OLIGONUCLEOTIDE CONTAINING BLOCKER

20220348606 · 2022-11-03

Assignee

Inventors

Cpc classification

International classification

Abstract

An oligonucleotide containing a blocker, relating to the field of target sequence hybridization capture and the design and synthesis of universal blocking oligonucleotides. Applying an oligonucleotide that has a blocking function or a combination thereof not only has a good blocking effect on an linker sequence during the capture of a target sequence in a single sample, but also reduces non-specific capture and improves the capture efficiency. In particular, the oligonucleotide may effectively block linker sequences at both ends of a target sequence in a plurality of samples and improve the target sequence capture efficiency.

Claims

1. An oligonucleotide containing a blocker introduced into a basic sequence, wherein the backbone of the blocker contains a carbon-carbon bond, a carbon-oxygen bond, a carbon-nitrogen bond, a nitrogen-oxygen bond, a phosphorus-oxygen bond, or a combination thereof, and the quantity of the carbon-carbon bond, the carbon-oxygen bond, the carbon-nitrogen bond, the nitrogen-oxygen bond, the phosphorus-oxygen bond, or the combination thereof is 10-900.

2-3. (Canceled)

4. The oligonucleotide according to claim 1, wherein the carbon-carbon bond, the carbon-oxygen bond, the carbon-nitrogen bond, the nitrogen-oxygen bond, the phosphorus-oxygen bond, or the combination thereof exists in a glycol molecule, nitroindole, deoxyinosine, furan, or a phosphine oxide thereof.

5. The oligonucleotide according to claim 4, wherein the glycol molecule is ethylene glycol, propylene glycol, butylene glycol, pentylene glycol, hexylene glycol, nonamethylene glycol, dodecamethylene glycol, or polyethylene glycol.

6. The oligonucleotide according to claim 1, wherein the blocker further contains a phosphodiester bond.

7. The oligonucleotide according to claim 6, wherein the blocker comprises the following structural formula, m being an integer from 3-150: ##STR00009##

8. (Canceled)

9. The oligonucleotide according to claim 6, wherein the blocker comprises the following structural formula, n being an integer from 4-150: ##STR00010##

10. (Canceled)

11. The oligonucleotide according to claim 6, wherein the blocker comprises the following structural formula: ##STR00011## a being an integer from 3-150

12. The oligonucleotide according to any one of claims 1 to 11, wherein the basic sequence comprises is selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

13. The oligonucleotide according to claim 12, wherein the basic sequence further comprises a modified base, and the modified base is selected from a bicyclic nucleotide modified base, a phosphorothioate modified base, a 2′-methoxy modified base, or a combination thereof.

14. The oligonucleotide according to claim 13, wherein the quantity of the modified base is 1-20.

15-16. (Canceled)

17. The oligonucleotide according to claim 13, wherein the bicyclic nucleotide modified base is selected from a locked nucleic acid modified base; and wherein the locked nucleic acid modified base is LNA-A, LNA-G, LNA-C, LNA-T, or a combination thereof.

18-19. (Canceled)

20. The oligonucleotide according to claim 13, wherein the phosphorothioate modified base is phosphorothioate modified adenine, phosphorothioate modified guanine, phosphorothioate modified cytosine, phosphorothioate modified thymine, phosphorothioate modified uracil, or a combination thereof.

21. The oligonucleotide according to claim 13, wherein the 2′-methoxy modified base is 2′ methoxy modified adenine, 2′-methoxy modified guanine, 2′-methoxy modified cytosine, 2′-methoxy modified thymine, 2′-methoxy modified uracil, or a combination thereof.

22. The oligonucleotide according to claim 1, further comprising a 3′-end modification.

23. The oligonucleotide according to claim 22, wherein the 3′-end modification is a 3′Spacer C3 modification or 3′-ddC modification.

24. A combination of oligonucleotide sequences, comprising at least two oligonucleotides according to claim 1.

25. (Canceled)

26. The combination of oligonucleotide sequences according to claim 24, comprising: an oligonucleotide as set forth in SEQ ID NO: 5 and an oligonucleotide as set forth in SEQ ID NO 6; an oligonucleotide as set forth in SEQ ID NO: 7 and an oligonucleotide as set forth in SEQ ID NO: 8; an oligonucleotide as set forth in SEQ ID NO: 9 and an oligonucleotide as set forth in SEQ ID NO: 10; an oligonucleotide as set forth in SEQ ID NO: 11 and an oligonucleotide as set forth in SEQ ID NO: 12; an oligonucleotide as set forth in SEQ ID NO: 13 and an oligonucleotide as set forth in SEQ ID NO: 14; or an oligonucleotide as set forth in SEQ ID NO: 15 and an oligonucleotide as set forth in SEQ ID NO: 16.

27-31. (Canceled)

32. A kit, comprising the oligonucleotide according to claims 1.

33. Use of the oligonucleotide according to claim 1 in sequencing.

34. The use according to claim 33, wherein the use in sequencing is high-throughput sequencing, polynucleotide sequencing, forensic science, disease detection, medical diagnosis, precision medicine, companion diagnostics, non-invasive prenatal testing, or early tumor screening.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0105] FIG. 1 is a diagram of blocking of an oligonucleotide containing a blocker.

[0106] FIG. 2 is an analysis diagram of a relative content of SEQ ID NO: 5 measured by HPLC in Example 1.

[0107] FIG. 3 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 5 prepared in Example 1.

[0108] FIG. 4 is an analysis diagram of a relative content of SEQ ID NO: 6 measured by HPLC in Example 1.

[0109] FIG. 5 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 6 prepared in Example 1.

[0110] FIG. 6 is an analysis diagram of a relative content of SEQ ID NO: 7 measured by HPLC in Example 2.

[0111] FIG. 7 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 7 prepared in Example 2.

[0112] FIG. 8 is an analysis diagram of a relative content of SEQ ID NO: 8 measured by HPLC in Example 2.

[0113] FIG. 9 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 8 prepared in Example 2.

[0114] FIG. 10 is an analysis diagram of a relative content of SEQ ID NO: 9 measured by HPLC in Example 3.

[0115] FIG. 11 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 9 prepared in Example 3.

[0116] FIG. 12 is an analysis diagram of a relative content of SEQ ID NO: 10 measured by HPLC in Example 3.

[0117] FIG. 13 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 10 prepared in Example 3.

[0118] FIG. 14 is an analysis diagram of a relative content of SEQ ID NO: 11 measured by HPLC in Example 4.

[0119] FIG. 15 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 11 prepared in Example 4.

[0120] FIG. 16 is an analysis diagram of a relative content of SEQ ID NO: 12 measured by HPLC in Example 4.

[0121] FIG. 17 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 12 prepared in Example 4.

[0122] FIG. 18 is an analysis diagram of a relative content of SEQ ID NO: 13 measured by HPLC in Example 5.

[0123] FIG. 19 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 13 prepared in Example 5.

[0124] FIG. 20 is an analysis diagram of a relative content of SEQ ID NO: 14 measured by HPLC in Example 5.

[0125] FIG. 21 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 14 prepared in Example 5.

[0126] FIG. 22 is an analysis diagram of a relative content of SEQ ID NO: 15 measured by HPLC in Example 6.

[0127] FIG. 23 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 15 prepared in Example 6.

[0128] FIG. 24 is an analysis diagram of a relative content of SEQ ID NO: 16 measured by HPLC in Example 6.

[0129] FIG. 25 is an analysis diagram of actual relative molecular mass measurement of SEQ ID NO: 16 prepared in Example 6.

SEQUENCE LISTING

[0130] The Sequence Listing is submitted as an ASCII text file Sequence_Listing.txt, generated on Jun. 3, 2022, 22,663 bytes, which is herein incorporated by reference in its entirety.

[0131] SEQ ID NOS: 1-4 are exemplary basic oligonucleotide sequences.

[0132] SEQ ID NOS: 5-16 are an exemplary oligonucleotide sequences containing a blocker.

DETAILED DESCRIPTION

[0133] Preparation of reagents, raw materials, and apparatus:

[0134] A deprotection reagent was prepared by dissolving dichloroacetic acid in a dichloromethane solution (3%, v/v).

[0135] An activator was prepared by dissolving 5-ethylthio-1H-tetrazole in an acetonitrile solution (0.25 M).

[0136] A capping reagent A was prepared by dissolving N-methylimidazole in an acetonitrile solution (20%, v/v).

[0137] A capping reagent B was prepared by dissolving acetic anhydride in an acetonitrile solution (30%, v/v).

[0138] An oxidizing agent (0.06 M) was prepared by dissolving iodine in a pyridine solution/(a mixed solution of pyridine and acetonitrile (3/2, v/v) of 3-((dimethylamino-methylene)amino)-3H-1,2,4-dithiazole-3-thione (0.06 M)).

[0139] Phosphoramidite monomer (A/T/G/C/mA/mG/mC/mU) solutions (0.067 M) were separately prepared by separately dissolving phosphoramidite monomers (A/T/G/C/mA/mG/mC/mU) in acetonitrile solutions.

[0140] Locked nucleic acid phosphoramidite monomer (LNA-A/LNA-G/LNA-C/LNA-T) solutions were separately prepared by dissolving LNA-C (0.067 M) in a mixed solution of acetonitrile and dichloromethane (1/1, v/v) and separately dissolving LNA-A/LNA-G/LNA-T (0.067 M) in acetonitrile solutions.

[0141] Raw materials (0.067 M) for synthesizing a blocker were prepared by separately dissolving an ethylene glycol phosphoramidite monomer, a propylene glycol phosphoramidite monomer, and a hexaethylene glycol phosphoramidite monomer in acetonitrile solutions.

[0142] Solid-phase synthesis supports: 3′-Spacer C3-CPG support: 200 nmol/piece; and 3′-ddC-CPG support: 200 nmol/piece.

[0143] Apparatus: Dr. Oligo 96/192 synthesizer.

Example 1 Synthesis of Oligonucleotide Sequence Containing Blocker

[0144]

TABLE-US-00001 SEQ ID NO: 5 5′-AATGATACGGCGACCACCGAGATCTACACNACACTCTTTCCCTACAC GACGCTCTTCCGATCT-3′

[0145] The LC modification positions (starting from the 5′-end) are 8, 11, 14, 17, 24, 32, 34, 36, 40, 42, 45, 47, 50, 52, 54, and 58.

[0146] Nis a hexaethylene glycol phosphodiester bond structure.

TABLE-US-00002 SEQ ID NO: 6 5′-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNATCTCGTATGCC GTCTTCTGCTTG-3′

[0147] The LC modification positions (starting from the 5′-end) are 5, 13, 15, 17, 20, 25, 27, 28, 32, 38, 40, 46, 47, 50, 53, and 56.

[0148] N is a hexaethylene glycol phosphodiester bond structure.

[0149] Solid-phase synthesis steps: [0150] 1. The foregoing reagents were prepared on the Dr. Oligo192 apparatus, and the air tightness, channel unobstructedness, and operating state of the apparatus were checked. After there was no error in the check, a 3′-Spacer C3-CPG support with a pore size of 1000 Å, a sample load of 26 μmol/g, and a synthesis scale of 200 nmol was selected to synthesize the foregoing two primers in a synthesis direction from the 3′-end to the 5′-end with reference to the sequence synthesis procedures and methods in Current Protocols in Nucleic Acid Chemistry (2001) 3.8.1-3.8.15. [0151] 2. After the synthesis, the support was transferred into a 2 mL screw-cap centrifuge tube with a corresponding label, and 1 mL of ice-cold NH.sub.3.Math.H.sub.2O was added, to react in an oven at 80° C. for 2 h. [0152] 3. After the reaction, the centrifuge tube was taken out to cool down to room temperature, the cap was slowly unscrewed, centrifugation was first carried out and vacuumizing was then slowly started at 60° C. by using a fast centrifugal concentration dryer, the pressure was reduced to quickly volatilize the ammonia water and remove the ammonia smell, the CPG support was removed through filtration with a 0.22 μm membrane, and the filtrate was transferred into a new 2 mL screw-cap centrifuge tube with a corresponding label and concentrated under reduced pressure to a dry powder. [0153] 4. The dry powder in step 3 was added into 1 mL of Milli-Q water to shake for 15s and to be centrifuged at a high speed of 12000 rpm for 15s and mixed well for use. A 96-Well ELISA plate was used. 195 μL of deionized water was used as a blank control to measure the blank absorbance after calibration. 5 μL of the mixed sample solution was drawn up and dispensed slowly to mix well 5 times by using a pipette, and then the absorbance after calibration was measured by using the Tecan ELISA reader (Infinite® 200 PRO). The difference between the two was the sample absorbance. The crude product amount (unit: nmol) was calculated according to the corresponding molar attenuation coefficient, dilution factor, and remaining volume of the sample. [0154] 5. The crude product containing two blocking oligonucleotides was filtered by a 0.22 μm membrane. Target fractions were respectively separated and collected by using the Waters 1525 high-performance liquid preparative chromatography (model: XBridge BEH C18 OBD preparative column; pore size: 130 A; particle size: 5μm; length: 10 mm×100 mm; mobile phase A: Milli-Q aqueous solution containing 100 mM of triethylammonium acetate (pH 8.5); mobile phase B: mixed solution of the mobile phase A and acetonitrile (5/95, v/v); gradient: 6%-16%; time: 0-12 min; flow rate: 3 mL/min; temperature: room temperature). The target purity was analyzed from 0.1 nmol of the fraction by the Agilent 1260 high-performance liquid chromatography (model: XBridge Oligonucleotide BEH C18 Column; pore size: 130 A; particle size: 2.5 μm; length: 4.6 mm×50 mm; mobile phase A: Milli-Q aqueous solution containing 100 mM of triethylammonium acetate (pH 7.0); mobile phase B: mixed solution of the mobile phase A and acetonitrile (5/95, v/v); gradient: 5%-25%; time: 0-6 min; flow rate: 2 mL/min; temperature: room temperature), and the target mass was analyzed by MS (Thermo, LTQ). The remaining fractions were concentrated under reduced pressure to a dry powder and then redissolved with Milli-Q water. The samples that meet the QC standard (the HPLC purity is greater than 90%, the MS target peak ratio is greater than 90%, and the single impurity content is less than 5%) were quantified by the Tecan ELISA reader. The qualified samples were diluted to 1 nmol/μL and then stored at −20° C. For target sequence hybridization capture, the oligonucleotide 1 and oligonucleotide 2 were mixed in equal volumes and centrifuged to mix well to form a universal blocking oligonucleotide mixture 1. The purities of the two synthetic oligonucleotides are shown in FIG. 2 and FIG. 4. The theoretical molecular weight (MW) of SEQ ID NO: 5 is 20542. As shown in FIG. 3, the MW of actually prepared SEQ ID NO: 5 is 20541.8. The theoretical MW of SEQ ID NO: 6 is 19488. As shown in FIG. 5, the MW of actually prepared SEQ ID NO: 6 is 19487.1.

Example 2 Synthesis of Oligonucleotide Sequence Containing Blocker

[0155]

TABLE-US-00003 SEQ ID NO: 7 5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTC CCTACACGACGCTCTTCCGATCT-3′

[0156] The LC modification positions (starting from the 5-end) are 8, 11, 14, 17, 24, 39, 41, 43, 47, 49, 52, 54, 57, 59, 61, and 65.

[0157] N is an ethylene glycol phosphodiester bond structure.

TABLE-US-00004 SEQ ID NO: 8 5′-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCT CGTATGCCGTCTTCTGCTTG-3′

[0158] The LC modification positions (starting from the 5-end) are 5, 13, 15, 17, 20, 25, 27, 28, 32, 45, 47, 53, 54, 57, 60, and 63.

[0159] Nis an ethylene glycol phosphodiester bond structure.

[0160] Referring to the method in Example 1, a blocking oligonucleotide combination 2 was obtained by solid-phase synthesis and purification. The two blocking oligonucleotides therein were mixed in equal volumes and centrifuged to mix well to form a universal blocking oligonucleotide mixture 2. The purities of the two synthetic oligonucleotides are shown in FIG. 6 and FIG. 8. The theoretical molecular weight (MW) of SEQ ID NO: 7 is 20624. As shown in FIG. 7, the MW of actually prepared SEQ ID NO: 7 is 20622.4. The theoretical MW of SEQ ID NO: 8 is 19568. As shown in FIG. 9, the MW of actually prepared SEQ ID NO: 8 is 19569.3.

Example 3 Synthesis of Oligonucleotide Sequence Containing Blocker

[0161]

TABLE-US-00005 SEQ ID NO: 9 5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNACACTCTTTCC CTACACGACGCTCTTCCGATCT-3′

[0162] The LC modification positions (starting from the 5-end) are 8, 11, 14, 17, 24, 38, 40, 42, 46, 48, 51, 53, 56, 58, 60, and 64.

[0163] N is a propylene glycol phosphodiester bond structure.

TABLE-US-00006 SEQ ID NO: 10 5′-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNATCTCG TATGCCGTCTTCTGCTTG-3′

[0164] The LC modification positions (starting from the 5-end) are 5, 13, 15, 17, 20, 25, 27, 28, 32, 44, 46, 52, 53, 56, 59, and 62.

[0165] N is a propylene glycol phosphodiester bond structure.

[0166] Referring to the method in Example 1, a blocking oligonucleotide combination 3 was obtained by solid-phase synthesis and purification. The two blocking oligonucleotides therein were mixed in equal volumes and centrifuged to mix well to form a universal blocking oligonucleotide mixture 3. The purities of the two synthetic oligonucleotides are shown in FIG. 10 and FIG. 12. The theoretical molecular weight (MW) of SEQ ID NO: 9 is 20694. As shown in FIG. 11, the MW of actually prepared SEQ ID NO: 9 is 20693.3. The theoretical MW of SEQ ID NO: 10 is 19639. As shown in FIG. 13, the MW of actually prepared SEQ ID NO: 10 is 19640.1.

Example 4 Synthesis of Oligonucleotide Sequence Containing Blocker

[0167]

TABLE-US-00007 SEQ ID NO: 11 5′- CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGT ATGCCGTCTTCTGCTTG-3′

[0168] The LC modification positions (starting from the 5-end) are 5, 7, 13, 15, 18, 21, 25, 27, 29, 34, 45, 47, 54, 57, 60, and 63.

[0169] N is an ethylene glycol phosphodiester bond structure.

TABLE-US-00008 SEQ ID NO: 12 5′-CTGTCTCTTATACACATCTGACGCTGCCGACGANNNNNNNNGTGTAG ATCTCGGTGGTCGCCGTATCATT-3′

[0170] The LC modification positions (starting from the 5-end) are 5, 7, 13, 15, 18, 22, 24, 28, 31, 50, 52, 59, 61, and 67. The LT modification positions (starting from the 5-end) are 45 and 55.

[0171] N is an ethylene glycol phosphodiester bond structure.

[0172] Referring to the method in Example 1, a blocking oligonucleotide combination 4 was obtained by solid-phase synthesis and purification. The two blocking oligonucleotides therein were mixed in equal volumes and centrifuged to mix well to form a universal blocking oligonucleotide mixture 4. The purities of the two synthetic oligonucleotides are shown in FIG. 14 and FIG. 16. The theoretical molecular weight (MW) of SEQ ID NO: 11 is 20942. As shown in FIG. 16, the MW of actually prepared SEQ ID NO: 11 is 20938.6. The theoretical MW of SEQ ID NO: 12 is 19570. As shown in FIG. 5, the MW of actually prepared SEQ ID NO: 12 is 19567.2.

Example 5 Synthesis of Oligonucleotide Sequence Containing Blocker

[0173]

TABLE-US-00009 SEQ ID NO: 13 5′-mC*mU*GTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNA TCTCGTATGCCGTCTTCTGCT*mU*mG-3′

[0174] The LC modification positions (starting from the 5-end) are 5, 7, 13, 15, 18, 21, 25, 27, 29, 34, 45, 47, 54, 57, 60, and 63.

[0175] N is an ethylene glycol phosphodiester bond structure, and * is phosphorothioate modification.

TABLE-US-00010 SEQ ID NO: 14 5′-mC*mU*GTCTCTTATACACATCTGACGCTGCCGACGANNNNNNNNGT GTAGATCTCGGTGGTCGCCGTATCA*mU*mU-3′

[0176] The LC modification positions (starting from the 5-end) are 5, 7, 13, 15, 18, 22, 24, 28, 31, 50, 52, 59, 61, and 67. The LT modification positions (starting from the 5-end) are 45 and 55.

[0177] N is an ethylene glycol phosphodiester bond structure, and * is phosphorothioate modification.

[0178] Referring to the method in Example 1, a blocking oligonucleotide combination 5 was obtained by solid-phase synthesis and purification. The two blocking oligonucleotides therein were mixed in equal volumes and centrifuged to mix well to form a universal blocking oligonucleotide mixture 5. The purities of the two synthetic oligonucleotides are shown in FIG. 18 and FIG. 20. The theoretical molecular weight (MW) of SEQ ID NO: 13 is 21024. As shown in FIG. 19, the MW of actually prepared SEQ ID NO: 13 is 21021.9. The theoretical MW of SEQ ID NO: 14 is 19650. As shown in FIG. 21, the MW of actually prepared SEQ ID NO: 14 is 19653.0.

Example 6 Synthesis of Oligonucleotide Sequence Containing Blocker

[0179]

TABLE-US-00011 SEQ ID NO: 15 5′-CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNATCTCG TATGCCGTCTTCTGCTTG-3′

[0180] The LC modification positions (starting from the 5-end) are 5, 7, 13, 15, 18, 21, 25, 27, 29, 34, 44, 46, 53, 56, 59, and 62.

[0181] N is a propylene glycol phosphodiester bond structure.

TABLE-US-00012 SEQ ID NO: 16 5′-CTGTCTCTTATACACATCTGACGCTGCCGACGANNNNNNNGTGTAGA TCTCGGTGGTCGCCGTATCATT-3′

[0182] The LC modification positions (starting from the 5-end) are 5, 7, 13, 15, 18, 22, 24, 28, 31, 49, 51, 58, 60, and 66. The LT modification positions (starting from the 5-end) are 44 and 54.

[0183] N is a propylene glycol phosphodiester bond structure.

[0184] Referring to the method in Example 1, a blocking oligonucleotide combination 6 was obtained by solid-phase synthesis and purification. The two blocking oligonucleotides therein were mixed in equal volumes and centrifuged to mix well to form a universal blocking oligonucleotide mixture 6. The purities of the two synthetic oligonucleotides are shown in FIG. 22 and FIG. 24. The theoretical molecular weight (MW) of SEQ ID NO: 15 is 20870. As shown in FIG. 23, the MW of actually prepared SEQ ID NO: 15 is 20871.4. The theoretical MW of SEQ ID NO: 16 is 19504. As shown in FIG. 25, the MW of actually prepared SEQ ID NO: 16 is 19502.0.

Example 7 Use of Combination of Oligonucleotide Sequence Containing Blocker in Target Sequence Hybridization Capture

[0185] 1. Hybridization reaction

[0186] 1.1. Preparation of the following blocking mixture:

TABLE-US-00013 Blocking mixture Volume (μL) Human Cot DNA (1 μg/μL) 5 Universal blocking oligonucleotide mixture 2

[0187] The corresponding “universal blocking oligonucleotide mixture” was not added to the blocking mixture in a negative control group.

[0188] 1.2. 7 μL of the blocking mixture was transferred into a PCR tube to capture a library, where each 7 μL of the blocking mixture corresponds to a 500 ng library.

[0189] 1.3. The mixture in the PCR tube was concentrated in a vacuum to no liquid.

[0190] 1.4. The hybridization elution kit produced by IDT (Integrated DNA Technologies, Inc.) was taken out in advance and equilibrated at room temperature.

[0191] 1.5. Preparation of hybridization mixture:

TABLE-US-00014 Hybridization mixture Volume (μL) 2× hybridization buffer 8.5 Hybridization enhancer 2.7 Probe (3 pmol) x Nuclease-free water 5.8 − x Total volume 17

[0192] 1.6. After shaking, mixing, and centrifugation, 17 μL of the hybridization mixture was taken into the concentrated PCR tube.

[0193] 1.7. After a short centrifugation and mixing, incubation was carried out at room temperature for at least 5 min.

[0194] 1.8. The incubated PCR tube was placed on a PCR machine to run with the following hybridization procedures:

TABLE-US-00015 Temperature Time 95° C. 30 s Thermal 65° C. 16-18 h cover: 100° C.

[0195] 2. Capture

[0196] 2.1. 2×magnetic bead wash buffer, 10×wash buffer 1, 10×wash buffer 2, 10×wash buffer 3, 10×wash enhancement buffer, 2×hybridization buffer, and hybridization enhancer buffer were mixed well at room temperature and diluted to 1×working liquid for use (amount of each sample):

TABLE-US-00016 Nuclease-free Buffer Total volume Composition water (μL) (μL) (μL)  2× magnetic bead wash buffer 150 150 300 10× wash buffer 1 225 25 250 10× wash buffer 2 135 15 150 10× wash buffer 3 135 15 150 10× wash enhancement buffer 270 30 300

[0197] 2.2. Preparation of magnetic bead resuspension mixture:

TABLE-US-00017 Magnetic bead resuspension mixture Volume (μL) 2× hybridization buffer 8.5 Hybridization enhancement 2.7 buffer Nuclease-free water 5.8 Total volume 17

[0198] 2.3. Magnetic beads were taken out, and shaking and mixing were carried out for 15s.

[0199] 2.4. 50 μL of magnetic beads were taken into a 1.5 mL centrifuge tube, where each 50 μL of magnetic beads corresponds to a 500 ng library.

[0200] 2.5. 100 μL of 1×magnetic bead wash buffer was added into the centrifuge tube to draw up and dispense 10 times for mixing.

[0201] 2.6. The centrifuge tube was placed on a magnetic stand to stand for 1 min until the solution was clear, and then the supernatant was removed.

[0202] 2.7. 100 μL of magnetic bead wash buffer was added into the centrifuge tube to draw up and dispense 10 times for mixing, the centrifuge tube was then placed on the magnetic stand to stand for 1 min until the solution was clear, and then the supernatant was removed.

[0203] 2.8. The foregoing step was repeated for a total of 2 times of washing.

[0204] 2.9. 17 μL of magnetic bead resuspension mixture was added into the centrifuge tube to draw up and dispense for mixing and centrifuged at 400 rpm for 10s, to ensure that there are no dried magnetic beads left on the tube wall.

[0205] 2.10. After the hybridization reaction, 17 μL of the magnetic beads were transferred into the PCR tube to draw up and dispense for mixing, and in addition, the procedure of the PCR machine was set to 65° C. for constant (the thermal cover 70° C.).

[0206] 2.11. The mixture was placed in the PCR machine to undergo the washing procedure at 65° C. for 45 min (need timing) and shaken quickly and slightly for mixing well every 10 min, and the wash buffer 1 and wash enhancement buffer were put into a water bath at 65° C. for at least 15 min.

[0207] 2.12. After the 45 min timing was over, the sample was taken out from the PCR machine.

[0208] 2.13. 100 μL of pre-heated wash buffer 1 was taken into the PCR tube to draw up and dispense 10 times for mixing to avoid bubbles. After the wash buffer 1 was used, the PCR tube was equilibrated at room temperature.

[0209] 2.14. The sample was placed on the magnetic stand to stand for 1 min, and then the supernatant was removed.

[0210] 2.15. 150 μL of pre-heated wash enhancement buffer was taken into the PCR tube to draw up and dispense 10 times for mixing to avoid bubbles.

[0211] 2.16. The PCR tube was placed on the PCR machine to react for 5 min.

[0212] 2.17. The sample was placed on the magnetic stand to stand for 1 min, and then the supernatant was removed.

[0213] 2.18. 150 μL of pre-heated wash enhancement buffer was added to draw up and dispense

[0214] 10 times for mixing and then react on the PCR machine for 5 min.

[0215] 2.19. The sample was placed on the magnetic stand to stand for 1 min, and then the supernatant was removed.

[0216] 3. Washing

[0217] 3.1. 150 μL of wash buffer 1 at room temperature was added into a reaction tube to shake and mix thoroughly.

[0218] 3.2. The incubation was carried out at room temperature for 2 min with shaking and mixing every 30s.

[0219] 3.3. The sample after short centrifugation was placed on a magnetic stand to stand for 1 min until the solution was clear, and then the supernatant was removed.

[0220] 3.4. 150 μL of wash buffer 2 at room temperature was added to shake and mix thoroughly.

[0221] 3.5. The incubation was carried out at room temperature for 2 min with shaking and mixing every 30s.

[0222] 3.6. The sample after short centrifugation was placed on a magnetic stand to stand for 1 min until the solution was clear, and then the supernatant was removed.

[0223] 3.7. 150 μL of wash buffer 3 at room temperature was added to shake and mix thoroughly.

[0224] 3.8. The incubation was carried out at room temperature for 2 min with shaking and mixing every 30s.

[0225] 3.9. The sample after short centrifugation was placed on a magnetic stand to stand for 1 min until the solution was clear, and then the supernatant was removed.

[0226] 3.10. The magnetic beads were dried (until there was no obvious residue of the wash buffer 3).

[0227] 4. PCR after capture

[0228] 4.1. Preparation of the following PCR mixture:

TABLE-US-00018 PCR composition Volume (μL) 5× PCR buffer 10 10 mM dNTP 1 Primer F (10 μM) 1 Primer R (10 μM) 1 DNA polymerase 0.5 Nuclease-free water 36.5 Total volume 50

[0229] 4.2. The PCR mixture was added into a PCR tube with dried magnetic beads to draw up and dispense for mixing.

[0230] 4.3. Run with the following PCR procedures:

TABLE-US-00019 Number of Temperature Time cycles 98° C.  3 min 1 98° C. 20 s 13 62° C. 30 s 72° C. 30 s 72° C.  3 min 1  4° C. hold 1

[0231] 5. Magnetic bead purification

[0232] 5.1. 1×(50 μL) Yeasen Beads were directly added into 50 μL of PCR reaction tube for magnetic bead purification, and finally the product was eluted with 21 μL of nuclease-free water.

[0233] One human genome NA12878 was used as a sample to prepare a library using the ABclonal Rapid DNA Lib Prep Kit, and then 500 ng of the library was used as a starting amount, the universal blocking oligonucleotide mixture obtained in Examples 1 to 6 was applied to obtain a hybridized capture library, respectively, with reference to the foregoing procedures of the hybridization reaction example. No blocking oligonucleotide was added in the negative control group during the hybridization capture. On-machine sequencing was performed by using the Nextseq next-generation sequencer, and the percentage of bases in the target region to total bases in the sequencing result was analyzed, to obtain the hybridization capture efficiency with the sample size of 1 as shown in Table 1. The result shows that, compared with the negative control group, the addition of the universal blocking oligonucleotide of the present application significantly improves the capture efficiency of the target sequence with the improvement rate of 144.8%-180.5%.

TABLE-US-00020 TABLE 1 Capture efficiency of target sequence with sample size of 1 Group Capture efficiency Example 1 58.64% Example 2 65.69% Example 3 65.81% Example 4 67.16% Example 5 66.71% Example 6 67.18% Negative control 23.95%

[0234] 8 human genomes NA12878 were used as samples. The ABclonal Rapid DNA Lib Prep Kit was used to separately prepare libraries. The 8 libraries were mixed at 62.5 ng each to ensure that the total amount of the library was 500 ng. The universal blocking oligonucleotide mixture obtained in Examples 2 and 3 was used to obtain a hybridized capture library with reference to the foregoing procedures of the hybridization reaction example. No blocking oligonucleotide was added in the negative control group during the hybridization capture. On-machine sequencing was performed by using the Nextseq next-generation sequencer, and the percentage of bases in the target region to total bases in the sequencing result was analyzed, to obtain the hybridization capture efficiency with the sample size of 8 as shown in Table 2. The result shows that, compared with the negative control group, the addition of the universal blocking oligonucleotide of the present application significantly improves the capture efficiency of the target sequence with the improvement rate of 160.5%-160.9%. In addition, comparing Table 1 and Table 2, it is found that the capture efficiency of the universal primer of the present application in multi-sample target sequence capture is not significantly different from the capture efficiency of the universal primer of the present application in single-sample target sequence capture. It can be learned from this that the universal blocking oligonucleotide provided by the present application has a significant specific capture effect in multi-sample target sequence collective capture, which can greatly reduce the operation time and cost of the target sequence library construction.

TABLE-US-00021 TABLE 2 Capture efficiency of target sequence with sample size of 8 Group Capture efficiency Example 2 68.03% Example 3 68.15% Negative control 26.12%