A Theranostic Probe and its Use for Targeting and/or Labeling the EGFR Kinase and/or the Cells Expressing EGFR or its Family Members
20230085980 · 2023-03-23
Inventors
- Lizhi Mi (Nankai District, Tianjin, CN)
- Xingxing Wang (Nankai District, Tianjin, CN)
- Peng Liu (Nankai District, Tianjin, CN)
- Xiaohong Qin (Nankai District, Tianjin, CN)
- Zhiqun Shang (Nankai District, Tianjin, CN)
Cpc classification
International classification
Abstract
The present application is directed to a theranostic probe and its use for targeting and/or labeling the EGFR kinase and/or the cells expressing EGFR or its family members.
Claims
1. A theranostic probe represented by formula (1):
Module 2-L-Module 1 (1) wherein L is a linker; Module 1 is a moiety targeting the EGFR kinase; and Module 2 is an imaging probe selected from the group consisting of fluorescent, MM and radioactive probes; or a theranostically acceptable salt thereof.
2. The theranostic probe of claim 1, wherein L is —C(O)O— or —C(O)NH—.
3. The theranostic probe of claim 1, wherein Module 1 is an inhibitor against the EGFR kinase.
4. The theranostic probe of claim 1, wherein Module 1 is represented by formula (2): ##STR00025## wherein R.sub.1 in formula (2) is H, halogen or C.sub.2-6alkynyl; R.sub.2 in formula (2) is H, halogen, C.sub.6-10arylC.sub.1-6 alkyloxy or 5- to 6-membered heteroarylC.sub.1-6alkyloxy, wherein the C.sub.6-10aryl and 5- to 6-membered heteroaryl are optionally substituted with halogen, and the 5- to 6-membered heteroaryl comprises 1, 2, 3 or 4 heteroatoms selected from the group consisting of O, S and N; R.sub.3 in formula (2) is H, C.sub.1-6alkyloxy optionally substituted with C.sub.1-6alkyloxy, or 5- to 6-membered heterocycloalkyloxy, wherein the 5- to 6-membered heterocycloalkyl comprises 1 or 2 heteroatoms selected from the group consisting of O, S and N; R.sub.4 in formula (2), as the attachment point of Module 1 to L, is —(CH.sub.2).sub.n—; and n in formula (2) is 0, 1, 2, 3, 4, 5 or 6.
5. The theranostic probe of claim 1, wherein Module 2 is represented by formula (3) or (4): ##STR00026## wherein R.sub.1 in formula (3) or (4), as the attachment point of Module 2 to L, is —(CH.sub.2).sub.n—; R.sub.2 in formula (3) or (4) is —(CH.sub.2).sub.nCH.sub.3; and n in formula (3) or (4), at each occurrence, is independently 0, 1, 2, 3, 4, 5 or 6; or Module 2 is represented by formula (5) or (6): ##STR00027## wherein the symbol * in formula (5) or (6) represents the attachment point of Module 2 to L; and n in formula (5) is independently 0, 1, 2, 3, 4, 5 or 6, wherein if necessary, a counterion is present and selected from the group consisting of alkali metal and alkaline earth metal ions.
6. The theranostic probe of claim 1, represented by formula (7): ##STR00028## wherein if necessary, a counterion is present and selected from the group consisting of alkali metal and alkaline earth metal ions.
7. The theranostic probe of claim 1, wherein the EGFR kinase has a mutation of L834R, V924R, V745M or combination of any two or three of L834R, V924R and V745M.
8. The theranostic probe of claim 1, wherein the EGFR kinase is present in a dimeric conformation.
9. The theranostic probe of claim 1, wherein the conformation of the EGFR kinase is associated with oncogenesis, preferably prostate cancer, and more preferably metastatic and/or castration-resistant prostate cancer.
10. A use of the theranostic probe of claim 1 for targeting and/or labeling the EGFR kinase and/or the cells expressing EGFR or its family members.
11. The use of claim 10, wherein the EGFR kinase has a mutation of L834R, V924R, V745M or combination of any two or three of L834R, V924R and V745M.
12. The use of claim 10, wherein the EGFR kinase is present in a dimeric conformation.
13. The use of claim 10, wherein the EGFR kinase is associated with oncogenesis, preferably prostate cancer, and more preferably metastatic and/or castration-resistant prostate cancer.
14. A use of the theranostic probe of claim 1 for stratification of a patient suffering from a cancer expressing EGFR.
15. The use of claim 14, wherein the cancer is prostate cancer, and more preferably metastatic and/or castration-resistant prostate cancer.
16. The use of claim 14, wherein the EGFR has a mutation of V745M.
17. The use of claim 14, wherein the EGFR is present in a dimeric conformation.
18. The use of claim 14, wherein the EGFR is present in a dimeric conformation formed from the EGFR having a mutation of V745M.
19. The use of claim 14, wherein the stratification is conducted by the following steps: mixing a sample from the patient with the theranostic probe; and determining the binding level therebetween.
20. The use of claim 19, wherein the sample is body fluid or biopsy tissue.
21.-26. (canceled)
Description
SUMMARY OF THE FIGURES
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
EXAMPLES
Example 1. Preparation of the Probes
General Procedures
[0113] .sup.1H NMR spectra were recorded on Bruker AVIII 400.
[0114] LCMS measurement was run on Agilent 1200 HPLC/6100 SQ System using the follow condition: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
##STR00005## ##STR00006## ##STR00007## ##STR00008## ##STR00009## ##STR00010##
[0115] In the following syntheses, a counterion, if necessary, is present and is a sodium ion, unless indicated otherwise.
1. Synthesis of Synthesis of Compound a-1
[0116] ##STR00011##
[0117] a-01 (5.0 g, 26.56 mmol) was dissolved in AcOH (30 mL), and 3-methylbutan-2-one (4.58 g, 53.13 mmol) was added. The mixture was heated to reflux for 5 hours. And then the solution was cooled to room temperature. Then a saturated solution of CH.sub.3COOK in 2-propanol was added, solid was observed at this process, and filtered to obtain a-1 5.5 g (74%) as a yellow solid.
[0118] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0119] LC/MS m/z 240.0 [M+H].sup.+. RT=1.17 min.
2. Synthesis of Compound a-2
[0120] ##STR00012##
[0121] 2.2 g of 2,3,3-trimethylindoleninium-5-sulfonate (a-1) were suspended in 30 mL of methyl iodide. The reaction mixture was heated to boiling for 25 hours in a sealed tube. After the mixture was cooled, excess methyl iodide was decanted, and the residue was suspended in 50 mL of acetone. The solution was filtered to obtain a-2 2.48 g (98% purity) as a pink solid.
[0122] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0123] LC/MS m/z 254.0 [M+H].sup.+. RT=1.34 min.
3. Synthesis of Compound a-3
[0124] ##STR00013##
[0125] a-1 (2.77 g, 10 mmol) and 6-bromo-n-hexanoic acid (2.34 g, 12 mmol) were dissolved in sulfolane (2.5 mL), and heated at 130° C. for 3 hours. The reaction mixture was allowed to cool to ambient temperature, then DCM was added to the residue, and the resulting solid was filtered and dried under reduced pressure to obtain a pink solid.
[0126] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0127] LC/MS m/z 353.0 [M+H].sup.+. RT=1.19 min.
4. Synthesis of Compound a-4
[0128] ##STR00014##
[0129] 3-CD (25.77 g, 21.48 mmol) was dissolved in H.sub.2O (200 mL) under warm condition till clear solution obtained, then it was allowed to cool to room temperature. To this clear solution, amine (20.0 g, 214.75 mmol) was added dropwise with stirring followed by dropwise addition of triethylorthoformate (15.91 g, 107.38 mmol), and the reaction was allowed to stir at room temperature overnight. After completion of the reaction (monitored by TLC), the reaction mass was extracted with ethyl acetate. The combined organic layer on evaporation leads to crude product which further purified by simple recrystallization in hexane-ethyl acetate giving pure products a-4 as a white solid.
[0130] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0131] LC/MS m/z 196.0 [M+H].sup.+. RT=1.83 min.
5. Synthesis of Compound Compound A
[0132] ##STR00015##
[0133] A solution of a-3 (2.95 g, 7.52 mmol) and a-4 (1.77 g, 9.03 mmol) in acetic acid (4.5 mL) and acetic anhydride (4.5 mL) was heated at 120° C. for 4 hours. The completion of the reaction was monitored by absorption spectra in methanol. Then added a-2 (2.2 g, 7.52 mmol) and more acetic anhydride (4.5 mL) and pyridine (4.5 mL). The mixture is heated for 30 min until the anyl intermediate disappears (monitored by absorption spectra). The reaction mixture was cooled and poured into ethyl acetate (50 mL). The crude product is collected by centrifugation and washed with ethyl acetate twice. Preparative HPLC purification gives Compound A (260 mg) as a dark purple solid.
[0134] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0135] LC/MS m/z 617.0 [M+H].sup.+. RT=1.15 min.
[0136] .sup.1H NMR (400 MHz, D.sub.2O) δ 8.43-8.36 (t, J=26.8 Hz, 1H), 7.77-7.76 (d, J=1.6 Hz, 2H), 7.71-7.68 (m, J=12 Hz, 2H), 7.24-7.19 (m, J=20.8 Hz, 2H), 6.27-6.20 (m, J=29.6 Hz, 2H), 3.97-3.93 (t, J=14.4 Hz, 2H), 3.54-3.47 (d, J=28 Hz, 3H), 2.08-2.05 (t, J=14.8 Hz, 2H), 1.72-1.66 (m, J=22.4 Hz, 2H), 1.61 (s, 12H), 1.53-1.46 (t, J=29.6 Hz, 2H), 1.33-1.28 (m, J=23.6 Hz, 2H).
6. Synthesis of Compound e-1
[0137] ##STR00016##
[0138] To a solution of e-01 (2 g, 9.5 mmol) in 2-propanol was added 3-bromoaniline (1 mL, 9.5 mmol) and the resulting mixture was allowed to stir at room temperature overnight under argon. The precipitate that formed was filtered and washed with water and ether, after which it was dried under vacuum to give 6-nitro-4-(3-bromophenylamino)quinazoline (e-1) (72%) as a yellow solid.
[0139] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0140] LC/MS m/z 344.0 [M+H].sup.+. RT=1.90 min.
7. Synthesis of Compound e-2
[0141] ##STR00017##
[0142] To a solution of the isolated e-1 (1.0 g, 2.80 mmol) in aqueous ethanol (1:2, 58 mL) and acetic acid (2.8 mL) was added Fe (1.95 g. 34.77 mmol), and the resulting cloudy mixture was kept under reflux for 1 hour. The reaction was cooled to room temperature, alkalinized with concentrated ammonia, and extracted by DCM. The organic layer was dried by Na.sub.2SO.sub.4 and concentrated under reduced pressure to obtain the target compound e-2 as a yellow solid.
[0143] LCMS: Mobile Phase: A: Water (0.1% TFA) B: ACN (0.1% TFA) Gradient: 5% B increase to 95% B within 1.5 min. Flow Rate: 1.5 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0144] LC/MS m/z 316.0 [M+H].sup.+. RT=1.00 min.
8. Synthesis of Compound e-3
[0145] ##STR00018##
[0146] A mixture of 4-amino-1-butanol (SM-1) (5 g, 56.09 mmol) and phthalic anhydride (8.30 g, 56.09 mmol) in toluene (150 mL) was heated to reflux under Dean-Stark conditions for 3 h. After cooling, removal of solvent in vacuo produced the crude product which was purified by flash column chromatography eluting with PE/EA providing a colorless oil, which upon standing became a colorless crystalline solid 12.4 g (97%).
[0147] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0148] LC/MS m/z 219.0 [M+H].sup.+. RT=1.52 min.
9. Synthesis of Compound e-4
[0149] ##STR00019##
[0150] A solution of dimethyl sulfoxide (6.45 ml, 22.81 mmol) in dichloromethane was added dropwise to a solution of oxalyl chloride (5.79 g, 45.61 mmol) in dichloromethane at −78° C., followed by adding dropwise thereto a solution of 2-(4-hydroxybutyl)-1H-isoindole-1,3(2H)-dione (e-3) (5.0 g, 22.81 mmol) in dichloromethane.
[0151] After stirring for 20 minutes, a solution of triethylamine (9.23 g, 91.22 mmol) in dichloromethane was added thereto and the reaction temperature was raised to 0° C., followed by stirring for another 30 minutes. After completion of the reaction, a saturated aqueous sodium chloride solution was added thereto, followed by extraction with ethyl acetate. The organic layer was washed with water and a saturated aqueous sodium chloride solution and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound (6.0 g, 82% purity).
[0152] LCMS: Mobile Phase: A: Water (0.1% TFA) B: ACN (0.1% TFA) Gradient: 5% B increase to 95% B within 1.5 min. Flow Rate: 1.5 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0153] LC/MS m/z 217.0 [M+H].sup.+. RT=1.05 min.
10. Synthesis of Compound e-5
[0154] ##STR00020##
[0155] 4-Phthalimidobutanal (1.0 g, 4.60 mmol) was dissolved in CH2Cl2 (10 mL) and treated with methyl (triphenylphosphoranylidene)-acetate (1.53 g, 4.60 mmol) in CH2Cl2 (10 mL). After 1 h, the mixture was concentrated, poured onto a silica gel column, packed in and eluted with PE/EA, and obtained the product as a white solid (79%).
11. Synthesis of Compound e-6
[0156] ##STR00021##
[0157] A solution of e-5 (0.9 g, 3.29 mmol) and 4 N HCl (10 mL) solution in dioxane was refluxed for 4 h. The solution was cooled to RT and the solvent was removed. The residue was submitted to column chromatography (SiO.sub.2, DCM to EtOAc) to afford the title compound as a white solid.
12. Synthesis of Compound e-7
[0158] ##STR00022##
[0159] e-2 (1.0 g, 3.17 mmol), e-1 (0.55 g, 2.11 mmol) and HATU (0.63 g, 1.66 mmol) were dissolved in DCM (10 mL) and DMF (1 mL). Then added N-ethyl diisopropylamine (0.041 mg, 3.17 mmol), and the mixture was stirred at room temperature for 2 hours. Then extracted by DCM, the organic layer was dried by Na.sub.2SO.sub.4 and concentrated to get the crude product and purified by silica gel column (eluent: DCM/MeOH).
[0160] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0161] LC/MS m/z 557.0 [M+H].sup.+. RT=1.88 min.
13. Synthesis of Compound E
[0162] ##STR00023##
[0163] e-7 (1.4 g, 2.52 mmol) was dissolved in EtOH (60 mL) and CHCl3 (20 mL), and the mixture was heated to 80° C. NH2NH2.H2O (0.7 mL) was added to the solution, and the mixture was heated at 80° C. for 1 hour. Then it was allowed to cool to room temperature, and the precipates was removed by filtration and washed by EtOH. The filtrate was concentrated to get the crude product. Preparative HPLC purification gives Compound E (600 mg) as a yellow solid.
[0164] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0165] LC/MS m/z 425.0 [M+H].sup.+. RT=1.60 min.
14. Synthesis of PDCy3 (Compound 2)
[0166] ##STR00024##
[0167] Compound A (50 mg, 0.081 mmol), compound E (51 mg, 0.12 mmol) and HATU (33 mg, 0.088 mmol) were dissolved in DCM (2 mL). Then added N-ethyl diisopropylamine (20.9 mg, 0.16 mmol), and the mixture was stirred at room temperature for 2 hours. Then purified by Pre-HPLC to get compound 2 (40 mg) as a pink solid.
[0168] LCMS: Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: MeCN. Gradient: 5% B increase to 95% B within 1.3 min. Flow Rate: 1.8 mL/min. The column used for the chromatography is a 4.6×50 mm XBridge C18 column (3.5 μm particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive/negative electrospray ionization.
[0169] Compound 2:
1-(6-((E)-6-(4-(3-bromophenylamino)quinazolin-6-ylamino)-6-oxohex-4-enylamino)-6-oxohexyl)-3,3-dimethyl-2-((1E,3E)-3-(1,3,3-trimethyl-5-sulfonatoindolin-2-ylidene)prop-1-enyl)-3H-indolium-5-sulfonate
[0170]
C.sub.50H.sub.53BrN.sub.7O.sub.8S2 Chemical Formula:
[0171] MW: 1024.03/mol
[0172] Appearance: Pink solid
[0173] LC/MS m/z 1024.0 [M+H].sup.+, [M+H].sup.+/2. RT=1.46 min.
[0174] .sup.1H NMR (400 MHz, DMSO) δ 10.37 (s, 1H), 8.83 (d, 1H), 8.68 (s, 1H), 8.33 (t, 1H), 8.13 (s, 1H), 8.02-8.01 (s, J=2 Hz, 1H), 7.80-7.99 (d, J=2 Hz, 1H), 7.82-7.79 (m, J=11.2 Hz, 4H), 7.72-7.66 (m, J=21.6 Hz, 2H), 7.44-7.37 (m, J=28 Hz, 4H), 7.22 (s, 1H), 7.09 (s, 1H), 7.96 (s, 1H), 6.51-6.46 (d, J=17.6 Hz, 2H), 4.30 (s, 1H), 4.12 (s, 2H), 3.65-3.63 (d, J=7.6 Hz, 3H), 2.75-2.71 (t, J=17.6 Hz, 1H), 2.33 (s, 1H), 2.21-2.15 (m, J=24.4 Hz, 2H), 1.90-1.85 (m, J=21.2 Hz, 2H), 1.75-1.73 (d, J=8 Hz, 2H), 1.68 (s, 12H), 1.67-1.65 (d, J=10 Hz, 1H), 1.5 (s, 2H).
Example 2. Biological Assays
[0175] Materials and Methods
[0176] Materials. The plasmids encoding human EGFR (1-988) and split YFP fragments were obtained from Addgene (#11011, #27097, and #22010) as gifts from Dr. Timothy A. Springer and Dr. Chang-Deng Hu. Gefitinib from MedChem Express (NJ, USA) and recombinant human EGF from Sino Biological Inc (China) were reconstituted and stored as recommended by the manufactures. Restriction enzymes and Gibson assembly kit were purchased from NEB (MA, USA); DNA polymerase was from Vazyme (China); anti-protein C antibody was from Genscript (China); and anti-phoshotyrosine antibody 4G10 was from Merck Millipore (USA).
[0177] The synthesis of PDCy3. The details for the synthesis of PDCy3 were described in the supplementary methods. The synthesized material was characterized by 1H NMR spectra recorded on Bruker AVIII 400 and LCMS measurement running on Agilent 1200 HPLC/6100 SQ System. For LCMS experiment, the mobile phase A was water (10 mM NH.sub.4HCO.sub.3), and mobile phase B was MeCN. The material was eluted from a 4.6×50 mm XBridge C18 column (3.5 μm particles) by a linear gradient of 5% B to 95% B within 1.3 minutes. The flow rate was 1.8 mL/min. Detection methods were diode array (DAD), evaporative light scattering (ELSD), and positive/negative electrospray ionization.
[0178] Inhibition of the EGF receptor kinase activity. HEK 293T cells cultured in 24-well plates were transfected as described. Transfected cells were starved in EX-Cell 293 Serum-Free Medium (SIGMA) supplemented with 6 mM Glutamine for 44 hours before treatment with EGF, inhibitor, or the probe. Treated cells were lysed by mixing with 40 μl/well lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1% TritonX-100, 1% sodium deoxycholate, 0.1% SDS, 10 mM EDTA, 1 mM Na.sub.3VO.sub.4, 2 mM PMSF). The lysates were then cleared by centrifugation at 13,200 g for 20 min. The supernatants were mixed with 6×SDS sample buffer, and were subjected to SDS-PAGE and Western blotting analysis. The expression and phosphorylation levels of EGFR were detected by 4G10 and anti-Protein C antibodies, respectively, in western blotting.
[0179] Cell sorting. Following starvation in EX-Cell 293 Serum-Free Medium for 44 hours, transfected cells were treated with gefitinib, PDCy3, or EGF for 4 hours at 37° C. Then, the cells were washed twice with 500 μl/well ice-cold PBS, and were re-suspended in 400 μl/well PBS. The final cell density was estimated to be 5×10.sup.5˜1×10.sup.6 cells/ml. To detect EGFR expression, 3 μl anti-EGFR 528 antibody (santa cruz biotechnology inc, USA) at 200 μg/ml concentration was added to each well of re-suspended cells. After 30-minute incubation on ice, cells were washed twice with 500 μl/well PBS, and were re-suspended in 400 μl PBS. Then, 0.3 μl FITC-labelled secondary antibody at a concentration of 2 mg/ml was added to each sample. After incubation on ice for 30 minutes, cells were washed three times with PBS, re-suspended in 400 μl/well PBS, and analyzed by flowcytometry using a BD FACS Calibur machine.
[0180] Protein complementary assay. For protein complementary assay, we designed two complementary constructs: one encoding human EGFR(1-998) fused with a split YFP-N(1-172) fragment, and the other encoding hEGFR(1-998) linked to a split YFP-C(155-238) fragment. Kinase mutations were introduced on both constructs to make a complementary pair. All the constructs were verified by sequencing. The paired constructs encoding the same receptor were co-transfected into HEK 293T cells. Transfected cells were starved in EX-Cell 293 Serum-Free Medium for 44 hours before treatment with 1 μM PDCy3 for additional 4 hours. The dimerization of the EGF receptors and the binding of dimerized receptors to PDCy3 were analyzed by flowcytometry.
[0181] Results
[0182] The Fluorescent Probe could Competitively Inhibit the Kinase Activity of EGFR.
[0183] The functions of each module of the probe were analyzed individually. Overall, the fluorescent spectrum of our synthesized probe is quite similar to the spectrum of Cy3, except an additional minor peak at 674 nm shown in the emission spectrum (
[0184] Then, we analyzed the inhibitory effects of the PDCy3 probe on EGFR kinase activity (
[0185] Using gefitinib as a competitor.sup.19, we confirmed the inhibitory specificity of the PDCy3 probe on EGFR kinase activity (
[0186] PDCy3 Probe was Sensitive to EGFR Expression and Oncogenic Mutation.
[0187] To extend the application of PDCy3 probe in a diagnosis-related setting, we optimized the labelling conditions so that the cells with over-expressed EGFR could be more specifically labelled with the probe. We compared the efficiencies in labelling EGFR over-expressed cells versus those non-over-expressed cells under different PDCy3 concentrations (
[0188] As the PDCy3 probe was derived from PD168393, which is compatible with active and inactive conformations of EGFR kinase and is able to promote EGFR dimerization on the cell surface in the absence of EGF 20,21, we studied whether this probe would be more sensitive to EGFR activating mutation associated with oncogenesis or to EGFR kinase asymmetric dimerization, which is required for kinase allosteric activation.sup.15 (
[0189] To further investigate how EGFR kinase dimerization affects PDCy3 binding, we did a protein complementary assay. In the assay, split YFP fragments were individually fused to the C-terminus of the full length EGFR, and EGF kinase dimerization was reported by the fluorescence of assembled YPF from co-transfected receptors (
DISCUSSION
[0190] In this report, we proposed our concepts in modular design and development of probes targeting oncogenic receptors. With the dramatically increased cost in new drug development and considerably decreased therapeutic targets identified, re-evaluation of drugs used on the market drew more and more attentions from industry and academia. In our structure-based design, we explore the potentials in re-programing the verified EGFR kinase inhibitor for applications in drug screening, cell sorting, and imaging of protein interactions. The benefits for our modular design include, but not limited to, the exchangeable imaging and targeting modules. The exchangeable imaging module could be used at different biological and/or therapeutic settings with their different imaging properties. On the other hand, the exchangeable targeting module could be used for detection of different targets or different states of a specific target. In our case, PDCy3 was selective for EGFR overexpressing cells and was more sensitive to the oncogenic mutation of L834R. Future studies will address whether this probe could be used in clinical diagnosis and how the EGF receptors are dynamically interacting with each other on the cell surface.
[0191] Based on their sensitivities to PDCy3 binding, two different cell populations representing different EGFR dimers were identified on the cell surface. In these two populations, one was highly sensitive to PDCy3 binding, but the other was not. L834R mutation promoted the formation of dimers with weak sensitivity to PDCy3 binding, while V924R mutation stimulated the formation of dimers with high sensitivity to PDCy3. Considering that V924R mutation could disrupt the asymmetric, active EGFR kinase dimer and L834R favors the active conformation of the kinase.sup.15,24 we believe that the EGFR dimers with weak sensitivity to PDCy3 represent the asymmetric, active kinase dimers. On the other side, we believed that the EGFR dimers with high sensitivity to PDCy3 actually represent another kinase association state. From early structural studies, it had been proposed that EGFR kinase domain were capable of forming both the asymmetric, active dimer and the symmetric, inactive dimer in vitro.sup.15, 16. Intuitively, it is possible that PDCy3-sensitive dimer was equivalent or related to the symmetric, inactive kinase dimer. However, many evidences argued against that possibility. It had been shown that gefitinib and PD168393, being compatible with both active and inactive conformations of EGFR kinase, could drive the homo- or hetero-dimerization of unligated EGF receptors on cell surface.sup.20,25. In contrast, lapatinib and HKI-272, both stabilizing the kinase in inactive conformation, failed to do so.sup.20. Such disparity had been attributed to the conformational, dynamic nature of the kinase.sup.21, 26 Indeed, intermediate transition states of the EGFR kinase had been identified in molecular dynamic simulation.sup.27, 28. It is intriguing to note that the available structures of PD168393-bound EGFR kinases varied largely at their N-lobe and α-C helix positioning (r.m.s.d. varies from 1.8 Å to 2.7 Å, when they were superimposed on their C-lobes) (
Example 3. Biological Assays
[0192] Inspired by these unresolved challenges as stated in the section “Background”, we designed modular theranostic probes targeting EGFR kinase in specific conformations associated with oncogenesis, and applied the probe-based cytometry in chemical stratification of prostate cancers. We demonstrated examples of using such a probe in screening inhibitors by competition, in sorting cells with over-expressed or mutated EGFR, and in imaging of EGFR interactions on cell surface. Surprisingly, we found that PD168393, an EGFR kinase inhibitor.sup.50, was more reactive to an intermediate state of the kinase distinguished from that active, asymmetric dimer. Moreover, we analyzed eight urine samples from seven confirmed and one putative prostate cancer patients using the probe-based cytometry. These samples showed distinctive responses to the probe: one was highly sensitive to the probe, but the others were not. EGFR mutations were only detected in the sample with high sensitivity to the probe but not in others with overexpressed wild type (WT) EGFR. Clinical analysis confirmed the subject, whose sample was highly sensitive to the probe, progressed to the castration-resistant, metastatic stage.
[0193] Materials and Methods
[0194] Materials. The plasmids encoding human EGFR (1-988) and split YFP fragments were obtained from Addgene (#11011, #27097, and #22010) as gifts from Dr. Timothy A. Springer and Dr. Chang-Deng Hu. Gefitinib from MedChem Express (NJ, USA) and recombinant human EGF from Sino Biological Inc (China) were reconstituted and stored as recommended by the manufactures. Restriction enzymes and Gibson assembly kit were purchased from NEB (MA, USA); DNA polymerase was from Vazyme (China); anti-protein C antibody was from Genscript (China); and anti-phosphotyrosine antibody 4G10 was from Merck Millipore (USA). Anti-CK7 (ab181598), anti-CK20 (ab76126), anti-Androgen Receptor (ab74272), anti-VILLIN (ab130751), and anti-TTF-1 (ab72876) antibodies were from Abcam (Cambridge, Mass., USA); and anti-PSA (31-1210-00) antibody was from RevMAb Biosciences (San Francisco, Calif., USA).
[0195] The synthesis of PDCy3. The details for the synthesis of PDCy3 were described above. The synthesized material was characterized by .sup.1H NMR spectra recorded on Bruker AVIII 400 and LCMS measurement running on Agilent 1200 HPLC/6100 SQ System. For LCMS experiment, the mobile phase A was water (10 mM NH.sub.4HCO.sub.3), and mobile phase B was MeCN. The material was eluted from a 4.6×50 mm XBridge C18 column (3.5 μm particles) by a linear gradient of 5% B to 95% B within 1.3 minutes. The flow rate was 1.8 mL/min. Detection methods were diode array (DAD), evaporative light scattering (ELSD), and positive/negative electrospray ionization.
[0196] Inhibition of the EGF receptor kinase activity. HEK 293T cells cultured in 24-well plates were transfected as described.sup.51. Transfected cells were starved in EX-Cell 293 Serum-Free Medium (SIGMA) supplemented with 6 mM Glutamine for 44 hours before treatment with EGF, inhibitor, or the probe. Treated cells were lysed by mixing with 40 μL/well lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 10 mM EDTA, 1 mM Na.sub.3VO.sub.4, 2 mM PMSF). The lysates were then cleared by centrifugation at 13,200 g for 20 min. The supernatants were mixed with SDS sample buffer and subjected to SDS-PAGE and Western blotting analysis. The expression and phosphorylation levels of EGFR were detected by 4G10 and anti-Protein C antibodies, respectively, in western blotting.
[0197] Cell sorting. Following starvation in EX-Cell 293 Serum-Free Medium for 44 hours, transfected cells were treated with gefitinib, PDCy3, or EGF for 4 hours at 37° C. Then, the cells were washed twice with 500 μL/well ice-cold PBS, and were re-suspended in 400 L/well PBS. The final cell density was estimated to be 5×10.sup.5˜1×10.sup.6 cells/mL. To detect EGFR expression, 3 μL anti-EGFR 528 antibody (Santa Cruz Biotechnology Inc, USA) at 200 μg/mL concentration was added to each well of re-suspended cells. After 30-minute incubation on ice, cells were washed twice with 500 μL/well PBS, and were re-suspended in 400 μL PBS. Then, 0.3 μL FITC-labelled secondary antibody at a concentration of 2 mg/mL was added to each sample. After incubation on ice for 30 minutes, cells were washed three times with PBS, re-suspended in 400 μL/well PBS, and analyzed by flowcytometry using a BD FACS Calibur machine.
[0198] Protein complementary assay. For protein complementary assay, we designed two complementary constructs: one encoding human EGFR(1-998) was fused with a split YFP-N(1-172) fragment; and the other encoding hEGFR(1-998) was linked to a split YFP-C(155-238) fragment. Kinase mutations were introduced on both constructs to make a complementary pair. All constructs were verified by sequencing. The paired constructs encoding the same receptor were co-transfected into HEK 293T cells. Transfected cells were starved in EX-Cell 293 Serum-Free Medium for 44 hours before treatment with 1 μM PDCy3 for additional 4 hours. The dimerization of the EGF receptors and the binding of dimerized receptors to PDCy3 were analyzed by flowcytometry.
[0199] Cytometry of urine samples from cancer patients. 10-15 mL void urine sample was collected from each cancer patient. The cells in those samples were collected by centrifugation at 300 g for 10 minutes at 4° C., and were re-suspended in PBS. Then, the cells from each sample were divided into three aliquots: one was used in cytometry; another was used in RT-qPCR; and the rest was mixed with cryo-protectant (80% FBS and 20% DMSO) at 1:1 ratio, and stored in liquid nitrogen. The cells used for cytometry were incubated with 0, 0.5, 1, and 5 μM PDCy3, respectively, on ice for 20 minutes in the dark, and then were analyzed by flowcytometry.
[0200] RT-qPCR analysis. Cells collected from each urine sample were centrifuged at 300 g for 10 minutes at 4° C., and then were re-suspended in 1 mL Trizol. After sitting at RT for 5 minutes, 0.25 mL chloroform was added into each sample. After incubation at RT for 5 minutes, the samples were centrifuged at 13,700 g for 15 minutes at 4° C., and the aqueous phase from each sample was collected individually and mixed with isopropanol at 1:1 (v/v) ratio. After sitting at −20° C. for 30 minutes, the samples were cleared by centrifugation at 13,700 g for 15 minutes at 4° C., the supernatants were discarded, and the pellets were washed with 75% ethanol. Then, the pellets were air-dried for half an hour and dissolved in 20 μL DEPC-treated H.sub.2O, separately.
[0201] The reverse transcription of extracted RNA and q-PCR quantification of gene expression were carried out as described by the manufacture using the Transcriptor First Strand cDNA Synthesis kit and the FastStart Essential DNA Green Master kit, respectively (Roche, USA). The primers used in the experiments were listed in the Table 1. The expression of each gene from each subject was determined by q-PCR analysis using a LightCycler-96 machine. Experimental statistics were determined by using triplicated samples of extracted RNA.
TABLE-US-00001 TABLE 1 Primers used in q-PCR analysis Primer Sequence EGFR-Forward CCCACTCATGCTCTACAACCC EGFR-Reverse TCGCACTTCTTACACTTGCGG HER2-Forward TGTGACTGCCTGTCCCTACAAC HER2-Reverse CCAGACCATAGCACACTCGG β-actin-Forward GGGACCTGACTGACTACCTC β-actin-Reverse TCATACTCCTGCTTGCTGAT GAPDH-Forward ATCATCCCTGCCTCTACTGG GAPDH-Reverse GTCAGGTCCACCACTGACAC
[0202] HE Staining. After deparaffinization and rehydration, 5 μm-long sections were stained with hematoxylin solution for 5 minutes followed by dipping in 1% acid ethanol (1% HCl, 70% ethanol) 5 times. The sections were rinsed with distilled water, stained with eosin solution for 3 minutes, dehydrated with graded alcohol, and cleared in xylene. The mounted slides were examined and photographed using a Leica DM2500 microscope.
[0203] Immunohistochemistry. Formalin-fixed, paraffin-embedded (FFPE) sections were deparaffinized and blocked with 3% H.sub.2O.sub.2. Antigen retrieval was carried out twice in 0.01 M citrate for 10 minutes each using a microwave, and the sections were cooled down for 60 minutes. The slides were blocked with 3% goat serum and labelled separately with various primary antibodies. Then, the slides were labelled with secondary antibodies conjugated to Envision-plus HRP-labelled polymer and stained with DAB staining solution (Zhong Shan gold bridge, Beijing). Counterstaining was performed using Mayer-hematoxylin.
[0204] Ethics statement. Informed consent was obtained from each enrolled patient. This study was approved by the ethics board of The Second Hospital of Tianjin Medical University (Certificate #KY2017K010).
[0205] Results
[0206] Competitive Inhibition of the EGFR Kinase Activity
[0207] The functions of each module of the probe were analyzed individually. Overall, the fluorescent spectrum of our synthesized probe was quite similar to that of Cy3, except an additional minor peak at 674 nm appeared in the emission spectrum (
[0208] Then, we analyzed the inhibitory effects of PDCy3 on EGFR kinase activity (
[0209] Using gefitinib as a competitor.sup.52, we confirmed the inhibitory specificity of PDCy3 on EGFR kinase activity (
[0210] Sensitive to Oncogenic EGFR Mutation but not Asymmetric Kinase Dimerization
[0211] To characterize the specificity of PDCy3, we compared the efficiencies in labelling EGFR over-expressed cells versus those non-over-expressed cells under different PDCy3 concentrations (
[0212] As PDCy3 was derived from PD168393, which was compatible with the active and inactive conformations of the EGFR kinase and was able to promote EGFR dimerization on cell surface in the absence of EGF so, 53 we studied whether this probe would be more sensitive to EGFR oncogenic mutation or to EGFR asymmetric kinase dimerization 4 (
[0213] To further investigate how EGFR kinase dimerization affects PDCy3 binding, we carried out a protein complementary assay. In the assay, split YFP fragments were individually fused to the C-termini of EGFRs, and the kinase dimerization was reported by the fluorescence of assembled YPF from co-transfected, dimerized receptors (
[0214] Stratification of Prostate Cancers by Using the Probe-Based Cytometry
[0215] In two small cohort studies, it was estimated that over 30% prostate cancer patients associated with EGFR overexpression and about 10-15% patients associated with EGFR mutations 47′48. However, much remained unknown regarding the following questions. Are these expression or genetic alterations really associated with malfunctions of EGFR? How to effectively identify those patients with abnormally activated EGFR? How do EGFR malfunctions associate with the pathogenesis of prostate cancer? Which subgroup of patients could benefit from EGFR inhibitor treatment? As a forward step to understand these questions, we tested the possibility of using probe-based cytometry to classify prostate cancer patients according to the response of their urine samples to the binding of our designed probe. In total, seven prostate cancer patients had been enrolled in our small cohort study (Table 2). To avoid bias, clinical information of enrolled subjects were blinded to the biochemical and cell biology experimentalists until the end of all experiments and analysis.
TABLE-US-00002 TABLE 2 Clinical information of enrolled subjects Gleason Subject Age Scores Diagnosis Pathology Treatment 1 71 3 + 3 Hematuria Urothelial cell Urine Cytology: carcinoma tumor cells Prostate carcinoma detected 3 times 2 67 4 + 4 tPSA 221 ng/mL Prostate carcinoma Hormone MRI: Deprivation Prostate carcinoma Therapy: 3 months Radical Prostatectomy 3 63 tPSA > 120 ng/mL Prostate carcinoma Goserlin + Bone metastasis Bicalutamide: 14 months Abiraterone: >15 months 4 67 tPSA 395 ng/mL Metastatic Prostate Goserlin + adeno-carcinoma Bicalutamide: Immunohistochemistry: 9 months AR(+), PSA(+), Abiraterone: >3 CK7(−), CK20(−), months Villin(−) 5 67 3 + 3 tPSA 7.02 ng/mL Prostate carcinoma Radical fPSA 2.02 ng/mL Prostatectomy MRI: Nodules in the apex of the prostate gland 6 70 4 + 4 tPSA 10.9 ng/mL Prostate carcinoma Radical fPSA 0.61 ng/mL Prostatectomy MRI: Nodules in the peripheral zone and apex of the prostate gland 7 71 tPSA 37.4 ng/mL Prostate carcinoma Radical fPSA 5.89 ng/mL Metastasis found in Prostatectomy Bone Scintigraphy: bilateral lymph nodes Unable to exclude bone metastasis 8 69 MRI: Invasive urothelial Transurethral Bladder carcinoma; carcinoma resection of Unable to exclude Immunohistochemistry: bladder tumor prostate carcinoma CK7(+), CK20 partial (+), P63(+), Ki-67 80% (+), GATA3(+)
[0216] The urine samples were labeled with 0.0, 0.5, 1.0, and 5.0 μM probe, respectively, at 4° C. for half an hour, and then were subjected to FACS analysis. Different cell populations could be distinguished by their side scattering and fluorescent intensity of bound probes (
[0217] To gain further insights into the different response profiles of these samples in probe-based cytometry, we analyzed the expression and mutation status of these samples by RT-qPCR and Sanger sequencing (
[0218] Examining the biopsy specimen from subject 4 confirmed that the patient had metastatic prostate adenocarcinoma with overexpressed androgen receptor (
DISCUSSION
[0219] Effective stratification of patients is critical in the diagnosis and treatment of prostate cancer.sup.34. Currently, tissue specimen examination and genetic profiling are widely used in clinical studies. However, abnormal variations on genetic, immunologic, or metabolic biomarkers, as detected by these techniques, are not equivalent to personalized pharmaceutic response to a potential or applied therapeutic agent. Yet, enormous genetic and epigenetic variations associated with tumor heterogeneity and mutational burden are still not fully appreciated.sup.59. These limitations hindered the development of novel therapeutic strategies and complicated our understanding of how to correlate genetic analysis to clinical applications.sup.59. Our chemical stratification strategy comes to the point on detecting personalized drug response using body fluid from individual patient and subtyping patients accordingly. By using this liquid biopsy technique in a small cohort study, we identified one prostate cancer patient with high sensitivity to our designed theranostic probe carrying an EGFR activating mutation (V745M) and having metastatic tumor. In the same patient, two more accompany, inactivating mutations (G800D and P770T) were also identified, indicating increased mutational frequency or heterogeneity associated with cancer progression. In addition, we found those patients who had overexpressed WT EGFR did not exhibit high sensitivity to the probe, in concert with the reports from early multicenter clinical studies.sup.49. We envisioned that chemical stratification combined with liquid biopsy could be complimentary to genetic profilings in the future clinical studies.
[0220] Our chemical stratification was established on our modular design of theranostic probes targeting EGFR kinase in specific conformations associated with oncogenesis. In our structure-based design, we explored the potentials in re-programing the verified EGFR kinase inhibitors for applications in drug screening, cell sorting, and imaging of protein interactions. The benefits of our modular design include, but not limited to, the exchangeable imaging and targeting modules. The exchangeable imaging module could be used at different biological and/or therapeutic settings with their different imaging properties. On the other hand, the exchangeable targeting module could be used for detecting other targets or other states of a specific target. In our case, PDCy3 was selective for EGFR overexpressing cells and was more sensitive to EGFR activating mutations, including L834R, a well-characterized mutation, and V745M, a mutation identified in this study.
[0221] Based on their sensitivities to PDCy3 binding, two different cell populations representing different EGFR dimers were identified on cell surface. In these two populations, one was highly sensitive to PDCy3 binding, but the other was not. L834R mutation promoted the formation of dimers with weak sensitivity to PDCy3 binding, while V924R mutation stimulated the formation of dimers with high sensitivity to PDCy3. Considering that V924R mutation could disrupt the asymmetric, active EGFR kinase dimer and L834R favors the active conformation of the kinase.sup.54, 60 the EGFR dimers with weak sensitivity to PDCy3 represent the asymmetric, active kinase dimers. On the other side, the EGFR dimers with high sensitivity to PDCy3 actually represent another kinase association state. From early structural studies, it had been proposed that EGFR kinase domain was capable of forming both the asymmetric, active dimer and the symmetric, inactive dimer in vitro.sup.54,61. Intuitively, it is possible that PDCy3-sensitive dimer was equivalent or related to the symmetric, inactive kinase dimer. However, many evidences argued against that possibility. In our experiments, we found EGFR activating mutations, including L834R and V745M, promoted the binding of PDCy3 to EGFR-expressed cells. However, inactivating mutations, including G800D and P770T, lowered or abolished the binding of PDCy3 to those cells. At the same time, disruption of the asymmetric, active kinase dimer by V924R mutation enhanced the binding of PDCy3 to EGFR-expressed cells. These results indicated that the PDCy3 preferred to bind non-asymmetrically associated, non-inactive EGFR kinase. It had also been shown that gefitinib and PD168393, being compatible with both active and inactive conformations of EGFR kinase, could drive the homo- or hetero-dimerization of unligated EGFRs on cell surface.sup.50,62. In contrast, lapatinib and HKI-272, both stabilizing the kinase in inactive conformation, failed to do so 5°. Such disparity had been attributed to the conformational, dynamic nature of the kinase.sup.53,63. Indeed, intermediate transition states of the EGFR kinase had been identified in molecular dynamic simulation.sup.64,65. It is intriguing to note that the available structures of PD168393-bound EGFR kinases varied largely at their N-lobe and α-C helix positioning (r.m.s.d. varies from 1.8 Å to 2.7 Å, when they were superimposed on their C-lobes) (
REFERENCES
[0222] 1. Bray, F. et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin (2018). [0223] 2. Qian, W., Zhang, Y & Chen, W. Capturing Cancer: Emerging Microfluidic Technologies for the Capture and Characterization of Circulating Tumor Cells. Small 11, 3850-3872 (2015). [0224] 3. Rawal, S., Yang, Y P., Cote, R. & Agarwal, A. Identification and Quantitation of Circulating Tumor Cells. Annu Rev Anal Chem (Palo Alto Calif.) 10, 321-343 (2017). [0225] 4. Kowalik, A., Kowalewska, M. & Gozdz, S. Current approaches for avoiding the limitations of circulating tumor cells detection methods-implications for diagnosis and treatment of patients with solid tumors. Transl Res 185, 58-84 e15 (2017). [0226] 5. Gorin, M. A. et al. Circulating tumour cells as biomarkers of prostate, bladder, and kidney cancer. Nat Rev Urol 14, 90-97 (2017). [0227] 6. Singh, A. P., Li, S. & Cheng, H. Circulating DNA in EGFR-mutated lung cancer. Ann Transl Med 5, 379 (2017). [0228] 7. Kobayashi, S. et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 352, 786-792 (2005). [0229] 8. Shih, J. Y, Gow, C. H. & Yang, P. C. EGFR mutation conferring primary resistance to gefitinib in non-small-cell lung cancer. N Engl J Med 353, 207-208 (2005). [0230] 9. Paez, J. G. et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 304, 1497-1500 (2004). [0231] 10. Lynch, T. J. et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350, 2129-2139 (2004). [0232] 11. Pao, W. & Miller, V. A. Epidermal growth factor receptor mutations, small-molecule kinase inhibitors, and non-small-cell lung cancer: current knowledge and future directions. J Clin Oncol 23, 2556-2568 (2005). [0233] 12. da Cunha Santos, G., Shepherd, F. A. & Tsao, M. S. EGFR mutations and lung cancer.
[0234] Annu Rev Pathol 6, 49-69 (2011). [0235] 13. Kovacs, E., Zorn, J. A., Huang, Y, Barros, T. & Kuriyan, J. A structural perspective on the regulation of the epidermal growth factor receptor. Annu Rev Biochem 84, 739-764 (2015). [0236] 14. Lemmon, M. A., Schlessinger, J. & Ferguson, K. M. The EGFR family: not so prototypical receptor tyrosine kinases. Cold Spring Harb Perspect Biol 6, a020768 (2014). [0237] 15. Zhang, X., Gureasko, J., Shen, K., Cole, P. A. & Kuriyan, J. An allosteric mechanism for activation of the kinase domain of epidermal growth factor receptor. Cell 125, 1137-1149 (2006). [0238] 16. Jura, N. et al. Mechanism for activation of the EGF receptor catalytic domain by the juxtamembrane segment. Cell 137, 1293-1307 (2009). [0239] 17. Eck, M. J. & Yun, C. H. Structural and mechanistic underpinnings of the differential drug sensitivity of EGFR mutations in non-small cell lung cancer. Biochim Biophys Acta 1804, 559-566 (2010). [0240] 18. Blair, J. A. et al. Structure-guided development of affinity probes for tyrosine kinases using chemical genetics. Nat Chem Biol 3, 229-238 (2007). [0241] 19. Yun, C. H. et al. The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP. Proc Natl Acad Sci USA 105, 2070-2075 (2008). [0242] 20. Lu, C., Mi, L. Z., Schurpf, T., Walz, T. & Springer, T. A. Mechanisms for kinase-mediated dimerization of the epidermal growth factor receptor. J Biol Chem 287, 38244-38253 (2012). [0243] 21. Park, J. H., Liu, Y, Lemmon, M. A. & Radhakrishnan, R. Erlotinib binds both inactive and active conformations of the EGFR tyrosine kinase domain. Biochem J 448, 417-423 (2012). [0244] 22. Yun, C. H. et al. Structures of lung cancer-derived EGFR mutants and inhibitor complexes: mechanism of activation and insights into differential inhibitor sensitivity.
[0245] Cancer Cell 11, 217-227 (2007). [0246] 23. Shyu, Y J., Liu, H., Deng, X. & Hu, C. D. Identification of new fluorescent protein fragments for bimolecular fluorescence complementation analysis under physiological conditions. Biotechniques 40, 61-66 (2006). [0247] 24. Zhang, X. et al. Inhibition of the EGF receptor by binding of MIG6 to an activating kinase domain interface. Nature 450, 741-744 (2007). [0248] 25. Anido, J. et al. ZD1839, a specific epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, induces the formation of inactive EGFR/HER2 and EGFR/HER3 heterodimers and prevents heregulin signaling in HER2-overexpressing breast cancer cells. Clin Cancer Res 9, 1274-1283 (2003). [0249] 26. Barkovich, K. J. et al. Kinetics of inhibitor cycling underlie therapeutic disparities between EGFR-driven lung and brain cancers. Cancer Discov 2, 450-457 (2012). [0250] 27. Shan, Y et al. Oncogenic mutations counteract intrinsic disorder in the EGFR kinase and promote receptor dimerization. Cell 149, 860-870 (2012). [0251] 28. Shan, Y, Arkhipov, A., Kim, E. T., Pan, A. C. & Shaw, D. E. Transitions to catalytically inactive conformations in EGFR kinase. Proc Natl Acad Sci USA 110, 7270-7275 (2013). [0252] 29. Red Brewer, M. et al. Mechanism for activation of mutated epidermal growth factor receptors in lung cancer. Proc Natl Acad Sci USA 110, E3595-3604 (2013). [0253] 30. Yasuda, H. et al. Structural, biochemical, and clinical characterization of epidermal growth factor receptor (EGFR) exon 20 insertion mutations in lung cancer. Sci Transl Med 5, 216ra177 (2013). [0254] 31. Bray, F. et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68, 394-424, doi:10.3322/caac.21492 (2018). [0255] 32. Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2018. CA Cancer J Clin 68, 7-30, doi:10.3322/caac.21442 (2018). [0256] 33. Streicher, J., Meyerson, B. L., Karivedu, V. & Sidana, A. A review of optimal prostate biopsy: indications and techniques. Ther Adv Urol 11, 1756287219870074, doi:10.1177/1756287219870074 (2019). [0257] 34. Litwin, M. S. & Tan, H. J. The Diagnosis and Treatment of Prostate Cancer: A Review. JAMA317, 2532-2542, doi:10.1001/jama.2017.7248 (2017). [0258] 35. Parikh, A. R. et al. Liquid versus tissue biopsy for detecting acquired resistance and tumor heterogeneity in gastrointestinal cancers. Nat Med 25, 1415-1421, doi:10.1038/s41591-019-0561-9 (2019). [0259] 36. Qian, W., Zhang, Y & Chen, W. Capturing Cancer: Emerging Microfluidic Technologies for the Capture and Characterization of Circulating Tumor Cells. Small 11, 3850-3872, doi:10.1002/smll.201403658 (2015). [0260] 37. Rawal, S., Yang, Y P., Cote, R. & Agarwal, A. Identification and Quantitation of Circulating Tumor Cells. Annu Rev Anal Chem (Palo Alto Calif.) 10, 321-343, doi:10.1146/annurev-anchem-061516-045405 (2017). [0261] 38. Kowalik, A., Kowalewska, M. & Gozdz, S. Current approaches for avoiding the limitations of circulating tumor cells detection methods-implications for diagnosis and treatment of patients with solid tumors. Transl Res 185, 58-84 e15, doi:10.1016/j.trsl.2017.04.002 (2017). [0262] 39. Gorin, M. A. et al. Circulating tumour cells as biomarkers of prostate, bladder, and kidney cancer. Nat Rev Urol 14, 90-97, doi:10.1038/nrurol.2016.224 (2017). [0263] 40. Labib, M. et al. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping. Nat Chem 10, 489-495, doi:10.1038/s41557-018-0025-8 (2018). [0264] 41. Singh, A. P., Li, S. & Cheng, H. Circulating DNA in EGFR-mutated lung cancer. Ann Transl Med 5, 379, doi:10.21037/atm.2017.07.10 (2017). [0265] 42. Kobayashi, S. et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 352, 786-792, doi:10.1056/NEJMoa044238 (2005). [0266] 43. Shih, J. Y, Gow, C. H. & Yang, P. C. EGFR mutation conferring primary resistance to gefitinib in non-small-cell lung cancer. N Engl J Med 353, 207-208, doi:10.1056/NEJM200507143530217 (2005). [0267] 44. Paez, J. G. et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 304, 1497-1500, doi:10.1126/science.1099314 (2004). [0268] 45. Lynch, T. J. et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350, 2129-2139, doi:10.1056/NEJMoa040938 (2004). [0269] 46. Shah, R. B., Ghosh, D. & Elder, J. T. Epidermal growth factor receptor (ErbB1) expression in prostate cancer progression: correlation with androgen independence. Prostate 66, 1437-1444, doi:10.1002/pros.20460 (2006). [0270] 47. Peraldo-Neia, C. et al. Epidermal Growth Factor Receptor (EGFR) mutation analysis, gene expression profiling and EGFR protein expression in primary prostate cancer. BMC Cancer 11, 31, doi:10.1186/1471-2407-11-31 (2011). [0271] 48. Cho, K. S. et al. Gene amplification and mutation analysis of epidermal growth factor receptor in hormone refractory prostate cancer. Prostate 68, 803-808, doi:10.1002/pros.20743 (2008). [0272] 49. Sridhar, S. S. et al. A multicenter phase II clinical trial of lapatinib (GW572016) in hormonally untreated advanced prostate cancer. Am J Clin Oncol 33, 609-613, doi:10.1097/COC.0b013e3181beac33 (2010). [0273] 50. Lu, C., Mi, L. Z., Schurpf, T., Walz, T. & Springer, T. A. Mechanisms for kinase-mediated dimerization of the epidermal growth factor receptor. J Biol Chem 287, 38244-38253, doi:10.1074/jbc.M112.414391 (2012). [0274] 51. Mi, L. Z. et al. Simultaneous visualization of the extracellular and cytoplasmic domains of the epidermal growth factor receptor. Nat Struct Mol Biol 18, 984-989, doi:10.1038/nsmb.2092 (2011). [0275] 52. Yun, C. H. et al. The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP. Proc Natl Acad Sci USA 105, 2070-2075, doi:10.1073/pnas.0709662105 (2008). [0276] 53. Park, J. H., Liu, Y, Lemmon, M. A. & Radhakrishnan, R. Erlotinib binds both inactive and active conformations of the EGFR tyrosine kinase domain. Biochem J 448, 417-423, doi:10.1042/BJ20121513 (2012). [0277] 54. Zhang, X., Gureasko, J., Shen, K., Cole, P. A. & Kuriyan, J. An allosteric mechanism for activation of the kinase domain of epidermal growth factor receptor. Cell 125, 1137-1149, doi:10.1016/j.cell.2006.05.013 (2006). [0278] 55. Yun, C. H. et al. Structures of lung cancer-derived EGFR mutants and inhibitor complexes: mechanism of activation and insights into differential inhibitor sensitivity. Cancer Cell 11, 217-227, doi:10.1016/j.ccr.2006.12.017 (2007). [0279] 56. Shyu, Y J., Liu, H., Deng, X. & Hu, C. D. Identification of new fluorescent protein fragments for bimolecular fluorescence complementation analysis under physiological conditions. Biotechniques 40, 61-66, doi:10.2144/000112036 (2006). [0280] 57. Huang, S. F. et al. High frequency of epidermal growth factor receptor mutations with complex patterns in non-small cell lung cancers related to gefitinib responsiveness in Taiwan. Clin Cancer Res 10, 8195-8203, doi:10.1158/1078-0432.CCR-04-1245 (2004). [0281] 58. Nagalakshmi, K., Jamil, K., Pingali, U., Reddy, M. V. & Attili, S. S. V. Epidermal growth factor receptor (EGFR) mutations as biomarker for head and neck squamous cell carcinomas (HNSCC). Biomarkers 19, 198-206, doi:10.3109/1354750x.2014.895852 (2014). [0282] 59. Buisson, R. et al. Passenger hotspot mutations in cancer driven by APOBEC3A and mesoscale genomic features. Science 364, doi:10.1126/science.aaw2872 (2019). [0283] 60. Zhang, X. et al. Inhibition of the EGF receptor by binding of MIG6 to an activating kinase domain interface. Nature 450, 741-744, doi:10.1038/nature05998 (2007). [0284] 61. Jura, N. et al. Mechanism for activation of the EGF receptor catalytic domain by the juxtamembrane segment. Cell 137, 1293-1307, doi:10.1016/j.cell.2009.04.025 (2009). [0285] 62. Anido, J. et al. ZD1839, a specific epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, induces the formation of inactive EGFR/HER2 and EGFR/HER3 heterodimers and prevents heregulin signaling in HER2-overexpressing breast cancer cells. Clin Cancer Res 9, 1274-1283 (2003). [0286] 63. Barkovich, K. J. et al. Kinetics of inhibitor cycling underlie therapeutic disparities between EGFR-driven lung and brain cancers. Cancer Discov 2, 450-457, doi:10.1158/2159-8290.CD-11-0287 (2012). [0287] 64. Shan, Y et al. Oncogenic mutations counteract intrinsic disorder in the EGFR kinase and promote receptor dimerization. Cell 149, 860-870, doi:10.1016/j.cell.2012.02.063 (2012). [0288] 65. Shan, Y, Arkhipov, A., Kim, E. T., Pan, A. C. & Shaw, D. E. Transitions to catalytically inactive conformations in EGFR kinase. Proc Natl Acad Sci USA 110, 7270-7275, doi:10.1073/pnas.1220843110 (2013). [0289] 66. Red Brewer, M. et al. Mechanism for activation of mutated epidermal growth factor receptors in lung cancer. Proc Natl Acad Sci USA 110, E3595-3604, doi:10.1073/pnas.1220050110 (2013). [0290] 67. Yasuda, H. et al. Structural, biochemical, and clinical characterization of epidermal growth factor receptor (EGFR) exon 20 insertion mutations in lung cancer. Sci Transl Med 5, 216ra177, doi:10.1126/scitranslmed.3007205 (2013).