a pharmaceutical composition for treating or preventing cancer or angiogenesis-related diseases, and a composition for diagnosing cancer or angiogenesis-related diseases are provided. A polynucleotide encoding the peptide that binds specifically to NRP1 and a method for screening the peptide that binds specifically to NRP1 are provided. An antibody heavy-chain constant region Fc-fused peptide binding specifically to NRP1 has the property of binding specifically to NRP1, and thus when it is administered in vivo, it accumulates selectively in tumor tissue, and widens the intercellular space between tumor-associated endothelial cells to promote its extravasation and increases its tumor tissue penetration.

Claims

1. A peptide that binds specifically to neuropilin-1, without binding to neuropilin-2, wherein the peptide comprises 5 to 50 amino acids, and the C-terminus of the peptide is represented by X1-X2-X3-X4, wherein X1 is arginine, lysine, or any amino acid residue, X2 and X3 are each independently any amino acid residue, and X4 is arginine or lysine.

2. The peptide of claim 1, wherein the amino acid residue constituting X3 from the N-terminus of the peptide is selected from the group consisting of histidine, glycine, asparagine, serine, glutamine, phenylalanine, valine, leucine, threonine, arginine, proline, isoleucine, alanine, and lysine.

3. The peptide of claim 1, wherein the peptide has tumor tissue-penetrating activity and/or anti-angiogenesis activity.

4. The peptide of claim 1, wherein the peptide comprises an amino acid sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 3.

5. The peptide of claim 1, wherein the peptide further comprises a linker peptide.

6. The peptide of claim 5, wherein the linker peptide consists of 1 to 50 amino acids.

7. The peptide of claim 5, wherein the linker peptide comprises an amino acid sequence of (GGGGS)n, wherein n is each independently an integer between 1 and 20.

8. The peptide of claim 7, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 6.

9. A fusion protein comprising the peptide of claim 1, which is fused thereto.

10. The fusion protein of claim 9, wherein the protein is selected from the group consisting of antibodies, antibody fragments, immunoglobulin, peptides, enzymes, growth factors, cytokine, transcription factors, toxins, antigen peptides, hormones, carrier proteins, motor function proteins, receptors, signaling proteins, storage proteins, membrane proteins, transmembrane proteins, internal proteins, external proteins, secretory proteins, viral proteins, glycoproteins, cleaved proteins, protein complexes, and chemically modified proteins.

11. The fusion protein of claim 9, wherein the peptide binds to neuropilin-1 bivalently or multivalently.

12. The fusion protein of claim 9, wherein the fusion is mediated by a linker peptide.

13. The fusion protein of claim 10, wherein each of the antibody fragments is a heavy-chain constant region fragment (Fc), a heavy-chain constant region domain fragment (CH1, CH2, or CH3), an antigen binding fragment (Fab), a single-chain variable fragment (scFv), a heavy-chain variable region fragment (VH), a light-chain constant region fragment (CL), or a light-chain variable region fragment (VL).

14. The fusion protein of claim 10, wherein a peptide is fused to the C-terminus of the heavy-chain constant region (Fc) of an antibody, in case where the protein is an antibody.

15. The fusion protein of claim 14, wherein the fusion is mediated by a linker peptide.

16. The fusion protein of claim 14, wherein the antibody is any one selected from the group consisting of IgG, IgM, IgA, IgD, and IgE.

17. A nanoparticle comprising the peptide of claim 1, which is fused thereto.

18. A liposome comprising fused thereto the peptide of claim 1, which is fused thereto.

19. A small-molecule drug comprising fused thereto the peptide of claim 1, which is fused thereto.

20. A polynucleotide that encodes the peptide of claim 1.

21. A pharmaceutical composition for treating or preventing cancer or angiogenesis-related diseases, comprising the peptide of claim 1, a fusion protein comprising the peptide which is fused thereto, a nanoparticle comprising the peptide which is fused thereto, a liposome comprising the peptide which is fused thereto, or a small-molecule drug comprising the peptide which is fused thereto.

22. A composition for diagnosing cancer or angiogenesis-related diseases, in which the composition comprises the peptide of claim 1, a fusion protein comprising the peptide which is fused thereto, a nanoparticle comprising the peptide which is fused thereto, a liposome comprising the peptide which is fused thereto, or a small-molecule drug comprising the peptide which is fused thereto.

23. A method of screening the peptide according to claim 1 comprises the steps of: (1) designing a peptide library capable of interacting with the VEGF-binding site (or arginine-binding pocket) of the b1 domain of NRP1; (2) fusing the peptide library of step (1) to the C-terminus of an antibody heavy-chain constant region Fc; (3) binding the Fc-fused library of step (2) to NRP1-b1b2 in the presence of high amount of NRP2-b1b2 as a competitor; and (4) screening desirable Fc-fused peptides based on the binding affinity between the isolated Fc-fused peptide library and NRP1-b1b2 bound in step (3).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0117] FIG. 1 schematically shows the structures of neuropilin 1 and 2.

[0118] In FIGS. 1(A) and 1(B), neuropilin includes major 5 domains, in which a1 and a2 domains from the N-terminus are classified as CUB domains, to which the semaphorin Ig-like C2 type domain binds. Particularly, this domain forms a complex with plexin to increase the semaphorin-plexin binding affinity. The b1 and b2 domains are classified as FV/VIII domains, and the C-terminus of VEGF or class 3 semaphorin ligands binds thereto. Particularly, in this portion, a site to which heparin can bind is present and it facilitates the binding of ligands containing many positively charged residues. Further, MAM induces oligomerization, the transmembrane domain (TM) enables neuropilin to be fixed to the cell surface, and in a cytosolic domain, a site capable of binding to a Postsynaptic density 95, Disk large, Zona occludens 1 (PDZ) domain is present.

[0119] FIG. 2 shows a binding complex of neuropilin-1 (NRP1) with a fusion protein of an antibody heavy-chain constant region and a selected peptide that binds specifically to NRP1 and a fusion protein of an antibody heavy-chain constant region and a selected peptide that binds specifically to NRP1. A dimeric clone is obtained which binds specifically to the arginine-binding pocket of the NRP1 b1 domain without binding to NRP2.

[0120] FIG. 3 is a schematic view of a library constructed by adding the degenerate codon NHB (ATGC/ACT/TCG) to a 18-residue portion (residues 5 to 22) from the C-terminus of an A22p peptide (N terminusH T P G N S N K W K H L Q E N K K G R P R RC terminus) that binds to both NRP1 and NRP2. A Fc-fusion peptide library was constructed by fusing a linker comprising 15-amino-acid sequence (Gly-Gly-Gly-Gly-Ser)X3 to the carboxy (C)-terminus of an antibody heavy-chain constant region (Fc). The constructed Fc-fusion peptide library is fused to Aga1p-Aga2p on the yeast cell surface and displayed on the yeast cell surface as shown at the bottom of FIG. 3, and the peptide library is present at the C-terminus of the antibody heavy-chain constant region (Fc) fragment.

[0121] FIG. 4 shows proteins used to select a peptide that binds specifically to NRP1, and the results of MACS and FACS analysis.

[0122] FIG. 4(A) schematically shows the structures of biotinylated neuropilin-1 b1b2 protein and neuropilin-2 b1b2 protein used to select a peptide that binds specifically to NRP1, and also shows the results of SDS-PAGE with expressed and purified neuropilins.

[0123] FIG. 4(B) shows FACS analysis results obtained by performing MACS and FACS of the constructed library using biotinylated NRP1-b1b2 as a binding antigen and a 10-fold higher concentration of NRP2-b1b2 as a competitive antigen, and analyzing a pool bound to NRP1-b1b2 in each selection round. The expression level of the antibody heavy-chain constant region (Fc) and binding to biotinylated NRP1-b1b2 could be analyzed, and comparison with cells including Fc-A22p displayed on the yeast cell surface was performed. As MACS and FACS are repeated, the number of clones, which bind to biotinylated NRP1-b1b2 and do not affect the expression of the antibody heavy-chain constant region (Fc), increases.

[0124] FIGS. 5(A) and 5(B) shows the results of FACS performed to identify binding of selected single clones to biotinylated NRP1-b1b2.

[0125] In FIG. 5(A), a total 50 single clones were analyzed competitively with A22p, and the binding affinity for each clone to 100 nM biotinylated NRP1-b1b2 was identified by mean fluorescence intensity shown in FACS. Among the clones, clones, named TPP1, TPP8 and TPP11, which showed higher mean fluorescence intensities, were selected.

[0126] FIG. 5(B) shows the results of FACS analysis performed to analyze binding of Fc-TPP1, Fc-TPP8 and Fc-TPP11, displayed on the yeast cell surface, to 100 nM NRP1-b1b2.

[0127] FIG. 6 is an example of a cleavage map of a vector for expressing Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein, which is a Fc-fusion peptide obtained by fusing an antibody heavy-chain constant region with a selected peptide that binds specifically to NRP1, in mammalian cells, HEK293F.

[0128] FIG. 7 shows a schematic view of a fusion protein of an antibody heavy-chain constant region and a selected peptide that binds specifically to NRP1, and also shows the results of expressed and purified SDS-PAGE.

[0129] In FIG. 7(A), the antibody heavy-chain constant region was constructed starting from the N-terminal hinge so as to maintain two disulfide bonds to easily form a dimer. The peptide that binds specifically to NRP1 was fused to the end of CH3 of the antibody heavy-chain constant region by a peptide linker comprising 15 amino acids ((G.sub.4S).sub.3).

[0130] In FIG. 7(B), dimer formation and purification purity of each clone can be seen on SDS-PAGE. In addition, the difference in size caused by introduction of a linker and a peptide that binds specifically to NRP1 can be seen.

[0131] FIG. 8 shows the results of ELISA analysis performed to measure the NRP1 binding affinities of Fc-TPP1, Fc-TPP8 and Fc-TPP11, which are each a fusion protein of an antibody heavy-chain constant region, expressed and purified from mammalian cells, and a peptide that binds specifically to NRP1.

[0132] In FIG. 8(A), the results of concentration-dependent ELISA indicate that Fc-TPP1, Fc-TPP8 and Fc-TPP11 have about 10-fold to 60-fold higher affinities than Fc-A22p for the NRP1-b1b2 domain.

[0133] In FIG. 8(B), Fc-TPP11 binds specifically to NRP1-b1b2 without binding to NRP2-b1b2, unlike Fc-A22p. In addition, it does not bind to the control VEGFR2. The synthetic peptide TPP11 not fused to Fc shows an at least 100-fold lower affinity than Fc-TPP11 for NRP1-b1b2 protein. This indicates that Fc-TPP11 has a high affinity due to the avidity effect.

[0134] FIG. 9 shows the results of confocal microscopic analysis to observe co-localization with NRP1 displayed on the human umbilical vein endothelial cell (HUVEC) surface in order to determine whether the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein binds specifically to NRP1 displayed on the cell surface. Fc-TPP1, Fc-TPP8 and Fc-TPP11 were treated with a control (PBS buffer), Fc or Fc-A22p in the same manner, and the degree of binding thereof to the cell surface was observed by staining. As a result, Fc-TPP1, Fc-TPP8 or Fc-TPP11 co-localized with NRP1 on the cell surface, unlike Fc, indicating that the fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 binds specifically to NRP1.

[0135] FIG. 10 shows the results of confocal microscopic analysis performed to confirm whether the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein binds specifically to NRP1 displayed on the cell surface to activate NRP1 and is endocytosed into cells. Human umbilical vein endothelial cells (HUVECs) were treated with a control (PBS buffer), Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 or Fc-TPP11 under the same conditions, and the degree of endocytosis was stained by staining. As a result, it was observed that Fc-TPP1, Fc-TPP8 or Fc-TPP11 endocytosed into the cells while it co-localized with NRP1, unlike Fc. This suggests that Fc-TPP1, Fc-TPP8 or Fc-TPP11 binds specifically to NRP1 and activate NRP1.

[0136] FIG. 11 shows the results of analyzing the biological mechanisms of Fc-TPP1, Fc-TPP8 and Fc-TPP11 proteins in HUVEC.

[0137] FIG. 11(A) shows the results of Western blot analysis performed to examine the biological mechanisms of Fc-TPP1, Fc-TPP8 and Fc-TPP11 proteins in HUVEC. VEGF165A as a control group showed an improved ability to penetrate HUVEC, as can be seen by a reduction in VE-cadherin, unlike Fc. The control group VEGF165A reduced VE-cadherin, and among selected single clones that bind specifically to NRP1, Fc-TPP11 most effectively reduced VE-cadherin. Moreover, it was shown that Fc-TPP11 more effectively reduced VE-cadherin at a 10-fold lower concentration compared to Fc-A22p protein. FIG. 11(B) shows the results of Transwell assay performed to confirm whether the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein has an improved ability to penetrate human umbilical vein endothelial cells (HUVEC). The results indicate that VEGF165A, Fc-TPP8 and Fc-TPP11 had an increased ability to effectively penetrate the cells. However, Fc-TPP1 having no ability to reduce VE-cadherin had no increased penetrating ability. Such results have a close connection with the results shown in FIG. 11(A).

[0138] FIG. 12 shows the results of immunohistochemistry performed to identify whether the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein accumulates in tumor tissue and penetrates tissue. Human epidermoid cancer A431 cells were transplanted and grown in nude mice, after which the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein was injected into the tail vein, and then the distribution of the Fc-fusion protein was analyzed by double staining with blood vessels (CD31). As a result, it was shown that the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein selectively reached tumor tissue, unlike the control Fc, and effectively penetrated tumor tissue. Particularly, it was shown that Fc-TPP1 and Fc-TPP11 more effectively penetrated tumor tissue, compared to the Fc-A22p protein. The bar graph on the right side shows the results of quantifying accumulation in tumor tissue.

[0139] FIG. 13 shows the results of measuring the activity of Fc-TPP11 in epithelial cancer-derived tumor cells and tissue.

[0140] FIG. 13(A) shows the results of Western blot analysis performed to observe the change in E-cadherin in human head and neck cancer FaDu cells by the Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein. As a result, among the selected single clones that bind specifically to NRP1, Fc-TPP11 most effectively induced a reduction in E-cadherin, unlike Fc, and reduced E-cadherin at a 10-fold lower concentration compared to that of Fc-A22p. FIG. 13(B) shows the results of ex vivo tumor penetration assay performed to confirm whether Fc-TPP11 binds to NRP1 to regulate the intercellular space in epithelial tissue and has the ability to penetrate tumor tissue. It was shown that the control group Fc did not penetrate tumor tissue, whereas Fc-TPP11 had the ability to penetrate tumor tissue even in the absence of blood vessels by regulating the intercellular space derived from the reduction of VE-cadherin and E-cadherin, which are functioning as cell adhesion factors through NRP1.

[0141] FIG. 14 shows the results of evaluating whether the TPP11 peptide binds to NRP1-b1b2 competitively with VEGF165A.

[0142] FIG. 14(A) shows results indicating that Fc-TPP1 and Fc-TPP11 bind to NRP1 competitively with VEGF165A to inhibit VEGF165A binding to NRP1, even at very low concentrations compared to Fc-A22p. This suggests that the position at which Fc-TPP1 and Fc-TPP11 bind to NRP1-b1b2 is the identical arginine-binding pocket to which VEGF165A binds.

[0143] FIG. 14(B) shows the results of competitive binding ELISA performed to examine whether the synthesized TPP11 peptide binds to NRP1 competitively with a RPARPAR peptide (Teesalu et al. 2009) and a VEGF165A ligand, which bind to the arginine-binding pocket located in NRP1-b1. It was shown that the synthesized TPP11 peptide did bind to NRP1 competitively with the RPARPAR peptide and VEGF165A known to bind to the arginine-binding pocket of NRP1-b1. This demonstrates that TPP11 binds to the arginine-binding pocket of NRP1-b1.

[0144] FIG. 15 shows the results of measuring the anti-angiogenesis activity of Fc-TPP11.

[0145] FIG. 15(A) shows the results of a tube formation assay performed to examine whether Fc-TPP11 inhibits VEGF165A-induced tube formation in human umbilical vein endothelial cells (HUVEC). As a result, it was shown that Fc-TPP11 effectively inhibited VEGF165A-induced tube formation in epithelial cells.

[0146] FIGS. 15(B) and 15(C) shows the results of an in vivo matrigel plug assay performed to examine whether Fc-TPP11 can inhibit VEGF165A-induced angiogenesis in living mice. In FIG. 15(B), angiogenesis was measured as the density of blood vessels by immunohistochemistry with anti-CD31 antibody. The right side of FIG. 15(C) shows the results of quantification of image. As a result, Fc-A22p and Fc-TPP11 inhibited VEGF165A-induced angiogenesis in living mice. Particularly, it was shown that Fc-TPP11 more effectively inhibited angiogenesis compared to Fc-A22p.

[0147] FIG. 16 shows the results of measuring the inhibitory activity of Fc-TPP11 against VEGF165A-mediated migration and invasion of vascular endothelial cells.

[0148] FIG. 16(A) shows the results of a wound healing assay performed to examine whether Fc-TPP11 inhibits VEGF165A-induced migration of vascular endothelial cells. The control VEGF165A increased the migration activity of vascular endothelial cells, and Fc-TPP11 inhibited the migration activity of vascular endothelial cells, unlike Fc.

[0149] FIG. 16(B) shows the results of a Transwell assay performed to examine whether Fc-TPP11 inhibits VEGF165A-induced invasion of HUVEC cells. Fc-TPP11 inhibited the invasion activity of vascular endothelial cells, unlike the control VEGF165A.

[0150] FIG. 17 shows the results of measuring the tumor growth inhibitory activity of Fc-TPP11 in living mice and the anti-angiogenesis activity of Fc-TPP11 in tumor tissue.

[0151] FIG. 17(A) shows the results of a tumor growth inhibitory experiment in nude mouse models, performed to examine whether the anti-angiogenesis activity of Fc-TPP11 actually influences the inhibition of tumor cell growth in vivo. FaDu cells were transplanted into nude mice, and then Fc or Fc-TPP11 was injected into the nude mice. As a result, it was shown that Fc-TPP11 effectively inhibited tumor cell growth, compared to PBS or Fc.

[0152] FIG. 17(B) shows the results of measuring the weight of mice in the experiment. There was no significant difference in weight between the mice injected with Fc-TPP11 and the mice injected with PBS or Fc. This indirectly demonstrates that Fc-TPP11 is not toxic to mice.

[0153] FIG. 17(C) shows the results of immunohistochemistry for extracted tumors, performed to examine whether the tumor inhibitory activity of Fc-TPP11 in the experiment would be attributable to anti-angiogenesis activity. As a result, in the mice injected with Fc-TPP11, the vascular density of tumor tissue decreased and co-localization of blood vessels and pericytes also decreased, compared to those in the mice injected with the control PBS or Fc.

[0154] FIG. 18(A) shows the results of immunohistochemistry performed to analyze the tumor-penetrating ability of doxorubicin co-administered with Fc-TPP11. As a result, when doxorubicin was co-administered with Fc-TPP11, the tumor tissue penetration of doxorubicin increased, compared to co-administration with the control Fc.

[0155] FIG. 18(B) shows the results of quantitatively analyzing the accumulation of doxorubicin in tissue.

[0156] FIG. 19 is a schematic view showing the overall effects of Fc-TPP11. Fc-TPP11 binds to the arginine-binding pocket of the NRP1-b1 domain with high affinity and high specificity without binding to NRP2. Due to this property, Fc-TPP11, when injected in vivo for binding to NRP1, can selectively reach tumor tissue, extravasation thereof into tumor tissue increases, and tumor tissue penetration thereof increases. In addition, Fc-TPP11 binds to NRP1 competitively with the vascular endothelial growth factor VEGF, thereby inhibiting VEGF-induced angiogenesis.

[0157] FIG. 20 is an example of a cleavage map of a vector for expressing IgG heavy chain-TPP11.

[0158] FIG. 21 is an example of a cleavage map of a vector for expressing an IgG light chain.

[0159] FIG. 22(A) is a schematic view of an antibody constructed by introducing TPP11 into the C-terminus of the heavy chain of the conventional anti-EGFR antibody Cetuximab.

[0160] FIG. 22(B) shows the results obtained by co-transforming the antibody into HEK293F cells, transiently expressing and purifying the antibody, and then analyzing the size and purity of the antibody on SDS-PAGE under reducing and non-reducing conditions.

[0161] FIG. 22(C) shows the results of ELISA performed to confirm that the binding between Cetuximab-TPP11 does not differ from the binding of Cetuximab to the original antigen EGFR, and shows that TPP11 fusion does not affect the antigen binding ability of the existing antibody.

[0162] FIG. 23 shows the results of immunohistochemistry performed to examine the ability of Cetuximab-TPP11 to penetrate tumor tissue. Human epidermoid cancer A431 cells expressing EGFR were transplanted into nude mice, after which Cetuximab, Cetuximab-A22p or Cetuximab-TPP11 was injected intravenously into the nude mice, and then tissue penetration thereof was analyzed by double staining with blood vessels (CD31). As a result, it was shown that Cetuximab penetrated only to the periphery of blood vessels, whereas Cetuximab-A22p and Cetuximab-TPP11 penetrated into tissue more distant from blood vessels (left panel). Particularly, Cetuximab-TPP11 more effectively penetrated into tissue compared to Cetuximab-A22p. The penetration was quantified using Image J program (right panel). This suggests that TPP11 has an activity of increasing the tumor tissue accumulation and penetration of a full-length IgG antibody.

BEST MODE FOR CARRYING OUT THE INVENTION

Examples

[0163] Hereinafter, the present disclosure will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present disclosure.

Example 1: Construction of Peptide Library that Binds Specifically to Arginine-Binding Pocket of NRP1-b1

[0164] As shown in FIGS. 1(A) and 1(B), neuropilin includes 5 major domains, in which a1 and a2 domains from the N-terminus are classified as CUB domains, to which the semaphorin Ig-like C2 type domain binds. Particularly, this domain forms a complex with plexin to increase the semaphorin-plexin binding affinity. The b1 and b2 domains are classified as FV/VIII domains, and the C-terminus of VEGF or class 3 semaphorin ligands binds thereto. Particularly, in this portion, a site to which heparin can bind is present, and it facilitates the binding of ligands containing many positively charged residues. Further, MAM induces oligomerization, the transmembrane domain (TM) enables neuropilin to be fixed to the cell surface, and in a cytosolic domain, a site capable of binding to a Postsynaptic density 95, Disk large, Zona occludens 1 (PDZ) domain is present. Among these domains, particularly the b1 domain has a pocket-shaped structure to which the C-end rule (CendR) can bind. In fact, when the C-terminal sequences of the ligand Sema3s and the VEGF family, which bind to the arginine-binding pocket of neuropilin b1 as shown in FIG. 2, were analyzed, they all had a sequence corresponding to the C-end rule -R/K-X-X-R/K.

[0165] It is known that, among natural ligands that increase tumor tissue penetration by interaction with neuropilin, VEGF165A or Sema3A binds more preferentially to NRP1 than to NRP2. Accordingly, the present inventors anticipated that NRP1 would have a closer connection with tumor tissue penetration than NRP2, and anticipated that NRP1 would be a more preferable target. Thus, as shown in FIG. 2, the present inventors attempted to select Fc-TPP wherein a tumor tissue-penetrating peptide (TPP) that binds specifically to the arginine-binding pocket of NRP1-b1 without binding to NRP2 is fused to the heavy-chain constant region (Fc) of an antibody.

[0166] To this end, as shown in FIG. 3, using a conventional A22p sequence (HTPGNSNKWKHLQENKKGRPRR) as a template, a reverse primer comprising the degenerate codon NHB (ATGC/ACT/TCG) was synthesized in which a portion corresponding to 18 residues (5 to 22) from the C-terminus comprises serine, threonine, tyrosine, asparagine, glutamine, histidine, phenylalanine, leucine, isoleucine, valine, alanine, methionine, proline, lysine, asparaginic acid or glutamic acid. Furthermore, a forward primer corresponding to the CH3 region of the antibody heavy-chain constant region (Fc) fragment was synthesized. The forward primer and the reverse primer include the same portion as the sequence of a 50 bp vector so as to enable homologous recombination in yeast cells. The nucleotide sequences of the primers used for construction of the peptide library fused to the antibody heavy-chain constant region (Fc) are shown in Table 1 below.

TABLE-US-00004 TABLE1 Oligonucleotidesequencesusedforconstruction ofFc-fusionpeptidelibrary Nameofprimer Oligonucleotidesequence SEQIDNOs: Forwardprimer 5-CATCGAGAAACCATCTC SEQIDNO:7 CAAAGCCA-3 Reverseprimer 5-AAAGTCGATTTTGTTACAT SEQIDNO:8 CTACACTGTTGTTATCAGATC TCGAGAAGCTTATCAVDNVDN VDNVDNVDNVDNVDNVDNVDN VDNVDNVDNVDNVDNVDNVDN VDNVDNTCCAGGAGTATGTGA TCC-3

[0167] Library DNA was prepared by performing PCR. Using a Fc-A22p yeast surface display vector (pCTCON, Colby et al. 2004) as a template and the above-described forward and reverse primers, DNA was amplified. The amplified DNA (a total of 300 g; 10 g/transformation) was electroporated 30 times into yeast together with a vector DNA (1 g/transformation) prepared by treating the Fc yeast surface display vector with BsrGI and Xhol restriction enzymes, thereby constructing a library. Thereafter, as shown in FIG. 3, the library and the vector were connected in the yeast cells by homologous recombination. The size of the peptide library fused to the antibody heavy-chain constant region (Fc) was found to be 210.sup.7 by measurement of the number of colonies grown in selection medium according to a selectable marker present in the vector, after serial dilution.

Example 2: Selection of Single Clones Binding Specifically to Only NRP1 from Constructed Fc-Peptide Library Obtained by Fusion to Antibody Heavy-Chain Constant Region (Fc)

[0168] The target protein NRP1-b1b2 (273-586) and the competitive protein NRP2-b1b2 (275-595) were prepared with a purity of 90% or higher according to conventional methods (BA Appleton et al., 2007). The target protein NRP1-b1b2 was biotinylated as shown in FIG. 4 (EZ-LINK Sulfo-NHS-LC-Biotinylation kit (Pierce Inc., USA)).

[0169] FIG. 4(A) schematically shows the structures of biotinylated neuropilin-1 b1b2 protein and neuropilin-2 b1b2 protein used to select a peptide that binds specifically to NRP1, and also shows the results of expressed and purified SDS-PAGE.

[0170] FIG. 4(B) shows the results of FACS performed to analyze a pool in each selection round after MACS and FACS of the constructed library. This can analyze the expression level of the antibody heavy-chain constant region (Fc) and binding to biotinylated NRP1-b1b2, and comparison with cells including Fc-A22p displayed on the yeast cell surface was performed. As MACS add FACS are repeated, the number of clones, which bind to biotinylated NRP1-b1b2 and do not affect the expression of the antibody heavy-chain constant region (Fc), increases.

[0171] 1 M biotinylated NRP1-b1b2 was bound to the antibody heavy-chain constant region (Fc)-fused peptide library, displayed on the yeast cell surface, at 37 C. for 1 hour. The antibody heavy-chain constant region (Fc)-fused peptide library, bound to the biotinylated NRP1-b1b2 and displayed on the yeast cell surface, was bound to streptavidin microbeads (Miltenyi Biotec Inc., Germany) at 4 C. for 10 minutes, and then clones bound to the biotinylated NRP1-b1b2 were selected using MACS (magnetic activated cell sorting). Next, 1 M NRP1-b1b2 was bound to the antibody heavy-chain constant region (Fc)-fused peptide library, displayed on the yeast cell surface, at 37 C. for 1 hour, and then PE-conjugated streptavidin (Streptavidin-R-phycoerythrin conjugate (SA-PE), Invitrogen) and FITC-conjugated anti-Fc antibody (anti-Fc antibody FITC conjugated, goat, (SIGMA-ALDRICH co., USA)) were bound to the library at 4 C. for 20 minutes, after which clones, which express a high level of Fc and have binding affinity for the biotinylated NRP1-b1b2, were selected using FACS (fluorescence activated cell sorting). The second FACS round was performed in the same manner as described above, except that biotinylated NRP1-b1b2 was used at a concentration of 0.5 M. In addition, in the MACS and FACS processes, non-biotinylated NRP2-b1b2 was used as a competitive protein for biotinylated NRP1-b1b2 at a 10-fold higher concentration, and individual clones that bind to NRP1-b1b2 were selected.

[0172] In addition, as shown in FIGS. 5(A) and 5(B), individual clones having high binding affinity for 100 nM biotinylated NRP1-b1b2 were classified according to PE signals by FACS analysis, and clones, named TPP1, TPP8 and TPP11, were selected.

[0173] The selected individual clones were recovered from the yeast cells, and the DNA sequences and amino acid sequences thereof were analyzed.

[0174] Table 2 below shows the sequences of the selected peptides that bind specifically to NRP1 without binding to NRP2.

TABLE-US-00005 TABLE2 AminoacidsequencesandpIofindividual clonesselectedfrompeptidelibraryfusedto antibodyheavy-chainconstantregion(Fc) NRP1-targeting peptidesequence (N-to-Cterminus NameofTPP direction) SEQIDNOs: TPP1 HTPGNSNQFVLTSTRPPR SEQIDNO:1 TPP8 HTPGIATRTPR SEQIDNO:2 TPP11 HTPGNSKPTRTPRR SEQIDNO:3

[0175] Table 3 shows sequences comprising a linker used when fusing the selected peptide to the antibody heavy-chain constant region.

TABLE-US-00006 TABLE3 Linker-connected,NRP1-targetingpeptidesequences Linker-connected,NRP1-targeting peptidesequence(N-to-Cterminus direction) NRP1-targeting NameofTPP Linkersequence peptidesequence SEQIDNOs: TPP1 GGGGSGGGGSGGGGS HTPGNSNQFVLTSTRPPR SEQIDNO:4 TPP8 GGGGSGGGGSGGGGS HTPGIATRTPR SEQIDNO:5 TPP11 GGGGSGGGGSGGGGS HTPGNSKPTRTPRR SEQIDNO:6

Example 3: Construction and Expression/Purification of Antibody Heavy-Chain Constant Region Fused with Peptide that Binds Specifically to NRP1

[0176] To express the individual clones, selected in Example 2, in mammalian cells, the DNA recovered from the yeast cells was treated with BsrGI and HindII restriction enzymes to obtain the CH3 of the antibody heavy-chain constant region and the peptide portion that binds specifically to NRP1. The obtained DNA fragments were cloned into a pcDNA3.4 vector as shown in FIG. 6.

[0177] Using a HEK293-F system (Invitrogen), a plasmid encoding a fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1 was transiently transfected to express the protein. In a shaking flask, HEK293-F cells (Invitrogen) suspended in serum-free FreeStyle 293 expression medium (Invitrogen) were transfected with a mixture of a plasmid and polyethylenimine (PEI) (Polyscience). For 200 mL transfection in a shaking flask (Corning), HEK293-F cells were seeded in 100 ml of medium at a density of 2.010.sup.6 cells/ml, and incubated at 120 rpm in 8% CO.sub.2. Next, a plasmid encoding a fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 was diluted in 10 ml of FreeStyle 293 expression medium (Invitrogen) to 250 g (2.5 g/ml) and mixed with 10 ml of medium in which 750 g (7.5 g/ml) of PEI was diluted. The medium mixture was incubated at room temperature for 10 minutes. Next, the incubated medium mixture was added to 100 ml of the medium containing the seeded cells, and incubated for 4 hours at 120 rpm in 8% CO.sub.2, after which the remaining 100 ml of FreeStyle 293 expression medium was added thereto and incubated for 7 days. The supernatant was collected after 7 days.

[0178] With reference to standard protocols, protein was purified from the collected cell culture supernatant. Antibody was applied to Protein A Sepharose column (GE healthcare) and washed with PBS (pH 7.4). The antibody was eluted using 0.1 M glycine buffer at pH 3.0, and then the sample was immediately neutralized using 1 M Tris buffer. The eluted antibody fraction was replaced with PBS (pH7.4) using Pierce Dextran Desalting Column (5K MWCO), and then concentrated using MILLIPORE Amicon Ultra (10 MWCO) centrifugal concentrator. The purified fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 was quantified based on the absorbance at 280 nm and the extinction coefficient. The purified fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 was analyzed on SDS-PAGE under reducing and non-reducing conditions.

[0179] FIG. 7(A) schematically shows an Fc-TPP protein wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant region (Fc). In FIG. 7(A), the antibody heavy-chain constant region (Fc) was constructed starting from the N-terminal hinge so as to maintain two disulfide bonds to easily form a dimer. The Fc-TPP protein has a structure in which the peptide that binds specifically to NRP1 is fused to the terminus of the heavy-chain constant region CH3 of an antibody by a linker peptide of (GGGGS)X3.

[0180] FIG. 7(B) shows the results of SDS-PAGE analysis of purified Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins under reducing and non-reducing conditions. In FIG. 7(B), dimer formation and purity of each clone can be seen on SDS-PAGE.

[0181] Table 4 shows the yield of purified Fc-TPP1, Fc-TPP8 or Fc-TPP11 protein that is produced per L of culture. The results obtained in triplicate were statistically processed, and indicates standard deviation value. The yield of protein produced did not significantly differ from those of wild-type Fc protein and the control Fc-A22p fusion protein.

TABLE-US-00007 TABLE 4 Production yields of Fc-TPP1, Fc-TPP8 and Fc- TPP11 fusion proteins in HEK293 cells Name of Clone Yield (mg/L) Fc 34.2 4.8 Fc-A22p 36.1 5.6 Fc-TPP1 34.2 3.6 Fc-TPP8 32.5 3.2 Fc-TPP11 37.6 2.2

Example 4: Evaluation of Binding Affinities of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins for b1b2 Domains of NRP1 and NRP2

[0182] The binding affinities of purified Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins for the b1b2 domains of NRP1 and NRP2 were analyzed by ELISA (Enzyme Linked Immunosorbent Assay).

[0183] FIG. 8 shows the results of ELISA performed to measure the NRP1 binding affinities of the control Fc-A22p and the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant region and which are the NRP1-specific individual clones selected from the library. It was shown that the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins selected from the library had an about 10-fold to 60-fold higher affinity than Fc-A22p.

[0184] To examine specificity for NRP1, the control VEGF165A and Fc, A22p, and each of the fusion proteins wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region, was biotinylated using a NHS-biotin kit (SIGMA-ALDRICH co., USA).

[0185] 1 g of each of NRP1-b1b2 (273-586) protein, NRP2-b1b2 (275-595) protein and the control group VEGFR2 (46-753) was immobilized in each well of a 96-well EIA/RIA plate (COSTAR Corning In., USA) at room temperature for 1 hour, and then washed three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. After binding with 5% skim milk (5% Skim milk, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 1 hour, each well was washed three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. Each of biotinylated VEGF165A and Fc as controls, A22p, and the TPP11 peptide and Fc-TPP11, which bind specifically neuropilin-1 as test groups, are bound at a concentration of 10 nM (or 100 nM for the peptide), and then washed three times with 0.1% PBST for 10 minutes. Each well was bound with AP-conjugated anti-biotin antibody (alkaline phosphatase-conjugated anti-biotin mAb, Sigma, USA), and then reacted with pNPP (pnitrophenyl palmitate, SIGMA-ALDRICH co., USA), and the absorbance at 405 nm was measured. Based on the ELISA results obtained by reaction with AP-pNPP for 30 minutes, the binding affinities of the expressed and purified Fc-TPP for the b1b2 domains of NRP1 and NRP2 were evaluated.

[0186] As can be seen in FIG. 8(B), it was shown that Fc-TPP11 did bind to NRP1 with high affinity and high specificity.

[0187] In addition, in order to further quantitatively analyze the binding affinities of Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins for NRP1 and NRP2 b1b2 proteins, SPR (surface plasmon resonance) was performed using a Biacore2000 instrument (GE healthcare).

[0188] Specifically, each of NRP1 and NRP2 b1b2 proteins was diluted in 10 mM Na-acetate buffer (pH 4.0), and immobilized on a CM5 sensor chip (GE healthcare, USA) at about 1000 response units (RU). For analysis, HBS-EP buffer [10 mM Hepes, 3 mM ethylenediaminetetraacetic acid, and 0.005% surfactant P20 (pH 7.4), GE Healthcare] was used at a flow rate of 30 l/min, and each of Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins was used at a concentration of 100 nM to 0.4 nM. As a control, Fc-A22p was used. After binding and dissociation analysis, regeneration of the CM5 chip was performed by flushing buffer (20 mM NaOH, 1M NaCl, pH10.0) at a flow rate of 30 l/min for 1 minute. Each sensorgram obtained by 3 minutes of binding and 3 minutes of dissociation was normalized and subtracted compared to a blank cell, thereby determining the affinity.

[0189] Table 5 below shows the results of analyzing the affinities of the Fc-TPP protein for NRP1-b1b2 and NRP2-b1b2 proteins by SPR (surface plasmon resonance, BIACORE 2000, GE healthcare, USA).

TABLE-US-00008 TABLE 5 Analysis of the NRP1-b1b2 and NRP2-b1b2 affinities and specificities of fusion proteins wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region Binding Affinity NRP1-b1b2 NRP2-b1b2 Ratio[(K.sub.D for Binding Binding NRP2)/K.sub.D for Affinity (nM) Affinity (nM) NRP1)] Fc-A22p 63.0 2.1 62.0 1.4 0.98 Fc-TPP1 1.81 0.19 1126 51 624.8 Fc-TPP8 3.85 0.52 253.5 33 65.8 Fc- 1.65 0.18 1555 205 945.3 TPP11

[0190] As shown in Table 5 above, when Fc-TPP1, Fc-TPP8 and Fc-TPP11 that bind specifically to neuropilin-1 was compared with Fc-A22p that binds to the NRP1 and NRP2 b1b2 proteins, there was an about 60-fold difference in the affinity for NRP1, and the affinity for NRP1 was about 60-fold to 1000-fold higher than the affinity for NRP2. In analysis, at least five sensor grams were analyzed, and the results obtained in triplicate were statistically processed. indicates the standard deviation value of independent experiment results.

Example 5: Evaluation of Specific Binding of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins to NRP1 Displayed on Cell Surface and NRP1-Mediated Endocytosis

[0191] In an experiment for biological identification of the peptides that binds specifically to NRP1, human umbilical vein endothelial cells (HUVECs) overexpressing NRP1 were used.

[0192] FIG. 9 shows the results of confocal microscopic analysis to observe co-localization with NRP1 displayed on the human umbilical vein endothelial cell (HUVEC) surface in order to determine whether the Fc-TPP1, Fc-TPP8 or Fc-TPP11 fusion protein binds specifically to NRP1 displayed on the cell surface.

[0193] Specifically, 510.sup.4 HUVEC cells were added to each well of a 24-well plate and incubated in 0.5 ml of EGM2 (Endothelial growth medium, Promocell) medium for 24 hours under the conditions of 5% CO.sub.2 and 37 C. When the cells were stabilized, each well was washed with 0.5 ml of PBS, and then incubated in EBM2 (Endothelial basal medium, Promocell) medium for 4 hours, after which each of Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 was diluted in 0.5 ml of EBM2 medium at 1 M and incubated for 30 minutes at 4 C. Next, the medium was removed, and each well was washed with cold PBS. Then, the fusion protein wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant region was stained with FITC (green fluorescence)-labeled antibody (Sigma) that specifically recognizes Fc, and NRP1 was stained with primary antibody (Abcam) that recognizes NRP1 and with TRITC (red fluorescence)-labeled secondary antibody. The nucleus was stained (blue fluorescence) with DAPI and analyzed by confocal microscopy.

[0194] As shown in FIG. 9, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 did bind to NRP1 on the HUVEC cell surface, unlike Fc.

[0195] In addition, in order to examine whether the fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 can be endocytosed by NRP1, like other neuropilin ligands, endocytosis of the fusion protein and co-localization of the fusion protein with NRP1 were observed by confocal microscopy. Each of Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 was diluted to 1 M and incubated for 10 minutes under the conditions of 37 C. and 5% CO.sub.2. Then, as described above, Fc and the fusion protein of the antibody heavy-chain constant region and the selected peptide that binds specifically to NRP1 were stained and analyzed by confocal microscopy.

[0196] FIG. 10 shows the results of confocal microscopy performed to observe co-localization of the fusion protein (wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region) with NRP1 in order to confirm whether the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins can be endocytosed by NRP1. As shown in FIG. 10, the control Fc was not endocytosed, and Fc-TPP1, Fc-TPP8 and Fc-TPP11 that bind specifically to NRP1 were more endocytosed than Fc-A22p that binds to NRP1 and NRP2, indicating that these fusion proteins more co-localize with NRP1. This suggests that Fc-TPP1, Fc-TPP8 and Fc-TPP11 can be endocytosed specifically by NRP1.

Example 6: Evaluation of Enhanced Cell Penetration Ability of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins

[0197] (1) Western Blot Analysis to Examine the Biological Mechanisms of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins in HUVECs

[0198] It is known that semaphorin 3A or VEGF165A enhances vascular permeability using NRP1 as a co-receptor. In this procedure, changes occur, such as a decrease in vascular endothelial (VD) cadherin, phosphorylation, or the like. Namely, VE-cadherin or epithelial (E)-cadherin is an adhesion factor forming the intercellular space between endothelial cells or between epithelial cells, and a decrease in such molecules densifies the intercellular space to interfere with material movement.

[0199] In an experimental method that can indirectly demonstrate an increase in vascular permeability, a change in VE-cadherin was analyzed by Western blot analysis. Specifically, 510.sup.5 HUVEC cells were seeded into each well of a 6-well plate and incubated for 24 hours, and then treated with 0.1 M of the fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1, for 10 minutes, followed by Western blot analysis. After SDS-PAGE, the gel was transferred to a PVDF membrane, and detection was performed using primary antibodies (SantaCruz) that recognize VE-cadherin and -actin and using HRP-conjugated secondary antibody (SantaCruz), and analysis was performed using ImageQuant LAS4000 mini (GE Healthcare).

[0200] FIG. 11(A) shows the results of Western blot analysis performed to examine the biological mechanisms of Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins in HUVEC. As shown in FIG. 11(A), in the case of the control VEGF165A and Fc-A22p, a decrease in VE-cadherin was observed, unlike the case of Fc. In the case of Fc-TPP8 and Fc-TPP11 specific for NRP1, a decrease in VE-cadherin was also observed. However, in the case of Fc-TPP1, a decrease in VE-cadherin was insignificant. In the case of Fc-A22p, VE-cadherin significantly decreased upon treatment with 1 M of Fc-A22p. In the case of Fc-TPP8 and Fc-TPP11 that bind specifically to NRP1 with high affinity, a significant decrease in VE-cadherin was observed even at 0.1 M, which is 10-fold lower than that of Fc-A22p. Among them, Fc-TPP11 was observed to most effectively induce a decrease in VE-cadherin.

[0201] (2) Transwell Assay to Examine the Abilities of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins to Penetrate Vascular Endothelial Cells

[0202] Based on the experimental results as described above, in order to examine whether the fusion proteins have an improved ability to penetrate vascular endothelial cells, the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins were subjected to a transwell assay.

[0203] Specifically, 510.sup.4 human umbilical vein endothelial cells (HUVECs) were seeded into the upper chamber of a transwell plate (Corning) and incubated in EGM2 for 3 days under the conditions of 37 C. and 5% CO.sub.2. Next, the medium was replaced with EBM medium, and the cells were treated with each of about 1.3 nM of the control VEGF165A and 1 M of each of Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 for 30 minutes. Then, 50 l of dextran-FITC (Sigma) was added to the upper chamber. After 30 minutes, based on the principle according to which the fluorescent substance would be observed when penetration into the vascular endothelial cells was increased, the medium was sampled from the lower chamber and the fluorescence thereof was measured.

[0204] FIG. 11(B) shows the results of Transwell assay performed to confirm whether the peptide binding specifically to NRP1 has an improved ability to penetrate human umbilical vein endothelial cells (HUVEC). As shown in FIG. 11(B), VEGF165A and Fc-A22p had an increased ability to penetrate vascular endothelial cells, and Fc-TPP8 and Fc-TPP11 specific for NRP1 had an increased ability to penetrate vascular endothelial cells, unlike Fc. On the other hand, Fc-TPP1 had a very low ability to penetrate vascular endothelial cells. Taking the results together, it was confirmed that the results shown in FIGS. 11(A) and 11(B) had a close connection with each other, and among the fusion peptides wherein the selected peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region, Fc-TPP11 is the most effective tumor-penetrating peptide (TPP) that penetrates tumor tissue by NRP1.

[0205] (3) Immunohistochemistry (IHC) Experiment for Examining Enhanced Penetration of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins in Mouse Models

[0206] In Examples 6(1) and 6(2) above, it was found in vitro that the fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1 had an enhanced ability to penetrate vascular endothelial cells. Thus, in order to confirm enhanced penetration of the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins in mouse models, an immunohistochemistry (IHC) experiment was performed.

[0207] In order to confirm that the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins have an enhanced ability to penetrate tumor tissue, 510.sup.6 A431 cells expressing neuropilin-1 were injected subcutaneously into Balb/c nude mice, and after about 9 days, when the tumor volume reaches about 300 to 400 mm.sup.3, each of PBS, Fc, Fc-A22p, Fc-TPP1, Fc-TPP8 and Fc-TPP11 was injected intravenously into the mice in an amount of 10 mg/kg. At 15 hours after injection, the tumor was extracted from the mice and subjected to immunohistochemistry. The extracted tumor tissue was sectioned to a thickness of 20 m by a frozen-section method, and the blood vessels were stained with the primary antibody CD31 antibody (BD Pharmingen) and TRITC (red fluorescence)-labeled secondary antibody that recognizes the same. In addition, to observe the distribution of the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins in the tissue, an FITC (green fluorescence)-labeled antibody that recognizes Fc was used.

[0208] FIG. 12 shows the results of immunohistochemistry performed to confirm actual tumor tissue penetration of the peptide that binds specifically to NRP1. As shown in FIG. 12, Fc-A22p selectively reached tumor tissue, unlike the control PBS and Fc, and Fc-TPP1 and Fc-TPP11 specific for NRP1 also penetrated tumor tissue. Furthermore, it was shown that Fc-TPP1 and Fc-TPP11 having higher selectivity and affinity for NRP1 than Fc-A22p more effectively penetrated tissue. However, Fc-TPP8 did not penetrate tumor tissue. Since Fc-TPP1 and Fc-TPP11 had high affinity for NRP1, they selectively reached NRP1-expressing tumor tissue. In addition, since Fc-TPP11 had a higher ability to penetrate tumor tissue than Fc-TPP1, it was more broadly distributed in tumor tissue.

[0209] (4) Examination of the Enhanced Ability of Fc-TPP1, Fc-TPP8 and Fc-TPP11 Fusion Proteins to Penetrate Cancer Cells

[0210] In order to examine whether the Fc-TPP1, Fc-TPP8 and Fc-TPP11 fusion proteins also have an enhanced ability to penetrate cancer cells, a change in E-cadherin in human head and neck cancer FaDu cells expressing NRP1 was analyzed by Western blot analysis under the same conditions as described above.

[0211] FIG. 13(A) shows the results of Western blot analysis performed to examine a change E-cadherin in human head and neck cancer FaDu cells. As shown in FIG. 13(A), Fc-A22p induced a decrease in E-cadherin. In addition, in the case of NRP1-specific Fc-TPP1, Fc-TPP8 and Fc-TPP11, a decrease in E-cadherin was also observed. Like the in vitro results obtained in Examples 6(1) and 6(2), Fc-TPP11 most effectively induced a decrease in E-cadherin.

[0212] (5) Ex Vivo Tumor Penetration Assay to Examine Tumor Penetration in Cancer Cells

[0213] Additionally, in order to examine whether Fc-TPP alleviates the intracellular space between epithelial cells to penetrate tumor tissue even in the absence of blood vessels, an ex vivo tumor penetration assay was performed. In an experimental method, 510.sup.6 FaDu cells were injected subcutaneously into Balb/c nude mice (Nara Biotec, 4-week old, female), and after about 10 days, when the tumor volume reached about 300 to 400 mm.sup.3, the tumor tissue was extracted. The extracted tumor tissue was washed with MEM medium containing 1% BSA (Welgene), and then incubated with 3 M of each of the control PBS and Fc and the test sample Fc-TPP11 for 2 hours and 30 minutes under the conditions of 37 C. and 5% CO.sub.2. The incubated tissue was washed twice with 1% BSA-containing MEM medium for 10 minutes each time, fixed with 4% para-formaldehyde, and then subjected to immunohistochemistry. The tumor tissue was sectioned to a thickness of 20 m by a frozen-section method, and stained with FITC (green fluorescence)-labeled antibody recognizing Fc in order to observe Fc and Fc-TPP11.

[0214] FIG. 13(B) shows the results of the ex vivo tumor penetration assay performed to examine whether Fc-TPP11 can penetrate tumor tissue due to NRP1-mediated tumor tissue penetration activity independently of convection caused by blood flow. As shown in FIG. 13(B), it was observed that the control Fc did not penetrate tumor tissue, whereas Fc-TPP11 did bind to tumor tissue even in the absence of blood vessels. This indicates that Fc-TPP11 allows NRP1 to reduce E-cadherin to thereby regulate the intercellular space in epithelial tissue so that Fc-TPP11 has the ability to penetrate tumor tissue.

Example 7: Evaluation of Competitive Binding of TPP11 Peptide and VEGF165A to NRP1-b1b2

[0215] In order to evaluate competitive binding of the TPP11 peptide, which binds specifically to NRP1 without binding to NRP2, and VEGF165A and a RPARPAR peptide, known to bind to the arginine-binding pocket of the NRP1-b1 domain, competitive ELISA was performed.

[0216] Specifically, binding NRP1-b1b2 (273-586) protein to each well of a 96-well EIA/RIA plate or a 96-well EIA/RIA black plate (COSTAR Corning In., USA) at room temperature for hour, is followed by washing three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. After binding with 5% skim milk (5% Skim milk, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 1 hour, each well was washed three times with 0.1% PBST (0.1% Tween20, pH 7.4, 137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, SIGMA-ALDRICH co., USA) for 10 minutes. A mixture of Fc-A22p (50 nM) and Fc-TPP1, and a mixture of Fc-TPP11 (3 nM) and VEGF165A (25 nM to 0.02 nM), were prepared, and each mixture was allowed to bind to the NRP1-b1b2 protein. Then, each mixture was incubated with AP-conjugated anti-human antibody (alkaline phosphatase-conjugated anti-human mAb, Sigma, USA), and then reacted with pNPP (p-nitrophenyl palmitate, SIGMA-ALDRICH co., USA), and the absorbance at 405 nm was measured. The ELISA results indicated that Fc-TPP1 and Fc-TPP11 did bind to NRP1-b1b2 competitively with VEGF165A.

[0217] FIG. 14(A) shows the results of analyzing whether or not Fc-A22p, Fc-TPP1 and Fc-TPP11 would bind to NRP1 competitively with VEGF165A. It was shown that a portion of NRP1, to which Fc-TPP1, Fc-TPP11 and Fc-A22p did bind, overlapped a portion of NRP1 to which VEGF165A did bind. In addition, it was shown that Fc-TPP1 and Fc-TPP11 had high affinity for NRP1. This suggests that the position at which Fc-TPP1 and Fc-TPP11 bind to NRP1-b1b2 is the arginine-binding pocket to which VEGF165A binds.

[0218] FIG. 14(B) shows the results of evaluating the competitive binding of VEGF165A and RPARPAR peptide, known to bind to the arginine-binding pocket of the NRP1-b1 domain, and the TPP11 peptide to NRP2. It was shown that the TPP11 peptide, a small peptide, inhibited the binding of the RPARPAR peptide and VEGF165 to NRP1. This demonstrates that TPP11 binds to the arginine-binding pocket of NRP1-b1.

Example 8: Evaluation of Anti-Angiogenesis Activity of Fc-TPP11

[0219] (1) Tube Formation Assay to Examine the Ability of Fc-TPP11 to Inhibit Tube Formation in HUVECs

[0220] VEGF165A is known to inhibit angiogenesis using NRP1 as a co-receptor. Based on this, as a method capable of observing angiogenesis in vitro, a tube formation assay was performed. In an experimental method, 50 l of ECMatrix was added to a 96-well plate and polymerized at 37 C. for 2 hours. After 2 hours, HUVEC cells were suspended in EBM2 medium, mixed with VEGF165A (20 ng/ml), Fc or Fc-TPP11 (1 M), plated on the ECMatrix at a density of 110.sup.4 cells per well, and incubated for 8 hours. The incubated cells were imaged with a microscope.

[0221] FIG. 15(A) shows the results of the tube formation assay performed to examine the ability to inhibit tube formation. As shown in FIG. 15(A), tube formation increased in the cells treated with VEGF165A alone, and Fc-TPP11 inhibited tube formation, unlike Fc.

[0222] (2) In Vivo Matrigel Plug Assay to Examine the Anti-Angiogenesis Activity of Fc-TPP11

[0223] Additionally, in order to examine anti-angiogenesis activity in vivo, a matrigel plug assay was performed. In an experimental method, each of 6-8-week-old Balb/c nude mice was injected subcutaneously with 7.510.sup.6 A431 cells, 200 g of Fc, Fc-A22p or Fc-TPP11, and 0.4 ml of Matrigel (BD Biosciences). After 8 days, the matrigel plug was extracted, imaged (FIG. 15(B)), and then sectioned to a thickness of 20 m by a frozen-section method, and subjected to immunohistochemistry. The blood vessels were stained with the primary antibody CD31 and a TRITC (red fluorescence)-labeled secondary antibody recognizing the same, and the density of the blood vessels was measured. FIG. 15(C) shows results indicating that Fc-TPP11 could inhibit VEGF165A-induced angiogenesis in living mice.

[0224] (3) Wound Healing Assay to Examine the Inhibitory Activity of Fc-TPP11 Against Migration of Vascular Endothelial Cells

[0225] In addition to the results obtained in Examples 8(1) and 8(2), in order to examine the inhibitory activity of Fc-TPP11 against VEGF165A-induced migration of vascular endothelial cells, a wound healing assay was performed. In an experimental method, 510.sup.5 HUVEC cells were seeded into each well of a 6-well plate, and then incubated in 0.5% serum EBM2 medium containing 1 g/ml mitomycin c for 1 hour until the cells were saturated (95% or more) in the plate. The dish bottom was linearly rubbed with a yellow tip to make injury lines having a uniform width. Then, the cells were washed with PBS such that the cells were detached from the bottom. After removal of PBS, medium was added slowly to the HUVEC cells. The cells were treated with 0 or 20 ng/ml of VEGF165A, treated with each of Fc and Fc-TPP11 (1 M), and then incubated under the conditions of 37 C. and 5% CO.sub.2. The cells were imaged with a microscope (Primo vert, Carl Zeiss co., Germany) at 0 hour and 18 hours, and the distance between both ends, measured with a computer program (AxioVision LE, Carl Zeiss co., Germany) included in the microscope, was statistically processed.

[0226] FIG. 16(A) shows the results of a wound healing assay performed to examine whether Fc-TPP11 inhibits VEGF165A-induced migration of vascular endothelial cells. The control VEGF165A increased the migration activity of vascular endothelial cells, and Fc-TPP11 inhibited the migration activity of vascular endothelial cells, unlike Fc. This suggests that Fc-TPP11 binds specifically to neuropilin-1 to inhibit the binding of VEGF165A to the arginine-binding pocket of NRP1-b1 to thereby inhibit the migration activity of vascular endothelial cells by VEGF165A.

[0227] (4) Transwell Assay to Examine the Inhibitory Activity of Fc-TPP11 Against Invasion of Vascular Endothelial Cells

[0228] Additionally, in order to examine the inhibitory activity of Fc-TPP11 against VEGF165A-induced invasion of vascular endothelial cells, a transwell assay was performed. A transwell (Corning Costar, USA) having a polycarbonate membrane with a 8-mm pore size was used. Matrigel (Corning Costar, USA) was coated on the lower layer surface of the filter at a ratio of 1:10 and polymerized for 2 hours under the conditions of 37 C. and 5% CO.sub.2, and then 510.sup.4 HUVEC cells and each of Fc and Fc-TPP11 (1 M) were seeded in EBM2 medium in the upper layer well. In addition, EBM2 medium containing VEGF165A (20 ng/ml) was added to the lower layer well. Next, the cells were incubated for 12 hours under the conditions of 37 C. and 5% CO.sub.2, and then unmoved cells in the upper layer well were removed with cotton, and the cells were fixed with 4% para-formaldehyde. Then, the cells were stained with crystal violet. Moved cells were observed with a microscope and counted.

[0229] FIG. 16(B) shows the results of the transwell assay, which indicate that Fc-TPP11 inhibits VEGF165A-induced invasion of HUVEC cells. The control VEGF165A increased the invasion activity of vascular endothelial cells whereas Fc-TPP11 inhibited the invasion activity of vascular endothelial cells. This suggests that Fc-TPP11 binds specifically to the arginine-binding pocket of NRP1-b1 to inhibit the binding of VEGF165A to NRP1 so that Fc-TPP11 inhibits the invasion activity of vascular endothelial cells by VEGF165A.

Example 9: In Vivo Evaluation of Inhibitory Activity of Fc-TPP11 Against Tumor Growth and Angiogenesis

[0230] In Example 8, the anti-angiogenesis of Fc-TPP11 was confirmed. Thus, in order to examine whether Fc-TPP11 has tumor growth inhibitory activity resulting from anti-angiogenesis activity in mouse models, each of Balb/c nude mice was injected subcutaneously with 510.sup.6 FaDu cells, and then injected with Fc-TPP11. Specifically, about 5 days after transplantation of the cells, when the tumor volume reached about 60 mm.sup.3, 20 mg/kg of each of Fc and Fc-TPP11 was injected intravenously into each mouse six times at 3-day intervals (N=6).

[0231] As shown in FIG. 17(A), Fc-TPP11 inhibited cancer cell growth, unlike the control PBS and Fc. Furthermore, as shown in FIG. 17(B), Fc-TPP11 showed no difference in the mouse weight from the case of PBS and Fc, indicating that Fc-TPP11 is not toxic.

[0232] FIG. 17(C) shows the results of performing immunohistochemistry (IHC) of the tumor extracted in the above-described experiment, on the assumption that the tumor growth inhibitory activity of Fc-TPP11 as shown in FIG. 17(A) is attributable to the anti-angiogenesis activity thereof. Angiogenic blood vessels were stained with CD31 antibody, and pericytes surrounding the blood vessels were stained with -SMA, followed by observation with a confocal microscope. As a result, the density of blood vessels in the tumor tissue of the mice injected with Fc-TPP11 decreased compared to that in the mice injected with the control PBS or Fc, and thus co-localization between the blood vessels and the pericytes decreased. This suggests that Fc-TPP11 inhibits VEGF165A-induced angiogenesis which is produced from tumors.

[0233] Taking the above-described experimental results together, as shown in FIG. 19, it was confirmed that the fusion protein (Fc-TPP), wherein the selected peptide that binds specifically to NRP1 without binding to NRP2 is fused to the antibody heavy-chain constant Fc region, shows signaling tendencies such as a decrease in VE-cadherin or E-cadherin, even when it binds specifically to NRP1. In addition, it was shown that when the peptide that binds specifically to NRP1 was present alone, it did not induce significant NRP1 signaling, but when the peptide was present as the Fc-TPP fusion protein that is a bivalently bound form, it effectively induced signaling. This suggests that the fusion protein, wherein the peptide that binds specifically to NRP1 is fused to the antibody heavy-chain constant Fc region, binds bivalently to NRP1 to induce NRP1 signaling, thereby exhibiting effective biological activity. Furthermore, the Fc-TPP fusion protein specific for NRP1 binds to NRP1 competitively with VEGF165A to thereby inhibit VEGF165A-induced angiogenesis, indicating that it has an activity of inhibiting tumor growth in vivo. Moreover, Fc-TPP11 obtained by fusing TPP11 among the selected peptides was most effective in tumor penetration.

Example 10: Evaluation of Enhanced Tumor Tissue Accumulation and Penetration of Small-Molecule Drug Co-Administered with Fc-TPP11

[0234] In order to examine tumor tissue penetration of a small-molecule drug co-administered with the Fc-TPP11 constructed in the above-described experiment, immunohistochemistry was performed. Specifically, each of Balb/c nude mice was injected subcutaneously with 510.sup.6 FaDu cells, and after about 15 days, when the tumor volume reached about 300 to 400 mm.sup.3, 10 mg/kg of the anticancer drug doxorubicin and 2.5 mg/kg of each of PBS, Fc and Fc-TPP11 were injected intravenously into each mouse. At 1 hour after injection, the mouse heart was perfused with PBS and perfused with 4% para-formaldehyde to fix tissue. Next, the tumor tissue was extracted and subjected to immunohistochemistry. The extracted tumor was sectioned to a thickness of 20 m by a frozen-section method, and the blood vessels were stained with the primary antibody CD31 (BD Pharmingen) and a FITC (green fluorescence)-labeled secondary antibody recognizing the same. It was observed that doxorubicin distributed in the tissue showed red fluorescence by itself.

[0235] FIG. 18(A) shows the results of immunohistochemistry (IHC) performed to examine tumor tissue penetration of doxorubicin co-administered with Fc-TPP11. As can be seen therein, in the FaDu cancer cell tissue, little or no red fluorescence was observed in the case of doxorubicin, whereas doxorubicin co-administered with Fc-TPP11 penetrated the tissue more distinct from the blood vessels, compared to doxorubicin alone. In addition, it was observed that co-administration of doxorubicin and the control Fc had no effect on penetration.

[0236] FIG. 18(B) shows the results obtained by homogenizing the extracted tumor tissue and measuring the fluorescence value of doxorubicin in the tumor tissue in order to quantitatively determine the accumulation of doxorubicin in the tissue. According to the same method as that used for FIG. 18(A), doxorubicin and each of PBS, Fc and Fc-TPP11 were injected intravenously into mice, and the mouse heart was perfused with PBS, and the tumor tissue was extracted. The extracted tissue was lysed in 1 ml of lysis buffer containing 1% SDS (sodium dodecyl sulfate) and 1 mM sulfuric acid. Then, a 1:1 mixture of chloroform and isopropyl alcohol was mixed with the lysed tissue at a ratio of 2:1 and then frozen at 80 C. Then, the tissue was thawed at 37 C. and centrifuged, and the fluorescence (Excitation 485 nm/emission 528 nm) of the supernatant was measured to quantify the amount of doxorubicin penetrated.

[0237] The above-described results indicate that the tumor-penetrating peptide that binds specifically to NRP1 may generally be applied to various small-molecule drugs.

Example 11: Construction and Production of TPP11-Fused Full-Length Antibody (mAb-TPP11)

[0238] In Examples 7 and 8, it was found in vitro and in vivo that the fusion protein of the antibody heavy-chain constant Fc region and the selected peptide that binds specifically to NRP1 has an enhanced ability to penetrate vascular endothelial cells. Thus, in order to verify the effect of the peptide that binds specifically to NRP1 in mouse models, the anti-EGFR antibody Cetuximab which is an antibody for treatment of solid tumors was selected as a model antibody for a peptide that binds specifically to mAb-NRP1. To construct Cetuximab-TPP11, in the vector for producing the fusion protein of the TPP11 peptide and the antibody heavy-chain constant region (Fc) as described in Example 3 above, the TPP11-fused DNA in the antibody heavy-chain constant region CH3 obtained by treatment with BsrGI and HindII restriction enzyme was substituted into a vector encoding a wild-type Cetuxmab heavy-chain. FIG. 20 is a schematic view of the constructed Cetuxmab heavy chain-TPP11, and FIG. 21 shows a vector encoding the light-chain of wild-type Cetuximab.

[0239] FIG. 22(A) is a schematic view of cetuximab-TPP11 which is a TPP11 peptide-fused full-length IgG monoclonal antibody. Expression and purification of the antibody was performed in HEK293F according to the method described in Example 3, and the purity of the antibody was analyzed by SDS-PAGE. FIG. 22(B) shows the results obtained by co-transforming the antibody into HEK293F cells, transiently expressing and purifying the antibody, and then analyzing the size and purity of the antibody on SDS-PAGE under reducing and non-reducing conditions.

[0240] Table 6 below the yield of the purified TPP11-fused antibody produced per L of culture. The results obtained in triplicate were statistically processed, and indicates standard deviation value. The yield of the produced protein (Cetuximab-TPP11) did not significantly differ from that of wild-type protein (Cetuximab).

TABLE-US-00009 TABLE 6 Comparison of expression/purification yield of TPP11 peptide-fused antibody with wild-type antibody Name of Clone Yield (mg/L) Cetuximab 39.9 6.2 Cetuximab- 40.2 5.0 TPP11

[0241] FIG. 22(C) shows the results of ELISA performed to compare the EGFR binding affinity of TPP11-fused Cetuximab-TPP11 with that of wild-type antibody (Cetuximab) as described in Example 4 above. It was shown that, even when the TPP11 was fused to Cetuximab, it did not affect the binding affinity of Cetuximab to the antigen EGFR.

Example 12: Evaluation of Enhanced Tissue Penetration Ability of Cetuximab-TPP11 Antibody

[0242] In order to evaluate tumor tissue penetration of the TPP11 peptide-fusion antibody constructed in the above-described experiment, each of Balb/c nude mice was injected subcutaneously with 510.sup.6 FaDu cells, and after about 9 days, when the tumor volume reached about 300 to 400 mm.sup.3, 1.25 mg/kg of PBS, Cetuximab and Cetuximab-TPP11 was injected intravenously into each mouse. At 3 hours after injection, the tumor was extracted from the mice and subjected to immunohistochemistry. The tissue was stained and observed in the same manner as described in Example 6.

[0243] FIG. 23 shows the results of immunohistochemistry (IHC) performed to evaluate tumor tissue penetration of TPP11 peptide-fused Cetuximab. As can be seen therein, in the case of Cetuximab, green fluorescence was observed around the blood vessels in the FaDu cancer cell tissue, whereas TPP11-fused Cetuximab-TPP11 penetrated the tissue more distant from the blood vessels, compared to Cetuximab. To quantify this penetration, ImageJ program was used. Particularly, TPP11-fused Cetuximab-TPP11 having higher binding affinity for NRP1 more effectively penetrated the tissue compared to Cetuximab-A22p. The above-described results indicate that the tumor-penetrating peptide that binds specifically to NRP1 may generally be applied to various monoclonal antibodies that recognize various antigens.