Method of production of 2,4-dihydroxybutyric acid

09890400 · 2018-02-13

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for the preparation of 2,4-dihydroxybutyric acid (2,4-DHB) including the successive steps of converting malate, succinyl-CoA and/or glyoxylate into malyl-CoA, converting malyl-CoA previously obtained into malate-4-semialdehyde, and converting malate-4-semialdehyde into 2,4-DHB using a DHB dehydrogenase.

Claims

1. A method for the preparation of 2,4-dihydroxybutyric acid (2,4-DHB), comprising the successive steps of: a) a first step of converting malate, succinyl-CoA, and/or glyoxylate into malyl-CoA by contacting the malate, the succinyl-CoA, and/or the glyoxylate with a malyl-CoA synthetase, succinyl-CoA: (L)-malate-CoA transferase, and/or malyl-CoA lyase, b) a second step of converting malyl-CoA previously obtained into malate-4-semialdehyde by contacting the malyl-CoA with a malyl-CoA reductase, and c) a third step of converting malate-4-semialdehyde into 2,4-DHB by contacting the malate-4-semialdehyde with a DHB dehydrogenase.

2. The method of claim 1, wherein the malyl-CoA lyase has the amino acid sequence set forth in SEQ ID NO: 1 or any variant or fragment thereof having malyl-CoA lyase activity and the succinyl-CoA: (L)-malate-CoA transferase has the amino acid sequence set forth in at least one of SEQ ID NO: 191 and SEQ ID NO: 193 or any variant or fragment thereof having succinyl-CoA: (L)-malate-CoA transferase activity.

3. The method of claim 1, wherein the malyl-CoA lyase is encoded by the nucleic acid sequence set forth in SEQ ID NO: 2 or any variant or fragment thereof which results in a functionally active malyl-CoA lyase, and the succinyl-CoA: (L)-malate-CoA transferase is encoded by at least one of the nucleic acid sequences set forth in SEQ ID NO: 194 and SEQ ID NO: 192 or any variant or fragment thereof, which results in a functionally active succinyl-CoA: (L)-malate-CoA transferase.

4. The method according to claim 1, wherein the malyl-CoA reductase is selected from the group consisting of: a malonyl-CoA reductase, a succinyl-CoA reductase,3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase, cinnamoyl-CoA reductase, acetaldehyde dehydrogenase, and any variant thereof having malonyl-CoA reductase activity, succinyl-CoA reductase activity, HMG-CoA reductase activity, cinnamoyl-CoA reductase activity, or acetaldehyde dehydrogenase activity.

5. The method of claim 1, wherein the malyl-CoA reductase has the amino acid sequence set forth in SEQ ID NO: 7, SEQ ID NO: 10, or SEQ ID NO: 189, or any variant or fragment thereof having malyl-CoA reductase activity.

6. The method of claim 5, wherein the malyl-CoA reductase is encoded by any one of the nucleic acid sequences set forth in SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 190, or any variant or fragment thereof, which results in a functionally active malyl-CoA reductase.

7. The method of claim 1, wherein: the malyl-CoA reductase comprises the amino acid sequence of SEQ ID NO: 7 with at least one mutation in at least one of the positions P111, L152, T154, L202, G203, D204, Y206, D207, K209, T210, T238, T239, D295, and R318, the amino acid in said positions is replaced by any one of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine, and the mutated malyl-CoA reductase has malyl-CoA reductase activity.

8. The method of claim 7, wherein the malyl-CoA reductase comprises the amino acid sequence set forth in SEQ ID NO: 202 or is encoded by the nucleic acid sequence set forth in SEQ ID NO: 201.

9. The method of claim 1, wherein the DHB dehydrogenase is a methylbutyraldehyde reductase, a succinic semialdehyde reductase, a 4-hydroxybutyrate dehydrogenase, or an alcohol dehydrogenase.

10. The method of claim 9, wherein the DHB dehydrogenase comprises the amino acid sequence of SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 187, or SEQ ID NO: 185, or any variant thereof having DHB dehydrogenase activity.

11. The method of claim 10, wherein the DHB dehydrogenase is encoded by any one of the nucleic acid sequences set forth in SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 188, SEQ ID NO: 186, or any variant or fragment thereof, which results in a functionally active DHB dehydrogenase.

12. The method according to claim 1, wherein, steps a), b) and c) are performed by a modified microorganism heterologously expressing at least one of malyl-CoA synthetase, succinyl-CoA: (L)-malate-CoA transferase, malyl-CoA lyase, malyl-CoA reductase, and DHB dehydrogenase.

13. The method according to claim 1, wherein steps a), b) and c) are performed within the same microorganism.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1: (i) Reaction scheme that describes the conversion of (L)-malate, succinyl-CoA, or glyoxylate into (L)-2,4-dihydroxybutyrate (2,4-DHB).

(2) FIG. 2: Figure shows (top graph) activity on malate semialdehyde, (middle graph) activity on succinic semialdehyde, (lower graph) changes of enzyme specificity compared to the wild-type enzyme expressed as the logarithm of the ratio of mutant activity on malate semialdehyde and succinic semialdehyde over the ratio of wild type activity on malate semialdehyde and succinic semialdehyde. (positive values indicate changes of specificity in favour of malate semialdehyde).

(3) FIG. 3: Chromatograms showing the presence of 2,4-DHB after incubation of 2 mM acetyl-CoA, 2 mM glyoxylate, and 2 mM NADPH, with different combinations of DHB pathway enzymes (Reaction 1: malyl-CoA lyase (150 g/mL Me-Mcl), malyl-CoA reductase (100 g/mL St-Mcr), and malate semialdehyde reductase (100 g/mL Ms-SSAred H39R N43H); Reaction 2:same as reaction 1 but using 100 g/mL Pg-SucD as malyl-CoA reductase; Control 1: same as reaction 1 but without malyl-CoA reductase; Control 2: same as reaction 1 but without malate semialdehyde reductase.)

EXAMPLES

Example 1: Demonstration of Malyl-CoA Lyase Activity

(4) Construction of plasmids containing wild-type genes coding for malyl-CoA lyase: The DNA sequences of the mcl genes coding for malyl-CoA lyase in M. extorquens (Arps et al., 1993) and Rhodobacter capsulatus (Meister et al., 2005) were optimized for the expression in Escherichia coli using the GENEius software (Eurofins). The optimized sequences were synthesized by Eurofins MWG OPERON adding NheI and EcoRI restriction sites upstream of the start codon and downstream of the stop codon of mcl, respectively, which allowed direct cloning of the synthesized DNA fragments into the pET28a+ vector (Novagen) using T4 DNA ligase (Biolabs). Ligation products were transformed into E. coli DH5 cells, amplified, and the plasmids pET28-Mex-mcl (expressing the malyl-CoA lyase from M. extorquens) and pET28-Rca-mcl (expressing the malyl-CoA lyase from R. capsulatus) were isolated using standard genetic protocols (Sambrook et al., 1989). NCBI and Integrated Genomics references of the utilized mcl protein sequences, and the references for the corresponding natural and synthetic DNA sequences are listed in Table 1.

(5) TABLE-US-00001 TABLE 1 References to proteins from different organisms having annotated malyl-CoA lyase activity, and references to natural and optimized DNA sequences. NCBI/Integrated Natural Optimized Genomics accession DNA DNA Organism Protein number sequence sequence M. extorquens Mcl YP 002962854 SEQ ID SEQ ID SEQ ID No. 2 No. 3 No. 1

(6) Expression of Enzymes:

(7) E. coli BL21 (DE3) cells were transformed with the appropriate plasmids using standard genetic protocols (Sambrook et al., 1989). Enzymes with an N-terminal hexa-His tag were expressed in 250 mL LB cultures that were inoculated from an overnight culture at OD.sub.600 of 0.1 and grown to OD.sub.600 of 0.6 before protein expression was induced by addition of 1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) to the culture medium. After 3 h of protein expression, cells were harvested by centrifugation at 13000 g for 10 min and the supernatant is discarded. Cell pellets were stored at 20 C. until further analysis. Growth and protein expression were carried out at 37 C. Culture media contained 50 g/mL kanamycin.

(8) Purification of Enzymes:

(9) Frozen cell pellets of expression cultures were resuspended in 0.5 mL of breakage buffer (50 mM Hepes, 300 mM NaCl, pH 7.5) and broken open by four successive rounds of sonication (sonication interval: 20 sec, power output: 30%, sonicator: Bioblock Scientific, VibraCell 72437). Cell debris were removed by centrifuging the crude extracts for 15 min at 4 C. at 13000 g and retaining the clear supernatant. RNA and DNA were removed from the extracts by adding 15 mg/mL streptomycin (Sigma), centrifuging the samples at 13000 g for 10 min at 4 C. and retaining the supernatant. Clear protein extract was incubated for 20 min at room temperature (1 h at 4 C.) with 0.3 (0.75 mL) (bed volume) of Talon Cobalt affinity resin (Clontech). The suspension was centrifuged at 700 g in a table top centrifuge and supernatant was removed. The resin was washed with 10 bed volumes of wash buffer (50 mM Hepes, 300 mM NaCl, 15 mM Imidazole, pH 7.5) before proteins were eluted with 0.5 mL of elution buffer (50 mM Hepes, 300 mM NaCl, 200 mM Imidazole, pH 7.5). Purity of eluted enzymes was verified by SDS-PAGE analysis. Protein concentrations were estimated with the method of Bradford.

(10) Enzymatic Assays:

(11) Malyl-CoA lyase activity was assayed using a method adapted from (Meister et al., 2005). Malyl-CoA synthesis by malyl-CoA lyase was coupled to the citrate synthase-catalyzed release of coenzyme A which was monitored by its spontaneous reaction with DTNB.

(12) Reaction Scheme
acetyl-CoA+glyoxylate.fwdarw.(L)-malyl-CoAMalyl-CoA lyase:
(L)-malyl-CoA.fwdarw.(L)-malate+Coenzyme ACitrate synthase:
coenzyme A+DTNB.fwdarw.CoA-DTNB disulfideSpontaneous:

(13) The reaction mixture according to Assay 1 contained 50 mM MOPS/KOH (pH 7.5), 0.25 mM DTNB, 5 mM MgCl.sub.2, 1 mM acetyl-CoA, 20 U/mL citrate synthetase (all products from Sigma), and appropriate amounts of purified malyl-CoA lyase or cell extract. Reactions were started by adding 10 mM glyoxylate. Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of DNTB at 412 nm (.sub.DNTB+CoA=13.6 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR).

(14) Purified malyl-CoA lyase from M. extorquens characterized had a Vmax of 36 mol/(min mg prot), and a Km on glyoxylate of 0.5 mM.

Example 2: Demonstration of Malyl-CoA Reductase Activity

(15) Construction of plasmids containing wild-type genes coding for malonyl-CoA reductase and succinyl-CoA reductase: The DNA sequence of the mcr gene coding for malyl-CoA reductase in Sulfolobus tokodaii str 7 (Alber et al., 2006) was optimized for the expression in Escherichia coli using the GENEius software (Eurofins). The optimized mcr sequence, and the natural DNA sequence of the sucD gene coding for succinyl-CoA reductase in Porphyromonas gingivalis W83 were synthesized by Eurofins MWG OPERON adding NheI and EcoRI restriction sites upstream of the start codon and downstream of the stop codon of mcr, respectively, which allowed direct cloning of the synthesized DNA fragments into the pET28a+ vector (Novagen) using T4 DNA ligase (Biolabs). Ligation products were transformed into E. coli DH5 cells, amplified, and the plasmids, pET28-St-mcr (expressing the malonyl-CoA reductase from S. tokodaii), and pET28-Pgi-sucD (expressing the succinyl-CoA reductase from P. gingivalis), were isolated using standard genetic protocols (Sambrook et al., 1989). NCBI references of the utilized mcr and sucD protein sequences, and the references for the corresponding natural and synthetic DNA sequences are listed in Table 2.

(16) TABLE-US-00002 TABLE 2 References to proteins from different organisms having annotated malyl-CoA reductase or succinyl-CoA reductase activity, and references to natural and optimized DNA sequences. NCBI/Integrated Natural Optimized Genomics DNA DNA Organism Protein accession number sequence sequence S. tokodaii St-Mcr NP 378167 SEQ ID SEQ ID SEQ ID No. 7 No. 8 No. 9 P. gingivalis Pg-SucD AAQ65862 SEQ ID SEQ ID No. 10 No. 11

(17) Expression and purification of Pg-SucD was carried out as described in Example 1 using plasmid pET28-Pgi-sucD.

(18) The St-mcr gene was amplified from plasmid pET28-St-mcr using primers 5-TATAATGAGCTCGTTTAACTTTAAGAAGGAGATATACCATGATTCTGATGC GCCGT-3(SEQ ID No. 12) and 5-TATAATGGATCCCTCGAATTCTTACTTCTC-3 (SEQ ID No. 13) which added a SacI and a BamHI restriction site upstream of the start codon and downstream of the stop codon, respectively. The PCR fragment was ligated into the pACT3 expression vector using the SacI and BamHI restriction sites. The resulting plasmid pACT3-St-Mcr was transformed into strain E. coli MG1655. The resulting expression strain was cultivated on mineral medium at 37 C. One liter mineral medium contained 20 g glucose, 18 g Na.sub.2HPO.sub.4*12 H.sub.2O, 3 g KH.sub.2PO.sub.4, 0.5 g NaCl, 2 g NH.sub.4Cl, 0.5 g MgSO.sub.4*7 H.sub.2O, 0.015 CaCl.sub.2*2 H.sub.2O, 1 mL of 0.06 mol/L FeCl.sub.3 stock solution prepared in 100 times diluted concentrated HCl, 2 mL of 10 mM thiamine HCl stock solution, 20 g MOPS, 50 g kanamycin sulphate (and 25 g chloramphenicol when necessary), and 1 mL of trace element solution (containing per liter: 0.04 g Na.sub.2EDTA*2H.sub.2O, 0.18 g CoCl.sub.2*6 H.sub.2O, ZnSO4*7 H.sub.2O, 0.04 g Na.sub.2MoO4*2 H.sub.2O, 0.01 g H.sub.3BO.sub.3, 0.12 g MnSO.sub.4*H.sub.2O, 0.12 g CuCl.sub.2*H2O.). Medium pH was adjusted to 7 and medium was filter-sterilized.

(19) When the exponentially growing culture reached an OD (600 nm) of 0.6, 1 mM IPTG was added and cultures were incubated at 20 C. during 14 h before harvesting the cells by centrifugation (13000g, 10 min). After discarding the supernatant cell pellets were stored at 20 C.

(20) To purify St-Mcr, frozen cell pellets of expression cultures were resuspended in 0.5 mL of breakage buffer (50 mM Hepes, 300 mM NaCl, pH 7.5) and broken open by four successive rounds of sonication (sonication interval: 20 sec, power output: 30%, sonicator: Bioblock Scientific, VibraCell 72437). Cell debris were removed by centrifuging the crude extracts for 15 min at 4 C. at 13000g and retaining the clear supernatant. Native proteins of E. coli were removed by heat precipitation at 85 C. during 30 min followed by centrifugation at 13000g. Purity of the protein preparations was analysed by SDS-page analysis which showed only one band corresponding to the expected size of the St-Mcr protein.

(21) Enzymatic Assays:

(22) Malyl-CoA reductase activity was assayed in the reductive and in the oxidative sense of the reaction employing Assay 1 or Assay 2, respectively.

(23) Assay 1 (Reaction Scheme):
glyoxylate+acetyl-CoA.fwdarw.malyl-CoA+acetateMalyl-CoA lyase:
(L)-Malyl-CoA+NADPH.fwdarw.(L)-Malate semialdehyde+Coenzyme A+NADPMalyl-CoA reductase:
Assay 2 (Reaction Scheme):
(L)-Malate semialdehyde+Coenzyme A+NADP.fwdarw.(L)-Malyl-CoA+NADPH
The reaction mixture according to Assay 1 contained 50 mM MOPS/KOH (pH 7.5), 10 mM glyoxylate, 4 mM acetyl-CoA, 5 mM MgCl.sub.2, 0.25 mM NADPH (all products from Sigma), 5 U/mL of malyl-CoA lyase, and appropriate amounts of purified malyl-CoA reductase or cell extract. Reactions were started by adding glyoxylate. Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NADPH at 340 nm (.sub.NADPH=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR).

(24) The reaction mixture according to assay 2 contained 200 mM HEPES (pH 9), 5 mM MgCl.sub.2, 1 mM NADP, 0.5 mM coenzyme A (all products from Sigma), and appropriate amounts of purified malyl-CoA reductase. Reactions were started by adding 5 mM (L)-malate semialdehyde. Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NADPH at 340 nm (.sub.NADPH=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR). Unstable malate semialdehyde was produced freshly prior to the enzymatic tests by the deprotection of the stable malate semialdehyde derivative 2-[(4S)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl]acetaldehyde (DMODA) (provided by Activation). Malate semialdehyde was obtained by dissolving appropriate amounts of DMODA in 2 M hydrochloric acid, short heating of the suspension to boiling temperature, and leaving the hot suspension for 15 min at room temperature. The released acetone was evaporated at 35 C. and 50 mbar in a rotary evaporator. The pH of the malate semialdehyde solution was fixed at 3.5 using sodium bicarbonate.

(25) Results listed in Tables 3 and 4 demonstrate malyl-CoA reductase activity for malonyl-CoA reductase, Mcr, of S. tokodaii and succinyl-CoA reductase, SucD, of P. gingivalis.

(26) TABLE-US-00003 TABLE 3 Kinetic parameters for the reductive sense of reaction (malonyl-CoA reductase and succinyl-CoA reductase activities were estimated by directly adding the substrates malonyl-CoA or succinyl-CoA to the reaction mixture). Substrate Malonyl-CoA Succinyl-CoA Malyl-CoA Vmax Km Vmax Km Vmax Km Enzyme [mol/(min mg)] [mM] [mol/(min mg)] [mM] [mol/(min mg)] [mM] St-Mcr 0.67 0.15 nd 0.98 0.17 0.2 0.24 0.045 nd Pg-SucD nd nd 1 1 0.025 nd

(27) TABLE-US-00004 TABLE 4 Kinetic parameters for the oxidative sense of reaction Substrate Succinic semialdehyde Malate semialdehyde Vmax Km Vmax Km Enzyme [mol/(min mg)] [mM] [mol/(min mg)] [mM] St-Mcr 1.7 1.15 0.1 0.25 Pg-SucD 4 nd 0.007 nd

Example 3: Demonstration of DHB Dehydrogenase Activity

(28) To identify a suitable 2,4 DHB dehydrogenase, beta-hydroxyacid dehydrogenases from different biological sources were tested for their ability to reduce malate semialdehyde. Among the tested enzymes were the methylbutyraldehyde reductase from Saccharomyces cerevisiae, Ypr1 (Ford & Ellis, 2002) (SEQ ID No.14), the 4-hydroxybutyrate dehydrogenase, 4hbdh, of P. gingivalis (SEQ ID No.187), the alcohol dehydrogenase, YqhD, of E; coli (SEQ ID no. 185), and the succinic semialdehyde reductase, Ms-Ssr, from Metallosphaera sedula (Kockelkorn & Fuchs, 2009) (SEQ ID No. 16). The genes YPR1, 4hbdh, yqhD, and Ms-SSR were amplified using primers listed in Table 5 and cloned into vector pET28 (restriction enzymes see Table 5) yielding plasmids pET28-Sce-YPR1, pET28-Pgi-4-hbdh, pET28-Eco-yqhd and pET28-Mse-SSR, respectively. The proteins were expressed and purified as described in Example 1.

(29) TABLE-US-00005 TABLE5 Primersandrestrictionenzymes usedtoclone candidatebeta-hydroxyacid dehydrogenases Re- Acces- stric- sion tion Enzyme No Primer5-3 enzymes YPR1 GI: TATAATGCTAGCATGCCTGC NheI 6320576 TACGTTAAAGAA (SEQIDNo.18) TATAATGAGCTCTCATTGGA SacI AAATTGGGAAGG (SEQIDNo.18) YqhD GI: TATAATGAATTCTTAGCGGG EcoRI 16130909 CGG CTTCGTATATACGGCGGCTG ACA (SEQIDNo.20) NheI TATCGTGCTAGCATGAACAA CTTTAATCTGCACA (SEQIDNo.21) 4hbdh GI: TATAATGGATCCTTAGTAGA BamHI 188994588 GTCTTCTGTAG (SEQIDNo.22) TATAATCATATGCAACTTTT NdeI CAAACTC (SEQIDNo.23) Ms-SSR GI: TATAATGCTAGCATGAAAGC NheI 146304190 TGCAGTACTTCA (SEQIDNo.24) TATAATGAATTCTTACGGGA EcoRI TTATGAGACTTC (SEQIDNo.25)
Test for Malate Semialdehyde Reductase Activity:
(L)-Malate semialdehyde+NAD(P)H.fwdarw.(L)-2,4-dihydroxybutyric acid+NAD(P)Reaction scheme:

(30) The assay mixture contained 200 mM Hepes (pH 7.5), 50 mM KCl, 5 mM MgCl.sub.2, 0.24 mM NADH or NADPH, and appropriate amounts of purified enzyme or cell extract. Reactions were started by adding 10 mM (L)-malate semialdehyde (malate semialdehyde was prepared freshly for each test, see Example 3). Enzymatic assays were carried out at 30 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NAD(P)H at 340 nm (.sub.NADPH=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR). Results are listed in Table 6.

(31) TABLE-US-00006 TABLE 6 Reducing activity of selected beta-hydroxyacid dehydrogenases on malate semialdehyde (Results represent the average of at least two independent experiments). Activity Activity on malate on malate semialdehyde semialdehyde (cofactor (cofactor NADH) NADPH) Reported [mol/(min * [mol/(min * Enzyme Origin function mg_prot)] mg_prot)] Ms-SSR M. Succinic 4.9 4.9 (SEQ sedula semialdehyde ID reductase No. 16) YqhD E. coli Alcohol nd 1.2 (SEQ dehydrogenase ID No 185) 4hbdh P. 4-hydroxy- 33 nd (SEQ gingivalis butyrate ID No dehydrogenase 187) YPR1 S. Methyl- nd 0.19 (SEQ cerevisiae butyraldehyde ID No. reductase 14)
The succinic semialdehyde dehydrogenase from M. sedula and the methylbutyraldehyde reductase from S. cerevisiae have malate semialdehyde reductase activity. The Km of Ms-SSR for malate semialdehyde was 4 mM.

Example 4: Rational Construction of an Improved Malyl-CoA Reductase Enzyme

(32) Site-directed mutagenesis was carried out using the oligonucleotide pairs listed in Table 7 and the pET28-Sto-mcr plasmid as the template. Point mutations to change the amino acid sequences were introduced by PCR (Phusion 1U, HF buffer 20% (v/v), dNTPs 2.5 mM, direct and reverse primers 1 M each, template plasmid 200 ng, water). When possible, plasmids created by PCR contained new restriction sites (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 22 h to remove template DNA, and transformed into NEB DH5- competent E. coli cells (NEB). The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing.

(33) TABLE-US-00007 TABLE7 Primerpairsusedtomutatethemcr geneofS.tokodaii. Mutation Primer5-3 Tyr206 Forward CATTCTGCCTTTAGGGGACGGCNNKGACGCCAAAACG (SEQIDNo.26) Revers CGTTTTGGCGTCMNNGCCGTCCCCTAAAGGCAGAATG (SEQIDNo.27)

(34) The impact of the genetic modifications of St-Mcr was tested in the oxidative sense of the reaction using Assay 3 described in Example 2. FIG. 3 shows that replacing the natural Tyr206 by other amino acids decreases the activity on the natural substrate, succinic semialdehyde, causing at the same time an increased or at least constant activity on malate semialdehyde. Thus, replacing Tyr206 by appropriate amino acid residues provides a selective advantage regarding the specificity of Mcr for the DHB pathway intermediate.

(35) Preferred amino acid residues in position 206 are therefore phenylalanine, histidine, isoleucine, lysine, methionine, glycine, asparagine, proline, arginine, glutamine, leucine, serine, tryptophane, and threonine.

(36) The protein wherein the Tyrosine 206 is replaced by a Proline residue is represented by SEQ ID No. 202.

Example 5: Rational Construction of an Improved DHB Dehydrogenase

(37) Site-directed mutagenesis was carried out using the oligonucleotide pairs listed in Table 6 and the pET28-Mse-SSR plasmid as the template. Point mutations to change the amino acid sequences were introduced by PCR (Phusion 1U, HF buffer 20% (v/v), dNTPs 2.5 mM, direct and reverse primers 1 M each, template plasmid 200 ng, water). When possible, plasmids created by PCR contained new restriction sites (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 22 h to remove template DNA, and transformed into NEB DH5- competent E. coli cells (NEB). The mutated plasmids were identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing. Table 8 summarizes kinetic parameters of the mutants. The results demonstrate that the double mutant Ms-SSR H39R N43H (SEQ ID No.38) has improved affinity for malate semialdehyde when compared to the wild type enzyme.

(38) TABLE-US-00008 TABLE8 PrimerpairsusedtomutateM.sedulasuccinic semialdehydereductase(Ms-SSR) Muta- Restriction tion Primer5-3 enzymes H39R gtcaaggcaaccggtctctgtcg NheI ctccgacgtcaatg(SEQIDNo.28) cattgacgtcggagcgacagaga ccggttgccttgac(SEQIDNo.29) N43H ggctctgtcactccgacgtacat NheI gtctttgaggggaaaac(SEQIDNo.30) gttttcccctcaaagacatgtac gtcggagtgacagagcc(SEQIDNo.31)

(39) TABLE-US-00009 TABLE 9 Summary of kinetic parameters of M. sedula succinic semialdehyde reductase (Ms-SSR) mutants (Results represent the average of at least two independent experiments). Maximum activity Km Mutant [mol/(min * mg.sub.prot)] [mmol/L] Wild type (SEQ ID No. 4.9 4 16) H39R (SEQ ID No. 32) 1.7 1 N43H (SEQ ID No. 34) 4.3 5 H39R N43H (SEQ ID 4.7 1 No. 36)
The corresponding nucleic sequences are represented by SEQ ID No. 17, SEQ ID No. 33, SEQ ID No. 35 and SEQ ID No. 37.

(40) The coding sequence of M. sedula succinic semialdehyde reductase including the mutations H39R and N43H was optimized for maximum expression in E. coli, using the GeneOptimizer software. The synthetic gene was produced by GeneArt Gene Synthesis (Invitrogen Life Technologie). NheI and EcoRI restriction sites were introduced upstream of the start codon and downstream of the stop codon, respectively, allowing direct cloning into pET28a+(Novagen).

(41) The resulting pET28-Mse-DHB-Dh-H39R_N43H-opt plasmid was isolated and shown by DNA sequencing to contain the full-length M. sedula SSR H39R N43H gene having the correct sequence (SEQ ID No.38).

Example 6: Demonstration of In Vitro Production of DHB by the Synthetic Malyl-CoA Pathway

(42) The enzymes malyl-CoA lyase (Me-Mcl), malyl-CoA reductase (St-Mcr or Pg-SucD), and DHB dehydrogenase (Ms-SSA-red H.sub.39N N43H) were expressed and purified as described in Examples 1, 2, and 3.

(43) Production of DHB by the pathway comprising malyl-CoA lyase, malyl-CoA reductase, and DHB dehydrogenase was demonstrated in vitro by adding 2 mM glyoxylate to a reaction mixture that contained 50 mM Hepes (pH 7.5), 2 mM acetyl-CoA, 2 mM NADPH, 100 g/mL DHB dehydrogenase, 150 g/mL malyl-CoA lyase, and 100 g/mL malyl-CoA reductase (which was either St-Mcr (reaction 1), or Pg-SucD (reaction 2)).

(44) Control reactions contained all components but were lacking either DHB dehydrogenase (Control 1) or malyl-CoA reductase (Control 2). After 120 min of incubation at 37 C. the DHB content in the reaction mixture was analysed by gas chromatography [GCMS-QP2010 Ultra Shimadzu; equipped with a FID detector (FID-2010 Plus Shimadzu); autosampler AOC20s (Shimadzu); splitless injector AOC20i (Shimadzu) (230 C.); column: Zebron ZB-FFAP, 30 m0.25 mm, d.sub.f 0.25 m; and liner: Tapered focus Liner5953.4 mm (SGE). Carrier gas was hydrogen at a total flow rate of 25 mL/min. Flame ionization was carried out using an air-hydrogen mixture (flow rates were 300 mL/min and 30 mL/min, respectively). Detector temperature was 240 C. Injected sample volume was 1 L. Temperature program is provided in Table 10.
Chromatograms showing presence of DHB in the reactions containing all pathway enzymes and absence of DHB in samples containing only two out of three pathway enzymes are shown in FIG. 2.

(45) TABLE-US-00010 TABLE 10 Temperature program for GC analysis of reaction mixtures Column temperature Hold Gradient Runtime [ C.] [min] [ C./min] [min] 90 0 0 0 115 1.8 30 2.63 170 1 4 17.38 230 3 50 21.58

Example 7: Construction of Optimized DHB Producer Strains

(46) Construction of a Plasmid for Simultaneous Expression of Malyl-CoA Synthetase, Malyl-CoA Reductase, and DHB-Dehydrogenase:

(47) The coding sequence of the malyl-CoA lyase from M. extorquens, Me-mcl, was amplified from plasmid pET28-Mex-mcl using the high fidelity polymerase Phusion (Fermentas) and the forward and reverse primers 5-TCACACAGGAAACAGAATTCGAGCTCGGTAATGTCGTTTACCCTGATTCAG CAAGCGACT-3 (SEQ ID No. 39) and 5-GGTATATCTCCTTCTTAAAGTTAAACTTATTTGCCGCCCATTGCATCCGCTT TCTG-3 (SEQ ID No. 40) which contained restriction sites for SacI upstream of the start codon (underlined). The coding sequence of the malonyl-CoA reductase from S. tokodaii, St-mcr, was amplified from plasmid pET28-Sto-mcr using the forward and reverse primers 5-GTTTAACTTTAAGAAGGAGATATACCATGATTCTGATGCGCCGTACCCTGA AAGCG-3 (SEQ ID No. 41) and 5-GGTATATCTCCTTCTTAAAGTTAAACTTACTTCTCGATGTAGCCTTTCTCCA CGAG-3 (SEQ ID No. 42) which contained restriction sites for BamHI downstream of the stop codon. The plasmid pET28-Mse-DHB-Dh-H39R_N43H-opt (Example 5) was used as the template to amplify the optimized coding sequence of the succinic semialdehyde reductase H39R N43H from M. sedula using the forward and reverse primers 5-GTTTAACTTTAAGAAGGAGATATACCATGAAAGCAGCAGTTCTGCATACCT ATAAAGAACCGCTGAGCAT-3 (SEQ ID No. 43) and 5-ATGCCTGCAGGTCGACTCTAGAGGATCCTTACGGAATAATCAGGCTACGA ATTGCTTC-3 (SEQ ID No. 44) that introduced a BamHI restriction site downstream of the stop codon (underlined).

(48) The forward primers for St-mcr and the succinic semialdehyde reductase H39R N43H from M. sedula contained a rbs motif. The three genes were simultaneously cloned into the pACT3 expression vector by homologous recombination using the In-Fusion cloning kit (Clontech).

(49) The resulting and pACT3-MCL-DHB (SEQ ID No. 45) plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(50) Construction of a Plasmid for Simultaneous Expression of Malyl-CoA Synthetase, Malyl-CoA Reductase, and DHB-Dehydrogenase:

(51) The DNA sequences coding for the two protein subunits of malyl-CoA synthetase, mtkA (YP_00296285) and mtkB (YP_002962852), from Methylobacterium extorquens AM1 were optimized for the expression in Escherichia coli using the GENEius software (Eurofins). The optimized DNA sequences of the subunit were physically linked by the DNA sequence naturally occurring between the mtkA and mtkB genes in M. Extorquens genome (CGAACGGGGGAGGAATCACGCC, SEQ ID No. 46). The resulting DNA fragment, mtkA gene-linker DNA-mtkB gene, was synthesized by Eurofins MWG OPERON and subcloned into pET28b expression vector using NheI and EcoRI restriction enzymes. The resulting DNA plasmid pET28-Mex-mtkAB (SEQ ID No. 47) was used to simultaneously amplify the two codons optimized genes encoding malyl-CoA synthetase from M. extorquens, Me-mtkA and Me-mtkB using the high fidelity polymerase Phusion (Fermentas) and the forward and reverse primers 5-CAGGAAACAGAATTCGAGCTCGGTAATGGATGTGCACGAATATCAGGCGA AAGAACTGCT-3 (SEQ ID No. 48) and 5-TACGGCGCATCAGAATCATtacgccgcacgtgctaacacatcggcaac-3 (SEQ ID No. 49) which contained restriction sites for SacI upstream of the start codon (underlined). The coding sequence of the malonyl-CoA reductase from S. tokodaii, St-mcr, was amplified from plasmid pET28-Sto-mcr using the forward and reverse primers 5-GGCGTAATGATTCTGATGCGCCGTACCCTGAAAGCG-3 (SEQ ID No. 50) and 5-CTGCTGCTTTCATTACTTCTCGATGTAGCCTTTCTCCACGAG-3 (SEQ ID No. 51) which contained restriction sites for BamHI downstream of the stop codon. The plasmid pET28-Mse-DHB-Dh-H39R_N43H-opt (Example 5) was used as the template to amplify the optimized coding sequence of the succinic semialdehyde reductase H39R N43H from M. sedula using the forward and reverse primers 5-TACATCGAGAAGTAATGAAAGCAGCAGTTCTGCATACCTATAAAGAAC-3 (SEQ ID No. 52) and 5-CCTGCAGGTCGACTCTAGAGGATCCTTACGGAATAATCAGGCTACGAATT GCTTCAC-3 (SEQ ID No. 53) that introduced a BamHI restriction site downstream of the stop codon (underlined).

(52) The three genes were simultaneously cloned into the pEXT20 expression vector by homologous recombination using the In-Fusion cloning kit (Clonetch).

(53) The resulting pEXT20-MCS-DHB (SEQ ID No.54) plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(54) Construction of Plasmids for Overexpression of Phosphoenolpyruvate (PEP) Carboxykinase, PEP Carboxylase, Pyruvate Kinase, Pyruvate Carboxylase, Isocitrate Lyase Enzymes and the Galactose Symporter Permease:

(55) The plasmid pACT3-pck harbouring the PEP carboxykinase encoding pck gene of E. coli was constructed by amplifying the pck coding sequence using genomic DNA from E. coli MG1655 as the template and the forward and reverse primers, respectively, .sup.5TATAATCCCGGGATGCGCGTTAACAATGGTTTGACC.sup.3 (SEQ ID No. 56 and .sup.5TATAATTCTAGATTACAGTTTCGGACCAGCCG.sup.3 (SEQ ID No. 57). The DNA fragment was digested with XmaI and XbaI, ligated into the corresponding sites of the pACT3 expression vector (Dykxhoorn et al., 1996) using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The transformants were selected on solid LB medium containing chloramphenicol (25 g/mL). The resulting plasmid was isolated and correct insertion of the pck gene was verified by sequencing. Plasmids pACT3-aceA, pACT3-ppc, pACT3-galP, pACT3-pck and pACT3-pyc harbouring, respectively, aceA, ppc, galP, or pykA (all E. coli) or pck from Lactococcus lactis were constructed analogously using the primers listed in Table 11.

(56) TABLE-US-00011 TABLE11 Primersusedforconstructionofplasmids forgeneoverexpression. Gene Primer Linker Sequence Ec_ Ec_pck_ XmaI tataatcccgggatgcgcgttaa pck clon_for caatggtttgacc (SEQIDNo.57) Ec_pck_ XbaI tataattctagattacagtttcg clon_rev gaccagccg (SEQIDNo.58) Ec_ Ec_ppc_ XmaI tataatcccgggatgaacgaaca ppc clon_for atattcc (SEQIDNo.59) Ec_ppc_ XbaI tataattctagattagccggtat clon_rev tacgcat (SEQIDNo.60) Ec_ Ec_pykA_ XmaI tataatcccgggatgtccagaag pykA clon_for gcttcgcagaaca (SEQIDNo.61) Ec_pykA_ XbaI tataattctagattactctaccg clon_rev ttaaaatac (SEQIDNo.62) Ec_ Ec_aceA_ XmaI tataatcccgggatgaaaacccg aceA clon_for tacacaacaaatt (SEQIDNo.63) Ec_aceA_ XbaI tataattctagattagaactgcg clon_rev attcttcag (SEQIDNo.64) Ll_ Ll_pycA_ XmaI tataatcccgggatgaaaaaact pycA clon_for actcgtcgccaat (SEQIDNo.65) Ll_pycA_ XbaI tataattctagattaattaattt clon_rev cgattaaca (SEQIDNo.66) Ec_ Ec_galP_ XmaI tataatcccgggatgcctgacgc galP clon_for taaaaaacaggggcggt (SEQIDNo.67) Ec_galP_ XbaI tataattctagattaatcgtgag clon_rev cgcctatttc (SEQIDNo.68) Restriction sites used for cloning into pACT3 are underlined

(57) It is understood that removal of the lacI gene from the backbone of the above described plasmids along with the genomic deletion of lacI in the host strain may render protein expression from above described plasmids constitutive.

(58) Construction of Strains with Optimized Carbon Flux Repartitioning for DHB Production

(59) Several genes were disrupted in E. coli strain MG1655 in order to optimise carbon flux repartitioning and cofactor supply for DHB production. Gene deletions were carried out using either the lambda red recombinase method according to Datsenko et al. (Datsenko & Wanner, 2000), or the phage transduction method adapted from Miller (Miller, 1992).

(60) Protocol for introduction of gene deletions using the lambda red recombinase method: the deletion cassettes were prepared by PCR using high fidelity polymerase Phusion (Finnzymes), and the FRT-flanked kanamycin resistance gene (kan) of plasmid pKD4 as the template (Datsenko & Wanner, 2000). Sense primers contained sequences corresponding to the 5-end of each targeted gene (underlined) followed by 20 bp corresponding to the FRT-kan-FRT cassette of pKD4. Anti-sense primers contained sequences corresponding to the 3-end region of each targeted gene (underlined) followed by 20 bp corresponding to the cassette. The primers are described in Table 12. PCR products were digested with DpnI and purified prior to transformation.

(61) E. coli MG1655 strain was rendered electro-competent by growing the cells to an OD.sub.600 of 0.6 in LB liquid medium at 37 C., concentrating the cells 100-fold, and washing them twice with ice-cold 10% glycerol. The cells were transformed with plasmid pKD46 (Datsenko & Wanner, 2000) by electroporation (2.5 kV, 200 , 25 F, in 2 mm gap cuvettes). Transformants were selected at 30 C. on ampicillin (100 g/mL) LB solid medium.

(62) Disruption cassettes were transformed into electro-competent E. coli strains harbouring the lambda Red recombinase-expressing plasmid pKD46. The cells were grown at 30 C. in liquid SOB medium containing ampicillin (100 g/mL). The lambda red recombinase system was induced by adding 10 mM arabinose when OD.sub.600 of the cultures reached 0.1. Cells were further grown to an OD.sub.600 of 0.6 before they were harvested by centrifugation, washed twice with ice-cold 10% glycerol, and transformed with the disruption cassette by electroporation. After an overnight phenotypic expression at 30 C. in LB liquid medium, cells were plated on solid LB medium containing 25 g/mL kanamycin. Transformants were selected after cultivation at 30 C.

(63) The gene replacement was verified by colony PCR using Crimson Taq polymerase (NEB). A first reaction was carried out with the flanking locus-specific primers (see Table 12) to verify simultaneous loss of the parental fragment and gain of the new mutant specific fragment. Two additional reactions were done by using one locus-specific primer together with one of the corresponding primers k1rev, or k2for (see Table 12) that align within the FRT-kanamycin resistance cassette (sense locus primer/k1rev and k2for/reverse locus primer).

(64) The resistance gene (FRT-kan-FRT) was subsequently excised from the chromosome using the FLP recombinase-harbouring plasmid pCP20 (Cherepanov & Wackernagel, 1995) leaving a scar region containing one FRT site. pCP20 is an ampicillin and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP recombinase synthesis. Kanamycin resistant mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C. Transformants were then grown on solid LB medium at 37 C. and tested for loss of all antibiotic resistances. Excision of the FRT-kanamycin cassette was analysed by colony PCR using crimson Taq polymerase and the flanking locus-specific primers (Table 12). Multiple deletions were obtained by repeating the above described steps.

(65) TABLE-US-00012 TABLE12 Primersusedforgenedisruptions. Gene Primer Sequence ldhA _ldhA_ gaaggttgcgcctacactaagcatagttgttgatgagtgtaggctggagctgcttc for (SEQIDNo.69) _ldhA_ ttaaaccagttcgttcgggcaggtttcgcctttttcatgggaattagccatggtcc rev SEQIDNo.70) adhE _adhE_ atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtgtaggctggagctgcttc for (SEQIDNo.71) _adhE_ ttaagcggattttttcgcttttttctcagctttagccggagcagccatatgaatatcctccttag rev (SEQIDNo.72) ackA _ackA_ atgtcgagtaagttagtactggttctgaactgcggtagttcttcagtgtaggctggagctgcttc for (SEQIDNo.73) _ackA_ tcaggcagtcaggcggctcgcgtcttgcgcgataaccagttcttccatatgaatatcctccttag rev (SEQIDNo.74) focA- _focA- ttactccgtatttgcataaaaaccatgcgagttacgggcctataagtgtaggctggagctgcttc pfIB pfIB_for (SEQIDNo.75) _focA- atagattgagtgaaggtacgagtaataacgtcctgctgctgttctcatatgaatatcctccttag pfIB_rev (SEQIDNo.76) pta _pta_ gtgtcccgtattattatgctgatccctaccggaaccagcgtcggtgtgtaggctggagctgcttc for (SEQIDNo.77) _pta_ ttactgctgctgtgcagactgaatcgcagtcagcgcgatggtgtacatatgaatatcctccttag rev (SEQIDNo.78) poxB _poxB_ atgaaacaaacggttgcagcttatatcgccaaaacactcgaatcggtgtaggctggagctgcttc for (SEQIDNo.79) _poxB_ ttaccttagccagtttgttttcgccagttcgatcacttcatcacccatatgaatatcctccttag rev (SEQIDNo.80) sad _sad_ atgaccattactccggcaactcatgcaatttcgataaatcctgccgtgtaggctggagctgcttc for (SEQIDNo.81) _sad_ tcagatccggtctttccacaccgtctggatattacagaattcgtgcatatgaatatcctccttag rev (SEQIDNo.82) gabD _gabD_ atgaaacttaacgacagtaacttattccgccagcaggcgttgattgtgtaggctggagctgcttc for (SEQIDNo.83) _gabD_ ttaaagaccgatgcacatatatttgatttctaagtaatcttcgatcatatgaatatcctccttag rev (SEQIDNo.847) gadA _gadA_ atggaccagaagctgttaacggatttccgctcagaactactcgatgtgtaggctggagctgcttc for (SEQIDNo.85) _gadA_ tcaggtgtgtttaaagctgttctgctgggcaataccctgcagtttcatatgaatatcctccttag rev (SEQIDNo.86) gadB _gadB_ atggataagaagcaagtaacggatttaaggtcggaactactcgatgtgtaggctggagctgcttc for (SEQIDNo.87) _gadB_ tcaggtatgtttaaagctgttctgttgggcaataccctgcagtttcatatgaatatcctccttag rev (SEQIDNo.88) gadC _gadC_ atggctacatcagtacagacaggtaaagctaagcagctcacattagtgtaggctggagctgcttc for (SEQIDNo.89) _gadC_ ttagtgtttcttgtcattcatcacaatatagtgtggtgaacgtgccatatgaatatcctccttag rev (SEQIDNo.90) sfcA _sfcA_ atggaaccaaaaacaaaaaaacagcgttcgctttatatcccttacgtgtaggctggagctgcttc for (SEQIDNo.91) _sfcA_ ttagatggaggtacggcggtagtcgcggtattcggcttgccagaacatatgaatatcctccttag rev (SEQIDNo.92) maeB _maeB_ atggatgaccagttaaaacaaagtgcacttgatttccatgaatttgtgtaggctggagctgcttc for (SEQIDNo.93) _maeB_ ttacagcggttgggtttgcgcttctaccacggccagcgccaccatcatatgaatatcctccttag rev (SEQIDNo.94) ppc _ppc_ atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcgtgtaggctggagctgcttc for (SEQIDNo.95) _ppc_ ttagccggtattacgcatacctgccgcaatcccggcaatagtgaccatatgaatatcctccttag rev (SEQIDNo.96) pykA _pykA_ atgtccagaaggcttcgcagaacaaaaatcgttaccacgttaggcgtgtaggctggagctgcttc for (SEQIDNo.97) _pykA_ ttactctaccgttaaaatacgcgtggtattagtagaacccacggtcatatgaatatcctccttag rev (SEQIDNo.98) pykF _pykF_ atgaaaaagaccaaaattgtttgcaccatcggaccgaaaaccgaagtgtaggctggagctgcttc for (SEQIDNo.99) _pykF_ ttacaggacgtgaacagatgcggtgttagtagtgccgctcggtaccatatgaatatcctccttag rev (SEQIDNo.100) mgsA _mgsA_ atggaactgacgactcgcactttacctgcgcggaaacatattgcggtgtaggctggagctgcttc for (SEQIDNo.101) _mgsA_ ttacttcagacggtccgcgagataacgctgataatcggggatcagcatatgaatatcctccttag rev (SEQIDNo.102) icIR _icIR_ atggtcgcacccattcccgcgaaacgcggcagaaaacccgccgttgtgtaggctggagctgcttc for (SEQIDNo.103) _icIR_ tcagcgcattccaccgtacgccagcgtcacttccttcgccgctttcatatgaatatcctccttag rev (SEQIDNo.104) icd _icd_ atggaaagtaaagtagttgttccggcacaaggcaagaagatcaccgtgtaggctggagctgcttc for (SEQIDNo.105) _icd_ ttacatgttttcgatgatcgcgtcaccaaactctgaacatttcagcatatgaatatcctccttag rev (SEQIDNo.106) sucA _sucA_ atgcagaacagcgctttgaaagcctggttggactcttcttacctcgtgtaggctggagctgcttc for (SEQIDNo.107) _sucA_ ttattcgacgttcagcgcgtcattaaccagatcttgttgctgtttcatatgaatatcctccttag rev (SEQIDNo.108) sucB _sucB_ atgagtagcgtagatattctggtccctgacctgcctgaatccgtagtgtaggctggagctgcttc for (SEQIDNo.109) _sucB_ ctacacgtccagcagcagacgcgtcggatcttccagcaactctttcatatgaatatcctccttag rev (SEQIDNo.110) frdA _frdA_ gtgcaaacctttcaagccgatcttgccattgtaggcgccggtggcgtgtaggctggagctgcttc for (SEQIDNo.111) _frdA_ tcagccattcgccttctcclicttattggctgcttccgccttatccatatgaatatcctccttag rev (SEQIDNo.112) frdB _frdB_ atggctgagatgaaaaacctgaaaattgaggtggtgcgctataacgtgtaggctggagctgcttc for (SEQIDNo.113) _frdB_ ttagcgtggtttcagggtcgcgataagaaagtctttcgaactttccatatgaatatcctccttag rev (SEQIDNo.114) frdC _frdC_ atgacgactaaacgtaaaccgtatgtacggccaatgacgtccaccgtgtaggctggagctgcttc for (SEQIDNo.115) _frdC_ ttaccagtacagggcaacaaacaggattacgatggtggcaaccaccatatgaatatcctccttag rev (SEQIDNo.116) frdD _frdD_ atgattaatccaaatccaaagcgttctgacgaaccggtattctgggtgtaggctggagctgcttc for (SEQIDNo.117) _frdD_ ttagattgtaacgacaccaatcagcgtgacaactgtcaggatagccatatgaatatcctccttag rev (SEQIDNo.118) ptsl _ptsl_ atgatttcaggcattttagcatccccgggtatcgctttcggtaaagtgtaggctggagctgcttc for (SEQIDNo.119) _ptsl_ ttagcagattgttttttcttcaatgaacttgttaaccagcgtcatcatatgaatatcctccttag rev (SEQIDNo.120) ptsG _ptsG_ atgtttaagaatgcatttgctaacctgcaaaaggtcggtaaatcggtgtaggctggagctgcttc for (SEQIDNo.121) _ptsG_ ttagtggttacggatgtactcatccatctcggttttcaggttatccatatgaatatcctccttag rev (SEQIDNo.122) lacl _lacl_ gtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtcgtgtaggctggagctgcttc for (SEQIDNo.123) _lacl_ tcactgcccgctttccagtcgggaaacctgtcgtgccagctgcatcatatgaatatcctccttag rev (SEQIDNo.124) lldD _lldD_ atgattatttccgcagccagcgattatcgcgccgcagcgcaacgcgtgtaggctggagctgcttc for (SEQIDNo.125) _lldD_ ctatgccgcattccctttcgccatgggagccagtgccgcaggcaacatatgaatatcctccttag rev (SEQIDNo.126) pgi _pgi_ atgaaaaacatcaatccaacgcagaccgctgcctggcaggcactagtgtaggctggagctgcttc for (SEQIDNo.127) _pgi_ ttaaccgcgccacgctttatagcggttaatcagaccattggtcgacatatgaatatcctccttag rev (SEQIDNo.128) Sequences homologous to target genes are underlined

(66) TABLE-US-00013 TABLE13 Primerpairsusedforverification ofgenedisruptions Deleted Sequence(5-3) gene Forwardprimer ReversePrimer K2for/ cggtgccctga cagtcatagcc k1rev atgaactgc gaatagcct (SEQIDNo.129) (SEQIDNo.130) ldhA atacgtgtccc tacacatcccg gagcggtag ccatcagca (SEQIDNo.131) (SEQIDNo.132) adhE gaagtaaacgg agaagtggcata gaaaatcaa agaaaacg (SEQIDNo.133) (SEQIDNo.134) ackA ccattggctga gttccattgca aaattacgc cggatcacg (SEQIDNo.135) (SEQIDNo.136) focA_ atgccgtagaa tgttggtgcgca pflB gccgccagt gctcgaag (SEQIDNo.137) (SEQIDNo.138) pta gcaaatctggt tcccttgcacaa ttcatcaac aacaaagt (SEQIDNo.139) (SEQIDNo.140) poxB ggatttggtt agcattaacgg ctcgcataat tagggtcgt (SEQIDNo.141) (SEQIDNo.142) sad gctgattctcg aaaaacgttct cgaataaac tgcgcgtct (SEQIDNo.143) (SEQIDNo.144) gabD tctgtttgtca aagccagcacc ccaccccgc tggaagcag (SEQIDNo.145) (SEQIDNo.146) gadA aagagctgccg gccgccctctt caggaggat aagtcaaat (SEQIDNo.147) (SEQIDNo.148) gadB ggattttagca cctaatagcag atattcgct gaagaagac (SEQIDNo.149) (SEQIDNo.150) gadC gctgaactgt ggcgtgctttt tgctggaaga acaactaca (SEQIDNo.151) (SEQIDNo.152) sfcA tagtaaataa tcagtgagcgc cccaaccggc agtgtttta (SEQIDNo.153) (SEQIDNo.154) maeB attaatggtga tgctttttttt gagtttgga attattcgc (SEQIDNo.155) (SEQIDNo.156) ppc gctttataaa gtaacgacaat agacgacgaa tccttaagg (SEQIDNo.157) (SEQIDNo.158) pykA tttatatgccc atctgttagag atggtttct gcggatgat (SEQIDNo.159) (SEQIDNo.160) pykF ctggaacgtt ccagtttagt aaatctttga agctttcatt (SEQIDNo.161) (SEQIDNo.162) iclR gatttgttcaacat tgcgattaac taactcatcgg agacaccctt (SEQIDNo.163) (SEQIDNo.164) mgsA tctcaggtgct tatggaagagg cacagaaca cgctactgc (SEQIDNo.165) (SEQIDNo.166) icd cgacctgctgc tgaacgctaag ataaacacc gtgattgca (SEQIDNo.167) (SEQIDNo.168) sucA acgtagacaa catcacgtacg gagctcgcaa actgcgtcg (SEQIDNo.169) (SEQIDNo.170) sucB tgcaactttg tatcgcttccg tgctgagcaa ggcattgtc (SEQIDNo.171) (SEQIDNo.172) frdA aaatcgatctcgt aggaaccacaa caaatttcagac atcgccata (SEQIDNo.173) (SEQIDNo.174) frdB gacgtgaaga agttcaatgc ttactacgct tgaaccacac (SEQIDNo.175) (SEQIDNo.176) frdC tagccgcgaccac cagcgcatcac ggtaagaaggag ccggaaaca (SEQIDNo.177) SEQIDNo.178) frdD atcgtgatca ttaccctgat ttaacctgat aaattaccgc (SEQIDNo.179) (SEQIDNo.180) lacI gaatctggtg tcttcgctat tatatggcga tacgccagct (SEQIDNo.181) (SEQIDNo.182) lldD cgtcagcgga gcggaatttct tgtatctggt ggttcgtaa (SEQIDNo.183) (SEQIDNo.184) pgi ttgtcaacga aaaaatgccg tggggtcatg acataacgtc (SEQIDNo.195) (SEQIDNo.196) ptsG ccatccgttga tggtgttaact atgagtttt ggcaaaatc (SEQIDNo.197) (SEQIDNo.198) ptsI gtgacttccaa ccgttggtttg cggcaaaag atagcaata (SEQIDNo.199) (SEQIDNo.200)

(67) Protocol for introduction of gene deletions using the phage transduction method: strains carrying the desired single deletions were obtained from the Keio collection (Baba et al., 2006). Phage lysates of single deletion mutants were prepared by inoculating 10 mL of LB medium containing 50 g/mL kanamycin, 2 g/L glucose, and 5 mM CaCl.sub.2 with 100 L of overnight precultures. Following an incubation of 1 h at 37 C., 200 L of phage lysate prepared from the wild-type MG1655 strain were added, and cultures were incubated for another 2-3 h until cell lysis had completed. After addition of 200 L chloroform, cell preparations were first vigorously vortexed and then centrifuged for 10 min at 4500g. The clear lysate was recovered and stored at 4 C.

(68) The receptor strain was prepared for phage transduction by an overnight cultivation at 37 C. in LB medium. A volume of 1.5 mL of the preculture was centrifuged at 1500g for 10 min. The supernatant was discarded and the cell pellet was resuspended in 600 L of a solution containing 10 mM MgSO.sub.4 and 5 mM CaCl.sub.2. The transduction was carried out by mixing 100 L of the solution containing the receptor strain with 100 L of lysate and incubating this mixture at 30 C. for 30 min. Thereafter, 100 L of a 1M sodium citrate solution were added followed by vigorous vortexing. After addition of 1 mL LB medium, the cell suspension was incubated at 37 C. for 1 h before spreading the cells on LB agar dishes containing 50 g/mL kanamycin. Clones able to grow in presence of the antibiotic were confirmed by colony PCR to contain the desired deletion using the primers listed in Table 13. After the introduction of each gene deletion, the antibiotic marker was removed as described above following the method of (Cherepanov & Wackernagel, 1995)

(69) The plasmids co-expressing malyl-CoA synthetase, malyl-CoA reductase, and DHB dehydrogenase (pEXT20-MCS-DHB or pACT3-MCS-DHB); or plasmids co-expressing malyl-CoA lyase, malyl-CoA reductase, and DHB dehydrogenase (pEXT20-MCL-DHB or pACT3-MCL-DHB); or the empty control plasmids (pEXT20 or pACT3) were transformed alone or together with one of the plasmids pACT3-aceA, pACT3-ppc, pACT3-galP, pACT3-pck or pACT3-pyc into the optimized host strains. Transformants containing both a plasmid expressing the DHB-pathway enzymes, and a plasmid expressing an anaplerotic enzyme were selected on solid LB medium containing chloramphenicol (25 g/mL) and kanamycin (50 g/mL). Non-exclusive examples of constructed strains are listed in Table 14.

(70) TABLE-US-00014 TABLE 14 Examples of strains constructed for DHB production Strain Relevant Genotype MG1655 Wild-type ECE50 pEXT20-MCS-DHB ECE51 pACT3-MCS-DHB ECE52 pEXT20-MCL-DHB ECE53 pACT3-MCL-DHB ECE54 ldhA adhE pta-ack pflB pEXT20-MCS-DHB ECE55 ldhA adhE pta-ack pflB pACT3-MCS-DHB ECE56 ldhA adhE pta-ack pflB pACT3-MCS-DHB, pACT3-ppc ECE57 ldhA adhE pta-ack pflB poxB pEXT20-MCS-DHB ECE58 ldhA adhE pta-ack pflB poxB pACT3-MCS-DHB ECE59 ldhA adhE pta-ack pflB poxB pEXT20-MCS-DHB, pACT3-ppc ECE60 ldhA adhE pta-ack pflB poxB maeB sfcA pEXT20-MCS-DHB ECE61 ldhA adhE pta-ack pflB poxB maeB sfcA pACT3-MCS-DHB ECE62 ldhA adhE pta-ack pflB poxB maeB sfcA pEXT20-MCS-DHB, pACT3-ppc ECE63 ldhA adhE pta-ack pflB poxB maeB sfcA pts pEXT20-MCS-DHB ECE64 ldhA adhE pta-ack pflB poxB maeB sfcA pts pACT3-MCS-DHB ECE65 ldhA adhE pta-ack pflB poxB maeB sfcA pts pEXT20-MCS-DHB, pACT3-ppc ECE66 ldhA adhE pta-ack pflB poxB maeB sfcA pts frdBC pEXT20-MCS-DHB ECE67 ldhA adhE pta-ack pflB poxB maeB sfcA pts frdBC pACT3-MCS-DHB ECE68 ldhA adhE pta-ack pflB poxB maeB sfcA pts frdBC pEXT20-MCS-DHB, pACT3-ppc ECE69 pta iclR aceB pACT3-MCL-DHB ECE70 pta iclR aceB ECE71 pta iclR aceB adhE pACT3-MCL-DHB ECE72 pta iclR aceB adhE ECE73 ldhA adhE pta-ack poxB maeB sfcA mdh mqo iclR aceB pEXT20-MCS-DHB, pACT3-MCL-DHB ECE74 ldhA adhE pta-ack poxB maeB sfcA mdh mqo iclR aceB pts pEXT20-MCS-DHB, pACT3-MCL-DHB ECE75 ldhA adhE pta-ack poxB maeB sfcA mdh mqo iclR aceB pts pgi pEXT20-MCS-DHB, pACT3-MCL-DHB ECE76 ldhA adhE pta-ack poxB maeB sfcA mdh mqo iclR aceB pgi pEXT20-MCS-DHB, pACT3 MCL-DHB ECE77 ldhA adhE pta-ack poxB maeB sfcA mdh mqo iclR aceB ghrAB pEXT20-MCS-DHB, pACT3-MCL-DHB ECE79 ldhA adhE pta-ack pflB poxB maeB sfcA aspC pEXT20-MCS-DHB, pACT3-ppc ECE80 ldhA adhE pta-ack pflB poxB maeB sfcA aspC iclR aceB pEXT20-MCS-DHB, pACT3-ppc ECE81 ldhA adhE pta-ack pflB poxB maeB sfcA aspC iclR aceB ghrAB pEXT20-MCS-DHB, pACT3-ppc

Example 8: Demonstration of Zymotic Production of DHB by the Synthetic Malyl-CoA Pathway

(71) Strains and Cultivation Conditions:

(72) Experiments were carried out using strain ECE69 which expressed the DHB pathway from plasmid pACT3-MCL-DHB represented by SEQ ID No. 203 (the wild-type Mcr enzyme was replaced by the Mcr Tyr206Pro mutant in this experiment) and the isogenic control strain ECE70 containing the empty plasmid pACT3. All cultivations were carried out at 37 C. on an Infors rotary shaker running at 170 rpm. Overnight cultures (3 mL medium in test tube) were inoculated from glycerol stocks and used to adjust an initial OD.sub.600 of 0.05 in 100 mL growth cultures cultivated in 500 mL shake flasks. IPTG was added at a concentration of 1 mmol/L when OD.sub.600 of the growth cultures reached 1. The composition of the growth mineral medium is provided in Example 2.

(73) Estimation of DHB Concentration by LC-MS/MS Analyses:

(74) DHB was quantified using LC-MS: Liquid anion exchange chromatography was performed on an ICS-3000 system from Dionex (Sunnyvale, USA) equipped with an automatic eluent (KOH) generator system (RFIC, Dionex), and an autosampler (AS50, Dionex) holding the samples at 4 C. Analytes were separated on an IonPac AS11 HC (2502 mm, Dionex) column protected by an AG11 HC (502 mm, Dionex) pre-column. Column temperature was held at 25 C., flow rate was fixed at 0.25 mL/min, and analytes were eluted applying the KOH gradient described earlier (Groussac E, Ortiz M & Francois J (2000) Improved protocols for quantitative determination of metabolites from biological samples using high performance ionic-exchange chromatography with conductimetric and pulsed amperometric detection. Enzyme. Microb. Technol. 26, 715-723). Injected sample volume was 15 L. For background reduction, an ASRS ultra II (2 mm, external water mode, 75 mA) anion suppressor was used. Analytes were quantified a mass-sensitive detector (MSQ Plus, Thermo) running in ESI mode (split was , nitrogen pressure was 90 psi, capillary voltage was 3.5 kV, probe temperature was 450 C.).

(75) Results:

(76) After 24 h of cultivation the supernatant of strains ECE69 and ECE70 contained 0.05 mM DHB and 0 mM DHB, respectively, demonstrating DHB production via the synthetic pathway.

REFERENCES

(77) Akita, O., Nishimori, C., Shimamoto, T., Fujii, T. & Iefuji, H. (2000). Transport of pyruvate in Saccharomyces cerevisiae and cloning of the gene encoded pyruvate permease. Biosci Biotechnol Biochem 64, 980-984. Alber, B., Olinger, M., Rieder, A., Kockelkorn, D., Jobst, B., Hgler, M. & Fuchs, G. (2006). Malonyl-coenzyme A reductase in the modified 3-hydroxypropionate cycle for autotrophic carbon fixation in archaeal Metallosphaera and Sulfolobus spp. J Bacteriol 188, 8551-8559. Arps, P. J., Fulton, G. F., Minnich, E. C. & Lidstrom, M. E. (1993). Genetics of serine pathway enzymes in Methylobacterium extorquens AM1: phosphoenolpyruvate carboxylase and malyl coenzyme A lyase. J Bacteriol 175, 3776-3783. Auriol, C., Bestel-Corre, G., Claude, J.-B., Soucaille, P. & Meynial-Salles, I. (2011). Stress-induced evolution of Escherichia coli points to original concepts in respiratory cofactor selectivity. Proc Natl Acad Sci USA 108, 1278-1283. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L. & Mori, H. (2006). Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2, 2006.0008. Bailey, J. E. (1991). Toward a science of metabolic engineering. Science 252, 1668-1675. Camarasa, C., Bidard, F., Bony, M., Barre, P. & Dequin, S. (2001). Characterization of Schizosaccharomyces pombe malate permease by expression in Saccharomyces cerevisiae. Appl Environ Microbiol 67, 4144-4151. Cherepanov, P. P. & Wackernagel, W. (1995). Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158, 9-14. Chistoserdova, L., Kalyuzhnaya, M. G. & Lidstrom, M. E. (2009). The expanding world of methylotrophic metabolism. Annu Rev Microbiol 63, 477-499. Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97, 6640-6645. Ford, G. & Ellis, E. M. (2002). Characterization of Ypr1p from Saccharomyces cerevisiae as a 2-methylbutyraldehyde reductase. Yeast Chichester Engl 19, 1087-1096. Friedmann, S., Steindorf, A., Alber, B. E. & Fuchs, G. (2006). Properties of succinyl-coenzyme A:L-malate coenzyme A transferase and its role in the autotrophic 3-hydroxypropionate cycle of Chloroflexus aurantiacus. J Bacteriol 188, 2646-2655. Grobler, J., Bauer, F., Subden, R. E. & Van Vuuren, H. J. (1995). The mae1 gene of Schizosaccharomyces pombe encodes a permease for malate and other C4 dicarboxylic acids. Yeast Chichester Engl 11, 1485-1491. Groeneveld, M., Weme, R. G. J. D. O., Duurkens, R. H. & Slotboom, D. J. (2010). Biochemical characterization of the C4-dicarboxylate transporter DctA from Bacillus subtilis. J Bacteriol 192, 2900-2907. Jantama, K., Zhang, X., Moore, J. C., Shanmugam, K. T., Svoronos, S. A. & Ingram, L. O. (2008a). Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C. Biotechnol Bioeng 101, 881-893. Jantama, K. Haupt, M. J., Svoronos, S. A., Zhang, X., Moore, J. C., Shanmugam, K. T. & Ingram, L. O. (2008b). Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate. Biotechnol Bioeng 99, 1140-1153. Kawasaki, T., Koita, H., Nakatsubo, T., Hasegawa, K., Wakabayashi, K., Takahashi, H., Umemura, K., Umezawa, T. & Shimamoto, K. (2006). Cinnamoyl-CoA reductase, a key enzyme in lignin biosynthesis, is an effector of small GTPase Rac in defense signaling in rice. Proc Natl Acad Sci USA 103, 230-235.

(78) Kockelkorn, D. & Fuchs, G. (2009). Malonic semialdehyde reductase, succinic semialdehyde reductase, and succinyl-coenzyme A reductase from Metallosphaera sedula: enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in Sulfolobales. J Bacteriol 191, 6352-6362. Larkin, M. A., Blackshields, G., Brown, N. P., Chema, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A. & other authors. (2007). Clustal W and Clustal X version 2.0. Bioinforma Oxf Engl 23, 2947-2948. Lin, H., Bennett, G. N. & San, K.-Y. (2005). Metabolic engineering of aerobic succinate production systems in Escherichia coli to improve process productivity and achieve the maximum theoretical succinate yield. Metab Eng 7, 116-127. Meister, M., Saum, S., Alber, B. E. & Fuchs, G. (2005). L-malyl-coenzyme A/beta-methylmalyl-coenzyme A lyase is involved in acetate assimilation of the isocitrate lyase-negative bacterium Rhodobacter capsulatus. J Bacteriol 187, 1415-1425. Millard, C. S., Chao, Y. P., Liao, J. C. & Donnelly, M. I. (1996). Enhanced production of succinic acid by overexpression of phosphoenolpyruvate carboxylase in Escherichia coli. Appl Environ Microbiol 62, 1808-1810. Miller, J. H. (1992). A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichica coli and Related Bacteria. Plainview (NY): Cold Spring Harbor Laboratory Press. Rognstad, R. & Katz, J. (1979). Effects of 2,4-dihydroxybutyrate on lipogenesis in rat hepatocytes. J Biol Chem 254, 11969-11972. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. Sanchez, A. M., Bennett, G. N. & San, K.-Y. (2005). Novel pathway engineering design of the anaerobic central metabolic pathway in Escherichia coli to increase succinate yield and productivity. Metab Eng 7, 229-239. Sauer, U. & Eikmanns, B. J. (2005). The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. Fems Microbiol Rev 29, 765-794. Seedorf, H., Fricke, W. F., Veith, B., Brggemann, H., Liesegang, H., Strittmatter, A., Miethke, M., Buckel, W., Hinderberger, J. & other authors. (2008). The genome of Clostridium kluyveri, a strict anaerobe with unique metabolic features. Proc Natl Acad Sci USA 105, 2128-2133. Shinka, T., Inoue, Y., Ohse, M., Ito, A., Ohfu, M., Hirose, S. & Kuhara, T. (2002). Rapid and sensitive detection of urinary 4-hydroxybutyric acid and its related compounds by gas chromatography-mass spectrometry in a patient with succinic semialdehyde dehydrogenase deficiency. J Chromatogr B Anal Technol Biomed Life Sci 776, 57-63. Smejkalov, H., Erb, T. J. & Fuchs, G. (2010). Methanol assimilation in Methylobacterium extorquens AM 1: demonstration of all enzymes and their regulation. Plos One 5. Shling, B. & Gottschalk, G. (1993). Purification and characterization of a coenzyme-A-dependent succinate-semialdehyde dehydrogenase from Clostridium kluyveri. Eur J Biochem Febs 212, 121-127. Vuilleumier, S., Chistoserdova, L., Lee, M.-C., Bringel, F., Lajus, A., Zhou, Y., Gourion, B., Barbe, V., Chang, J. & other authors. (2009). Methylobacterium genome sequences: a reference blueprint to investigate microbial metabolism of C1 compounds from natural and industrial sources. Plos One 4, e5584. Wang, Q., Ou, M. S., Kim, Y., Ingram, L. O. & Shanmugam, K. T. (2010). Metabolic flux control at the pyruvate node in an anaerobic Escherichia coli strain with an active pyruvate dehydrogenase. Appl Environ Microbiol 76, 2107-2114. Werpy, T. & Petersen, G. (2004). Top value added chemicals from biomass. Results of screening for potential candidates from sugars and synthesis gas. Washington D.C. Zarzycki, J., Brecht, V., Mller, M. & Fuchs, G. (2009). Identifying the missing steps of the autotrophic 3-hydroxypropionate CO2 fixation cycle in Chloroflexus aurantiacus. Proc Natl Acad Sci USA 106, 21317-21322. Zelle, R. M., de Hulster, E., van Winden, W. A., de Waard, P., Dijkema, C., Winkler, A. A., Geertman, J.-M. A., van Dijken, J. P., Pronk, J. T. & van Maris, A. J. A. (2008). Malic acid production by Saccharomyces cerevisiae: engineering of pyruvate carboxylation, oxaloacetate reduction, and malate export. Appl Environ Microbiol 74, 2766-2777. Zelle, R. M., de Hulster, E., Kloezen, W., Pronk, J. T. & van Maris, A. J. A. (2010). Key process conditions for production of C(4) dicarboxylic acids in bioreactor batch cultures of an engineered Saccharomyces cerevisiae strain. Appl Environ Microbiol 76, 744-750. Zhang, X., Jantama, K., Shanmugam, K. T. & Ingram, L. O. (2009). Reengineering Escherichia coli for Succinate Production in Mineral Salts Medium. Appl Environ Microbiol 75, 7807-7813. Zhang, X., Wang, X., Shanmugam, K. T. & Ingram, L. O. (2011). L-malate production by metabolically engineered Escherichia coli. Appl Environ Microbiol 77, 427-434.