COMPOSITION, KIT AND METHOD FOR DETECTING SARS-COV-2 AND USE THEREOF
20230090551 · 2023-03-23
Inventors
- Lizhong DAI (Changsha, CN)
- Zhongping DENG (Changsha, CN)
- Deyong TAN (Changsha, CN)
- Jia LIU (Changsha, CN)
- Bozhi JI (Changsha, CN)
- Jin YAN (Changsha, CN)
- Xinwu GUO (Changsha, CN)
- Xiaomei REN (Changsha, CN)
- Kang WU (Changsha, CN)
- Xing CHENG (Changsha, CN)
Cpc classification
C12Q2600/166
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
Abstract
A composition for detecting SARS-CoV-2 is provided; moreover, a kit including the composition, the use of the kit, and a method for detecting SARS-CoV-2 are also provided.
Claims
1. A composition for detecting SARS-CoV-2, comprising: a first primer pair, used for specifically amplifying an N gene of SARS-CoV-2; a first probe, used for detecting an amplification product of the first primer pair; a second primer pair, used for specifically amplifying an area as shown in SEQ ID NO: 1 in an ORF1ab gene; a second probe, used for detecting an amplification product of the second primer pair; a third primer pair, used for specifically amplifying an area as shown in SEQ ID NO: 2 in the ORF1ab gene; and a third probe, used for detecting an amplification product of the third primer pair.
2. The composition according to claim 1, wherein the second primer pair and the second probe are: TABLE-US-00023 an ORF1ab forward primer 1-1: (SEQ ID NO: 8) 5′-ATTCACCTAATTTAGCATGGCCTC-3′; an ORF1ab reverse primer 1-1: (SEQ ID NO: 9) 5′-ACATCTGTCGTAGTGCAACAGGAC-3′; and an ORF1ab probe 1-1: (SEQ ID NO: 10) 5′-TTGTAACAGCTTTAAGGGCCAATTCTGCTGT-3′; or an ORF1ab forward primer 1-2: (SEQ ID NO: 11) 5′-ATGGCCTCTTATTGTAACAGCT-3′; an ORF1ab reverse primer 1-2: (SEQ ID NO: 12) 5′-AGCAGTTTGTGTAGTACCGGCAGC-3′; and an ORF1ab probe 1-2: (SEQ ID NO: 13) 5′-CCAATTCTGCTGTCAAATTACAGAATA-3′.
3. The composition according to claim 1, wherein the third primer pair and the third probe are: TABLE-US-00024 an ORF1ab forward primer 2-1: (SEQ ID NO: 14) 5′-GAAGGTTCTGTTGCTTATGAAAGTT-3′; an ORF1ab reverse primer 2-1: (SEQ ID NO: 15) 5′-TACCACTCTAACAGAACCTTC-3′; and an ORF1ab probe 2-1: (SEQ ID NO: 16) 5′-GCCCTGACACACGTTATGTGCTCATGGA-3′; or an ORF1ab forward primer 2-2: (SEQ ID NO: 17) 5′-ATGAAAGTTTACGCCCTGAC-3′; an ORF1ab reverse primer 2-2: (SEQ ID NO: 18) 5′-CCGTGCCTACAGTACTCAGAATC-3′; and an ORF1ab probe 2-2: (SEQ ID NO: 19) 5′-ATGTGCTCATGGATGGCTCTATTATTCAATT-3′.
4. The composition according to claim 1, wherein the first primer pair is used for specifically amplifying an area as shown in SEQ ID NO: 3 in the N gene.
5. The composition according to claim 4, wherein the first primer pair and the first probe are: TABLE-US-00025 an N gene forward primer 1: (SEQ ID NO: 5) 5′-GGTATTTCTACTACCTAGGAACT-3′; an N gene reverse primer 1: (SEQ ID NO: 6) 5′-TGCAGCATTGTTAGCAGGATTG-3′; and an N gene probe 1: (SEQ ID NO: 7) 5′-GCCAGAAGCTGGACTTCCCTATGGTGC-3′; or an N gene forward primer 2: (SEQ ID NO: 43) 5′-ACTACCTAGGAACTGGGCCAG-3′; an N gene reverse primer 2: (SEQ ID NO: 44) 5′-AGCAGGATTGCGGGTGCCAAT-3′; and an N gene probe 2: (SEQ ID NO: 45) 5′-ACTTCCCTATGGTGCTAACAAAGACGGCAT-3′.
6. The composition according to claim 1, the composition further comprises: TABLE-US-00026 a first primer pair: an N gene forward primer 1: (SEQ ID NO: 5) 5′-GGTATTTCTACTACCTAGGAACT-3′; an N gene reverse primer 1: (SEQ ID NO: 6) 5′-TGCAGCATTGTTAGCAGGATTG-3′; and a first probe: an N gene probe 1: (SEQ ID NO: 7) 5′-GCCAGAAGCTGGACTTCCCTATGGTGC-3′; a second primer pair: an ORF1ab forward primer 1-1: (SEQ ID NO: 8) 5′-ATTCACCTAATTTAGCATGGCCTC-3′; an ORF1ab reverse primer 1-1: (SEQ ID NO: 9) 5′-ACATCTGTCGTAGTGCAACAGGAC-3′; and a second probe: an ORF1ab probe 1-1: (SEQ ID NO: 10) 5′-TTGTAACAGCTTTAAGGGCCAATTCTGCTGT-3′; and a third primer pair: an ORF1ab forward primer 2-1: (SEQ ID NO: 14) 5′-GAAGGTTCTGTTGCTTATGAAAGTT-3′; an ORF1ab reverse primer 2-1: (SEQ ID NO: 15) 5′-TACCACTCTAACAGAACCTTC-3′; and a third probe: an ORF1ab probe 2-1: (SEQ ID NO: 16) 5′-GCCCTGACACACGTTATGTGCTCATGGA-3′.
7. The composition according to claim 1, the composition further comprises: TABLE-US-00027 a first primer pair: an N gene forward primer 1: (SEQ ID NO: 5) 5′-GGTATTTCTACTACCTAGGAACT-3′; an N gene reverse primer 1: (SEQ ID NO: 6) 5′-TGCAGCATTGTTAGCAGGATTG-3′; and a first probe: an N gene probe 1: (SEQ ID NO: 7) 5′-GCCAGAAGCTGGACTTCCCTATGGTGC-3′; a second primer pair: an ORF1ab forward primer 1-2: (SEQ ID NO: 11) 5′-ATGGCCTCTTATTGTAACAGCT-3′; an ORF1ab reverse primer 1-2: (SEQ ID NO: 12) 5′-AGCAGTTTGTGTAGTACCGGCAGC-3′; and a second probe: an ORF1ab probe 1-2: (SEQ ID NO: 13) 5′-CCAATTCTGCTGTCAAATTACAGAATA-3′; and a third primer pair: an ORF1ab forward primer 2-2: (SEQ ID NO: 17) 5′-ATGAAAGTTTACGCCCTGAC-3′; an ORF1ab reverse primer 2-2: (SEQ ID NO: 18) 5′-CCGTGCCTACAGTACTCAGAATC-3′; and a third probe: an ORF1ab probe 2-2: (SEQ ID NO: 19) 5′-ATGTGCTCATGGATGGCTCTATTATTCAATT-3′.
8. The composition according to claim 1, the composition further comprises: TABLE-US-00028 a first primer pair: an N gene forward primer 1: (SEQ ID NO: 5) 5′-GGTATTTCTACTACCTAGGAACT-3′; an N gene reverse primer 1: (SEQ ID NO: 6) 5′-TGCAGCATTGTTAGCAGGATTG-3′; and a first probe: an N gene probe 1: (SEQ ID NO: 7) 5′-GCCAGAAGCTGGACTTCCCTATGGTGC-3′; a second primer pair: an ORF1ab forward primer 1-1: (SEQ ID NO: 8) 5′-ATTCACCTAATTTAGCATGGCCTC-3′; an ORF1ab reverse primer 1-1: (SEQ ID NO: 9) 5′-ACATCTGTCGTAGTGCAACAGGAC-3′; and a second probe: an ORF1ab probe 1-1: (SEQ ID NO: 10) 5′-TTGTAACAGCTTTAAGGGCCAATTCTGCTGT-3′; and a third primer pair: an ORF1ab forward primer 2-2: (SEQ ID NO: 17) 5′-ATGAAAGTTTACGCCCTGAC-3′; an ORF1ab reverse primer 2-2: (SEQ ID NO: 18) 5′-CCGTGCCTACAGTACTCAGAATC-3′; and a third probe: an ORF1ab probe 2-2: (SEQ ID NO: 19) 5′-ATGTGCTCATGGATGGCTCTATTATTCAATT-3′.
9. The composition according to claim 1, the composition further comprises: TABLE-US-00029 a first primer pair: an N gene forward primer 1: (SEQ ID NO: 5) 5′-GGTATTTCTACTACCTAGGAACT-3′; an N gene reverse primer 1: (SEQ ID NO: 6) 5′-TGCAGCATTGTTAGCAGGATTG-3′; and a first probe: an N gene probe 1: (SEQ ID NO: 7) 5′-GCCAGAAGCTGGACTTCCCTATGGTGC-3′; a second primer pair: an ORF1ab forward primer 1-2: (SEQ ID NO: 11) 5′-ATGGCCTCTTATTGTAACAGCT-3′; an ORF1ab reverse primer 1-2: (SEQ ID NO: 12) 5′-AGCAGTTTGTGTAGTACCGGCAGC-3′; and a second probe: an ORF1ab probe 1-2: (SEQ ID NO: 13) 5′-CCAATTCTGCTGTCAAATTACAGAATA-3′; and a third primer pair: an ORF1ab forward primer 2-1: (SEQ ID NO: 14) 5′-GAAGGTTCTGTTGCTTATGAAAGTT-3′; an ORF1ab reverse primer 2-1: (SEQ ID NO: 15) 5′-TACCACTCTAACAGAACCTTC-3′; and a third probe: an ORF1ab probe 2-1: (SEQ ID NO: 16) 5′-GCCCTGACACACGTTATGTGCTCATGGA-3′.
10. The composition according to claim 1, further comprising an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for monitoring.
11. The composition according to claim 1, further comprising an internal standard primer pair, used for specifically amplifying an area of an RNaseP gene as shown in SEQ ID NO: 4; and an internal standard probe, used for detecting an amplification product of the internal standard primer pair.
12. The composition according to claim 11, wherein the internal standard upstream primer is: 5′-GAGGTGGGACTTCAGCATGGC-3′ (SEQ ID NO: 20); the internal standard downstream primer is: 5′-TGTTTCTTTTCCTTAAAGTCAAC-3′ (SEQ ID NO: 21); and the internal standard probe is 5′-AGATTTGGACCTGCGAGCGGGTTCTGA-3′ (SEQ ID NO: 22).
13. The composition according to claim 1, wherein in the composition, the first probe, the second probe and the third probe carry fluorescent reporter groups that do not interfere with each other.
14. The composition according to claim 1, wherein a dosage of the primer in the composition is 25 nM-200 nM.
15. The composition according to claim 1, wherein a dosage of the probe in the composition is 10 nM-80 nM.
16. A kit for detecting SARS-CoV-2, comprising the composition of claim 1.
17. A method for detecting SARS-CoV-2, comprising the following steps: 1) extracting or releasing nucleic acids from a to-be-tested sample; 2) using the composition of claim 1 to perform fluorescent quantitative PCR on the nucleic acids obtained in step 1); and 3) obtaining and analyzing a result.
18. The method according to claim 17, wherein the sample is selected from a group consisting of a throat swab, sputum, a bronchoalveolar lavage fluid, and blood.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
DETAILED DESCRIPTION
[0090] In the present invention, the expressions “first”, “second”, “third” and “fourth” etc. are only used for descriptive purposes, to distinguish the defined substances, and not to define the order or priority in any way.
[0091] For a target area provided by the present invention (e.g., an area as shown in SEQ ID NO: 1, an area as shown in SEQ ID NO: 2, an area as shown in SEQ ID NO: 3, and/or an area as shown in SEQ ID NO: 4), specific amplification primers and corresponding detection probes can be designed. For example, it can be done in the following manner.
[0092] For the fluorescent quantitative PCR primers, the following principles are usually followed: 1. the primers should be designed in an area and have specificity; 2. the length of the amplification product is 80-150 bp, and the longest one should not exceed 300 bp; 3. the product cannot form a secondary structure (the free energy is less than 58.61 KJ/mol); 4. The primer length is generally between 17 bases and 25 bases, the upstream primer and the downstream primer should not differ too much; 5. the primer itself cannot have four consecutive bases of complementarity to avoid the formation of a hairpin structure; 6. the primers cannot have four consecutive bases of complementarity to avoid the formation of primer dimers; 7. the G+C content of the primers is between 40% and 60%, and 45% to 55% is the best, and the bases in the primers are randomly distributed, and evenly distributed to the greatest extent; and 8. the Tm value of the primers is between 58 degrees and 62 degrees.
[0093] According to the principles above, for the target area provided by the present invention, for example, the primers, including, but not limited to, the primers as shown in SEQ ID NO: 5 and SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:9, SEQ ID NO:11 and SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:15, SEQ ID NO:17 and SEQ ID NO:18, SEQ ID NO:20 and SEQ ID NO:21, SEQ ID NO:43 and SEQ ID NO:44 can be designed.
[0094] For the fluorescent quantitative PCR probes, the following principles are usually followed: 1. the probes are designed, and then the primers are designed to be close to the probes as far as possible; 2. the Tm value of the probes should be between 68 and 70, and in the case of visual probes, GC-rich areas are examined carefully; 3. a chain with more C than G is selected as the probe, and the content of G more than C may reduce the reaction efficiency; in this case, another paired chain should be selected as the probe; 4. the probe should be as short as possible, generally not more than 30 bp; and 5. the DNA folding and secondary structure of the probe is detected.
[0095] According to the principles above, for the target area provided by the present invention, for example, the primers, including, but not limited to, the primers as shown in SEQ ID NOs: 7, 10, 13, 16, 19, 22, and 45 can be designed.
[0096] Common primer and probe design software, such as Primer Express, Primer Premier, Oligo, and Omiga can be used, to assist in design. According to the specific amplification area provided by the present invention, those skilled in the art can use the software to assist in the design of probes and primers under the guidance of the above-mentioned principles.
[0097] Hereinafter, the present invention is described in detail with reference to specific embodiments and examples, and the advantages and various effects of the present invention may be more clearly presented therefrom. It should be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the present invention, instead of limiting the present invention.
Example 1. Primers and Probes Used in the Present Invention
[0098] The primers and probes used in the present invention are as shown below:
[0099] a first composition:
[0100] a first primer pair: an N gene forward primer 1 (SEQ ID NO: 5) and an N gene reverse primer 1 (SEQ ID NO: 6);
[0101] a first probe: an N gene probe 1 (SEQ ID NO: 7);
[0102] a second primer pair: an ORF1ab forward primer 1-1 (SEQ ID NO: 8) and an ORF1ab reverse primer 1-1 (SEQ ID NO: 9);
[0103] a second probe: an ORF1ab probe 1-1 (SEQ ID NO: 10); and
[0104] a third primer pair: an ORF1ab forward primer 2-1 (SEQ ID NO: 14) and an ORF1ab reverse primer 2-1 (SEQ ID NO: 15);
[0105] a third probe: an ORF1ab probe 2-1 (SEQ ID NO: 16).
[0106] a third composition:
[0107] a first primer pair: an N gene forward primer 1 (SEQ ID NO: 5) and an N gene reverse primer 1 (SEQ ID NO: 6);
[0108] a first probe: an N gene probe 1 (SEQ ID NO: 7);
[0109] a second primer pair: an ORF1ab forward primer 1-1 (SEQ ID NO: 8) and an ORF1ab reverse primer 1-1 (SEQ ID NO: 9);
[0110] a second probe: an ORF1ab probe 1-1 (SEQ ID NO: 10); and
[0111] a third primer pair: an ORF1ab forward primer 2-2 (SEQ ID NO: 17) and an ORF1ab reverse primer 2-2 (SEQ ID NO: 18);
[0112] a third probe: an ORF1ab probe 2-2 (SEQ ID NO: 19).
[0113] a fourth composition:
[0114] a first primer pair: an N gene forward primer 1 (SEQ ID NO: 5) and an N gene reverse primer 1 (SEQ ID NO: 6);
[0115] a first probe: an N gene probe 1 (SEQ ID NO: 7);
[0116] a second primer pair: an ORF1ab forward primer 1-2 (SEQ ID NO: 11) and an ORF1ab reverse primer 1-2 (SEQ ID NO: 12);
[0117] a second probe: an ORF1ab probe 1-2 (SEQ ID NO: 13); and
[0118] a third primer pair: an ORF1ab forward primer 2-1 (SEQ ID NO: 14) and an ORF1ab reverse primer 2-1 (SEQ ID NO: 15);
[0119] a third probe: an ORF1ab probe 2-1 (SEQ ID NO: 16).
[0120] Each composition further has an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe (SEQ ID NOs: 20-22).
[0121] Moreover, the fluorescent reporter group of the first probe is ROX, the fluorescent reporter groups of the second and third probes are FAM, and the fluorescent reporter group of the internal standard probe is HEX. The 3′ end of the probe also has a quenching group such as BHQ1 or BHQ2.
Example 2. Method for Detecting SARS-CoV-2
[0122] A sample for detection in the present invention is a throat swab, sputum, bronchoalveolar lavage fluid, or blood. The following operations are carried out:
[0123] (1) mixing a nucleic acid release agent S1014 of Sansure Biotech with a positive control at a ratio of 1:1, and lysing at room temperature for 10 minutes;
[0124] (2) according to the proportions of 26 μL of each reaction solution and 4 μL of mixed enzyme, taking a corresponding amounts of reaction solution and mixed enzyme, mixing well, and dispensing into each reaction tube at a volume of 30 μL per reaction; adding 20 μL of the lysed to-be-tested sample to each reaction tube, then covering with a PCR tube cap, instantaneously centrifuging, and placing it in a real-time fluorescent PCR instrument; and
[0125] (3) performing reaction and detection under the following cycle conditions (a FAM channel, an ROX channel and a HEX channel are selected for fluorescence acquisition):
TABLE-US-00015 qPCR procedure Number of Step Temperature Time cycles 1 Reverse transcription 60° C. 15 minutes 1 2 cDNA pre-denaturation 95° C. 1 minute 1 3 Denaturation 95° C. 15 seconds 45 Annealing, extension 60° C. 20 seconds and fluorescence acquisition 4 Instrument cooling 25° C. 10 seconds 1
[0126] After the reaction is completed, the results are automatically saved, and the amplification curves of the detection standard and the internal standard are analyzed respectively. The Start value, End value and Threshold value of Baseline are adjusted according to the image after analysis (a user can adjust it according to the actual situation, the Start value can be set between 3 and 15, and the End value can be set between 5 and 20, the amplification curve of the negative control is adjusted to be straight or below a threshold line), Analyze is clicked to analyze, so that the parameters meet the requirements in the following “Quality Control”, and then the qualitative results are recorded in a Plate window.
[0127] (4) Quality Control
[0128] SARS-CoV-2-PCR-negative control: the FAM, ROX and internal standard (HEX) channels have no Ct value or Ct>40;
[0129] SARS-CoV-2-PCR-positive control: the FAM, ROX and internal standard (HEX) channels all have Ct≤35.
[0130] The requirements above should all be met in the same experiment, otherwise, the experiment is invalid and needs to be repeated.
Example 3. Composition of the Present Invention for Detecting SARS-CoV-2
[0131] The preservation samples of novel coronavirus from the CDC of China are tested using the first composition in Example 1 of the present invention according to the method described in Example 2, and the experiment is repeated twice, and the results are as shown in
[0132] The preservation samples of the novel coronavirus from the CDC of China are tested using the first composition, the second composition, and the third composition in Example 1 of the present invention according to the method described in Example 2.
[0133] As can be seen from
Example 4. Comparison of the Detection Effects of the Composition of the Present Invention and a Single-Primer Probe Composition of ORF1ab
[0134] Eight cases of novel coronavirus samples with negative cotton throat swab samples stored in a preservation solution for more than one week and positive nucleic acid added as simulated interference samples are tested using the first composition described in Example 1 of the present invention, an ORF1ab single-primer probe composition 1 (excluding SEQ ID NOs: 14-16, the rest of the composition is consistent with the first composition), and an ORF1ab single-primer probe combination 2 (excluding SEQ ID NOs: 8-10, the rest of the composition is consistent with the first composition) according to the method described in Example 2. The test results are as shown in
[0135] As can be seen from
Example 5. Comparison of the Detection Effects of the Composition of the Present Invention and the Primer Probes of the CDC of China, the CDC of the United States, and the University of Hong Kong
[0136] Combined detection is performed on 5-10 copies/ml of the novel coronavirus sample (a virus culture solution) by using the first primer pair and the first probe (SEQ ID NOs: 5-7) in the composition described in Example 1 of the present invention, the primer probes (three sets) of the CDC of China and the CDC of the United States (because the CDC of the United States only provides the primers and probes of the N gene, this example can only compare the difference of the N gene) according to the method described in Example 2, and the detection is repeated 10 times. The detection results are as shown in
[0137] Combined detection is performed on 5-10 copies/ml of the novel coronavirus sample (the bronchoalveolar lavage fluid sample, the virus culture solution, the plasma sample) using the first primer pair and the first probe in the composition described in Example 1 of the present invention, and the primers and probes of the University of Hong Kong according to the method described in Example 2, and the detection is repeated 10 times. The detection results are as shown in
[0138] SARS-CoV-2 can be detected more accurately by using the composition of the present invention.
[0139] The specific sequences of various primers and probes used as comparisons in this example are given below:
TABLE-US-00016 China CDC SARS-CoV-2 N upstream primer: (SEQ ID NO: 23) 5′-GGGGAACTTCTCCTGCTAGAAT-3′; China CDCSARS-CoV-2 N downstream primer: (SEQ ID NO: 24) 5′-CAGACATTTTGCTCTCAAGCTG-3′; China CDCSARS-CoV-2 N probe: (SEQ ID NO: 25) 5′-TTGCTGCTGCTTGACAGATT-3′; US CDCSARS-CoV-2_N1 upstream primer: (SEQ ID NO: 26) 5′-GACCCCAAAATCAGCGAAAT-3′; US CDCSARS-CoV-2_N1 downstream primer: (SEQ ID NO: 27) 5′-TCTGGTTACTGCCAGTTGAATCTG-3′; US CDCSARS-CoV-2_N1 probe: (SEQ ID NO: 28) 5′-ACCCCGCATTACGTTTGGTGGACC-3′; US CDCSARS-CoV-2_N2 upstream primer: (SEQ ID NO: 29) 5′-TTACAAACATTGGCCGCAAA-3′; US CDCSARS-CoV-2_N2 downstream primer: (SEQ ID NO: 30) 5′-GCGCGACATTCCGAAGAA-3′; US CDCSARS-CoV-2_N2 probe: (SEQ ID NO: 31) 5′-ACAATTTGCCCCCAGCGCTTCAG-3′; US CDCSARS-CoV-2_N3 upstream primer: (SEO ID NO: 32) 5′-GGGAGCCTTGAATACACCAAAA-3′; US CDCSARS-CoV-2_N3 downstream primer: (SEQ ID NO: 33) 5′-TGTAGCACGATTGCAGCATTG-3′; US CDCSARS-CoV-2_N3 probe: (SEQ ID NO: 34) 5′-AYCACATTGGCACCCGCAATCCTG-3′; HKU-N upstream primer: (SEQ ID NO: 35) 5′-TAATCAGACAAGGAACTGATTA-3′; HKU-N downstream primer: (SEQ ID NO: 36) 5′-CGAAGGTGTGACTTCCATG-3′; HKU-N probe: (SEQ ID NO: 37) 5′-FAM-GCAAATTGTGCAATTTGCGG-TAMRA-3′.
Example 6. Anti-Interference Test of the Composition of the Present Invention
[0140] The novel coronavirus samples with interfering substances are verified using the first composition (SEQ ID NOs: 5-10, 14-16, and 20-22) in Example 1 of the present invention according to the method described in Example 2.
[0141] Upon test and verification, the interfering substances do not significantly interfere with the test results of the kit. The experimental results are as shown in Table 1, and no interference occurs in the three repeated experiments.
TABLE-US-00017 TABLE 1 Result (three Result (three Interfering repeated Interfering repeated substances Concentration experiments) substances Concentration experiments) Purified mucin 20 pg/mL 0/3 Dexamethasone 50 μg/mL 0/3 Human whole 5% (v/v) 0/3 Cefmenoxime 50 μg/mL 0/3 blood hydrochloride Oxymetazoline 100 μg/mL 0/3 Oseltamivir 100 μg/mL 0/3 hydrochloride Beclomethasone 50 μg/mL 0/3 Zanamivir 100 μg/mL 0/3 Ribavirin 100 μg/mL 0/3 Azithromycin 100 μg/mL 0/3 Fluticasone 200 μg/mL 0/3 Budesonide 320 μg/mL 0/3 α-interferon 300 μg/mL 0/3 Phenylephrine 125 μg/mL 0/3 Mometasone 100 μg/mL 0/3 Tobramycin 100 μg/mL 0/3 Ritonavir 100 μg/mL 0/3 Flunisolide 100 μg/mL 0/3 Histamine 200 μg/mL 0/3 Peramivir 100 μg/mL 0/3 hydrochloride Lopinavir 100 μg/mL 0/3 Mupirocin 100 μg/mL 0/3 Triamcinolone 100 μg/mL 0/3 Anhydrous 20% (v/v) 0/3 acetonide ethanol Abidore 100 μg/mL 0/3 Sodium 60 μg/mL 0/3 chloride Urea 100 μg/mL 0/3 Heme 10 μg/mL 0/3
Example 7. Specificity Verification of the Composition of the Present Invention
[0142] The first composition (SEQ ID NOs: 5-10, 14-16, and 20-22) of the present invention does not cross-react with the positive samples such as coronaviruses (NL63, HKU1, 229E, OC43), SARS coronavirus, MERS coronavirus, influenza A virus, influenza B Yamagata, Victoria, influenza A H1N1, influenza A H3N2, influenza A H5N1, influenza A H7N9, respiratory syncytial virus types A and B, rhinovirus types A, B and C, adenovirus types 1, 2, 3, 4, 5, 7 and 55, parainfluenza virus types 1, 2, and 3, enterovirus types A and B, enterovirus C (EV-C95), enterovirus D (EV-D70), metapneumovirus, human metapneumovirus, Cryptococcus neoformans, Streptococcus pyogenes, Acinetobacter baumannii, Pneumocystis, Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Legionella pneumophila, Bacillus pertussis, Staphylococcus aureus, Mycoplasma pneumoniae, Streptococcus pneumoniae, Klebsiella pneumoniae, Chlamydia pneumoniae, Epstein-Barr virus, human cytomegalovirus, Aspergillus fumigatus, Candida albicans, Candida glabrata, Mycobacterium tuberculosis, nontuberculous Mycobacterium, norovirus, rotavirus, aquatic sore virus, measles virus, mumps virus, and human genome DNA.
[0143] The test results for some specific examples are listed in Table 2 below.
TABLE-US-00018 TABLE 2 Ct value Source/sample (ORF1ab Positive samples Strain type Concentration gene/N gene) Human coronavirus 229E Clinical 1.0 × 10.sup.6 copies/ml Not detected/not 229E sample detected Human coronavirus OC43 Clinical 1.0 × 10.sup.6 copies/ml Not detected/not OC43 sample detected Human coronavirus HKU1 Clinical 1.0 × 10.sup.6 copies/ml Not detected/not HKU1 sample detected Human coronavirus NL63 Clinical 1.0 × 10.sup.6 copies/ml Not detected/not NL63 sample detected SARS-coronavirus RNA 1.0 × 10.sup.6 copies/ml Not detected/not detected MERS-coronavirus Pseudovirus 1.0 × 10.sup.6 copies/ml Not detected/not detected Adenovirus 1 Clinical 1.0 × 10.sup.6 copies/ml Not detected/not sample detected Human Clinical 1.0 × 10.sup.6 copies/ml Not detected/not Metapneumovirus sample detected (hMPV) Parainfluenza Clinical 1.0 × 10.sup.6 copies/ml Not detected/not vims 1-4 sample detected Influenza A National 1.0 × 10.sup.6 TCID50/L Not detected/not standard detected Influenza B Clinical 1.0 × 10.sup.6 copies/ml Not detected/not sample detected Enterovirus (EV- Clinical 1.0 × 10.sup.6 copies/ml Not detected/not C95) sample detected Respiratory Clinical 1.0 × 10.sup.6 copies/ml Not detected/not syncytial virus sample detected Rhinovirus Clinical 1.0 × 10.sup.6 copies/ml Not detected/not sample detected Chlamydia Clinical 1.0 × 10.sup.6 copies/ml Not detected/not pneumonia sample detected Haemophilus National 1.0 × 10.sup.6 CFU/ml Not detected/not influenzae standard detected Legionella National 1.0 × 10.sup.6 CFU/ml Not detected/not pneumophila standard detected Mycobacterium Clinical 1.0 × 10.sup.6 copies/ml Not detected/not tuberculosis sample detected Streptococus National 1.0 × 10.sup.6 CFU/ml Not detected/not pneumonia standard detected Streptococcus Clinical 1.0 × 10.sup.6 copies/ml Not detected/not pyogenes sample detected Bordetella pertussis Clinical 1.0 × 10.sup.6 copies/ml Not detected/not sample detected Mycoplasma Clinical 1.0 × 10.sup.6 copies/ml Not detected/not pneumoniae sample detected Pneumocystis Clinical 1.0 × 10.sup.6 copies/ml Not detected/not jirovecii (PJP) sample detected
Example 8. Precision Verification of the Composition of the Present Invention
[0144] In this experiment, SARS-CoV-2 positive samples are diluted to medium concentration positive and critical concentration positive, and SARS-CoV-2 negative samples are added as to-be-tested samples for intra-batch imprecision determination.
[0145] For each precision sample, one experimental batch is analyzed per day, and each precision sample is repeated five times for five consecutive days. A qualified novel coronavirus detection kit (including the first composition of the present invention (SEQ ID NOs: 5-10, 14-16 and 20-22)) is used for detection on the same SLAN 96P instrument, the positive detection rate and negative detection rate are analyzed, and the precision performance of the kit are investigated. The results are as shown in Table 3 below. The results show that the detection results of the composition of the present invention are consistent in each batch, reflecting good precision.
TABLE-US-00019 TABLE 3 Statistics of Ct values of reagent intra-batch imprecision test results Medium Critical concentration concentration Number Serial positive positive Negative of days number ORF1ab N ORF1ab N ORF1ab N Day 1 1 26.30 25.48 32.03 32.03 No Ct No Ct 2 26.31 25.45 32.04 32.32 No Ct No Ct 3 26.29 25.51 31.79 32.37 No Ct No Ct 4 26.31 25.47 32.18 32.06 No Ct No Ct 5 26.31 25.54 31.88 32.28 No Ct No Ct Day 2 6 26.40 25.58 31.53 32.42 No Ct No Ct 7 26.34 25.54 31.85 32.40 No Ct No Ct 8 26.36 25.65 31.73 32.29 No Ct No Ct 9 26.31 25.53 32.23 32.22 No Ct No Ct 10 26.30 25.54 32.06 32.14 No Ct No Ct Day 3 11 26.37 25.39 31.88 32.24 No Ct No Ct 12 26.36 25.48 32.22 32.20 No Ct No Ct 13 26.29 25.47 32.24 32.30 No Ct No Ct 14 26.28 25.50 32.07 32.10 No Ct No Ct 15 26.33 25.43 32.27 32.03 No Ct No Ct Day 4 16 25.14 25.40 31.99 32.19 No Ct No Ct 17 25.16 25.41 32.17 32.10 No Ct No Ct 18 25.15 25.51 31.76 32.87 No Ct No Ct 19 25.17 25.44 32.03 32.39 No Ct No Ct 20 25.18 25.41 32.52 32.91 No Ct No Ct Day 5 21 25.16 25.39 32.10 32.21 No Ct No Ct 22 25.14 25.48 32.03 32.01 No Ct No Ct 23 25.13 25.45 31.85 31.92 No Ct No Ct 24 25.13 25.41 31.97 32.26 No Ct No Ct 25 25.17 25.45 32.06 32.67 No Ct No Ct Positive 100% 100% 100% 100% 0% 0% detection rate
Example 9. Detection of Comparative Example Composition of the ORF1ab Gene of the Present Invention
[0146] To further demonstrate the advantages of the specific areas mentioned in the present invention, the inventors use anther specific area on the ORF1ab gene:
[0147] ATAAAGAAATGTATCTAAAGTTGCGTAGTGATGTGCTATTACCTCTTACGCAAT ATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCAATGGATAC AACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCA GTAACTCAGGTTCTGATGTTCTTTA (SEQ ID NO: 38), and on this basis, the primer and the probe are designed, and the specific sequence thereof is as shown below:
TABLE-US-00020 an ORF1ab forward primer 3: (SEQ ID NO: 39) 5′-ATGTATCTAAAGTTGCGTAG-3′; an ORF1ab reverse primer 3: (SEQ ID NO 40) 5′-GTTACTGAAGTCATTGAGAGCCT-3′; an ORF1ab probe 3: (SEQ ID NO: 41) 5′-ATGTGCTATTACCTCTTACGCAATATAAT-3′
[0148] First, the inventors verify the detection efficiency of primers and probes using one ORF1ab gene detection alone.
[0149] The ORF1ab gene is detected by respectively using combinations of three primers and probes: 1. an ORF1ab forward primer 1-1, an ORF1ab reverse primer 1-1, and an ORF1ab probe 1-1; 2. an ORF1ab forward primer 2-1, an ORF1ab reverse primer 2-1, and an ORF1ab probe 2-1; and 3. an ORF1ab forward primer 3, an ORF1ab reverse primer 3, and an ORF1ab probe 3, and the results are as shown in
[0150] SEQ ID NOs: 39-41 (the ORF1ab forward primer 3, the ORF1ab reverse primer 3, and the ORF1ab probe 3) are combined with SEQ ID NOs: 8-10 mentioned in Example 1 of the present invention to form a fifth composition. SEQ ID NOs: 39-41 (the ORF1ab forward primer 3, the ORF1ab reverse primer 3, and the ORF1ab probe 3) are combined with SEQ ID NOs: 14-16 mentioned in the example of the present invention to form a sixth composition.
[0151] The fifth composition and the sixth composition respectively implement detection according to the method in Example 2, and the detection results of the FAM channel are as shown in
Example 10. Detection of Comparative Example Composition of the N Gene of the Present Invention
[0152] To further demonstrate the advantages of the specific areas mentioned in the present invention, the inventors first design an N gene primer probe combination 2 for the above-mentioned specific area of the N gene (SEQ ID NO: 3), and the specific sequence thereof is as shown below:
TABLE-US-00021 an N gene forward primer 2: (SEQ ID NO: 43) 5′-ACTACCTAGGAACTGGGCCAG-3′; an N gene reverse primer 2: (SEQ ID NO: 44) 5′-AGCAGGATTGCGGGTGCCAAT-3′; and an N gene probe 2: (SEQ ID NO: 45) 5′-ACTTCCCTATGGTGCTAACAAAGACGGCAT-3′.
[0153] Secondly, the inventors find another specific area on the N gene:
[0154] TGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACT AAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTA AAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAG GAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCC GCA (SEQ ID NO: 42), and on this basis, an N gene primer probe combination 3 is designed, and the specific sequence thereof is as shown below:
TABLE-US-00022 an N gene forward primer 3: (SEQ ID NO: 46) 5′-ATGTCTGGTAAAGGCCAACAAC-3′; an N gene reverse primer 3: (SEQ ID NO: 47) 5′-AGTTCCTTGTCTGATTAGTTC-3′; and an N gene probe 3: (SEQ ID NO: 48) 5′-ACTGTCACTAAGAAATCTGCTGCTGAGGC-3′.
[0155] First, the inventors verify the detection efficiency of the primer probe combination using one N gene detection alone.
[0156] The N gene is detected by respectively using combinations of three primers and probes: 1. an N gene forward primer 1, an N gene reverse primer 1, and an N gene probe 1; 2. an N gene forward primer 2, an N gene reverse primer 2, and an N gene probe 2; and 3. an N gene forward primer 3, an N gene reverse primer 3, and an N gene probe 3, and the results are as shown in
[0157] The N gene primer probe combination 2 is combined with SEQ ID NOs: 8-10 and SEQ ID NOs: 14-16 mentioned in Example 1 of the present invention to form a seventh composition. The N gene primer probe combination 3 is combined with SEQ ID NOs: 8-10 and SEQ ID NOs: 14-16 mentioned in the example of the present invention to form an eighth composition.
[0158] The seventh composition and the eighth composition respectively implement detection according to the method in Example 2, and the detection results of the ROX channel are as shown in