PRIMER FOR DETECTING FECAL POLLUTION IN WATER, KIT AND HIGH-THROUGHPUT TRACING METHOD

Abstract

A primer for detecting fecal pollution in water, kit and high-throughput tracing method is disclosed, and belongs to the field of water pollution detection. The method mainly comprises the following steps: extracting DNA from water samples to be tested; using two pairs of universal primers for amplifying mitochondrial DNA to perform nested PCR amplification on the water sample DNA; performing high-throughput sequencing of the amplified products; performing annotation and alignment between sequencing data and a mitochondrial DNA database, and determining the sources of fecal pollution in water samples based on the alignment results. According to the present invention, nested PCR technology is utilized to amplify mitochondrial DNA with high sensitivity. The universal primers are combined with high-throughput sequencing, which can not only trace multiple sources of potential fecal pollution simultaneously, but also correspondingly quantify the degree of fecal pollution, thereby determining the main pollution source.

Claims

1. A primer for detecting fecal pollution in water, wherein the primer has nested PCR amplification sequences, and the sequences are respectively: TABLE-US-00005 AF (5′-3′): (SEQ ID NO: 1) ACTGGGATTAGATACCCCACTATG;  AR (5′-3′): (SEQ ID NO: 2) ACCAGCTATCACCMRGCTC;  BF (5′-3′): (SEQ ID NO: 3) CCCACTATGCYTRGCCCTAAA;  and BR (5′-3′): (SEQ ID NO: 4) GTAYRCTTACCWTGTTACGACTT.

2. A kit for detecting fecal pollution in water, comprising the primer for detecting fecal pollution in water according to claim 1, dNTP, PCR buffer, Taq enzyme, Mg.sup.2+ solution and ddH.sub.2O.

3. The kit for detecting fecal pollution in water according to claim 2, wherein the PCR buffer is 10×PCR buffer, and the concentration of the dNTP is 2.5 mM, the concentration of the Taq enzyme is 5 U/μL, and the concentration of the Mg.sup.2+ solution is 25 mmol/L.

4. A high-throughput traceable method for detecting fecal pollution in water, comprising the following steps: (a) sample treatment: taking water samples to be tested and extracting DNA from the water samples; (b) nested PCR amplification: performing nested PCR amplification on the DNA extracted in step (a) to obtain nested PCR products, by using the primer for detecting fecal pollution in water according to claim 1 or the kit for detecting fecal pollution in water according to any one of claims 2-3; (c) high-throughput sequencing: recovering and purifying the nested PCR products, and then performing high-throughput sequencing, outputting the sequencing results in .fastq format, and filtering out the sequences with short sequencing length; and (d) pollution source analysis: performing BLAST alignment between that sequences obtained in step (c) and a mitochondrial DNA database, and analyzing pollution sources according to BLAST annotation information.

5. The high-throughput traceable method for detecting fecal pollution in water according to claim 4, wherein the process of the nested PCR in step (b) comprises the following steps: first performing the first round of PCR amplification by AF and AR, wherein the water sample DNA is used as the template, and the amplification conditions are as follows: predenaturation for 5 min at 95° C., for 30 s at 95° C., for 60 s at 59° C., for 45 s at 72° C., 35 cycles; for 7 min at 72° C., preservation at 4° C.; and then performing the second round of PCR amplification by BF and BR, wherein the products in the first round of PCR are used as the templates, and the amplification conditions are as follows: predenaturation for 5 min at 95° C., for 30 s at 95° C., for 40 s at 58° C., for 45 s at 72° C., 35 cycles; for 7 min at 72° C., preservation at 4° C.

6. The high-throughput traceable method for detecting fecal pollution in water according to claim 5, wherein in step (c), the product at 500 bp is recovered for purification, and the sequences with a length less than 450 bp are filtered out after high-throughput sequencing.

7. The high-throughput traceable method for detecting fecal pollution in water according to claim 6, wherein in step (d), the mitochondrial DNA database is a mitochondrial 12S rRNA gene library.

8. The high-throughput traceable method for detecting fecal pollution in water according to claim 7, wherein the BLAST annotation threshold is 0.8.

9. The high-throughput traceable method for detecting fecal pollution in water according to claim 8, wherein in step (d), the species returned by BLAST are taken as potential fecal pollution sources, and when the number of the returned species is equal to or greater than 2, the proportion of the number of annotated sequences of each species to the total sequence number is positively correlated with the degree of fecal pollution from each source.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0026] FIG. 1 is a schematic diagram of the high-throughput method for tracing the sources of fecal pollution in water according to the present invention;

[0027] FIG. 2 is a PCR amplification diagram of the universal primers according to the present invention on DNA of water samples contaminated by feces from different sources, wherein (A) is a PCR amplification diagram of universal primers AF and AR; and (B) is a PCR amplification diagram of universal primers BF and BR; and

[0028] FIG. 3 is a sequence information diagram showing high-throughput sequencing data.

DETAILED DESCRIPTION

[0029] Unless otherwise specified, the terms used in the present invention have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described in detail below with reference to specific examples and the accompanying drawings. It should be noted that these examples are only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention in any way.

Example 1

[0030] A method of the present invention can simultaneously detect fecal pollution from sources including human beings, livestock, wild birds, mammals and the like, and the steps are shown in FIG. 1. In this example, Homo sapiens, Sus scrofa, Bos taurus, Ovis aries, Gallus gallus, Anas platyrhynchos, Anser cygnoides, Felis catus, Mus musculus and Gracula religiosa were selected as representatives, and fecal pollution water samples of various species were simulated in the laboratory to verify the applicability of universal primers in the present invention.

[0031] Fresh feces of the above species were collected, a small amount of the feces were respectively added into river water which was not contaminated by feces, and 1 L of the feces-containing river water was respectively taken and filtered through a mixed cellulose ester membrane with a pore diameter of 0.22 μm; and then DNA on the filter membrane was extracted by using FastDNA SPIN Kit for Soil (Takara), and the DNA was taken as the template DNA to perform nested PCR amplification. The PCR instrument was ABI Veriti96 instrument. FIG. 2 is a PCR amplification diagram of universal primers according to the present invention on DNA of water samples contaminated by feces from different sources. First, two rounds of PCR amplification were performed.

[0032] The primer sequences of the first round of PCR were: AF (5′-3′): ACTGGGATTAGATACCCCACTATG (SEQ ID NO: 1) and AR (5′-3′): ACCAGCTATCACCMRGCTC (SEQ ID NO: 2); PCR reaction system was: 2.5 μl of 10×PCR buffer; 2.5 μL of dNTP; 0.1 μL of Taq enzyme; 2 μL of Mg.sup.2+; 0.5 μL of AF primer, 0.5 μL of AR primer, 2 μL of template DNA, making up to 25 μL with sterile water; and PCR reaction conditions were: predenaturation for 5 min at 95° C., for 30 s at 95° C., for 60 s at 59° C., for 45 s at 72° C., 35 cycles; for 7 min at 72° C., preservation at 4° C.

[0033] The products in the first round of PCR were subjected to 1% gel electrophoresis at 120 V and 440 mA for 25 min. The electrophoresis results are shown in FIG. 2A. DNA of water samples contaminated by feces from various species could be amplified by universal primers AF and AR, and the amplified fragments had the same length (about 950 bp).

[0034] Then, the products in the first round of PCR were used as templates to perform the second round of PCR amplification, and the PCR primers were BF (5′-3′): CCCACTATGCYTRGCCCTAAA (SEQ ID NO: 3) and BR (5′-3′): GTAYRCTTACCWTGTTACGACTT (SEQ ID NO: 4); PCR reaction system was: 2.5 μL of 10×PCR buffer; 2.5 μL of dNTP; 0.1 μL of Taq enzyme; 2 μL of Mg.sup.2+; 0.5 μL of BF primer, 0.5 μL of BR primer, 2 μL of template DNA, making up to 25 μL with sterile water; and PCR reaction conditions were: predenaturation for 5 min at 95° C., for 30 s at 95° C., for 40 s at 58° C., for 45 s at 72° C., 35 cycles; for 7 min at 72° C., preservation at 4° C.

[0035] The products in the second round of PCR were subjected to 1% gel electrophoresis at 120 V and 440 mA for 25 min. The electrophoresis results are shown in FIG. 2B. It can be seen that the universal nested PCR primers in the present invention could be used to amplify the DNA of water samples contaminated by feces from various species, and the nested PCR products of each species had the same length (about 500 bp).

[0036] The above results show that the nested PCR primers in the present invention has good applicability to different species, and the length of the nested PCR products are moderate, which is favorable for performing high-throughput sequencing by using the current mainstream second generation sequencing platform.

Example 2

[0037] The feces of the above 10 species were used to simulate the detection of water contaminated by multiple feces. Ten kinds of feces were simultaneously added into river water which was not contaminated by feces, wherein the Bos taurus feces were added in the largest amount. One liter of the above river water was taken and filtered by a mixed cellulose ester membrane with a pore diameter of 0.22 μm; then DNA on the filter membrane was extracted by using FastDNA SPIN Kit for Soil (MP bio), and the DNA was taken as the template DNA to perform nested PCR amplification in the same way as in Example 1. The nested PCR products were subjected to gel electrophoresis in the same way as in Example 1. The PCR product at 500 bp was recovered from gel and purified by Takara MiniBEST Agarose Gel DNA Extraction Kit (Takara), and high-throughput sequencing was performed by an IlluminaMiseq sequencing platform, with the read length mode of 300 bp at both ends. The obtained sequencing data in .fastq format was first subjected to quality control by prinseq-lite software to ensure that the quality value of each base was greater than 30. The data format was converted to .fasta, and then sequences with the length less than 450 bp were removed by mothur software to obtain 36760 valid sequences. The sequence information is shown in FIG. 3.

[0038] In order to verify the accuracy of sequencing results, a simple mitochondrial DNA database was constructed, which contained mitochondrial 12S rRNA genes of 20 species (Table 1). The annotation and alignment between the sequencing data and the simple database was performed by local BLAST, and the BLAST annotation threshold was set to 0.8.

[0039] The species information of the simple mitochondrial DNA database and the results of numbers of annotated sequences are shown in Table 1, with a total of 36160 sequences successfully annotated. The annotated species were Homo sapiens, Sus scrofa, Bos taurus, Ovis aries, Gallus gallus, Anas platyrhynchos, Anser cygnoides, Felis catus, Mus musculus and Gracula religiosa, which were completely consistent with the species sources of feces contained in the water sample, while none of the other species was annotated, indicating that the method of the present invention has good accuracy and specificity. In addition, among all annotated sequences, the number of sequences derived from Bos taurus was the largest, indicating that Bos taurus feces pollution was relatively the most serious, which was consistent with the actual situation. It is indicated that the method of the present invention can be used to identify the main pollution source in a complex fecal pollution environment.

[0040] The species returned by BLAST were taken as potential fecal pollution sources. When the number of returned species was equal to or greater than 2, the proportion of the number of annotated sequences of each species to the total sequence number is positively correlated with the degree of fecel pollution from each source.

TABLE-US-00003 TABLE 1 Species information of the simple mitochondrial DNA database and numbers of annotated sequences NCBI serial Number of annotated Species number sequences Cygnus NC_027095.1 0 Phoca largha FJ895151.1 0 Castor canadensis NC_033912.1 0 Anser cygnoides KU211647.1 53 Meles leucurus amurensis KU707936.1 0 Egretta eulophotes EU072995.1 0 Gracula religiosa JF937590.1 5852 Phalacrocorax carbo NC_027267.1 0 Anas platyrhynchos MF069251.1 3033 Equus caballus KX669268.1 0 Felis catus NC_001700.1 1209 Bos taurus MK028750.1 19976 Canis lupus familiaris HM048871.1 0 Homo sapiens FJ986465.1 2799 Sciurus vulgaris KU962990.1 0 Mus musculus EU450583.1 36 Ursus arctos AF303110.1 0 Ovis aries KU575248.1 3117 Mustek itatsi NC_034330.1 0 Gallus gallus KX512321.1 52 Sus scrofa KX146493.1 33 Total 36160

[0041] The present invention and its embodiments have been schematically described above, and the description is not restrictive. The accompanying drawing also shows only one embodiment of the present invention, and the actual structure is not limited thereto. Therefore, if a person of ordinary skill in the art designs similar structural modes and embodiments without creativity under the enlightenment without departing from the purpose of the present invention, the structural modes and the embodiments should fall within the protection scope of the present invention.

Sequence Listing

[0042]

TABLE-US-00004 SEQ ID NO: 1 ACTGGGATTAGATACCCCACTATG SEQ ID NO: 2 ACCAGCTATCACCMRGCTC SEQ ID NO: 3 CCCACTATGCYTRGCCCTAAA SEQ ID NO: 4 GTAYRCTTACCWTGTTACGACTT